CN117286147A

CN117286147A - SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata

Info

Publication number: CN117286147A
Application number: CN202310991461.9A
Authority: CN
Inventors: 祝建波; 侯梦娟; 孔辉; 夏雯雯; 李锦�; 刘瑞娜
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2023-08-07
Filing date: 2023-08-07
Publication date: 2023-12-26

Abstract

The invention relates to a SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata. A SiLEA4 stress-resistant gene fragment of saussurea involucrata, wherein the sequence of the SiLEA4 stress-resistant gene fragment is <210>2. The invention also discloses SiLEA4 stress-resistant protein of saussurea involucrata, an expression vector and application thereof. The SiLEA4 stress-resistant gene fragment, the protein and the application of the saussurea involucrata of the invention construct a plant expression vector by using the gene, and the stress-resistant (low temperature, yield improvement and the like) transgenic plant is obtained through genetic transformation.

Description

SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata.

Background

Cold stress, including cold damage (< 20 ℃) and freeze damage (< 0 ℃), has an effect on both plant growth and geographical distribution, and is one of the main factors limiting crop yield and quality. Many important commercial crops, such as cotton, corn, capsicum, rice, soybean, tomato, some tropical fruits (e.g. banana, papaya and mango) and subtropical fruits (e.g. grape, orange) are sensitive to low temperature stress. The unpredictable late spring cold events accompanying late spring directly lead to low survival of these crop seedlings. Frost events occurring in early autumn and winter lead to early death of crops, cause crop yield reduction, and greatly reduce the quality of agricultural products. Meanwhile, in areas of cold climate, freeze injury is a long-term concern for crop production. Therefore, research on cold-resistant genes is of great importance to genetic improvement of crops.

In plants, COR is a key gene that determines a plant's response to cold stress. The main regulatory pathway of plants to cold stress responses is ICE-CBF-COR, where the LEA family plays an important role. Late Embryogenesis Abundant (LEA) proteins belong to a large family, which are widely found in plants, normally accumulate in late embryos, are produced under stress conditions, up-regulate expression in plant tissues, and are involved in plant responses to abiotic stress. The LEA proteins were first discovered during cotton embryo development and accumulated in large quantities later in the seed maturation process, after which the LEA proteins were reported successively in seed of various species and in vegetative tissues under various stress conditions. Overexpression of some LEA genes can enhance the stress resistance of bacteria, yeast and transgenic plants. The fourth subgroup member of the LEA family has a characteristic sequence (pfam) of about 75 amino acid residues at the N-terminus, a conserved region which is thought to be advantageous for plants against water stress. For example, the fourth set of LEA proteins in tomato can accumulate in large amounts in the leaves and exert a cell water loss reducing effect Zegzouti, H, jones, B, marty, C, leli re, J.M., latch, A, pech, J.C., et al (1997) ER5, a tomato cDNA encoding an ethylene-responsive LEA-like protein characterization and expression in response to drought, ABA and working. Silencing the fourth set of LEA genes in peanuts results in a decrease in drought resistance of the plants, su, l., zhao, c.z., bi, y.p., wan, s.b., xia, h.and Wang, x.j. (2011) Isolation and expression analysis ofLEA genes in peanut (araachis hypogaea l.), J Biosci,36,223-8.

Tomato (Solanum lycopersicum l.) is a typical cold-sensitive vegetable crop, whereas arabidopsis is a relatively cold-resistant plant. Both have similar CBF proteins responses to cold stress, but there are only four similar proteins downstream of the CBF response, suggesting that the downstream genes are more important for tomato cold sensitivity. Most of research on freezing stress at home and abroad is focused on the aspect of upstream regulation of cold reaction, while research on downstream genes is little. In contrast, saussurea involucrata has evolved a complex cold-resistance mechanism due to its unique growing environment and contains abundant cold-resistance genes. For these reasons, it is very novel to study the cold-resistance gene of saussurea involucrata using tomatoes that are sensitive to cold as model plants. In previous studies, siPIP; overexpression of the 5A gene improves low temperature resistance Li, j, xia, w, zang, h, dai, b, zhang, y, feng, y, et al (2020) Expression analysis of aquaporin genes in Saussureainvolucrata rosette leaves and functional analysis of upregulated SiPIP1 by modulating cellular water balance; 5A under-temperature stress and Experimental Botany,171. Studies have shown that overexpression of the SiDHN gene can promote cold and drought tolerance Ganapath i, T.R., guo, X, zhang, L., wang, X, zhang, M, xi, Y, et al (2019) Overexpression of Saussureainvolucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants. Plos One,14 in transgenic tomato plants by inhibiting cell membrane damage, protecting chloroplasts, and enhancing reactive oxygen species clearance. Recently, transcriptome sequencing and extensive bioinformatic analysis of saussurea involucrata have been completed, providing us with an opportunity to explore specific LEA genes associated with saussurea involucrata cold resistance.

Disclosure of Invention

The first object of the present invention is to provide a SiLEA4 stress-resistant gene fragment of saussurea involucrata, wherein the sequence of the SiLEA4 stress-resistant gene fragment is <210>2. The saussurea involucrata gene SiLEA4 has value for plant stress-resistant cultivation.

The second object of the present invention is to provide a SiLEA4 stress-resistant protein of saussurea involucrata, wherein the sequence of the SiLEA4 stress-resistant protein is <210>1.

Further, the SiLEA4 stress-resistant protein is obtained by the SiLEA4 stress-resistant gene fragment.

Further, the SiLEA4 stress-resistant protein codes 344 amino acids

The third object of the invention is to provide an expression vector of the SiLEA4 stress-resistant gene of saussurea involucrata, wherein the expression vector has the SiLEA4 stress-resistant gene fragment.

The fourth object of the present invention is to provide the use of the above-mentioned segment of the SiLEA4 stress-resistant gene, or the above-mentioned SiLEA4 stress-resistant protein, or the above-mentioned expression vector in transgenic plants.

Further, the plant is tomato.

Furthermore, the application is to improve the low temperature resistance and yield of plants.

Still further, the application is: transgenic plants resistant to stress are obtained by genetic transformation.

Still further, the genetic transformation method is an Agrobacterium-mediated method.

Compared with the prior art, the invention has the beneficial effects that:

the invention has the SiLEA4 protein and gene coding sequence from saussurea involucrata and the application in cold resistance and yield increase. The SiLEA4 protein sequence provided by the invention is shown as <210>1, and the coding gene sequence is shown as <210>2. Experiments prove that the SiLEA4 protein can improve the survival rate of tomatoes under the freezing condition, and is particularly shown by the rapid increase of POD, SOD, CAT and APX activities under the freezing condition, and the higher proline content. Plasma membrane damage is lower, lower relative conductivity and malondialdehyde content. Experiments prove that the SiLEA4 protein can increase tomato yield, and is particularly characterized by improving photosynthetic efficiency, reducing transpiration rate, improving water utilization efficiency and enlarging fruits. Therefore, the protein SiLEA4 has important theoretical significance and practical value in cultivating plants with enhanced cold resistance and increased yield.

Drawings

FIG. 1 is a DNAPCR identification of transgenic tomato; numbers 1-22 are transgenic lines, + positive control plasmid, -negative control untransformed wild type line;

FIG. 2 is an identification of transgenic tomato expressing SiLEA4 by RT-PCR; numbers 1-8 represent single transgenic plant lines, + plasmids as positive controls, -untransformed wild type lines as negative controls;

FIG. 3 is a phenotype under cold stress of a transgenic tomato plant of wild type and SiLEA4 expression; wild-type and SiLEA4 transgenic plants of 5 weeks of age were placed under cold stress (6 hours at 4℃and 4 hours at-2 ℃) and recovered at 25℃for 1 day;

FIG. 4 is a physiological change under cold stress of wild type and SiLEA4 expressing transgenic tomato plant lines (OE-1, OE-2 and OE-3); (a) RWC (%), (B) REL (%), (C) MDA content, (D) Pro content, (E) soluble protein; data are mean ± SD of three replicates; asterisks indicate significant differences between wild-type and transgenic plants. * Represents P <0.05, < P <0.01;

FIG. 5 is a comparison of related enzyme activities of transgenic plants and wild type plants under normal and cold stress conditions; comparison of SOD activity (a), POD activity (B), CAT activity (C) and APX activity (D) in transgenic plants and wild type plant leaves under normal and cold stress conditions; WT represents a wild tomato plant; OE-1, OE-2 and OE-3 represent three independent SiLEA4 transgenic tomato lines; data are mean ± SD of three replicates; asterisks indicate significant differences between wild-type and transgenic plants. * Represents P <0.05, < P <0.01;

FIG. 6 is transgenic line and wild type tomato yield; (A) is the number of single plant fruits, (B) is the average fruit weight, and (C) is the single plant fruit yield; error bars, mean ± SD; n=number of plants; ns. there was no significant difference; asterisks indicate statistically significant differences (student t test, < P0.05, < P < 0.01);

FIG. 7 is an appearance and aspect ratio of transgenic lines and wild type tomatoes; (A) The transgenic line and the whole fruit of the wild type (left) and cross-section (right), (B, C) transgenic tomato fruit compared to the cross-section and longitudinal section diameters of the wild type tomato fruit; error bars, mean ± SD; n=number of plants; ns. there was no significant difference; asterisks indicate statistically significant differences (student t test, < P0.05, < P < 0.01);

FIG. 8 is an analysis of photosynthesis ability of wild type tomatoes and transgenic tomatoes; (A) Is inter-cell CO ₂ Concentration, (B) is net photosynthetic rate, (C) is transpiration rate, (D) is water utilization efficiency, (E) is pore conductance; error bars, mean ± SD; n=number of plants; ns. there was no significant difference; asterisks indicate statistically significant differences (student t-test,..times.P)<0.01)。

Detailed Description

In order to further illustrate the SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata according to the present invention, the following description will be given with reference to the preferred embodiments, in which specific embodiments, structures, features and effects of the SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata according to the present invention are described in detail below. In the following description, different "an embodiment" or "an embodiment" do not necessarily refer to the same embodiment. Furthermore, the particular features, structures, or characteristics of one or more embodiments may be combined in any suitable manner.

The SiLEA4 stress-resistant gene fragment, protein and application of the saussurea involucrata of the present invention will be described in further detail with reference to the following examples:

the invention aims to improve the cold resistance and yield of plants. The technical scheme of the invention is as follows:

a SiLEA4 stress-resistant gene fragment of saussurea involucrata, the sequence of the SiLEA4 stress-resistant gene fragment is <210>2, and the total length of a coding region is 1034bp.

A SiLEA4 stress-resistant protein of saussurea involucrata, wherein the sequence of the SiLEA4 stress-resistant protein is <210>1.

Preferably, the SiLEA4 stress-resistant protein is obtained by the SiLEA4 stress-resistant gene fragment.

Preferably, the SiLEA4 stress-resistant protein encodes 344 amino acids

In the technical proposal, the polypeptide is obtained by point mutation, deletion, substitution and addition of <210>1, or the amino acid sequence similarity with <210>1 is more than eighty percent, and the polypeptide is relevant to cold resistance and yield increase.

The SiLEA4 stress-resistant protein can be directly synthesized, or the protein can be produced by organisms after the coding genes are obtained through biological and chemical methods.

An expression vector of the SiLEA4 stress-resistant gene of saussurea involucrata, wherein the expression vector has the SiLEA4 stress-resistant gene fragment.

In the above technical scheme, the recombinant bacterium contains a gene expression frame, an expression vector and a recombinant bacterium of <210>2 or more than eighty percent of similarity with <210>2.

The SiLEA4 stress-resistant gene fragment, the SiLEA4 stress-resistant protein or the expression vector is applied to transgenic plants and is mainly used for improving stress resistance (low temperature, yield improvement and the like) of green plants.

Preferably, the plant is tomato.

Preferably, the application is to improve the low temperature resistance and yield of plants.

Further preferably, the application is: transgenic plants resistant to stress are obtained by genetic transformation.

Further preferably, the genetic transformation method is an Agrobacterium-mediated method.

Example 1: acquisition of the SiLEA4 Gene

Total RNA was extracted from cryogenically treated saussurea involucrata leaves and cDNA was synthesized using the cDNA synthesis kit (TaKaRa, dalia, china) according to the instructions of the RNAisoPlus kit (TianGen Biotech, beijin, china). Based on the sequence information <210>1 of SiLEA4, the gene-specific Primer SiLEA4-F sequence was designed with the biological software Primer Premier 5.0 as <210>3 and SiLEA4-R sequence as <210>4. And (3) performing PCR amplification by taking the saussurea involucrata cDNA as a template. The PCR product was identified by agarose gel electrophoresis, cloned into pMD19T vector (TaKaRa, dalian, china) and transformed into E.coli DH 5. Alpha. Host cell, and the positive clone screened by PCR was verified by DNA sequencing.

The specific operation steps are as follows:

(1) Total RNA was extracted from cryogenically treated saussurea involucrata leaves and cDNA was synthesized using a cDNA synthesis kit (TaKaRa, dalia, china) according to the instructions of RNAisoPlus kit (TianGen Biotech, beijin, china);

(2) Based on the sequence information of SiLEA4, the following gene-specific primers SiLEA4-F were designed using the biological software PrimerPremier 5.0: CCCGGGAGCCACCGACAAACCCTATG; siLEA4-R: GTCGAC TGCCAGAATGATTCGCCAGT;

(3) Performing PCR amplification by using saussurea involucrata cDNA as a template, wherein a PCR reaction system is shown in table 1, and a PCR reaction program is shown in table 2;

(4) The PCR product was identified by agarose gel electrophoresis, and ligated with pMD19T vector (TaKaRa, dalian, china) in a ligation system and procedure as shown in Table 3;

(5) The positive monoclonal was transformed into E.coli DH 5. Alpha. Host cells by heat shock method and screened by PCR with the PCR system as shown in Table 1. The cloning vector was subjected to DNA sequencing validation.

TABLE 1 Gene cloning PCR reaction System

TABLE 2 Gene cloning PCR procedure

TABLE 3T-vector ligation System

Example 2: acquisition of transgenic plants

The siloa 4 ORF was cloned into pCAMBIA2300 vector under the control of CaMV 35S promoter. The insert was released from pMD19-T-SiLEA4 by Xma I and Sal I cleavage and then ligated to pCAM-BIA2300 MCS. The construct was introduced into Agrobacterium strain GV3101 by electroporation.

The SiLEA4 gene was transferred into tomato using Agrobacterium-mediated leaf disc transformation. The infected tomato hypocotyls were screened on MS medium containing 2.0 mg/L6-BA, 0.3mg/L IAA, 100mg/L Kan and 400mg/LTm and the screened resistant transgenic shoots were cut into rooting medium (1/2 MS medium containing 0.3mg/L IAA, 100mg/L Kan and 400 mg/LTm). The DNA of the transgenic plant is used as a template, the PCMBIA2300-SiLEA4 recombinant plasmid is used as a positive control, the DNA of the wild tomato plant is used as a negative control, and the transgenic tomato seedlings are identified through PCR. Expression of the SiLEA4 gene at the RNA level was confirmed by RT-PCR. Transgenic plants were transplanted into plastic pots containing nutrient soil and vermiculite (3:1). They were then grown in a naturally lit greenhouse at 22-28℃and a relative humidity of 60-70% until flowering and fruiting. T2 generation seeds of transgenic tomatoes were collected for further analysis.

The specific operation steps are as follows:

construction of A plant overexpression vector

(1) Simultaneous double cleavage from pMD19-T-SiLEA4 and pCAMBIA2300-35s-mcs-ocs was performed by Xma I and Sal I cleavage. The cleavage system is shown in Table 4.

TABLE 4 cleavage reaction System and conditions

(2) The cleavage reaction solution was separated by 1% agarose gel electrophoresis.

The double enzyme fragments containing SiLEA4 and pCAMBIA2300-35s-mcs-ocs were recovered and purified using a product recovery kit (Nuo-uzan). The ligation system of the above DNA fragments at 4℃using T4-DNA ligase is shown in Table 5.

Table 5 connection reaction System and program

B obtaining recombinant Agrobacterium

The construct was introduced into Agrobacterium strain GV3101 by electroporation, after 42h, the plates were observed for the presence of single colonies, if any, each plate was picked up for several single colonies, shake-cultured, PCR-identified as positive colonies, glycerol was added to a final concentration of 20%, and the strain was stored at-80 ℃.

Genetic transformation of C plants

(1) Transferring the SiLEA4 gene into tomatoes by adopting an agrobacterium-mediated leaf disc transformation method;

(2) The infected part of tomato is hypocotyl;

(3) The adventitious bud screening culture medium is MS culture medium containing 2.0 mg/L6-BA, 0.3mg/L IAA, 100mg/L Kan and 400 mg/LTm;

(4) The rooting medium of the resistant buds is 1/2MS medium containing 0.3mg/L IAA, 100mg/L Kan and 400mg/L Tm;

(5) The transgenic plants are transplanted into plastic flowerpots containing nutrient soil and vermiculite (3:1);

(6) Extracting transgenic tomato genome DNA, taking the DNA of a transgenic plant as a template, taking PCMBIA2300-SiLEA4 recombinant plasmid as a positive control, taking wild tomato plant DNA as a negative control, and identifying the transgenic tomato seedling by PCR, wherein the PCR program refers to example 1, and the result is shown in figure 1;

(7) Transgenic tomato leaf RNA was extracted and the presence of SiLEA4 gene RNA level was confirmed by RT-PCR. PCR procedure referring to example 1, the results are shown in fig. 2;

(8) Transgenic plants were transplanted into plastic pots containing nutrient soil and vermiculite (3:1), and then they were grown in a naturally lit greenhouse at 22-28℃and 60-70% relative humidity until flowering and fruiting. T2 generation seeds of transgenic tomatoes were collected for further analysis.

Example 3 anti-Cold and anti-Freeze detection of SiLEA 4-transformed tomatoes

Wild-type and T2-generation transgenic tomato plants grown at 25℃for 30 days were transferred to a4℃incubator for 6 hours and then to a-2℃incubator for another 4 hours. The tomato phenotype was observed at different times and tomato leaves were collected separately for physiological index determination.

The measurement of physiological indicators includes Relative Water Content (RWC), relative Electrolyte Leakage (REL), malondialdehyde (MDA) content, proline (Pro), soluble sugars, soluble proteins, superoxide dismutase (SOD), peroxidases (POD), catalases (CAT) and Ascorbate Peroxidases (APX).

The specific operation steps are as follows:

phenotype of transgenic tomato at Low temperature

And planting the T2 generation seeds in a flowerpot, and germinating and growing in a greenhouse. Genome-level and transcriptome-level identification was again performed 15 days after germination, with reference to example 1. A population of homozygous lines that did not undergo gene isolation was selected for subsequent experiments. Wild-type and T2-generation transgenic tomato plants grown at 25℃for 30 days were transferred to a4℃incubator for 6 hours and then to a-2℃incubator for another 4 hours. The tomato phenotype was observed at different times and the results are shown in figure 3.

And respectively collecting tomato leaves for physiological index measurement.

B determination of the degree of Water loss

The Relative Water Content (RWC) reflects the water retention capacity of plants, which is used to measure the moisture status and osmotic regulation of plants. The relative moisture content of the leaves was determined by weighing.

The results are shown in fig. 4A, which shows that RWC levels in leaves of transgenic plants and wild type plants are similar prior to exposure to stress. The level of RWC was reduced in both wild-type and transgenic plants when exposed to stress at 4 ℃, but the level of RWC was significantly higher in transgenic plants than in wild-type plants. However, the RWCs of the transgenic plants OE-2 and OE-3 lines were significantly higher than the wild-type plants under stress at-2 ℃. The transgenic tomato can respond to the water loss reaction more positively.

Determination of the extent of damage to the C film

MDA is the product of ROS-induced lipid peroxidation, which, together with relative conductivity, reflects the extent of plasma membrane damage.

The Relative Electrolyte Leakage (REL) was measured using an EC 215 thermal conductivity meter (marks on Science inc., del Mar, CA, USA).

Malondialdehyde (MDA) content was measured according to the thiobarbituric acid (TBA) method.

The results are shown in FIGS. 4B-C, which show that both the MDA content and REL levels of wild-type and transgenic plants increased under cold stress, but the increase in wild-type plants was more pronounced. Both REL and MDA were significantly higher in wild type plants than in transgenic plants (P < 0.01) at 4 ℃ or-2 ℃. Indicating that the transgenic tomatoes have a lower degree of membrane damage under low temperature conditions.

D resistance at Low temperature

The proline content to some extent illustrates the resistance of plants in stress. The free proline content was determined by the sulfasalicylic acid method.

The results are shown in figures 4D-E, which demonstrate that the proline content of the transgenic plants is also significantly higher than that of the wild type plants at 25 ℃ and rapidly accumulates at-2 ℃. The content of proline and soluble protein in transgenic plants was significantly higher than in wild type plants (P < 0.01) at both 4 ℃ and-2 ℃. The transgenic tomatoes are shown to be more resistant to low temperatures.

To demonstrate the change in the ability of the SiLEA4 transgenic plants to scavenge ROS, SOD, POD, CAT and APX were further determined according to spectrophotometry as described previously. All samples were tested in triplicate. The results are shown in FIG. 5.

As can be seen from FIG. 5, the activities of both the four enzymes of the wild type and transgenic plants were up-regulated under low temperature stress. The dramatic increase in SOD activity in transgenic tomatoes was most pronounced at 4 ℃ stress, 7.54 times that of wild type. Furthermore, the activity of POD is significantly higher than that of wild type plants, whereas CAT and APX are also higher than that of wild type plants. While the activities of the four enzymes SOD, POD, CAT and APX are obviously up-regulated under the stress of-2 ℃, the average values of the four enzymes are 5.29, 2.31, 2.37 and 1.55 times of that of wild plants respectively. The transgenic plants are shown to have strong ROS scavenging ability.

Example 4.

In Xinjiang stone river in China (N44 DEG 20', E85 DEG 30'). The planting area of the transgenic tomatoes and the wild tomatoes is 10.5m ² Three biological replicates were performed for each experiment. Yield evaluation of fruits the number of individual fruits, the weight of individual fruits and the weight of individual fruits were investigated. Finally, the transverse and longitudinal cutting diameters of the tomato fruits are measured.

Four tomato independent transformation events and three wild type tomato fully developed leaves were measured with GFS-3000 photosynthesizer on sunny days at 9:45-10:55 h. Three transient photosynthesis values were recorded for each leaf, including transpiration rate (Tr), net photosynthetic rate (Pn), intercellular carbon dioxide concentration (Ci), stomatal conductance (Gs), PSII maximum fluorescence efficiency and Water Use Efficiency (WUE). The Water Use Efficiency (WUE) is calculated as follows: wue=pn/Tr.

The specific operation steps are as follows:

a transgenic tomato yield parameter determination

The planting area of the transgenic tomatoes and the wild tomatoes is 10.5m ² Three biological replicates were performed for each experiment.

Yield evaluation of fruits: the number of individual fruits, the weight of individual fruits and the weight of individual fruits were investigated. The results are shown in FIG. 6, which shows that the transgenic lines have a greater number of fruits than the wild type and the average single fruit weight is also higher than the wild type. The results show that the average yield of transgenic plants is also significantly higher than that of wild type plants.

Finally, the transverse and longitudinal cutting diameters of the tomato fruits are measured. The results are shown in fig. 7, which shows: expression of SiLEA4 in tomato can increase the transverse and longitudinal diameters of tomato fruits.

Determination of photosynthetic parameters of B transgenic tomato

The transpiration rate (Tr), net photosynthetic rate (Pn), intercellular carbon dioxide concentration (Ci), stomatal conductance (Gs), and Water Use Efficiency (WUE) of each tomato plant were measured using GFS-3000 photosynthetic apparatus, and the results are shown in fig. 8, which show that photosynthetic efficiency is improved, transpiration rate is reduced, and water use efficiency is improved.

The foregoing description is only a preferred embodiment of the present invention, and is not intended to limit the embodiment of the present invention in any way, but any simple modification, equivalent variation and modification of the above embodiment according to the technical substance of the embodiment of the present invention still fall within the scope of the technical solution of the embodiment of the present invention.

Claims

1. The SiLEA4 stress-resistant gene fragment of saussurea involucrata is characterized in that the sequence of the SiLEA4 stress-resistant gene fragment is <210>2.

2. The SiLEA4 stress-resistant protein of saussurea involucrata is characterized in that the sequence of the SiLEA4 stress-resistant protein is <210>1.

3. The siea 4 stress-resistant protein according to claim 1, characterized in that said siea 4 stress-resistant protein is obtained by a siea 4 stress-resistant gene fragment according to claim 1.

4. The SiLEA4 stress-resistant protein of claim 1 wherein said SiLEA4 stress-resistant protein encodes 344 amino acids.

5. An expression vector of the SiLEA4 stress-resistant gene of saussurea involucrata, which is characterized in that the expression vector comprises the SiLEA4 stress-resistant gene fragment as claimed in claim 1.

6. Use of a segment of a SiLEA4 stress-resistance gene according to claim 1, or a SiLEA4 stress-resistance protein according to any one of claims 2-4, or an expression vector according to claim 5, in a transgenic plant.

7. The use according to claim 6, wherein,

the plant is tomato.

8. The use according to claim 6, wherein,

the application is to improve the low temperature resistance and yield of plants.

9. The use according to claim 8, wherein,

the application is as follows: transgenic plants resistant to stress are obtained by genetic transformation.

10. The use according to claim 9, wherein,

the genetic transformation method is an agrobacterium-mediated method.