CN109293758A

CN109293758A - Resisting verticillium GAP-associated protein GAP GbVIP1 and its encoding gene and application

Info

Publication number: CN109293758A
Application number: CN201811277409.2A
Authority: CN
Inventors: 王红梅; 赵佩; 赵云雷; 张凯; 陈伟; 龚海燕; 桑晓慧; 崔艳利
Original assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2018-10-30
Filing date: 2018-10-30
Publication date: 2019-02-01
Anticipated expiration: 2038-10-30
Also published as: CN109293758B

Abstract

The invention discloses a kind of resisting verticillium GAP-associated protein GAP GbVIP1 and its encoding gene and applications, and amino acid sequence is as shown in SEQ ID NO:1.Protein G bVIP1 of the present invention comes from resisting verticillium island cotton variety sea 7124, belongs to the I subfamily of bZIP transcription factor family, has conservative bZIP structure domain.The research of the invention finds that GbVIP1 gene upregulation is expressed under verticillium wilt pathogen infection condition, silencing GbVIP1 gene reduces sea island cotton to the resistivity of verticillium wilt pathogen, so GbVIP1 albumen has great importance to verticillium wilt resistance of cotton by same breeding.

Description

Resisting verticillium GAP-associated protein GAP GbVIP1 and its encoding gene and application

Technical field

The present invention relates to field of biotechnology, more particularly to a kind of resisting verticillium GAP-associated protein GAP GbVIP1 and its coding base Cause and application.

Background technique

Verticillium wilt is to endanger disease the most serious, northwest China inland, Yellow River basin and the Changjiang river in Cotton in China production The all different degrees of harm by verticillium wilt every year of basin three cotton regions, year about 3,000,000 hm of occurring area², year economic loss Up to 1,200,000,000 yuan (the Cotton in China verticillium wilt research end-decade review such as Zhu Heqin, Li Zhifang, Feng Zili and prospect, Cotton Science, 2017,29 (supplementary issues): 37-50).By showing breeding and plantation disease-resistant variety just to the prevention practice of cotton verticillium wilt for a long time It is to prevent and treat most effective, the most economical measure of cotton verticillium wilt.But verticillium wilt pathogen is immunized in China upland cotton and the germplasm of highly resistance provides Source lacks, and resisting verticillium sea island cotton can not be widely applied, and traditional breeding method period length, low efficiency, cause tradition to be educated in addition Kind method breeding resisting verticillium kind is made slow progress, so many researchers use modern genetic engineering technology, to find The key protein of verticillium wilt resistance of cotton by same, and utilize ill-resistant protein binding molecule breeding technique breeding verticillium wilt-resistant cotton kind.

VirE2 interaction albumen 1 (VIP1, VirE2interacting proteins 1) is plant alkalescence leucine zipper (bZIP, Basic leucine zipper) transcription factor has conservative bZIP structure domain, belongs to bZIP transcription factor family I subfamily (Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T,Parcy F.bZIP transcription factors in Arabidopsis.Trends Plants Sci, 2002,7(3):106-111).VIP1 albumen by with VIP1 response original part (VRE, the VIP1response in genome Element) combine, the transcription of many anti contravariance related genes can be activated, cause plant Resistant reaction (Lacroix B, Citovsky V.Characterization of VIP1activity as a transcriptional regulator in vitro and in planta.Sci Rep,2013,3(8):2440).When plant is by invading pathogens, VIP1 albumen can MAPK (the Mitogen-activated protein kinases) approach of participation, the substrate as MAPK albumen are phosphorylated, phosphorus The VIP1 albumen of acidification can be positioned at nucleus, activate pathogenesis related gene PR1 (Pathogenesis-regulated Protein expression), improve plant to the resistance of pathogen (Zaltsman A, Krichevsky A, Kozlovsky S V, Yasmin F,Citovsky V,Plant defense pathways subverted by Agrobacterium for genetic transformation,Plant Signaling and Behavior,5:10,1245-1248.)。

Summary of the invention

The object of the present invention is to provide a kind of resisting verticillium GAP-associated protein GAP GbVIP1 and its encoding gene and applications.

Technical solution of the present invention is specific as follows:

A kind of resisting verticillium GAP-associated protein GAP GbVIP1, amino acid sequence is as shown in SEQ ID NO:1.

Application of the Protein G bVIP1 of the present invention in verticillium wilt resistance of cotton by same.

Protein G bVIP1 of the present invention derives from resisting verticillium island cotton variety sea 7124.

Protein G bVIP1 of the present invention cultivates the application of resisting verticillium Upland Cotton by genetic engineering means.

A kind of GbVIP1 gene, nucleotides sequence are classified as one of what follows:

(1) polynucleotide sequence of the protein as shown in SEQ ID NO:1 is encoded；

(2) with above-mentioned polynucleotide sequence according to the complementary polynucleotide sequence of base pair complementarity principle.

GbVIP1 gene of the present invention, polynucleotide sequence is as shown in SEQ ID NO:2.

A kind of recombinant vector contains above-mentioned GbVIP1 gene.

Recombinant vector of the present invention is interleaving in the restriction enzyme site BamHI and SacI of plant expression vector pBI121 Enter the recombinant vector of GbVIP1 gene.

A kind of host cell of genetic engineering, contains above-mentioned recombinant vector.

The host cell of genetic engineering of the present invention is the Escherichia coli or Agrobacterium of above-mentioned recombinant vector.

GbVIP1 albumen of the invention comes from resisting verticillium island cotton variety sea 7124, and research finds that verticillium wilt pathogen infects item GbVIP1 gene upregulation is expressed under part, and silencing GbVIP1 gene reduces sea island cotton to the resistivity of verticillium wilt pathogen, so GbVIP1 albumen has great importance to verticillium wilt resistance of cotton by same breeding.

GbVIP1 albumen is made of 337 amino acid residues, and amino acid sequence is as shown in SEQ ID NO:1, GbVIP1 Albumen theoretical molecular weight is 37.5kDa, and theoretical isoelectric point is 7.89, bright in bZIP structure domain comprising conservative bZIP structure domain Histidine residue position conservative is high, there is a leucine every 6 amino acid residues.VIP1 of the present invention to different plant species Albumen carries out VIP1 gene of the phylogenetic analysis discovery from different cotton varieties and gets together.Meanwhile to from different plant species VIP1 albumen carry out structural domain analyzed, discovery the VIP1 albumen from different plant species all include bZIP structure domain.

The present invention analyzes the tissue expression specificity of VIP1 gene in cotton, discovery GbVIP1 Levant Cotton Root, There is expression in stem, leaf texture, wherein the expression quantity highest in root.To VIP1 gene after cotton is inoculated with verticillium wilt pathogen Expression pattern carries out analysis and finds that GbVIP1 gene upregulation is expressed after cotton is inoculated with verticillium wilt pathogen, and 6h expression quantity is most after connecing bacterium Height is 3.73 times of control.

The present invention utilizes the GbVIP1 gene in VIGS technology silencing cotton, the results showed that, GbVIP1 gene silencing plant Blade turn yellow wilt, vein present yellow it is netted, the micro- aobvious dwarfing of plant shape.Resisting verticillium ability of the silencing plant than adjoining tree It is remarkably decreased.25 days investigation diseases refer to the verticillium wilt disease of silencing plant refers to be 22.5 after connecing bacterium, and the disease of adjoining tree refers to be 20.83, The verticillium wilt disease for connecing 35 days silencing plant after bacterium refers to be 30.54, and the disease of adjoining tree refers to be 23.45.35 days are connect after bacterium to cotton Plant carries out cuing open bar observation, it is found that the degree of lignification of the stalk of silencing plant weakens, the jaundice browning of vascular bundle conduit part.To Huang Cotton leaf progress Trypan Blue after disease of withering infects finds that the ratio of the blade dead cell of silencing plant is higher.So GbVIP1 gene and verticillium wilt resistance of cotton by same ability are positively correlated, and can be applied in verticillium wilt resistance of cotton by same breeding research.

Present invention obtains the recombinant expression carriers comprising said gene, and the GbVIP1 of acquisition is gene constructed to expression load In body pBI121, with the expression of 35S promoter promotor gene, NOS terminator is terminated, and is marked using kanamycin gene as screening Note.Above-mentioned recombinant expression carrier is transferred in Escherichia coli and Agrobacterium, the recombinant cell comprising said gene is obtained.It will packet Agrobacterium containing above-mentioned recombinant expression carrier is transferred in tobacco, obtains the transgene tobacco comprising recombinant expression carrier, includes Recombinant expression carrier, recombinant cell and the transgene tobacco of said gene can be further to be laid the foundation using the gene.

Explanation and specific embodiment are to verticillium wilt resistance of cotton by same GAP-associated protein GAP GbVIP1 of the present invention with reference to the accompanying drawing And its encoding gene is described further with application.

Detailed description of the invention

Fig. 1 is the PCR products electrophoresis map spectrum for cloning sea island cotton GbVIP1 gene, and left side swimming lane is 2000bpDNA molecular weight Standard, right lanes are amplified production；

Fig. 2 is the sequence difference figure of VIP1 albumen in resistance to verticillium wilt and sensitive varieties, 7124 Hes of island cotton variety sea Pima is resistant variety, and Upland Cotton TM-1 is sensibility kind；

Fig. 3 is expression of the GbVIP1 gene in cotton different tissues, and error line indicates standard error；

Fig. 4 is GbVIP1 albumen bZIP conserved structure domain analysis, and arrow meaning is leucine；

The phylogenetic analysis of VIP1 albumen of the Fig. 5 from different plant species；

The bZIP structure domain analysis of VIP1 albumen of the Fig. 6 from different plant species；

Fig. 7 is the recombinant expression carrier figure comprising GbVIP1 gene；

Fig. 8 is the picture of transgene tobacco detection, and swimming lane 1 is 2000bpDNA molecular weight standard, and swimming lane 2 is negative control, Swimming lane 3 is positive control, and swimming lane 4-6 is transgenic positive tobacco plant；

Fig. 9 is expression of the GbVIP1 gene after cotton is inoculated with verticillium wilt pathogen, and error line indicates standard error, significantly Property analysis * * * indicate P < 0.001；

Figure 10 is silent carrier pYL156-GbVIP1 figure；

Figure 11 is the photo using VIGS silencing GbVIP1 gene in sea island cotton, is significantly reduced after silencing GbVIP1 gene Resistance of the sea island cotton to verticillium wilt, pYL156:PDS are positive control, and pYL156:00 is negative control；

Figure 12 is to cut open bar to observe photo；

Figure 13 is Trypan Blue result photo.

Specific embodiment

Clone, sequence and the expression analysis of embodiment 1GbVIP1 gene

Island cotton variety sea 7124 is planted, takes cotton leaf in Seedling Stage, with liquid nitrogen cotton leaf grind into powder, benefit Cotton leaf total serum IgE is extracted with EASYspin Plus plant RNA rapidly extracting kit (Ai Delai), utilizes Reverse Transcription Box (TakaRa) synthesizes cDNA.

Using the cDNA of synthesis as template, GbVIP1 is expanded, the primer sequence is F:5 ' TACGCCGCCGCTTCTTCCGCCTACA3'；R:5 ' CTTACCAAGCATTTCCTTCCAACAT3 ' is (such as SEQ ID NO:3-4 institute Show).

GbVIP1 is expanded using high-fidelity Taq enzyme KOD-Plus-Neo (TOYOBO), 20ul reaction system is as follows, 10 × PCR buffer for KOD-Plus-Neo, 0.2mM dNTPs, 1.5mM MgSO₄, 0.3uM forward primer and 0.3uM reverse primer, 0.4U KOD-Plus-Neo, 200mM cDNA, amplification program be 94 DEG C of 4min, 98 DEG C of 10s, 60 DEG C of 1min, 68 DEG C of 1min；34 circulations, 68 DEG C of 5min take amplified production for agarose gel electrophoresis, as shown in Figure 1, expanding Increase the segment of 1000bp or so out.Band is cut out, is recycled using Ago-Gel QIAquick Gel Extraction Kit (Tiangeng).By recovery product It is connected in pLB vector sequencing vector (Tiangeng), recombinant vector GbVIP1-pLB is transferred to Escherichia coli sense using heat shock method By in state, the Escherichia coli containing recombinant vector are obtained, and be sequenced, the final sequence information for obtaining GbVIP1 gene.

Using same method and primer, expanded from resistant variety sea island cotton Pima and sensitive varieties upland cotton TM-1 VIP1 gene finds that there are some base differences for anti-sense kind VIP1 protein sequence.(Fig. 2) chooses Seedling Stage root, stem, leaf group It knits, tissue expression specificity's analysis is carried out to GbVIP1 gene using real-time PCR.Said extracted RNA is utilized after materials The cDNA that different tissues are obtained with the method for reverse transcription, utilizes fluorescent quantitation reagent SYBR Primix Ex Taq II (Tli RNaseH Plus) (TaKaRa) progress real-time PCR.Primer sequence used is as follows: F:5 ' CCAATCCCAGTCTGCCACCT R:5 ' TCAACCCGAGTCCATCAAAGA (as shown in SEQ ID NO:5-6).Reaction system It is as follows: 10ul2 × SYBR Premix Ex Taq II, 2ul cDNA template, 0.8ul PCR forward primer (10uM), 0.8ul PCR reverse primer (10uM), 0.4ul ROX and 6ul aqua sterilisa.Response procedures: 95 DEG C 30s, 40 circulations, 95 DEG C of 5s, 60 DEG C of 34s.Utilize 2^-ΔΔCtMethod handles obtained result.As a result, it has been found that GbVIP1 There is expression in root, stem, leaf texture, the expression quantity highest (Fig. 3) in root.

Analysis is carried out to the conserved domain of GbVIP1 albumen and finds that leucine is residual in the bZIP structure domain of GbVIP1 albumen Base location conservative is high, there is a leucine every 6 amino acid residues, as shown in Figure 4.Quasi- south has been downloaded from NCBI The amino acid sequence of the VIP1 albumen of other species such as mustard, rice, tobacco, using MEGA software to the VIP1 from different plant species Albumen carries out phylogenetic analysis and finds the VIP1 gene affiliation with higher from different cotton varieties, gets together, As shown in Figure 5.Meanwhile structural domain is carried out to the VIP1 albumen from different plant species and is analyzed, it finds from different plant species VIP1 albumen all includes bZIP structure domain, as shown in Figure 6.

The expression vector of embodiment 2GbVIP1 gene, the acquisition for recombinantly expressing cell and transgene tobacco

Recombinant expression carrier is obtained into expression vector pBI121 by GbVIP1 is gene constructed, and base is started with 35S promoter The expression of cause is terminated the expression of gene with NOS terminator, receives mycin gene as selection markers using card, and the specific method is as follows, benefit It is template with gained recombinant vector GbVIP1-pLB in embodiment 1, with primers F: acgggggactctagaggatccTACGCCG CCGCTTCTTCC, R:cgatcggggaaattcgagctcCTTACCAAGCATTTCCTTCCAAC are (such as SEQ ID NO:7-8 institute Show) it is expanded, the PCR product of GbVIP1 gene order is obtained, pBI121 is carried using restriction enzyme SacI and BamHI Body carries out digestion, obtains the linearization plasmid with restriction enzyme site, utilizes homologous recombination kit (ClonExpress II One Step Cloning Kit, promise are only praised) PCR product is building up in heavy over-express vector pBI121, obtain expression vector PBI121-GbVIP1 (Fig. 7).

Recombinant vector pBI121-GbVIP1 is transferred in E. coli competent using heat shock method, obtains and is carried containing recombination The Escherichia coli of body, and be sequenced, it is final to obtain recombinant expression cell.

Recombinant vector pBI121-GbVIP1 is transferred in agrobatcerium cell GV3101, method for transformation is as follows: in aseptic condition Under take 50ul Agrobacterium competent cell, Plasmid DNA (pBI121-GbVIP1) 1ug is added, after mixing gently, places on ice 30min is put in 5min in liquid nitrogen, 28 degree of heat shock 5min later, and the YEP culture fluid nutrient medium of antibiotic-free is added, in 28 degree, 200r/min shake culture 2h is coated with kalamycin resistance plate, and bacterium sequencing identification is chosen after 28 degree of stationary culture 36h.Utilize agriculture Recombinant vector pBI121-GbVIP1 is transferred to obtain in tobacco by the genetic transforming method that bacillus mediates turns cotton GbVIP1 gene Tobacco.Concrete operations are as follows:

(1) Ben's tobacco seed is sterilized in 0.1% liquor natrii hypochloritis, then is rinsed 3 times with aqua sterilisa, point is sowed at In MS culture medium.It is aseptically transplanted to culture bottle after germination and continues to cultivate.

(2) the open and flat Ben's tobacco leaf in selection blade face, is cut into 5.0mm × 5.0mm size box, is laid in MS and trains substantially 25 DEG C, preculture 3d under illumination condition are supported on the culture medium of base (vitamin containing MS)+1.0mg L-16-BA+0.2mg L-1IAA.

(3) it before infecting, will be activated containing the Agrobacterium of recombinant vector pBI121-TaVIP1, to Agrobacterium bacterium solution OD600= When 0.5, bacterium solution is collected by centrifugation, outwells supernatant, is resuspended with MS re-suspension liquid (pH 6.0).

(4) the Ben's tobacco leaf disc of preculture is gone in Agrobacterium bacterium solution and infects 20min, inhaled after taking-up with aseptic filter paper Dry blade surface bacterium solution is transferred to MS minimal medium+1.0mg L^-16-BA+0.2mg L^-1In the culture dish of IAA, 25 DEG C black 2d is co-cultured under dark condition.

(5) leaf dish after co-cultivation is gone into screening and culturing medium (MS minimal medium+1.0mg L^-16-BA+0.2mg L^- ¹IAA+Cb (carbenicillin) 400mg L^-1+ Cef (cephalo penicillin) 100mg L^-1+Kan 100mg L^-1), 25 DEG C, illumination Under the conditions of cultivate, every 3 weeks one subcultures of replacement

(6) when tobacco leaf disc periphery adventitious bud it is long to 0.5cm when adventitious bud is transferred to root media (1/2MS trained substantially Support base+Cb400mg L^-1+Cef100mg L^-1+Kan 100mg L^-1) further screening, culture.

The regeneration bud that height is 2-3cm is split from callus, is transferred in triangular flask and cultivates, obtains resistance Regeneration plant carries out PCR detection, the primer F:5 ' for transgene tobacco to T0 using kanamycin screening marker gene TACGCCGCCGCTTCTTCCGCCTACA3 ' R:5 ' CTTACCAAGCATTTCCTTCCAACAT3 ' is (such as SEQ ID NO:9-10 institute Show), the plant that can amplify 1014bpPCR product is the tobacco plant (Fig. 8) for turning sea island cotton GbVIP1 gene.This turns base Because application of the subsequent GbVIP1 albumen of plant pair in resisting verticillium breeding is laid a good foundation

The functional analysis of embodiment 3GbVIP1

(1) expression pattern analysis of the GbVIP1 gene after cotton is inoculated with verticillium wilt pathogen

Using water culture plant cotton, utilizing spore concentration in one heart stage of two leaves is 1*10⁷Verticillium dahliae Vd853 The root of cotton seedling is infected using root dipping method, has then taken 0h, 6h, 12h after connecing bacterium respectively, for 24 hours the root tissue of cotton seedling, RNA and reverse transcription are extracted into cDNA using method described in embodiment 1, have studied GbVIP1 base using real-time PCR Because of the expression after cotton is inoculated with verticillium wilt pathogen, the primer and reaction system are shown in embodiment 1.As a result, it has been found that after connecing bacterium The expression quantity of GbVIP1 gene raises, the 6h after connecing bacterium, the expression quantity highest of GbVIP1 gene, for 3.73 times (Fig. 9) of control. Thus deducibility GbVIP1 gene is related to verticillium wilt resistance of cotton by same ability.

(2) using virus induced gene silencing (VIGS:Virus induced gene silencing) technology in sea Silencing GbVIP1 gene in the cotton of island

272bp conserved sequence is had chosen from the cDNA sequence of GbVIP1 gene is reversely building up to silent carrier pYL156 In, it obtains silent carrier pYL156-GbVIP1 (Figure 10), concrete operations are as follows, firstly, the island according to obtained in embodiment 1 The cDNA of cotton blade is as template, with primers F ggcctcgagacgcgtgagctcGCCGTTGATGGTGTTAAGAAAAC, R: AgaaggcctccatggggatccATAGCCTGTAGCCGTAGTTTCAGTT (as shown in SEQ ID NO:11-12) is expanded Increase, obtains the PCR product of 272bp conserved sequence.Enzyme is carried out to pYL156 carrier using restriction enzyme SacI and BamHI It cuts, obtains the linearization plasmid with restriction enzyme site, utilize homologous recombination kit (ClonExpress II One Step Cloning Kit, promise are only praised) PCR product is building up in silent carrier pYL156, obtain silent carrier pYL156- GbVIP1.And silent carrier is transferred in agrobatcerium cell GV3101, method for transformation is as shown in embodiment 2.By cotton kind Son sterile water impregnates for 24 hours, and kind is completely open and flat to seedling cotyledon into mixed Nutrition Soil (matrix: vermiculite=1:1) after showing money or valuables one carries unintentionally Shi Jinhang VIGS experiment will carry Agrobacterium, the carrying control vector pYL156-GhPDS of pYL156-GbVIP1 carrier before inoculation Agrobacterium and carry the Agrobacterium activation of pYL156 empty carrier and pYL192 carrier, when Agrobacterium bacterium solution OD600=1.5, Bacterium solution is collected by centrifugation, utilizes re-suspension liquid (10Mm MgCl₂, 10mM MES, 150uM acetosyringone) Agrobacterium is resuspended, then Carry pYL192 carrier Agrobacterium respectively with carry pYL156-GbVIP1, pYL156, the Agrobacterium of pYL156-GhPDS carrier 1:1 is uniformly mixed, and is used after standing 4h.1 aperture is pricked at the Cotton Seeding Cotyledon back side with the syringe needle of 1ml, then will Bacterium solution is injected into cotton cotyledon, and the brown colored plastic cloth of the cotton seedling after injection is covered, is protected from light culture for 24 hours, then illumination Culture, is inoculated with verticillium wilt pathogen when albefaction phenotype occurs in adjoining tree, connects after bacterium the 25 days and 35 days investigation state of an illness and calculates disease and refers to, Disease investigation is using Pyatyi criteria for classifying division field verticillium wilt diseased plant rank: 0 grade: disease-free plant；1 grade: 25% or less blade The plant of morbidity；The plant of 2 grades: 25%-50% blade morbidity；The plant of 3 grades: 50%-75% blade morbidity；4 grades: 75% with The plant of blade morbidity.Disease index calculation formula are as follows:

It wilts as a result, it has been found that the blade of GbVIP1 gene silencing plant turns yellow, vein presentation yellow is netted, and plant shape is micro- to show short Change.Silencing plant is remarkably decreased (Figure 11) than the resisting verticillium ability of adjoining tree.25 days investigation diseases refer to after connecing bacterium, silencing plant Verticillium wilt disease refer to be 22.5, the disease of adjoining tree refers to be 20.83, connect 35 days silencing plant after bacterium verticillium wilt disease refer to for 30.54, the disease of adjoining tree refers to be 23.45.

The stalk of silencing plant and adjoining tree is splitted with blade, observes the phenotype at vascular bundle position under the microscope (Figure 12), the death that the cotton leaf after infecting to verticillium wilt carries out the blade of Trypan Blue observation silencing and adjoining tree are thin Born of the same parents' ratio takes the blade of silencing and adjoining tree same area, be immersed in trypan blue dye liquor (2.5g trypan blue, 25% lactic acid, 23% water-soluble phenol, 25% glycerol) in, boiling water bath dyes 2min, and room temperature stained over night after natural cooling is subsequently placed in 1.25g/ Ml chloraldurate solution decoloration 3d, replaces a destainer daily.Cell death situation (Figure 13) is observed under Stereo microscope. The degree of lignification for cuing open the stalk of bar observation discovery silencing plant weakens, the jaundice browning of vascular bundle conduit part.Trypan Blue examination The ratio for issuing after examination and approval the blade dead cell of existing silencing plant is higher.So GbVIP1 gene and verticillium wilt resistance of cotton by same ability positive It closes, can be applied in verticillium wilt resistance of cotton by same breeding research.

Embodiment described above only describe the preferred embodiments of the invention, not to model of the invention It encloses and is defined, without departing from the spirit of the design of the present invention, those of ordinary skill in the art are to technical side of the invention The various changes and improvements that case is made should all be fallen into the protection scope that claims of the present invention determines.

Sequence table

<120>resisting verticillium GAP-associated protein GAP GbVIP1 and its encoding gene and application

<141> 2018-10-30

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 337

<212> PRT

<213>GbVIP1 amino acid sequence (GbVIP1)

<400> 1

Met Glu Gln Lys Leu Arg Met Glu Ile Asp Gln Met Pro Pro Arg Gly

1 5 10 15

Ala His His Arg Arg Ala His Ser Asp Thr Thr Phe Arg Phe Asp Asp

20 25 30

Leu Leu Leu Phe Asp Pro Ser Asp Leu Asp Leu Ser Cys Leu Asp Leu

35 40 45

Pro Asp Ser Ser Ser Asn Pro Ser Leu Pro Pro Val Ala Pro Val Pro

50 55 60

Ala Glu Ser Ser Asp Asp Ser Ser Cys Asn Gly Pro Pro Arg Ser Thr

65 70 75 80

Leu Asn Asn Pro Arg His Ile Arg Ser Leu Ser Val Asp Ser Asp Phe

85 90 95

Phe Asp Gly Leu Gly Leu Thr Gly Pro Ala Ile Ser Gly Gly Ala Gly

100 105 110

Asp Glu Lys Phe Gly Gly Lys Arg Gly Ala Gly Glu Lys Arg Val His

115 120 125

His Arg His Ser Asn Ser Met Asp Gly Ser Thr Thr Ala Ser Phe Asp

130 135 140

Val Glu Ser Leu Met Ala Val Asp Gly Val Lys Lys Thr Met Ala Pro

145 150 155 160

Asp Arg Leu Ala Glu Leu Ala Leu Ile Asp Pro Lys Arg Ala Lys Arg

165 170 175

Ile Leu Ala Asn Arg Gln Ser Ala Ala Arg Ser Lys Glu Arg Lys Ile

180 185 190

Arg Tyr Thr Asn Glu Leu Glu Lys Lys Val Gln Thr Leu Gln Thr Glu

195 200 205

Ala Thr Asn Leu Ser Ala Gln Val Thr Met Leu Gln Arg Asp Thr Thr

210 215 220

Gly Leu Thr Thr Glu Asn Lys Glu Leu Lys Leu Arg Leu Gln Ala Met

225 230 235 240

Glu Gln Gln Ala Gln Leu Arg Asp Ala Leu Asn Glu Lys Leu Lys Glu

245 250 255

Glu Val Gln Arg Leu Arg Ile Gln Ala Gly Gln Val Ser Ala Met Asn

260 265 270

Gly Asn Pro Phe Asn Arg Gly Leu Ser Pro Gln Tyr Leu Thr His Gln

275 280 285

Pro Ala Pro His His Phe Gly Val Leu Gln Thr Pro His Gln Gln Gln

290 295 300

Gln Gln Gln Gln Gln Leu Gln Met Pro His Ser Ser Thr Asn Asn Pro

305 310 315 320

Thr Leu Asn Gly Gln Pro Gln Pro His Phe Met Asp Phe Asn Gln Arg

325 330 335

Ala

<210> 2

<211> 1014

<212> DNA

<213>GbVIP1 nucleotide sequence (GbVIP1)

<400> 2

atggagcaaa agctgcgaat ggagatagac cagatgccac cacgtggagc tcaccatagg 60

cgggctcatt ccgacacaac tttccgtttc gatgatcttc tcctcttcga cccctcggac 120

ctcgatcttt cctgccttga ccttccggat tcctcttcca atcccagtct gccacctgtc 180

gcacccgtac ctgctgaatc ctccgatgac tcctcatgca acggccctcc tcgctccacc 240

ctcaataacc ctaggcatat ccgtagcctt tctgttgact ctgatttctt tgatggactc 300

gggttgactg gacccgcgat ctccggagga gctggggatg agaaatttgg cgggaaaaga 360

ggtgcaggag agaagagggt tcaccataga catagtaact cgatggatgg ttcgactacg 420

gcatcgtttg acgttgagtc cttgatggcc gttgatggtg ttaagaaaac tatggctcct 480

gatagacttg ctgagcttgc ccttatcgat cccaagagag ctaaaaggat tctggctaac 540

aggcaatcag ctgcgcgttc aaaggagagg aagattcgat acacgaatga actagagaag 600

aaggttcaga ctcttcagac agaagctacc aatctctccg cacaagtcac aatgttacag 660

agagacacta ctgggttgac tactgagaac aaggaactga aactacggct acaggctatg 720

gagcaacaag cgcagcttag ggatgctttg aatgaaaaat tgaaggaaga agtgcaacgg 780

cttaggatac aagctggtca agtgtctgct atgaatggaa atcctttcaa tagaggacta 840

tctcctcaat atttaaccca ccaacctgct ccacatcact ttggcgtcct gcagacaccg 900

catcaacaac aacagcagca gcagcagctg cagatgcctc attcatccac caataacccg 960

actttgaacg gacagcctca acctcacttt atggatttta accagagggc atag 1014

<210> 3

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

tacgccgccg cttcttccgc ctaca 25

<210> 4

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

cttaccaagc atttccttcc aacat 25

<210> 5

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ccaatcccag tctgccacct 20

<210> 6

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

tcaacccgag tccatcaaag a 21

<210> 7

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

acgggggact ctagaggatc ctacgccgcc gcttcttcc 39

<210> 8

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

cgatcgggga aattcgagct ccttaccaag catttccttc caac 44

<210> 9

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

tacgccgccg cttcttccgc ctaca 25

<210> 10

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

cttaccaagc atttccttcc aacat 25

<210> 11

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

ggcctcgaga cgcgtgagct cgccgttgat ggtgttaaga aaac 44

<210> 12

<211> 46

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

agaaggcctc catggggatc catagcctgt agccgtagtt tcagtt 46

Claims

1. a kind of resisting verticillium GAP-associated protein GAP GbVIP1, it is characterised in that: its amino acid sequence is as shown in SEQ ID NO:1.

2. application of the Protein G bVIP1 described in claim 1 in verticillium wilt resistance of cotton by same.

3. Protein G bVIP1 described in claim 1 derives from resisting verticillium island cotton variety sea 7124.

4. the application that Protein G bVIP1 described in claim 1 cultivates resisting verticillium Upland Cotton by genetic engineering means.

5. a kind of GbVIP1 gene, it is characterised in that: its nucleotides sequence is classified as one of what follows:

6. GbVIP1 gene according to claim 5, it is characterised in that: its polynucleotide sequence such as SEQ ID NO:2 institute Show.

7. a kind of recombinant vector, it is characterised in that: contain GbVIP1 gene described in claim 5 or 6.

8. recombinant vector according to claim 7, it is characterised in that: the carrier is plant expression vector pBI121's The recombinant vector of GbVIP1 gene is inserted between restriction enzyme site BamHI and SacI.

9. a kind of host cell of genetic engineering, it is characterised in that: contain recombinant vector described in claim 7 or 8.

10. the host cell of genetic engineering according to claim 9, it is characterised in that: the host cell is containing having the right It is required that the Escherichia coli or Agrobacterium of 9 recombinant vectors.