CN101509007A - Synthesis of LfcinB15-Mag12 encoding gene and expression method in colon bacillus - Google Patents

Abstract

The invention provides a method for synthesizing an LfcinB15-Mag12 encoding gene and expressing the same in colon bacillus. Active gene fragments enconding LfcinB 1-15 amino acid and active gene fragments of Magainin from 1 to 12 are designed according to E. coli codon preference, a recombinant expression vector pET-32a-Lfcin B15-Mag12 is constructed by an expression vector pET-32a, codon encoding 6 histidine labels exists before multiple cloning sites of pET-32a, and stop codon TAG and TAA are added. The method successfully expresses the LfcinB15-Mag12 in the colon bacillus by a gene engineering method, establishes basis of theory and practice for scale production of hybrid peptide and other noble peptides by the gene engineering method, and is significant for establishing peptide gene engineering strains and commonness technology of antibacterial peptide research.

Description

The synthetic method that reaches at expression in escherichia coli of LfcinB15-Mag12 encoding gene

(1) technical field

The invention belongs to agriculture animal and veterinary Application Areas, be specifically related to a kind of LfcinB15-Mag12 encoding gene technology.

(2) background technology

The history in existing more than 50 year of development of antibiotics.Because it can prevent that the disease of livestock and poultry from taking place, and improves animal throughput, improves the aquaculture benefit, so be the important component part of additive premix always.But the life-time service of Antibiotic Additive can make many pathogenic bacterias produce resistance, produces serious drug residue simultaneously in livestock product, thereby the further control and the human beings'health of livestock and poultry all produced disadvantageous effect.Therefore, the use of Antibiotic Additive is more and more limited by strictness in countries in the world, and from January 1st, 2006, European Union just complete prohibition interpolation in feed was the antibiotics fodder additives of purpose with the health care promotes growth.In order to seek antibiotic substitute, produce the generation that can effectively prevent livestock and poultry, promote growth of animal, toxic side effect is little again, noresidue, the green feed additive that has no drug resistance, domestic and international many animal and veterinary workers have carried out a large amount of research, have obtained certain progress.They mainly contain at the microbiotic substitute of research: zymin, souring agent, probiotic bacterium, probiotics, plant milk extract, herbal medicine, saccharicter-penin etc.But these microbiotic substitutes all exist production cost too high, DeGrain, shortcoming such as the technology of extracting and producing is immature.

Antibacterial peptide is the small molecule polypeptide of resisting the external microbe infringement in the animal body, removing the vivo mutations cell, have broad-spectrum antimicrobial, nontoxicity, have no drug resistance, advantage such as noresidue and pollution, and its Heat stability is good, additive capacity is little, be adapted at using in the fodder production process, have the performance identical and meet the needs that livestock product are kept the safety in production fully, have potential quality as fodder additives of new generation with microbiotic.Research and development to antibacterial peptide in recent years become the research focus.People continuing to seek new cationic antibacterial peptide, transform in the hope of obtaining the antibacterials of highly effective and safe known natural antibacterial peptide on the one hand on the other hand.But natural antibacterial peptide kind source is limited, extract difficulty, and many existence activity are undesirable or the defective of hemolytic toxicity, therefore, with the antibacterial peptide that exists naturally is template, the design synthesis of derivatives to the research antibacterial peptide mechanism of action, composite reactive is stronger, toxicity is lower, antibacterial peptide more stable, more wide spectrum is significant, makes up the method that bio-reactor obtains antibacterial peptide by genetic engineering technique and has shown bright prospects and great potential.

(3) summary of the invention

The object of the present invention is to provide the encoding gene of a kind of T1249 LfcinB15-Mag12 according to e. coli codon preferences design, and divide four polynucleotide chains synthetic the positive anti-chain of encoding gene, utilize gene engineering method in intestinal bacteria successful expression LfcinB15-Mag12.

The object of the present invention is achieved like this: according to the active gene fragment of E.coli codon-bias design coding 1-15 amino acid whose active gene fragment of Lfcin B and Magainin (1-12), utilize expression vector pET-32a to make up recombinant expression vector pET-32a-Lfcin B15-Mag12, before the multiple clone site of pET-32a, there are 6 histidine-tagged codons of coding, in pET-32a-Lfcin B15-Mag12, to encode a Lfcin B15-Mag1227 amino acid whose gene fragment clone behind the codon of encoding histidine label, restriction enzyme Sal I, between the Nco I recognition site codon, add terminator codon TAG simultaneously, TAA

Divide four sections composition sequences as follows:

Fragment 1:5 '-CATGGCTTTCAAATGCCGCCGTTGGCAGTGGCGTTGGAAAAAACTGGGTGCGGGTA TCG-3 '

Fragment 2:5 '-GTAAATTCCTGCACTCTGCTAAAAAATTC TAGTAAG-3 '

Fragment 3:5 '-TCGAC TTACTAGAATTTTTTAGCAGAGTGCAGGAATTTACCGATACCC GCACCCAGTTT-3 '

Fragment 4:5 '-TTTCCAACGCCACTGCCAACGGCGGCATTTGAAAGC-3 '

Underscore partly is terminator codon TAG, the TAA that adds, and italicized item is restriction restriction endonuclease Sal I, Nco I recognition sequence, and rest part is Bovinelactoferrin-magainins T1249 gene.

The present invention also has some technical characterictics like this: for ease of directly being cloned in the pET-32a that double digestion is handled, directly the sticking tip designs of restriction enzyme site is gone in the Lfcin B15-Mag12 gene, promptly add restriction enzyme Sal I, the fragment of Nco I recognition site after enzyme is cut respectively in the upstream and the downstream of Lfcin B15-Mag12 gene.

Technical characterstic of the present invention has:

1. according to the e. coli codon preferences, design the encoding gene of T1249 LfcinB15-Mag12, divided four polynucleotide chains synthetic the positive anti-chain of encoding gene, after annealing connects, successfully obtained the encoding gene of T1249 LfcinB15-Mag12.

2. directly introduce sticky end at synthetic LfcinB15-Mag12 encoding gene fragment two ends, connect into expression vector pET-32a, construction of expression vector pET-32a-LfcinB15-Mag12, order-checking shows with design in full accord.

3. expression vector pET-32a-LfcinB15-Mag12 is transformed expressive host E.coli DH5 α, 0.1mmol/L IPTG, 30 ℃ induce 3h, produced and the expection molecular weight be the special abduction delivering band of 23.9kD, through western blot analysis, molecular weight is that the band of inducing of 24kDa is the TRX fusion rotein, proves that fusion rotein Trx-S-His-LfcinB15-Mag12 successfully obtains to express.

4. best inductive condition is optimized, under the best inductive condition of determining, promptly begins to induce when cell density reaches OD600=0.6,0.3mmol/L IPTG, 30 ℃ induce 4h, and the Expression of Fusion Protein amount accounts for 22% of tropina total amount.

5. reclaim fusion rotein Trx-S-His-LfcinB15-Mag12 through NTA-affinity chromatography column purification, purity is higher, reach more than 95%, but output is lower, induces bacterial cultures only to obtain the 19mg fusion rotein for average every liter.

6. according to enzyme: protein mass is than utilizing enteropeptidase crack fusion protein Trx-S-His-LfcinB15-Mag12 for the ratio of 1:100,23 ℃ of 6h can realize complete cracking, be to obtain purer T1249 LfcinB15-Mag12 after the ultrafiltration pipe ultrafiltration of 5kDa through molecular weight cut-off, induce bacterial cultures to obtain LfcinB15-Mag12200 μ g for average every liter.

7. utilize thin layer plate agarose disk diffusion method to detect the bacteriostatic activity of reorganization T1249 LfcinB15-Mag12, streptococcus aureus ATCC25923 had the obvious suppression effect, show that this experiment has obtained to have the reorganization LfcinB15-Mag12 of biologic activity, utilize gene engineering method successfully to realize the heterogenous expression of antibacterial peptide LfcinB15-Mag12 first.

The present invention has designed the encoding gene of T1249 LfcinB15-Mag12 according to the e. coli codon preferences, divides four polynucleotide chains synthetic the positive anti-chain of encoding gene, after annealing connects, has successfully obtained the encoding gene of T1249 LfcinB15-Mag12.This research and utilization gene engineering method in intestinal bacteria successful expression LfcinB15-Mag12; for gene engineering method large-scale production T1249 and other valuable peptide class have been established the theory and practice basis, significant to the common technology of setting up the research of peptide genoid engineering bacteria and antibacterial peptide.

(4) description of drawings

Fig. 1 is the antibacterial figure of the present invention;

Fig. 2 is a process flow sheet of the present invention;

Fig. 3 is the synthetic LfcinB15-Mag12 encoding gene synoptic diagram of purifying, and wherein 1 is dna molecular amount standard, and 2 are the Lfcin B15-Mag12 gene that is used to make up pET-32a-Lfcin B15-Mag12 of purifying;

Fig. 4 screens positive recombinant plasmid pET-32a and pET-32a-Lfcin B15-Mag12 synoptic diagram for PCR method, 1 is dna molecular amount standard, 2 for the pET-32a blank is the pcr amplification product of template, and 3 is to contain the pcr amplification product that the pET-32a-LfcinB15-Mag12 bacterium colony is a template;

Fig. 5 is that pET-32a, pET-32a-Lfcin B15-Mag12 transformant expression product SDS-PAGE analyze synoptic diagram, 1 is protein molecular weight standard, 2 is pET-32a transformant expression product, 3 are inductive pET-32a-Lfcin B15-Mag12 transformant abduction delivering product not, and 4 is pET-32a-Lfcin B15-Mag12 transformant abduction delivering product.

(5) embodiment

The present invention is further illustrated below in conjunction with the drawings and specific embodiments:

In conjunction with Fig. 2, the technological line that present embodiment is taked is:

1. directly introduce sticky end at synthetic LfcinB15-Mag12 encoding gene fragment two ends, connect into expression vector pET-32a, construction of expression vector pET-32a-LfcinB15-Mag12;

2. expression vector pET-32a-LfcinB15-Mag12 is transformed expressive host E.coli BL21 (DE3), 0.1mmol/LIPTG, 30 ℃ induce 3h, produce with the expection molecular weight be the special abduction delivering band of 23.9kD;

3. best inductive condition is optimized, under the best inductive condition of determining, had both begun to induce when cell density reaches OD600=0.6,0.3mmol/L IPTG, 30 ℃ induce 4h, and the Expression of Fusion Protein amount accounts for 22% of tropina total amount;

4. reclaim fusion rotein Trx-S-His-LfcinB15-Mag12 through NTA-affinity chromatography column purification, purity reaches more than 95%, induces bacterial cultures only to obtain the 19mg fusion rotein for average every liter;

5. according to enzyme: protein mass is than utilizing enteropeptidase crack fusion protein Trx-S-His-LfcinB15-Mag12 for the ratio of 1:100,23 ℃ of 6h can realize complete cracking, be to obtain purer T1249 LfcinB15-Mag12 after the ultrafiltration pipe ultrafiltration of 5kDa through molecular weight cut-off, induce bacterial cultures to obtain LfcinB15-Mag12200 μ g for average every liter;

6. utilize thin layer plate agarose disk diffusion method to detect the bacteriostatic activity of reorganization T1249 LfcinB15-Mag12.

The specific implementation process of present embodiment:

1, Lfcin B15-Mag 12 genes encodings is synthetic

According to the E.coli codon-bias (as shown in table 1, Grojean etc., 1982; Hale etc., 1998) the active gene fragment of LfcinB1-15 amino acid whose active gene fragment of design coding and Magainin (1-12), be express recombinant LfcinB15-Mag12, utilize expression vector pET-32a to make up recombinant expression vector pET-32a-Lfcin B15-Mag12, before the multiple clone site of pET-32a, there are 6 histidine-tagged codons of coding, therefore in pET-32a-Lfcin B15-Mag12, will encode 27 amino acid whose gene fragment clones of Lfcin B15-Mag12 behind the codon of encoding histidine label, restriction enzyme SalI, between the Nco I recognition site codon.Add terminator codon TAG, TAA simultaneously.

For ease of directly being cloned in the pET-32a that double digestion is handled, directly the sticking tip designs of restriction enzyme site is gone in the LfcinB15-Mag12 gene, promptly add restriction enzyme Sal I, the fragment of Nco I recognition site after enzyme is cut respectively in the upstream and the downstream of Lfcin B15-Mag12 gene.

Divide four sections composition sequences as follows:

Fragment 1:5 '-CATGGCTTTCAAATGCCGCCGTTGGCAGTGGCGTTGGAAAAAACTGGGTGCGGGTA TCG-3 '

Fragment 2:5 '-GTAAATTCCTGCACTCTGCTAAAAAATTC TAGTAAG-3 '

Fragment 3:5 '-TCGAC TTACTAGAATTTTTTAGCAGAGTGCAGGAATTTACCGATACCC GCACCCAGTTT-3 '

Fragment 4:5 '-TTTCCAACGCCACTGCCAACGGCGGCATTTGAAAGC-3 '

Underscore partly is terminator codon TAG, the TAA that adds, and italicized item is restriction restriction endonuclease SalI, Nco I recognition sequence, and rest part is Bovinelactoferrin-magainins T1249 gene.

Table 1 codon is in the frequency of utilization of E.coli

Continuous table 1

	Codon	Frequency of utilization		Codon	Frequency of utilization		Codon	Frequency of utilization
									Arg	AGC	0.00	Tyr	TAT	0.18	Pro	CCG	0.87
Arg	AGA	0.00	Tyr	TAC	0.82	Pro	CCA	0.13
									Ser	AGT	0.00	Leu	TTG	0.00	Pro	CCT	0.00
Ser	AGC	0.17	Leu	TTA	0.00	Pro	CCC	0.00
									Lys	AAG	0.18	Phe	TTT	0.17
Lys	AAA	0.82	Phe	TTC	0.83

1.1, polynucleotide passage 2 and 45 ' end phosphorylation

The polynucleotide passage of chemosynthesis, its 5 ' end is-OH form, carry out just carrying out ligation after phosphorylation is handled, and the T4 polynucleotide kinase is under the condition that ATP exists, γ-phosphate group of ATP can be transferred to 5 ' end of nucleotide fragments, replacement-OH.

Reaction system:

Gene fragment 2 or 4 10 μ L

10 * T4 polynucleotide kinase buffer, 5 μ L

ATP 10μL

T4 polynucleotide kinase 2 μ L (20 unit)

Water 23 μ L

Cumulative volume 50 μ L

37 ℃ of 1h of water-bath, 65 ℃ of 20min deactivation T4 polynucleotide kinase activity.

1.2, polynucleotide passage annealing and being connected

Reaction system

Gene fragment 2 phosphorylation reaction system solutions 10 μ L

Gene fragment 4 phosphorylation reaction system solutions 10 μ L

Gene fragment 15 μ L

Gene fragment 35 μ L

3mol/L NaCl solution 4 μ L

Water 6 μ L

Cumulative volume 40 μ L

95 ℃ of sex change 5min of above-mentioned reaction system reduce to 40 ℃ naturally, keep 2h, add 10 * ligase enzyme damping fluid, 5 μ L, T4DNA ligase enzyme 0.2 μ L (2 unit), H ₂O supplies 50 μ L, and 16 ℃ of connections are spent the night

1.3, the recovery of Lfcin B15-Mag12 encoding gene

1) polynucleotide passage annealing is carried out 2.5% gel electrophoresis with the product that is connected, utilize the Qiagen gel to reclaim test kit and reclaim, carry out according to the test kit operational manual;

2) ultraviolet lamp downcuts the gel piece that contains target DNA fragment down, makes it as much as possible little, puts into the 1.5mL centrifuge tube of weighing in advance;

3) centrifuge tube of gel piece is equipped with in weighing once more, the quality of calculated for gel piece, and the ratio that adds 600 μ L in every 100mg gel piece adds sol solutions, and 50 ℃ of water-bath 10min dissolve the agarose blob of viscose fully, and every 2min mixing is once;

4) ratio that adds 100 μ L in every 100mg gel piece adds Virahol, mixing;

5) coagulant liquid is moved into adsorption column, centrifugal 1min outwells the liquid in the collection tube, adsorption column is put into same collection tube again;

6) add 750 μ L washingss in adsorption column, leave standstill 2min, centrifugal 1min outwells the liquid in the collection tube, and adsorption column is put into same collection tube;

7) centrifugal 1min removes washings as far as possible;

8) adsorption column is put into a clean 1.5mL centrifuge tube, after adsorption film central authorities add 30-50 μ L elutriant, leave standstill 1min, centrifugal 1min, with 1.5mL centrifuge tube (containing DNA) be stored in-20 ℃ standby.

2, the structure of recombinant vectors

2.1, the enzyme of plasmid pET-32a cuts processing

Sal I and Nco I digested plasmid pET-32a reaction system:

Plasmid pET-32a 2 μ g

10×Sal Ibuffer 5μL

Nco I 1 μ L (20 unit)

Sal I 1 μ L (20 unit)

Water 37 μ L

Cumulative volume 50 μ L

37 ℃ of water-bath 3h, 65 ℃ of 20min inactivator activity.

2.2, the purifying of linear plasmid pET-32a reclaims

The enzyme of plasmid pET-32a is cut the processing reaction system carry out 0.8% gel electrophoresis, reclaim linear plasmid pET-32a according to 2.2.1.4 method purifying ,-20 ℃ of preservations are standby.

2.3, the preparation of competence E.coli

1) get stored frozen host bacterium, be seeded to the inclined-plane with transfering loop, bring back to life to cultivate for 2 generations, the single bacterium colony of picking then forwards in the triangular flask of 250mL of the LB substratum that contains 50mL, in 37 ℃ of concussion overnight incubation.

2) get in the 50mL LB substratum that 500 μ L bacterium liquid transfer fresh, when treating that cell density grows to OD600=0.4, bacterium liquid is transferred in aseptic, disposable, the ice-cold 50mL polypropylene tube, placed 10 minutes on ice.

3) 4 ℃ with the centrifugal 10min of 4100 commentaries on classics/min, reclaims cell.

4) pour out nutrient solution, will manage and be inverted 1min, so that last trace nutrient solution flows to end.

5) every 50mL initial incubation liquid 0.1mol/L MgCl of 30mL precooling ₂-CaCl ₂Solution (80mmol/L MgCl ₂, 20mmol/L CaCl ₂) resuspended every part of cell precipitation.

6) 4 ℃ of 4100 centrifugal 10min of commentaries on classics/min reclaims cell.

7) pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.

8) every 50mL initial incubation thing is iced the 0.1mol/L CaCl of precooling with 2mL ₂Resuspended, standby.2.4, Lfcin B15-Mag12 encoding gene is connected with plasmid pET-32a and transform

The linked system of LfcinB encoding gene and plasmid pET-32a

10 * ligase enzyme buffer, 1 μ l

Gene fragment 1 μ l (10ng)

Plasmid pET-32a 2 μ l (100ng)

T4DNA ligase enzyme 0.1 μ L

H ₂O 5.9μL

Cumulative volume 10 μ L

16 ℃ of connections are spent the night, Transformed E .coli BL21 (D E3).

1) uses CaCl with the aseptic suction nozzle of precooling from every part ₂Draw 200 μ L in the competent cell suspension of formulations prepared from solutions and transfer in the aseptic centrifuge tube, every pipe adds DNA (consumption is no more than the volume of 10 μ l, and DNA wherein is less than 50ng), rotates gently with the mixing content, places 30min on ice;

2) pipe is put into the circulator bath of heating in advance, exactly placed 90s, do not shake pipe to 42 ℃;

3) fast pipe is transferred in the ice bath, made cell cooling 2min;

4) every pipe adds 800 μ l SOC substratum, with water-bath substratum is heated to 37 ℃, then pipe is transferred on the shaking table, and 37 ℃ of temperature are bathed 45min, make the antibiotic marker gene of bacteria resuscitation and expression plasmid coding;

5) proper volume (every 90mm flat board reaches 200 μ l) is transferred to the competent cell that transforms contains 20mmol/L MgSO ₄On the LB nutrient agar of 100 μ g/mL acillins;

6) flat board is placed room temperature to liquid be absorbed, be inverted flat board, cultivate 12-16h in 37 ℃.

2.5, the PCR method screening positive clone

The primer:

Primer1：5′-GGG CTG GCA AGC CAC GTT TGG TG-3′，

Primer2：5′-CCG GGA GCT GCA TGT GTC AGA GG-3′，

Reaction system:

10×buffer(Mg ²⁺) 2μL

Primer1 0.4μL

Primer2 0.4μL

dNTP(2.5mmol/L) 0.4μL

Taq DNA polymerase 0.4μL

H ₂O 16.4μL

Cumulative volume 20 μ L

Aseptic toothpick is transferred the positive bacterium colony of picking, in above-mentioned reaction system solution fine rotation for several times, simultaneously with the bacterium colony that does not add bacterium colony, contains pGEX-4T-2 be template respectively as feminine gender, positive control, carry out pcr amplification,

Reaction conditions: 94 ℃ of pre-sex change 5min

72 ℃ are extended 1min

72 ℃ are extended 5min

4℃ 5min

Pcr amplification product detects with 2.5% agarose gel electrophoresis, the further sequence verification of positive colony.

2.6, the SDS alkaline lysis extracts plasmid in a small amount

Principle: alkaline denaturation extracting plasmid DNA is based on chromosomal DNA and reaches with the difference of renaturation with the sex change of plasmid DNA and separate purpose.PH up to 12.6 alkaline condition under, the hydrogen bond rupture of chromosomal DNA, the duplex DNA structure is untied and sex change.Most of hydrogen bond of plasmid DNA also ruptures, but the superhelix covalency closes with two complementary strands of cyclic and not exclusively separates again, when the NaAc high-salt buffer with pH4.8 goes to regulate its pH to neutrality, the plasmid DNA of sex change is recovered original configuration again, be kept in the solution, and chromosomal DNA can not renaturation and forms the reticulated structure of the company of twining, by centrifugal, chromosomal DNA and unsettled macromole RNA, protein-SDS mixture coprecipitation gets off and is removed.

Testing sequence:

1) picking contains single bacterium colony of purpose positive colony, is inoculated into 2mL and contains in the LB nutrient solution of 100 μ g/mL Amp, in 37 ℃ of concussion overnight incubation;

2) get the 1mL culture in the 1.5mL centrifuge tube, in 4 ℃ of centrifugal 30s of maximum speed of revolution, remaining culture is stored in 4 ℃, blot nutrient solution as far as possible after centrifugal with Eppendorf centrifuge;

3) bacterial precipitation is resuspended among the alkaline lysis liquid I of 100 μ L ice precooling concuss;

4) add the new alkaline lysis liquid II that disposes of 200 μ L, in every pipe bacterial suspension, cover the tight mouth of pipe, put upside down centrifuge tube fast 5 times,, be sure not concussion, centrifuge tube is positioned on ice with the mixed content thing;

5) 4 ℃ of centrifugal 5min get supernatant;

6) with the dehydrated alcohol of 2 times of volumes in precipitation at room temperature nucleic acid, concussion mixes, and places 2min in room temperature;

7) 4 ℃ of centrifugal 5min, the nucleic acid of collecting precipitation;

8) careful sucking-off supernatant liquor is inverted in centrifuge tube on the paper handkerchief, drains so that the liquid of all liquid flows out, and removes drop on the tube wall with disposable tip;

9) add 1mL 70% ethanol in precipitation and will cover tight test tube and put upside down for several times, 4 ℃ of centrifugal 2min reclaim DNA, reclaim and precipitate;

10) remove alcohol drop on the tube wall, the test tube of opening is positioned over room temperature makes the alcohol volatilization, exist until in vitro having visible liquid;

11) TE that contains the RNA enzyme A (Pancreatic RNase) (20 μ g/mL) of DNA enzyme with 50 μ L dissolves nucleic acid again, gentle concussion several seconds, is stored in-20 ℃.

3, the optimization of Expression of Fusion Protein and inductive condition

3.1, the IPTG abduction delivering of fusion rotein

1) recombinant plasmid is according to 2.4 method Transformed E .coli BL21 (DE3);

2) will transform bacterium colony and be inoculated in 5mL and contain in the LB substratum of 100 μ g/mL penbritins, and setting-out on LB/ penbritin inclined-plane, the transformed bacteria that inoculation simultaneously contains maternal pET-32a carrier compares.Slant culture is cultivated down after 12 hours in 4 ℃ of preservations based on 37 ℃, and liquid culture then shakes overnight incubation in 37 ℃ of shaking tables;

3) draw the 500 μ L bacterium liquid 50mL that transfers and contain in the LB substratum of 100 μ g/mL penbritins, 37 ℃ of shaking tables are cultured to about OD600=0.6, add 100mmol/L IPTG to final concentration 0.1mmol/L, induce 3 hours for 30 ℃;

4) get 1mL bacterium liquid, 12000 commentaries on classics/min high speed centrifugation 15s abandon supernatant;

5) add the PBS that 100 μ L ice precooling, piping and druming is evenly drawn 5 μ L in the another centrifuge tube, treats that SDS-PAGE analyzes.

3.2, SDS-PAGE analyzes

Principle: biomacromolecule especially protein has different electric charges and molecular weight.After handling through anionic detergent SDS, the electric charge on the protein molecule is neutralized, and when polyacrylamide gel electrophoresis, different protein distributes according to its molecular weight size, and electrophoretic mobility only depends on proteinic molecular weight.Polyacrylamide gel electrophoresis under the effect of catalyzer, forms tridimensional network by acrylamide monomer and methylene diacrylamide.Gel electrophoresis not only has the molecular sieve effect, also has the effect of concentrating.Because discontinuous pH gradient effect, sample is compressed into a stenosis area band, thereby has improved separating effect.Adopt the Xylene Brilliant Cyanine G rapid dyeing, can in time observe the electrophoretic separation effect.

Experimental procedure:

1), is fixed on the electrophoresis chamber with the sheet glass washes clean;

2) press formulated 15% separation gel of table 2, separation gel is injected glass sandwich, top less water front cover keeps the glue face smooth, and after the glue polymerization to be separated, preparation concentrates glue;

Table 2 different concns separation gel prescription

3) press table 3 preparation 5% and concentrate glue, the small amount of moisture of going to the separation gel surface pours into glue then, inserts the point sample comb;

Table 3 5% concentrates the glue prescription

Composition	5mL	8mL	10mL	15mL
					H 2O 30% stock solution 1.5mol/L Tris-HCl/SDS 10% SDS 10% ammonium persulphate TEMED	3.4 0.83 1.25 0.05 0.05 0.005	5.5 1.3 2.0 0.08 0.08 0.008	6.8 1.7 2.5 0.1 0.1 0.01	10.2 2.53 3.75 0.15 0.15 0.015

4) sample preparation: with the protein example of evaluation to be analyzed, add isopyknic 2 * SDS-PAGE sample preparation liquid, 100 ℃ of water-bath 3-5min, ice bath cooling;

5) application of sample: electrophoresis chamber is added electrophoretic buffer, carefully take out the point sample comb, blow and beat well with syringe then.Behind the sample high speed centrifugation, draw analytic sample respectively with micro sample adding appliance, according to protein concentration and well volume decision application of sample amount;

6) the initial low voltage 40V constant voltage electrophoresis of using is treated the tetrabromophenol sulfonphthalein indicator after concentrated glue partial concentration becomes a line, and the 120V electrophoresis treats that the tetrabromophenol sulfonphthalein indicator stops electrophoresis when arriving bottom margin;

7) dyeing: pry open layer glass gently, take out gel, corner cut makes marks, and places Xylene Brilliant Cyanine G R-250 staining fluid, and dyeing is spent the night;

8) destainer decolours totally to background, and band is clear.

3.3, the optimization of inductive condition

3.3.1, the determining of inductor IPTG optimum concn

The conversion bacterium colony is inoculated in 5mL to be contained in the LB substratum of 100 μ g/mL penbritins, shake overnight incubation in 37 ℃ of shaking tables, be equipped with in the 250mL triangular flask of LB substratum that 50mL contains 100 μ g/mL penbritins to 7 and respectively add 500 μ L bacterium liquid, 37 ℃ of shaking tables are cultured to OD ₆₀₀About=0.6, in different triangular flasks, add 100mmol/L IPTG to final concentration be respectively 0.05,0.1,0.2,0.3,0.4,0.5,0.6,0.8,1.0mmol/L, induced 3 hours for 30 ℃; The 5 μ L that take a sample, SDS-PAGE analyzes.

3.3.2, the determining of best induction time

The conversion bacterium colony is inoculated in 5mL to be contained in the LB substratum of 100 μ g/mL penbritins, shake overnight incubation in 37 ℃ of shaking tables, be equipped with in the 250mL triangular flask of LB substratum that 50mL contains 100 μ g/mL penbritins to 5 and respectively add 500 μ L bacterium liquid, treat that cell concentration grows to OD600=0.6 respectively, add 100mmol/L IPTG to final concentration 0.3mmol/L, 30 ℃ induce 0.5,1,3,5 respectively, 7h, the 5 μ L that take a sample, SDS-PAGE analyzes.

3.4, western blot analysis

Principle: through SDS-PAGE isolating protein example, transfer on the solid phase carrier (for example cellulose nitrate film), solid phase carrier is with non covalent bond form adsorbed proteins, and can keep the polypeptide type and the biologic activity thereof of electrophoretic separation constant.With the protein on the solid phase carrier or polypeptide as antigen, play immune response with corresponding antibody, with enzyme or the reaction of isotope-labeled second antibody, colour developing of process substrate or radioautograph are with the protein ingredient of the specific destination gene expression of inspection electrophoretic separation again.The His antibody that this test is adopted is directly coupled horseradish peroxidase, through directly can utilize 3,3 once the step antigen antibody reaction '-diamino aniline carries out color reaction.

3.4.1, proteinic electrotransfer

1) the abduction delivering protein sample is carried out the SDS-PAGE electrophoresis;

2) open transfer box and being placed in the tray, after with transfering buffering liquid sponge pad being soaked into fully, place it on the transfer box wall, put a 3MM Whatman filter paper on the sponge again, place gel, slowly move in gel surface with a test tube or glass stick, with the bubble between venting gel and filter paper;

3) prepare transfer film, by the gel size but pvdf membrane is all cut than the about 1mm of gel in each limit, become 45 degree slowly film to be put into distilled water, water can infilter in the film and moistening whole surface, balance 15min in transfering buffering liquid then;

4) wash gel surface with transfering buffering liquid, directly moistening film is placed on the gel top, the venting bubble;

5) moistening another 3MM Whatman filter paper, and place the anode surface of film, all bubbles of venting are put another piece and have been used the fine and glossy sponge of transfering buffering liquid at the top of filter paper;

6) assemble transfer box, the cellulose membrane side is by anodal, and the glue side with damping fluid, connects power supply by negative pole, and horizontal pressure 100V shifts 1h;

3.4.2, the immunoblotting detection-Western blot of marking protein detects

1) pvdf membrane is put into a plate and added confining liquid (its amount got final product to soak film), seal with 4% skimming milk confining liquid, 37 ℃ of 2h abandon reaction solution;

2) TBST washing film is twice;

3) TBST 1:5000 dilution antibody is put into a plastics bag with film, adds the 0.1mL antibody diluent by every square centimeter, sealing 1h;

4) TBST washes film 2 times, each 5min;

5) TBS washes film 2 times, each 5min;

6) film is put into chromophoric substrate tracing liquid, band occurs in 10-30min, distillation washing film, termination reaction, airing.

4, the purifying of fusion rotein

4.1, the cracking of E.coli

1) will contain the E.coli BL21 (DE3) of positive recombinant pET-32a-Lfcin B15-Ma12, be inoculated in the LB liquid nutrient medium that contains 100 μ g/mL Amp 37 ℃ of shaking table overnight incubation respectively;

2) getting above-mentioned overnight culture 0.5mL respectively is inoculated in fresh LB (the containing 100 μ g/mLAmp) liquid nutrient medium;

3) about 37 ℃ of shaking culture 3h to OD600=0.6, adding 100mmol/L IPTG is 0.3mmol/L to final concentration, 30 ℃ are continued to cultivate 3h;

4) GuNTA-0Buffer (20mM Tris-HCl pH7.9,0.5M NaCl, 10%Glycerol, 6M Guanidium HCl) and the PMSF of adding 1/20 cell growth volume.PMSF is mixed with the 200mM storage liquid with dehydrated alcohol, and-20 degree or 4 degree are preserved; The working concentration position 1mM that PMSF uses; Attention: the PMSF water breakthrough decomposes, and needs to add before use.

5) cell suspension is got up, the ultrasonication cell reduces viscosity on ice.

6) room temperature was placed 30 minutes, or mixing or use magnetic agitation.

7) 15000 rev/mins (20, more than the 000xg), 4 degree are centrifugal more than 15 minutes.Get supernatant, place standby on ice or-20 degree preservations.

4.2, the affinitive layer purification and the wash-out of fusion rotein

1) affinitive layer purification fusion rotein

(1) with the chromatography column (QIAgene) that it is suitable that the NTA resin is packed into, chromatography is washed with the GuNTA-0Buffer of 10 times of NTA volumes.

(2) sample is added in the NTA chromatography column, flow rate control is collected penetrating component about 15mL/ hour, be used for the SDS/PAGE analysing protein in conjunction with situation.

(3) chromatography is washed with the GuNTA-0Buffer of 5 times of NTA volumes, and flow rate control is about 30mL/ hour.

(4) use 5 times of NTA volume GuNTA-20 respectively, GuNTA-40, GuNTA-60, GuNTA-100, the GuNTA-500 wash-out, flow rate control is collected elutriant about 15mL/ hour, and every pipe is collected a NTA volume.

The polyacrylamide gel of (5) 15% concentration carries out SDS-PAGE and detects.

2) NTA regeneration of resin

The NTA resin is after using some number of times (3-5 time), and joint efficiency descends to some extent, can improve the work-ing life and the combination of proteins efficient of resin in order to method regeneration down.All solution that need before the NTA resin regeneration to drain off from the chromatography column lower end estimate the resin volume of NTA, by following order regeneration reagent are added in the chromatography column, after a regeneration solution stream is done on waiting, add next regeneration dissolving again.Need prepare 25%, 50%, 75%, 100% (v/v) ethanol and deionized water voluntarily.

The NTA regeneration step:

(1) all solution that drain off from the chromatography column lower end are washed with the Stripping Solution I of 2 times of NTA resin volumes.

(2) wash with the deionization of 2 times of volumes.

(3) the Stripping Solution II with 3 times of volumes washes.

(4) wash with 25% ethanol of 1 times of volume.

(5) wash with 50% ethanol of 1 times of volume.

(6) wash with 75% ethanol of 1 times of volume.

(7) wash with 100% ethanol of 5 times of volumes.

(8) wash with 75% ethanol of 1 times of volume.

(9) wash with 50% ethanol of 1 times of volume.

(10) wash with 25% ethanol of 1 times of volume.

(11) wash with the deionization of 1 times of volume.

(12) the Stripping Solution III with 5 times of volumes washes.

(13) wash with the deionization of 3 times of volumes.

(14) if use immediately, wash with the Ni Charging Solution of 5 times of volumes, use the balanced solution (NTA-0Buffer or GuNTA-0Buffer) of 10 times of volumes to wash again.

(15) if think standing storage, add 20% ethanol of 1 times of volume, 4 degree are preserved, and need performing step 14 before the use.3) processing of dialysis membrane

(1) wears gloves dialysis membrane is cut into suitable length, soak 15min in the distilled water;

(2) immerse in the 10mmol/L sodium hydrogen carbonate solution, add Hot to 80 ℃, Yi Bian stir 30min at least;

(3) change among the 10mmol/L Na2EDTA and soak 30min, handle three times with quadrat method with fresh EDTA;

(4) wash distilled water 30min with 80 ℃ again, change to then in 20% alcohol, 4 ℃ of preservations are standby.

4.3, the dialysis of eluted protein with concentrate

(1) dialysis tubing is clean with distilled water flushing, the dialysis sackholder clamps an end, and the protein sample of the 5mL wash-out of packing into drains air, and the dialysis sackholder clamps the other end;

(2) put into 500mL distilled water, 4 ℃ of dialysis of magnetic stirrer 1h;

(3) the His-Lfcin B15-Mag12 of wash-out puts into 500mL PBS, 4 ℃ of dialysis of magnetic stirrer 4h;

(4) change fresh damping fluid, continue dialysis 4h;

(5) dialysis tubing is put into small beaker, be embedded among the Sephadex G-200,4 ℃ are concentrated into proper volume;

(6) sampling 5 μ L carry out SDS-PAGE, assay determination purity of protein and affinity chromatography effect.

4.3.1, the Bradford method measures protein concentration

Principle: Xylene Brilliant Cyanine G G-250 is a kind of protein dye, is red-brown under acidic conditions, when its contained hydrophobic group with after protein combines by hydrophobic interaction, become blueness, this blueness and protein concn are proportional.Protein is with after Xylene Brilliant Cyanine G G-250 combines, and optical absorption peak is transferred to 595nm by 465nm.It is not only highly sensitive that this method is measured protein concn, and the concentration range of measuring is also wider, practical and convenient.It is 10 μ g/mL-1.0mg/mL that this law can be measured the protein scope.(1) making of typical curve:

1. get 4 μ L BSA protein standard substances and add PBS and be diluted to 100 μ L, making its final concentration is 200 μ g/mL;

2. the standard substance of getting after this dilution are added to respectively in the 96 hole enzyme plate sample wells by 1,2,4,6,8,10,15 μ L,

Add PBS and supply 20 μ L, every porin content is respectively 0,0.2,0.4,0.8,1.2,1.6,2.0,3.0 μ g,

3. each hole adds 200 μ L Bradford reagent, and muddy even, room temperature is placed 5min,

4. measure the light absorption value of A595 with the microplate reader of preheating, the drawing standard curve.

(2) mensuration of eluted protein concentration:

1. when configuration is used for production standard curve sample, get in the eluted protein His-Lfcin B15-Mag1296 hole enzyme plate sample well of proper volume, add PBS and add PBS and supply 20 μ L,

2. each hole adds 200 μ L Bradford reagent, and muddy even, room temperature is placed 5min,

3. measure the light absorption value of A595 with the microplate reader of preheating, according to typical curve, the protein concentration in the calculation sample.

5, the purifying of the cracking of fusion rotein and LfcinB15-Mag12

5.1, enteropeptidase crack fusion protein Trx-S-His-Lfcin B15-Mag12

Add 1.5 μ gEnterokinase among the 100 μ L1mg/mL fusion rotein Lfcin B15-Mag12, add 10 * damping fluid, 10 μ L, 23 ℃ of temperature are bathed reaction, at the 6h 5 μ L that take a sample, with 5 μ L, 2 * Tricine-SDS sample buffer mixing,-20 ℃ freezing, treats that urea-Tricine-SDS-PAGE analyzes.

5.2, ultrafiltration process purifying Lfcin B15-Mag12

1) utilize Enterokinase according to operation instruction crack fusion protein Trx-S-His-Lfcin B15-Mag12,22 ℃ of temperature are bathed 6h;

2) above-mentioned reaction solution is packed into molecular weight cut-off is in the ultrafiltration pipe of 5kDa, 12000 commentaries on classics/min4 ℃ of centrifugal 30min;

3) sampling is measured protein concentration according to 4.3.1;

4) collect filtered solution ,-20 ℃ of preservations are standby.

5.3, urea-Tricine-SDS-PAGE analyzes

Table 4 urea-Tricine-SDS-PAGE gel formula

	Separation gel	Interval glue	Concentrate glue
				49.5% (C=6%) gel storage liquid (mL)	3.3	-	-
49.5% (C=3%) gel storage liquid (mL)	-	0.60	0.45
				Gel buffer liquid (pH8.5) (mL)	3.3	1.0	1.4
Urea (g)	3.6	-	-
				H 2O	1.0	1.40	1.9
10％APS(μL)	45	20	37.5
				TEMED(μL)	4.5	20	3.75

1) press table 4 recipe configuration gel, collocation method and step are with 3.2;

2) add isopyknic 2 * Trincine sample buffer in sample, boiling water boils 5min, and cooling back high speed centrifugation carries out electrophoresis with reference to 3.2;

3) Xylene Brilliant Cyanine G R-250 dyeing, 42 ℃ of 1h, destainer decolour to background clear (Schagger and von Jagow, 1987; Strom etc., 1992,1993)

6, the activity identification of LfcinB15-Mag12

1) the streptococcus aureus S.aureas ATCC25923 that the inclined-plane is preserved is inoculated in the 5mL LB substratum 37 ℃ of shaking table overnight incubation;

2) get among the 50mL LB that culture 0.5mL transfers fresh, 37 ℃ are continued to cultivate 2.5h to logarithmic growth mid-term;

3) get 5mL bacterium liquid, 4 ℃ of 4100 centrifugal 10min of commentaries on classics/min collects thalline;

4) the resuspended thalline of PBS, 4 ℃ of 4100 centrifugal 10min of commentaries on classics/min collects thalline;

5) add the resuspended thalline of PBS, adjust about OD620 to 0.2, this moment, bacterial concentration was about 5 * 107CFU/mL;

6) be ready to 42 ℃ the low melting-point agarose LB substratum of sterilizing in advance, in this substratum of 10mL, add get above-mentioned bacterium liquid 50 μ L (contain 2.5 * 106CFU,, mixing gently immediately, to going in 90mm * 15mm flat board, this moment, slab-thickness was about 1mm;

7) treat culture medium solidifying after, be that 2 of the aseptic filter paper sheets of 3mm soak into Lfcin B15-Mag12 solution and are affixed on the flat board with diameter, 1 soaks into PBS in contrast;

8) flat board is faced up 37 ℃ cultivate 1h after, be inverted to continue cultivate 18h, observe fungistatic effect.

7, the purifying of the phosphorylation of polynucleotide, annealing, connection and encoding gene

Adopt solid-phase synthesis synthetic polynucleotide its 3 ' hold to be OH-form, annealing be connected before, earlier make its phosphorylation through the effect of T4 polynucleotide kinase, annealing back fragment 1 and 2, fragment 3 are connected through the T4DNA ligase enzyme with 4 breach, form the gene fragment of complete coding Lfcin B15-Mag12, be 95bp, after 2.5% gel electrophoresis, purification kit reclaim, obtain the gene fragment (shown among Fig. 3 2) of purifying respectively.

8, PCR screening recombinant expression vector

5 of pET-32a ' and 3 ' universal sequencing primer thing respectively with the 57U20 of pET-32a, the base complementrity of 327L20, with this sequencing primer is screened recombinant plasmid, after 2.5% gel electrophoresis, as shown in Figure 4, positive control, be that the PCR product of template is the DNA band of 270bp promptly, and positive recombinant plasmid pET-32a-Lfcin B15-Mag12 amplified production is respectively the DNA band about 370bp, illustrates to have connected into the purpose fragment in recombinant plasmid with the bacterium colony that contains plasmid pET-32a.

9, the optimization of Expression of Fusion Protein and inductive condition

9.1, the preliminary abduction delivering SDS-PAGE of pET-32a-Lfcin B15-Mag12 analyzes

Identify with SDS-PAGE, pET-32a-Lfcin B15-Mag12 transformant produces a protein band that about 24kDa is special respectively as a result, consistent with expection albumen (20.4+3.57KD) size, induce the non-reorganization pET-32a transformant of the feminine gender contrast of 3h to produce the 20.4KD band, (shown in Figure 5) do not occur and have the special band of inducing without the culture samples of IPTG inductive plasmid bacterium.

10, conclusion

1. the present invention adopts the method for synthetic according to the e. coli codon preferences, has designed, synthesized the encoding gene of antibacterial peptide LfcinB15-mag12 first

2. the encoding gene that will synthesize LfcinB15-mag12 connects into expression vector pET-32a, construction of expression vector pET-32a-LfcinB15-mag12, with E.coli BL (DE3) is expressive host, induce through IPTG, show that through western blot analysis molecular weight is that the band of inducing of 24kDa is the TRX fusion rotein, prove that fusion rotein Trx-S-His-LfcinB15-Mag12 successfully obtains to express, under the best inductive condition of determining, the Expression of Fusion Protein amount accounts for 22% of tropina total amount.

3. reclaim fusion rotein through the affinity chromatography column purification, purity is higher, reach more than 95%, but output is lower, induces bacterial cultures only to obtain the 19mg fusion rotein for average every liter.

4. fusion rotein Trx-S-His-LfcinB15-Mag12 is after the Enterokinase effect, obtain having the recombinant antibacterial peptide LfcinB15-Mag12 of bacteriostatic activity, successfully realized the heterogenous expression of T1249 LfcinB15-Mag12 first, induce bacterial cultures to obtain LfcinB15-Mag12 200 μ g for average every liter, for gene engineering method is produced T1249 LfcinB15-Mag12 and other valuable peptide class has been established the theory and practice basis, significant to the common technology of setting up the research of peptide genoid engineering bacteria and antibacterial peptide.

Sequence table

The active gene fragment of B1-15 amino acid whose active gene fragment of coding Lfcin and Magainin (1-12) is express recombinant Lfcin B15-Mag12

Normal chain:

CATG, TCGA are sticky end, are synthetic F1 in expanding number, and TAGTAA is a terminator codon.Red sequence is LfcinB.

Anti-chain:

One section aminoacid sequence of coding is: LfcinB (1-15) and Magainin (1-12)

Claims (3)

1, a kind of synthetic method of LfcinB15-Mag12 encoding gene, it is characterized in that: according to the active gene fragment of B1-15 amino acid whose active gene fragment of E.coli codon-bias design coding Lfcin and Magainin (1-12), utilize expression vector pET-32a to make up recombinant expression vector pET-32a-Lfcin B15-Mag12, before the multiple clone site of pET-32a, there are 6 histidine-tagged codons of coding, in pET-32a-Lfcin B15-Mag12, to encode a Lfcin B15-Mag1227 amino acid whose gene fragment clone behind the codon of encoding histidine label, restriction enzyme Sal I, between the Nco I recognition site codon, add terminator codon TAG simultaneously, TAA

Divide four sections composition sequences as follows:

Fragment 1:5 '-CATGGCTTTCAAATGCCGCCGTTGGCAGTGGCGTTGGAAAAAACTGGGTGCGGGTA TCG-3 '

Fragment 2:5 '-GTAAATTCCTGCACTCTGCTAAAAAATTC TAGTAAG-3 '

Fragment 3:5 '-TCGAC TTACTAGAATTTTTTAGCAGAGTGCAGGAATTTACCGATACCC GCACCCAGTTT-3 '

Fragment 4:5 '-TTTCCAACGCCACTGCCAACGGCGGCATTTGAAAGC-3 '

Underscore partly is terminator codon TAG, the TAA that adds, and italicized item is restriction restriction endonuclease SalI, Nco I recognition sequence, and rest part is Bovinelactoferrin-magainins T1249 gene.

2, the synthetic method of LfcinB15-Mag12 encoding gene according to claim 1, it is characterized in that: described directly being cloned in the pET-32a process that double digestion is handled, directly the sticking tip designs of restriction enzyme site is gone in the Lfcin B15-Mag12 gene, promptly add restriction enzyme Sal I, the fragment of Nco I recognition site after enzyme is cut respectively in the upstream and the downstream of Lfcin B15-Mag12 gene.

3, LfcinB15-Mag12 encoding gene according to claim 1 is characterized in that in the method for expression in escherichia coli:

(1) directly introduces sticky end at synthetic LfcinB15-Mag12 encoding gene fragment two ends, connect into expression vector pET-32a, construction of expression vector pET-32a-LfcinB15-Mag12;

(2) expression vector pET-32a-LfcinB15-Mag12 is transformed expressive host E.coliBL21 (DE3), 0.1mmol/LIPTG, 30 ℃ induce 3h, produce with the expection molecular weight be the special abduction delivering band of 23.9kD;

(3) best inductive condition is optimized, under the best inductive condition of determining, had both begun to induce when cell density reaches OD600=0.6,0.3mmol/L IPTG, 30 ℃ induce 4h, and the Expression of Fusion Protein amount accounts for 22% of tropina total amount;

(4) reclaim fusion rotein Trx-S-His-LfcinB15-Mag12 through NTA-affinity chromatography column purification, purity reaches more than 95%, induces bacterial cultures only to obtain the 19mg fusion rotein for average every liter;

(5) according to enzyme: protein mass is than utilizing enteropeptidase crack fusion protein Trx-S-His-LfcinB15-Mag12 for the ratio of 1:100,23 ℃ of 6h can realize complete cracking, be to obtain purer T1249 LfcinB15-Mag12 after the ultrafiltration pipe ultrafiltration of 5kDa through molecular weight cut-off, induce bacterial cultures to obtain LfcinB15-Mag12 200 μ g for average every liter;

(6) utilize thin layer plate agarose disk diffusion method to detect the bacteriostatic activity of reorganization T1249 LfcinB15-Mag12.

Images