CN101818155A - Application of herba saussureae involucratae sikDh2 gene in cultivating cold resistant plant - Google Patents

Abstract

The invention relates to application of a herba saussureae involucratae sikDh2 gene in cultivating a cold resistant plant. In the invention, a sikDh2 gene is cloned from a herba saussureae involucratae, and a plant expression vector is constructed by utilizing the gene to obtain the cold resistant transgenic plant through genetic transformation. The sikDh2 gene is cloned from the herba saussureae involucratae and then is expressed in the transgenic plant to improve the cold resistance of the transgenic plant, improve the low temperature stress resistance of the plant through excessive expression of the gene and finally obtain the plant with obviously enhanced low-temperature resistant capability. By screening and cloning genes directly related to cold resistance from the herba saussureae involucratae, the low-temperature adaptability mechanism of the saussureae involucratae is revealed, the genetic basis is researched, and the potential gene resources are fully exploited. The herba saussureae involucratae sikDh2 gene is used in breed improvement of crops, thus having great academic and economic value.

Description

The application of Herba Saussureae Involueratae sikDh2 gene in cultivating cold resistant plant

Technical field:

The present invention relates to a kind of from composite family phoenix hair Chrysanthemum plant Herba Saussureae Involueratae (Saussurea involucrata Kar.et Kir), clone and obtain the sikDh2 gene, make up the constitutive plant expression vector, transform plant, and cold-resistant effect is estimated, increase the cold performance of plant.

Background technology:

Low temperature is the important factor of restriction plant regional distribution and biological yield, also is one of main natural disaster of harm agriculture production.Low temperature often causes the vegetable cell dehydration, destroys the hydration protection system on film lipid bilayer surface, causes reducing of film lipid bilayer spacing, causes that film merges and the havoc of membrane structure.

Plain (Dehydrins) C-terminal of dehydration contains the K-section (consensus sequence:EKKGIMDKIKEKLPG) that is rich in the Lys motif, many dehydrations are plain to comprise the S-section of being made up of 6 above Serines (S-segment), and major part also comprises one or more Y-sections (Y-segment) (consensus sequence:{V/T}DEYGNP).Between amino acid terminator and K-section some conserved sequences are arranged also, comprise glycine and Threonine sequence, their characteristics all are highly-hydrophilics, can substitute between polare Aminosaeren.The K-section forms alpha-helix, it can stablize macromole and subcellular structure (Emergence of a biochemical roleof a family of plant dehydration proteins.Physiol Plant 97:795-80), (Structural motifs in LEA proteins ofhigher plants.In:Close TJ and Bray EA (eds) Response of Plants to Cellular Dehydration DuringEnvironmental Stress.Rockville:American Society of Plant Physiologists, pp 91-103).The S-section can be used as phosphorylation site, participation transportation (The maize abscisic acid-responsive protein Rab17 islocated in the nucleus and interacts with nuclear localization signals.Plant Cell 6:351-360), (Expression, tissue distribution and subcellular localization of dehydrin TAS14 in salt-stressed tomato plants.Plant MolBiol 26:1921-1934) combine with nuclear localization signal peptide.Immunolocalization shows that the dehydration element does not exist only in nucleus, and also has (Nuclear andcytoplasmic localisation of maize embryo and aleurone dehydrin.Protoplasma 177:87-94) in kytoplasm.Y-sector sequence and molecular chaperones part nucleic acid binding sequence homology (Identification Of nucleotide-binding regions in the chaperonin proteinsGroEL and GroES.Nature 366:279-282).

The number of plain its K-section of different dehydrations, Y-section, and the feature of other sequence all is different.

Comprise the plain sequence of many dehydrations in the Plant Genome, yet up to the present, the cool tone that is confirmed as in only indivedual several species saves the dehydration element, other dehydration element is expressed by arid and salt stress all in the seed development process.The dehydration of cool tone joint is plain in size, is different on the kind of conservative section, is not one type.The Y-section changes greatly, and what have has, and what have does not have.

Dehydration is plain to interact with the membrane structure of cell, comprise cytoplasmic membrane and cell inner membrance, show the plain effect that should have a stabilizing membrane structure of dehydration (Close TJ.Dehydrins:a commonalty in the response of plants todehydration and low temperature[J] .Physl Plant, 1997,100:291-296).The alpha-helix that the plain K fragment of dewatering forms can make the dehydration element combine with the hydrophobic site of partly denatured protein matter, has played the effect that is similar to molecular chaperones, stops proteinic further sex change; The position of all right place of water molecule, the polar link in its intramolecularly hydroxyl and the phospholipid molecule forms hydrogen bond, makes the state of film fat still be similar to not dewatering state; The plain alpha-helix of dehydration can be combined closely with the ice crystal surface that forms in the cell under the low temperature, stop the further expansion of ice crystal, prevent injury (the Wisniewski M that pair cell causes because moisture solidifies, Webb R, Balsamo R, Close T J, Yu X-M, Griffith M.Purification, immunolocalization, cryoprotective, and antifreeze activity of PCA60:A dehydrinfrom peach (Prunuspersica L.) [J] .Physl Plant, 1999,105:600-608).Because the plain hydratability of dehydration with height; it combines the too much loss that can stop ICW with film fat; keep the hydration protection system of membrane structure; prevent reducing of film lipid bilayer spacing; and then block film merges and destruction (the Allagulova C R of biofilm structure; Gimalov F R; Shakirova F M; Vakhitov V A.The plant dehydrins:structure and putative functions[J] .Biochemistry; 2003,68:945-951).

Adverse circumstance such as low temperature, arid can be destroyed the balance of vegetable cell Radical Metabolism, increases the generation of active oxygen radical, and then causes or aggravate the peroxidation of film fat, causes the damage of cell membrane system.Evidence suggests, plain active oxygen radical (the Hara M that can remove in the vegetable cell of dehydration, Fujinaga M, Kuboi T.Radical scavenging gactivity and oxidative modification of citrusDehydrin[J] .Plant Physiol Biochem, 2004,42:657-662) (Hara M, Terashima S, Fukaya T, Kuboi T.Enhancement of cold tolerance and inhibition of lipid peroxidation by citrus dehydrin in transgenic tobacco[J] .Planta, 2003,217:290-298.).

The plain stabilization that in plant materials, shows as microbial film and protein structure of dehydration, thereby reduce adverse circumstance and dehydration injury (Close T J.Dehydrins:Emergence of a biochemical role of a family of plant dehydration proteins.Physio Plant to vegetable cell, 1996,97 (4): 795-803).

As the characteristic plant in Xinjiang, Herba Saussureae Involueratae (Saussurea involucrata Kar.et Kir) has another name called Herba Saussureae Involueratae, Snow Lotus Herb etc.Belong to composite family phoenix hair Chrysanthemum, the high mountain steppe, high mountain moraine and stone crack, flowstone beach, the crag crack of stone etc. that mainly grow in height above sea level 2400～4100m are located.The there climate variability, cold and hot impermanence, sleet replaces, 3～5 ℃ of the highest monthly average temperature, minimum monthly average temperature-19～-21 ℃, about 800 millimeters of annual precipitation, frostless season only had about 50 days.

Herba Saussureae Involueratae is through secular natural selection, stable special construction, function and gene have been formed, the physiology and the biochemical mechanism that adapt under the extreme environmental conditions have been produced, this mechanism that adapts to environmental facies, different with general adaptation mechanism cold-resistant, cold-resistant responsiveness, mainly show under its cold condition and can grow normally, and general winter resistance plant is under corresponding cold condition, growing is suppressed.

The plant cold resistance genetically engineered is developed rapidly in recent years, and has worked out multiple transgenosis cold resistant plant, has opened up new way for cultivating cold resistant plant.Saussurea involucrata lives in the extreme environment, is a kind of resource of fabulous cold-resistant gene, so far, the plain research of saussurea involucrata dehydration be yet there are no bibliographical information both at home and abroad.Utilize this characteristic rare plant, therefrom screen, clone and cold-resistant directly related gene, disclose the adaptive mechanism of saussurea involucrata, study its hereditary basis, fully excavate its potential genetic resources, and use it for the variety of crops improvement, have huge science and economic worth.

Summary of the invention:

An object of the present invention is provides the valuable cold dehydrin gene sikDh2 that induces for the plant cold resistance breeding, the order of its invention also is to make up plant expression vector: pBin438-sikDh2, in transgenic plant, obtain expressing, improve the winter resistance of transgenic plant, overexpression by this gene, the anti-low temperature stress performance of plant is improved, the anti-obvious enhanced plant of (anti-) low temperature ability of final acquisition.

The objective of the invention is to realize by following process and method:

The sikDh2 gene of cloning from Herba Saussureae Involueratae of the present invention, its sequence is＜210〉1.

Of the present invention from Herba Saussureae Involueratae the process of clone's sikDh2 gene as follows:

With Herba Saussureae Involueratae cDNA library mono-clonal plasmid is template, with its sequence of DP1 for＜210〉2 and its sequence of DP2 for＜210〉3 for primer increases, obtain goal gene;

SikDh2 gene plant expression vector establishment: make up plant expression vector pBin438-sikDh2;

Utilize said gene to make up plant expression vector, obtain cold-resistant transgenic plant by the agrobacterium-mediated transformation genetic transformation:

With unconverted tobacco plant blade is contrast, transgenic line simulation is cold-resistant coerce 8 hours after, compare with transgenic line not, the blade relative conductivity descends 48.6%.When temperature is higher than-2 ℃, transgene tobacco and not the specific conductivity of transfer-gen plant tobacco leaf do not have significant difference, but when temperature reached-4 ℃, the specific conductivity of transgene tobacco blade did not illustrate in the time of-4 ℃ apparently higher than the transgene tobacco blade, the transgene tobacco blade cell can not tolerate low temperature, membranolysis, content overflows, and causes specific conductivity to rise, and the transgene tobacco blade cell can tolerate low temperature, and big variation does not appear in specific conductivity.

MDA is one of snperoxiaized product of film fat, and its content can be represented the degree of lipid peroxidation.After transfer-gen plant is identified, obtain aseptic seedling by vegetative propagation, after taking root on the MS substratum.Tobacco is handled through different cryogenic temperatures, and the content of MDA all increases.The tobacco MDA content ascensional range of different treatment is followed successively by: 21.9%, 24.9%; 12.9%, 18.5%.From the result, analyze and draw, no matter be 0 ℃ ,-4 ℃ of subzero treatment 8hr, wild-type tobacco increases big than the MDA content of transgene tobacco, illustrate that the membranous peroxidation degree of wild-type plant is higher relatively.Reason may be that transgene tobacco has reduced the degree of lipid peroxidation.

The present invention not only obtains the cold-resistant relevant cold dehydrin gene sikDh2 that induces of Herba Saussureae Involueratae first, and with its plant expression vector that is built into, has studied the critical function of this gene in improving the plant frigostabile performance in transgenic plant.This enriches plant cold resistance molecular biology theory for the cold-resistant mechanism that discloses saussurea involucrata, improves the low temperature tolerance ability of plant, has great importance.

Description of drawings:

Fig. 1 is Herba Saussureae Involueratae sikDh2 gene PCR amplification figure Fig1:sikDh2gene PCR amplified

Fig. 2 is pUCm-sikDh2PCR evaluation figure Fig2:PCR identification of pUCm-sikDh2

Fig. 3 is sikDh2 evolutionary analysis figure Fig3:Phylogenetic analysis sikDh2

Fig. 4 is that pBin438-sikDh2PCR identifies Fig4:PCR identification ofpBin438-sikDh2

Fig. 5 is that the pBin438-sikDh2 enzyme is cut evaluation Fig5:Restriction enzyme digestion identification of pBin438-sikDh2

Fig. 6 transforms GV3101PCR to identify Fig6:PCR identification of pBin438-sikDh2-GV3101

Fig. 7 is that transformation of tobacco PCR detects Fig7:PCR identification of transformed tobacco

Fig. 8 is that transgene tobacco RT-PCR analyzes Fig8:RT-PCR analysis on transgenic tobacco

Fig. 9 is the mensuration Fig9:Relative conductivity of tobacco leaves of sikDh2 gene transformation tobacco leaf relative conductivity

What Figure 10 was a treatment of different temperature to tobacco MDA content influences Fig.10:Effect of temperature treatment onthe content of MDA in tobacco

Figure 11 is that plant expression vector is the structure schema of pBin438-sikDh2

Among Fig. 1:

1: negative control; 2:sikDh2; M:Marker

Among Fig. 2:

1:pUCm-sikDh2; 2: negative control; M:Marker

Among Fig. 4:

1-4:pBin438-sikDh2; 5: negative control; M:Marker

Among Fig. 5:

1，2：pBin438-sikDh2；M：Marker

Among Fig. 6:

1: negative control; 2-5:pBin438-sikDh2-GV3101; M:Marker

Among Fig. 7:

1: negative control; The 2-6:sikDh2 transformation of tobacco; M:Marker

Among Fig. 8:

1: negative control; 2, the 3:sikDh2 transformation of tobacco; M:Marker

Embodiment:

Testing related medicine sepharose DNA recovery test kit is that the production of worker company is given birth in Shanghai; LA PCRTM in vitro CloningKit is available from TaKaRa company; RNA enzyme, Taq enzyme, T4-DNA ligase enzyme (T4-DNA ligase), Marker, TRNzol total RNA extraction reagent are purchased the company in TIANGEN; Restriction enzymes such as BamH I, Sal I are that Fermentas company is original-pack; IPTG, X-gal and microbiotic, plant hormone are available from Shanghai Sangon company; The all ingredients of other reagent and preparation MS substratum is homemade analytical pure.Concrete experimental implementation is according to [U.S.] J. Sa nurse Brooker D.W. Russell " molecular cloning experiment guide ".

Embodiment 1: the extraction of Herba Saussureae Involueratae cDNA library mono-clonal plasmid

The glycerine pipe of getting the mono-clonal preservation of Herba Saussureae Involueratae cDNA library is in 10mlLB liquid nutrient medium (Cm 50 μ g/ml), and 37 ℃ of 220rpm shaking culture are spent the night.Dip in that to get bacterium liquid streak culture on LB solid medium (Cm 50 μ g/ml) flat board, 37 ℃ of dark 12-16hr that cultivate.The picking mono-clonal is in 20mlLB liquid nutrient medium (Cm 50 μ g/ml), and 37 ℃ of 220rpm shaking culture 14hr extract plasmid, and concrete grammar is as follows:

1) bacterium liquid is sub-packed in 1.5ml Ep pipe, the centrifugal 3min of 12000rpm abandons supernatant liquor;

2) add 400ml STE solution, resuspended, the centrifugal 3min of 12000rpm abandons supernatant liquor;

3) precipitation is resuspended with 150 μ L alkaline lysis solution I, mixing;

4) add freshly prepared 300 μ L alkaline lysis solution II, mixing is limpid to solution gently;

5) add 225 μ L alkaline lysis solution III, mixing is placed 5min on ice gently; Centrifugal (12000rpm, 5min);

6) draw supernatant in another new Ep pipe, add the equal-volume trichloromethane, abundant mixing, room temperature is placed 5min; Centrifugal (10000rpm, 5min);

7) carefully draw supernatant in another new Ep pipe, add the two volumes dehydrated alcohol and be about 850 μ L, place 10min for-20 ℃; Centrifugal (12000rpm, 5min);

8) supernatant discarded, precipitation is dissolved in 40 μ L TE (the containing RNase A 20 μ g/ml) solution 37 ℃ of incubation 30min with 70% washing with alcohol twice after room temperature dries up.

Embodiment 2: be cloned into the sikDh2 gene from Herba Saussureae Involueratae

With Herba Saussureae Involueratae cDNA library mono-clonal plasmid is template, with its sequence of DP1 for＜210〉2 and its sequence of DP2 for＜210〉3 for primer increases, the while is that template increases as negative control with the deionized water.

DP ₁For:＜210〉2

5′

AAAATG?GCACAACAC?GGAT?3′

BamHI

DP ₂: for:＜210〉3

5′

ATGAAATGATTA?CTT?CTGACC?CC?3′

SalI

PCR reaction system (20 μ l) is:

10×PCRBuffer 2.0μl

DNTPs (each 2.5mM) 0.5 μ l

MgCl2(25mM) 1.0μl

Upstream primer (25 μ M) 0.5 μ l

Downstream primer (25 μ M) 0.5 μ l

Template DNA (ddH ₂O) 0.5 μ l

Taq?DNA?Polymerase(2.5U/μl) 0.3μl

ddH ₂O 14.7μl

Total 20.0μl

The PCR response procedures is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30s, 57 ℃ of renaturation 30s, 72 ℃ are extended 45s, 30cycles; 72 ℃ are extended 7min; 4 ℃ of insulations.

After PCR reaction finished, product was after 1.0% agarose gel electrophoresis separates through concentration, the sepharose that uses Shanghai to give birth to the worker reclaim test kit to specifications method reclaim goal gene respectively, the purpose fragment called after sikDh2 that obtains.As shown in Figure 1, 2.

Embodiment 3: make up sikDh2 gene plant expression vector

Make up plant expression vector: pBin438-sikDh2.With BamHI/SalI difference double digestion plant expression vector pBin438, obtain carrier segments.Reclaim target gene fragment and carrier segments.Target gene fragment is carried out external the connection with carrier segments, through identifying correct recombinant plasmid called after pBin438-sikDh2 respectively.In the present embodiment, we select for use tobacco as transgenic plant material, also can select for use other plant as transgenic line.Shown in Fig. 4,5.

In the present embodiment, sikDh2 gene and pBin438 constitute a plant expression vector, are used for the conversion of plant.According to this embodiment of the present invention, make up selected plant expression vector except pBin438, can also select the other plant expression vector for use.

Embodiment 4: the conversion of Agrobacterium

4.1 the competent preparation of Agrobacterium

1) from fresh GV3101 flat board single bacterium colony of picking in LB liquid nutrient medium (5ml)+Rif (50ug/ml)+Gen (50ug/ml), in 28 ℃, 200rpm shaking culture 48hr;

2) get 200ul bacterium liquid in the LB liquid nutrient medium that contains Rif (50ug/ml) and Gen (50ug/ml) of 20ml activation culture to OD ₆₀₀=O.5-0.8 collect bacterium liquid, ice bath 30min;

3) packing bacterium liquid is in the 1.5ml centrifuge tube, and in 4 ℃, the centrifugal 5min of 6000rpm abandons most supernatant, collects agrobatcerium cell;

4) with the 0.05mol/LCaCl of sedimentary Agrobacterium with the 750ul precooling ₂Resuspended, 4 ℃, the centrifugal 5min of 8000rpm;

5) abandon supernatant 75ul 0.05mol/lCaCl ₂(10% glycerine) re-suspended cell is stored in-70 ℃.

4.2 plant expression vector transforms agrobacterium tumefaciens GV3101 (freeze-thaw method)

1) draws the above-mentioned transfer vector plasmids of 10 μ l (about 0.5 μ/g μ l), with 75 μ l GV3101 competent cells mixing gently, ice bath 30min, liquid nitrogen cryopreservation 5min then;

2) place 37 ℃ of water-bath 2min rapidly;

3) add 600 μ l liquid LB substratum (Rif+Gen), 28 ℃, 200rpm shaking culture 5hr;

4) with above-mentioned nutrient solution in the centrifugal 5min of 6000rpm, collect agrobatcerium cell, discard 500 μ l liquid nutrient mediums, remain 100 μ l re-suspended cells;

5) bacterium liquid is coated on contains Kan 50 μ g/ml, on the solid LB culture medium flat plate of Rif50 μ g/ml and Gen50 μ g/ml, cultivate 24-48hr for 28 ℃.

4.3 positive colony screening

The some single bacterium colonies of picking carry out bacterium colony PCR, with the positive colony called after that filters out: pBin438-sikDh2-GV3101.

In the present embodiment, the method that plant expression vector imports Agrobacterium is a freeze-thaw method.Freeze-thaw method is the technological operation that those skilled in the art are familiar with very much, is not key of the present invention.Detect the male agrobacterium strains by PCR, be used to transform plant.As shown in Figure 6.

Embodiment 5: tobacco genetic transformation and regeneration

Method for transformation for the target plant among the present invention is not crucial, and the various transformation technology that can use those skilled in the art to be familiar with imports target vegetable cell to be transformed with recombinant DNA sequence.These methods include but are not limited to the Agrobacterium infestation method, microprojectile bombardment methods, and microinjection, coprecipitation method, electroporation, and ovary injection plant fertilization blastular method etc. all can.

Be used for method in this programme, can use to be suitable for other target plants transformant regeneration plant.Preferably make in the stable genome that is incorporated into the target vegetable cell of the sequence that transformed, thereby it is not lost in the process that goes down to posterity.In addition, the nucleotide sequence that is used to transform the target plant can be with linearity, and the form of annular or other recombinant vectors such as the form of artificial chromosome exist.

5.1 the preparation of During Agrobacterium liquid

1) picking bacterium piece the GV3101 Agrobacterium glycerine pipe of containing from-70 ℃ of preservations: pBin438-sikDh2-GV3101, be inoculated in that 5ml is additional Kan 50 μ g/ml, Rif50 μ g/ml is in the LB liquid nutrient medium of Gen 50 μ g/ml, 28 ℃, the about 30hr of 200rpm shaking culture;

2) draw 200 μ l bacterium liquid, use 20ml LB liquid nutrient medium (Kan 50 μ g/ml, Rif50 μ g/ml, Gen 50 μ g/ml) dilution again, 28 ℃, the about 4hr of 200rpm shaking culture;

3) activatory bacterium liquid is cultured to OD ₆₀₀During=0.4-0.6, be the dip-dyeing solution that transforms usefulness.

5.2 contaminate

1) on the Bechtop dip-dyeing solution is poured in the sterile petri dish, aseptic tobacco leaf is cut into 1cm ²The square of size is put into bacterium liquid, and 10min is contaminated in vibration;

2) take out tobacco leaf, blot the bacterium liquid that adheres on the clean leaf dish with filter paper;

3) covering an aseptic filter paper on the substratum (MS+6-BA2.0mg/L+IAA0.3mg/L) altogether, be placed in the leaf dish of contaminating on the filter paper equably; Under 26 ℃ of dark culture condition, cultivated altogether 2-3 days.

5.3 resistant calli screens and sprouts and induces

The tobacco that the tobacco leaf disc of cultivating altogether is transferred to MS+6-BA 2.0mg/L+IAA 0.3mg/L+Kan 50mg/L+Cb 500mg/L is induced on the selection substratum, and leaf dish wound fully contacts substratum.Switching in every 15-20 days once transfer after 1-2 time, and the leaf plate edge produces light green, fine and close callus gradually, and the continuation cultivation is until inducing the bud of growing thickly.

5.4 the root culture of transformed plant and transplanting

When bud to be grown thickly grew to the 2-3cm left and right sides, the tobacco that its cutting-out is transferred to MS+IAA 0.3mg/L+Kan 50mg/L+Cb 500mg/L took root and selects to carry out root culture on the substratum.

Transgene tobacco begins to have root to generate about 15 days, when treating well developed root system, and the transformed plant that root growth is good, film is sealed in removal, carries out hardening in the room temperature environment about 7 days, washes substratum then, with seedling change over to matrix (vermiculite: detritus soil=2: 1), 26 ℃, 16hr 40 μ molm ^-2S ^-1Illumination is cultivated under the 70% relative humidity condition, need shelter from heat or light in preceding 2-3 days, lucifuge, preserve moisture.

Embodiment 6: the Molecular Detection of transgene tobacco

6.1 the PCR of transgene tobacco identifies

6.1.1 the extraction of tobacco DNA (SDS method)

1) gets the fresh blade of 0.1g, in the 1.5ml centrifuge tube, fully grind with glass rod;

2) add 400 μ l and extract damping fluid, abundant mixing, the centrifugal 5min of 12000rpm;

3) carefully draw 300 μ l supernatant liquors, add 300 μ l Virahols, precipitation at room temperature 20min, the centrifugal 10min of 12000rpm, collecting precipitation;

4) will precipitate fully air-dryly, add 400 μ l TE dissolution precipitations;

5) add 400 μ l chloroform/primary isoamyl alcohol (24/1), fully mixing leaves standstill 20min, the centrifugal 10min of 12000rpm;

6) carefully draw supernatant, add 40 μ l 3M NaAC (pH5.2), 800 μ l dehydrated alcohols ,-20 ℃ of precipitations are spent the night;

7) 4 ℃, the centrifugal 15min of 12000rpm abandons supernatant;

8) 70% alcohol washed twice dries up back with 30 μ l ddH ₂The O dissolving.

6.1.2 the PCR of transgene tobacco identifies

Tobacco DNA with the transforming gene that extracts is a template, with its sequence of DP1 for＜210〉2 and its sequence of DP2 for＜210〉3 for primer increases, the while is that template increases as negative control with the deionized water, amplification system such as embodiment 2.As shown in Figure 7.

6.2 the RT-PCR of transgene tobacco detects

6.2.1 the extraction of the total RNA of plant to be detected

The TRNzol total RNA extraction reagent of TIANGEN company extracts transgene tobacco and the total RNA of unconverted tobacco that has identified:

1) mortar and used utensil are toasted more than the 6hr at 180 ℃ of baking ovens, all the other employed rifle heads, centrifuge tube all use 0.1% DEPC to handle autoclaving;

2) get plant young tender leaf agreement that contracts a film or TV play to an actor or actress 0.1g in mortar, liquid feeding N fully is ground to Powdered;

3) the powder branch is filled in the little centrifuge tube of 1.5mL, the TRNzol that adds 1ml extracts reagent, fully quick mixing, and room temperature is placed 3-5min.

4) 10000rpm, 4 ℃ of centrifugal 5min suct clearly to a new centrifuge tube, add 200 μ l chloroforms, the thermal agitation mixing;

5) 10000rpm, 4 ℃ of centrifugal 5min draw supernatant liquid to another new centrifuge tube, add the Virahol of 600 μ l precoolings, in-20 ℃ of precipitation 30min;

6) 10000rpm behind 4 ℃ of centrifugal 10min, outwells liquid, can see white precipitate in the centrifuge tube bottom, is total RNA.

7) with after 70% ethanol (DEPC processing) washing precipitation 2 times, blot liquid, dry up the back and add 30 μ l ddH ₂O (DEPC processing) dissolving, be stored in-20 ℃ standby.

6.2.2cDNA first chain is synthetic

In the 0.2ml centrifuge tube that DEPC handles, add RNA 2 μ l, dNTP (2.5mM) 1 μ l, Oligo dT 1 μ l behind the ddH2O 5 μ l, places 1min on ice rapidly behind 70 ℃ of water-bath 5min.In centrifuge tube, add Rnase Inhibitor 0.5 μ l then, AMV ThermoScript II 0.5 μ l, 42 ℃ of 1hr behind 95 ℃ of 5min, are cooled to 4 ℃.

7.2.3cDNA the synthetic and amplification of second chain

In the PCR reaction tubes, add the cDNA first chain reaction product 1 μ l, 5 * Taq buffer, 4 μ l, MgCl ₂(25mM) 1.0 μ l, dNTP (2.5mM) 0.5 μ l, each 0.5 μ l of upstream and downstream primer (25 μ mol), ddH ₂O complements to 20 μ l, and reaction conditions is with embodiment 2.As shown in Figure 8.

The simulation cold damage of embodiment 7 transfer-gen plants is handled and the blade membrane permeability is measured

After transfer-gen plant is identified, obtain aseptic seedling by vegetative propagation, after taking root on the MS substratum.Choose the consistent seedling (5-7 leaf phase) of growth after plant survives, simulate cold damage and handle.Beat from blade with punch tool respectively and get sequin mensuration blade membrane permeability.As shown in Figure 9.

Embodiment 8: the simulation cold damage of transfer-gen plant is handled the MDA assay of blade

After transfer-gen plant is identified, obtain aseptic seedling by vegetative propagation, after taking root on the MS substratum.MDA is one of snperoxiaized product of film fat, and its content can be represented the degree of lipid peroxidation.Tobacco is handled through different cryogenic temperatures, and the content of MDA all increases.The tobacco MDA content ascensional range of different treatment is followed successively by: 21.9%, 24.9%; 12.9%, 18.5%.From the result, analyze and draw, no matter be 0 ℃ ,-4 ℃ of subzero treatment 8hr, wild-type tobacco increases big than the MDA content of transgene tobacco, illustrate that the membranous peroxidation degree of wild-type plant is higher relatively.Reason may be that transgene tobacco has reduced the degree of lipid peroxidation.As shown in figure 10.

Sequence table

＜110〉Shihezi Univ

＜120〉application of Herba Saussureae Involueratae sikDh2 gene in cultivating cold resistant plant

<160>3

<210>1

<211>360

<212>DNA

＜213〉Herba Saussureae Involueratae (Saurrea.involucrata Kar.et Kir.)

<220>

<221>5’UTP

<222>(1)...(9)

<220>

<221>CDS

<222>(10)...(339)

<220>

<221>3’UTP

<222>(340)...(360)

<400>1

Translation?of?DNAMAN2(10-360)

Universal?code

Total?amino?acid?number：110，MW＝12162

Max?ORF?starts?at?AA?pos?3(may?be?DNA?pos?10)for?110AA(330bases)，MW＝11692

1 ggatccaaa?atg?gca?caa?cac?gga?tca?gga?gag?cag?tac?gtg?aag?gag?ggt?cac?cac?ggt

1 MET?Ala?Gln?His?Gly?Ser?Gly?Glu?Gln?Tyr?Val?Lys?Glu?Gly?His?His?Gly

70 80 90 100 110 120

61 aca?gac?aag?tat?gtc?cgc?aat?cca?ttt?cag?atc?acc?cca?gta?ggt?caa?gac?gtc?gga?ggt

21 Thr?Asp?Lys?Tyr?Val?Arg?Asn?Pro?Phe?Gln?Ile?Thr?Pro?Val?Gly?Gln?Asp?Val?Gly?Gly

130 140 150 160 170 180

121 acc?gga?acc?acc?gtt?caa?acg?gga?gcc?gct?ggt?act?cac?ggc?cat?gaa?gga?gct?ggg?aaa

41 Thr?Gly?Thr?Thr?Val?Gln?Thr?Gly?Ala?Ala?Gly?Thr?His?Gly?His?Glu?Gly?Ala?Gly?Lys

190 200 210 220 230 240

181 ggt?gtg?gtg?gag?cag?atc?aag?gag?aag?tta?cct?ggt?ggt?gat?aat?ggt?gtc?gcc?gat?gac

61 Gly?Val?Val?Glu?Gln?Ile?Lys?Glu?Lys?Leu?Pro?Gly?Gly?Asp?Asn?Gly?Val?Ala?Asp?Asp

250 260 270 280 290 300

24l cac?aag?gct?gca?acc?acc?acc?ggt?gat?cat?ggt?gtc?gcc?gat?gga?cat?aag?aag?aag?gga

81 His?Lys?Ala?Ala?Thr?Thr?Thr?Gly?Asp?His?Gly?Val?Ala?Asp?Gly?His?Lys?Lys?Lys?Gly

310 320 330 340 350 360

30l gtg?atg?gag?aag?ata?aag?gag?aag?ttg?cca?ggg?ggt?cag?aag?taa?tca?ttt?cat?gtc?gac

101 Val?MET?Glu?Lys?MET?Lys?Glu?Lys?Leu?Pro?Gly?Gly?Gln?Lys＊＊＊

<210>2

<211>25

<212>DNA

＜213〉artificial sequence

<400>2

ggatccaaaatggcacaacacggat

<210>3

<211>29

<212>DNA

＜213〉artificial sequence

<400>3

gtcgacatgaaatgattacttctgacccc

Claims (3)

1. a clone sikDh2 gene from Herba Saussureae Involueratae is characterized in that this gene coding region total length 336bp, and its sequence is＜210〉1,111 amino acid of encoding, 5 ' non-coding region 3bp, 3 ' non-coding region 9bp.Utilize DNAMAN software that it is analyzed, find that it does not contain signal peptide and strides the film district.

2. one kind is utilized the gene constructed plant expression vector of said gene sikDh2.

One kind from Herba Saussureae Involueratae cloned sequence be the purposes of＜210〉1 sikDh2 gene, it is characterized in that utilizing said gene to make up plant expression vector, obtain cold-resistant transgenic plant by genetic transformation.

Images