CN105950629A

CN105950629A - Prokaryotic expression vector culture method and method for preparing antiserum through prokaryotic expression vector

Info

Publication number: CN105950629A
Application number: CN201610401830.4A
Authority: CN
Inventors: 李玉兰; 何军邀; 杨仙玉; 岳继萍
Original assignee: Zhejiang Medical College
Current assignee: Zhejiang A&F University ZAFU
Priority date: 2016-06-07
Filing date: 2016-06-07
Publication date: 2016-09-21

Abstract

The invention relates to a prokaryotic expression vector culture method and a method for preparing an antiserum through a prokaryotic expression vector, and belongs to the technical field of mutation or genetic engineering. Codon optimization and synthesis are carried out on ORF sequences of PPDPF of the human and a toad through preference and rejection codons of escherichia coli, and PPDPF recombinant plasmids of the human and the toad after replacement are obtained; the recombinant plasmids are transferred into escherichia coli competent cells; an LD fluid nutrient medium with Lan added is inoculated with selected single colonies, and a bacterial solution is cultured; the sterilized LB culture solution is inoculated with the bacteria solution according to the ratio of 1%, shake culture is carried out at the temperature of 37 DEG C and the rotating speed of 260 rpm till the OD600 value reaches 0.7-1, inductive agents IPTG with different concentrations are added according to the ratio of 1/1000, and expression of two kinds of recombinant protein is induced. The methods are applied to prokaryotic expression vector and antiserum indexes, and has the advantage that site-specific mutagenesis can be achieved.

Description

The cultivation of a kind of prokaryotic expression carrier and sero-fast preparation method thereof

Technical field

The present invention relates to the cultivation of a kind of prokaryotic expression carrier and sero-fast preparation method thereof, belong to sudden change or heredity work Journey technical field.

Background technology

PPDPF is likely to have close ties with multiple disease especially malignant tumor, is including cancer of pancreas, hepatocarcinoma and kidney Cancer is all increased significantly at interior kinds cancer expression in the patient, therefore continues deeper into research PPDPF and seems necessary.

Inspection information shows, there is presently no the research report about PPDPF prokaryotic expression；The most most important Genes of interest is all at expression in escherichia coli.But the most still there is many shortcomings being difficult to and overcoming in prokaryotic expression system: as Cannot regulating and expressing time and level, host cell may be poisoned, expression product hypoactivity, inclusion body formula are expressed and are difficult to Destination protein purification etc., therefore, how keeping containing only specific cleavage site in genetic fragment does not the most disclose, and how to carry out Gene for the purpose of rite-directed mutagenesis and guarantee insertion vector fragment, is that the application to solve the technical problem that.

Based on this, make the application.

Summary of the invention

In order to overcome the drawbacks described above existing for existing prokaryotic expression, first the application provides a kind of rite-directed mutagenesis to ensure The cultural method of the prokaryotic expression carrier of gene for the purpose of the fragment of insertion vector.

For achieving the above object, the technical scheme that the application takes is as follows:

The cultural method of a kind of prokaryotic expression carrier, is specifically divided into following steps:

(1) structure of prokaryotic expression carrier: with the codon difference of " preference " and " repulsion " of escherichia coli (E.coli) The ORF sequence of people (human) and Bufo siccus (Bufo gargarizans) PPDPF is carried out codon optimized, to optimization After ORF sequence synthesize, and be connected to expression vector pET-28b (+) on, obtain respectively codon optimized after people and toad The PPDPF recombiant plasmid of bufonid toad；

(2) abduction delivering of recombiant protein:

1. recon converts: convert the pET-28b-PPDPF of Bufo and people to competent escherichia coli cell respectively In BL21, rear 37 DEG C of incubated overnight of ruling, within second day, obtain a large amount of single bacterium colony, take out when size to fit, can temporarily put 8 DEG C of ice Case preserves and uses in the recent period.

2. cultivate before: cultivating before induction expression of recombinant proteins preparation evening before that day, picking list colony inoculation is in 2mL Add 2 μ L (50mg mL^-1) Kanamycin (Kan) LB fluid medium in, 37 DEG C overnight concussion (220rpm) cultivate.

The biggest cultivation: two kinds of bacterium solution of front cultivation were connect, by 1%, the LB cultivation that bacterium crosses in autoclave sterilization the same day by induction Liquid (adds Kan to final concentration 50 μ g mL in advance^-1In), 260rpm cultivates in 37 DEG C of concussions, about starts during 1h to use ultraviolet spectrometry Luminosity measures its OD value, to OD₆₀₀When value reaches 0.7-1, taking out a part of bacterium solution as a control group, remaining bacterium solution is divided into four Group, the ratio in 1/1000 adds derivant IPTG (0.001,0.01,0.1, the 1mol L of variable concentrations^-1), by all bacterium solution Put back to 37 DEG C of 260rpm in constant incubator again and cultivate 1-4h, the expression of two kinds of recombiant proteins of induction.

Meanwhile, present invention also provides and a kind of use above-mentioned carrier to carry out method prepared by antiserum,

Prokaryotic expression vector construction refers to carry out genes of interest with carrying exogenous nucleic acid sequences entrance prokaryotic cell Genes of interest fragment is imported the process of carrier through ligase after carrying out double digestion respectively by the carrier expressed.Must protect during this Card genes of interest fragment comprises only single specific cleavage site, otherwise needs to carry out rite-directed mutagenesis in advance and carry to ensure to insert Total length ORF of gene for the purpose of the fragment of body.

Prokaryotic expression system refers to the carrier (usually plasmid) inserting genes of interest DNA fragmentation is transformed into antibacterial After (usually escherichia coli), expressed and destination protein needed for purification by IPTG induction destination protein, and then probe into purpose egg White relevant nature and biological function.The method is simple to operate, the expression cycle is short, expressing quantity is high and cost also compares Low, there is multiple advantage, be therefore to use a kind of widest vivoexpression method at present.But prokaryotic expression system is the most still deposited In many shortcomings being difficult to and overcoming: as cannot regulating and expressing time and level, may to poison host cell, expression product activity low Under, inclusion body formula express be difficult to destination protein purification etc..Therefore, PPDPF is built carrier for expression of eukaryon, and attempts carefully Study its mechanism of action in born of the same parents' level and seem necessary.

The present invention is by optimizing Bufo siccus PPDPF and people's PPDPF ORF partial password, and then synthesis is the most successful Build Bufo siccus pET-28b-PPDPF and people's pET-28b-PPDPF prokaryotic expression carrier, and thin at E. coli competent Through probing into, successful expression in born of the same parents BL21, finds that two kinds of recombiant proteins optimal inductive condition at 37 DEG C is: IPTG concentration is 0.1mmol·L^-1Induction time is 4h.Western botting testing result shows that the band of only this overexpression can be resisted His-tag antibody recognition, shows that this albumen is destination protein PPDPF.

The application utilizes escherichia coli as the prokaryotic expression cell of PPDPF albumen, carries out the external table of this recombiant protein Reach, establish experiment basis for the follow-up great expression purification carrying out recombiant protein further and the sero-fast preparation of mouse-anti PPDPF. The main flow of prokaryotic expression system technology used be the ORF of the genes of interest that early stage is cloned into carry out codon optimized also Synthesis, is then connected into expression vector and forms recombiant plasmid, then replicate in being conducted into certain prokaryotic cell by conversion and expand Increasing, add derivant when reaching exponential phase and make destination protein be expressed, the method has studies deep, condition of culture Simply, genetic manipulation is easily, from being building up to, the product purification cycle is short, low cost, yield high, be prone to the plurality of advantages such as scale.

Accompanying drawing explanation

Fig. 1 be expression vector pET-28b (+) collection of illustrative plates；

Fig. 2 is the abduction delivering of Bufo siccus PPDPF；

Fig. 3 behaves the abduction delivering of PPDPF；

In Fig. 2 and Fig. 3, M: standard protein；1: non-induced samples；2-4,5-7,8-10,11-13 are respectively IPTG concentration 0.001、0.01、0.1、1mmol·L^-1；2,3,4: induction 2,3,4h time sample；The same 2-4 of 5-7,8-10,11-13；

Fig. 4 is Bufo siccus PPDPF and the detection of people's PPDPF recombiant protein solubility；

Wherein, M: standard protein；1,5: do not add IPTG sample；2,6: full bacterium after induction；3,7: on after induction cellular lysate Clearly；4,8: induction cellular lysate postprecipitation；

Fig. 5 is the Western blotting detection of Bufo siccus PPDPF recombiant protein；

The Western blotting detection of the PPDPF recombiant protein that Fig. 6 behaves；

In Fig. 5 and Fig. 6, M: standard protein；1,2: the sample of coomassie brilliant blue staining；3,4:Western blotting samples Product；The sample of 1,3: unused IPTG induction；The sample of 2,4:IPTG induction 4h；

Fig. 7 is Bufo siccus PPDPF recombinant protein purification result；

Fig. 8 behaves PPDPF recombinant protein purification result；

In Fig. 7 and Fig. 8, M: standard protein；1: last percolation liquid；2-6:5 cleaning mixture sample；7-11:5 eluting The sample of liquid purification；12: supernatant after cellular lysate；13: inclusion body precipitation after cellular lysate；

Fig. 9 is Bufo siccus PPDPF and people's PPDPF recombiant protein cuts glue purification result；

In Fig. 9, M: standard protein；1,6: non-induced samples；2,7:IPTG induces full bacterium sample；3,8: induction cellular lysate Rear supernatant；4,9: inclusion body precipitation after induction cellular lysate；5,10: preliminary purification albumen is cut glue purification sample；

Figure 10 is mouse-anti Bufo siccus PPDPF antiserum specific detection；

Figure 11 is mouse-anti people's PPDPF antiserum specific detection；

In Figure 10 and Figure 11, M: standard protein；1-5: coomassie brilliant blue staining sample；6-10:western blotting Sample；1,6: non-induced samples；2,7:IPTG induces full bacterium sample；3,8: supernatant after induction cellular lysate；4,9: induction thalline Inclusion body precipitation after cracking；5,10: cut the restructuring PPPDF after glue purification.

Detailed description of the invention

1 experiment material and reagent

1.1 major experimental instruments

Bio-Rad electrophresis apparatus, protein Vertial electrophorestic tank are purchased from Shanghai Bole life medical product company limited；Transfer electricity Swimming groove is purchased from Shanghai Tian Neng Science and Technology Ltd.；Ultraviolet spectrophotometer is purchased from Shanghai Spectrum Apparatus Co., Ltd..

1.2 main material reagent

Experiment reagent: ECL luminescence reagent box is purchased from Beijing Bo Aolong Immune Technology Corp..

1.3 main solution preparations

1.3.1SDS-the preparation of polyacrylamide gel electrophoresis (SDS-PAGE) related solution

(1) 30% polyacrylamide (30%AA): claim acrylamide (Acrylamide) 29g and N, N-methylene propylene phthalein Amine lg adds about 80mL ddH₂In O, stir to fully dissolving, move to graduated cylinder, then add deionized water (ddH₂O) it is settled to 100mL, 4 DEG C keep in Dark Place standby.

(2) 10% Ammonium persulfate .s (APS): claim 0.2g Ammonium persulfate. to be dissolved in 2mL ddH₂In O ,-20 DEG C of preservations.

(3)1.5mol·L^-1Tris-HCl (pH8.8): claim Tris 181.7g to be dissolved in about 800mL ddH₂In O, dropping 5mol·L^-1Hydrochloric acid adjusts pH value to after 8.8, adds deionized water and is settled to 1000mL, room temperature preservation.

(4)1.0mol·L^-1Tris-HCl (pH6.8, pH7.6): claim Tris 121.1g to be dissolved in about 800mL ddH₂In O, Dropping 5mol L^-1Hydrochloric acid adjusts pH value to 6.8 (or 7.6), adds (ddH₂O) it is settled to 1000mL, room temperature preservation.

(5) 15%SDS polyacrylamide (separation gel, 10mL): add 30% acrylamide in small beaker successively (Acrylamide) solution 5mL (starting stirring), ddH₂O 2.3mL, 1.5mol L^-1Tris-Cl (pH8.8) 2.5mL, 10% SDS 0.lmL, 10%APS 0.l mL, TEMED 0.004mL, encapsulating immediately after stirring.

(6 5%SDS polyacrylamides (concentrate glue, 4mL): add 30% propylene phthalein amine aqueous solution in small beaker successively 0.67mL (starts stirring), ddH₂O 2.7mL, 1mol L^-1Tris (pH6.8) 0.5mL, 10%SDS0.04mL, 10%APS 0.04mL, TEMED 0.004mL, encapsulating immediately after stirring.

(7) 5 × SDS protein electrophorese sample-loading buffers: add 1mol L^-1Tris (pH6.8) 1.25mL in 10mL plastics from In heart pipe, claim bromophenol blue 0.025g, SDS 0.5g to add and fully dissolve, add glycerol 2.5mL, finally add ddH₂O is settled to 5mL (500 μ L/ part subpackages use first every part to add 25 μ L beta-mercaptoethanols).

(8) 5 × Tris-glycine electrophoresis (SDS-PAGE) buffer: claim Tris alkali 15.1g, glycine (Glycine) 94g, SDS 5.0g adds about 600mL ddH₂After O fully dissolves, add deionized water and be settled to 1000mL, room temperature preservation.

(9) preparation of coomassie brilliant blue staining liquid: claim 0.25g Coomassie brilliant blue (Commassise blue, R250) to be dissolved in The mixed liquor of 90ml first alcohol and water (1:1), adds 10mL glacial acetic acid, and after being filtered to remove particulate matter, room temperature preserves.

1.3.2 the preparation of immunoblotting (Western blotting) related solution

(1) film transfering buffering liquid: claim glycine 2.9g, Tris 5.8g, SDS 0.37g to add about 600mL ddH₂O fills After dividing stirring and dissolving, add ddH₂O is settled to 800mL, adds methanol reverse mixing, the room temperature preservation gently of 200mL.

(2) TBST buffer: claim NaCl 8.8g in 800mL ddH₂O dissolves, adds 1.0mol L^-1Tris-HCl (pH7.6) 20mL, add 0.5mL Tween 20 be sufficiently stirred for mixing after, use ddH₂O is settled to 1L, and 4 DEG C save backup.

(3) Block buffer: defatted milk powder 5g joins in the TBST buffer of 100mL, is sufficiently stirred for dissolving, 4 DEG C of guarantors Deposit standby.

2 experimental techniques

The structure of 2.1 prokaryotic expression carriers

Prokaryotic expression carrier because using traditional method to build can not be in selected prokaryotic expression place after connecting PPDPF Expressing smoothly in main bacterial strain E.coli, this laboratory attempts the codon for E.coli " preference " and " repulsion " to Bufo siccus The ORF sequence of PPDPF is optimized (before and after ensureing to optimize, its coded aminoacid sequence is completely the same), reduces E.coli pair The repulsion degree of PPDPF, makes the albumen of this gene code can pass through E.coli and expresses；For studying PPDPF the most further With the relation of people, download the ORF sequence of people (Human) PPDPF from ncbi database, and by same method to people PPDPF ORF carried out codon optimized.

ORF sequence after codon optimized entrusts Jin Weizhi bio tech ltd, Suzhou to synthesize, and is connected to Expression vector pET-28b (+) on, obtain the PPDPF recombiant plasmid pET-28b-PPDPF-of Bufo and Human after replacing respectively Bufo and pET-28b-PPDPF-Human.

The abduction delivering of 2.2 recombiant proteins

2.2.1 recon converts

Respectively the pET-28b-PPDPF of Bufo and Human is converted to E.coli competent cell BL21, after line 37 DEG C incubated overnight, obtains a large amount of single bacterium colony for second day, takes out, can temporarily put 8 DEG C of Refrigerator stores and use in the recent period when size to fit.

2.2.2 cultivate before

Cultivating before induction expression of recombinant proteins preparation evening before that day, picking list colony inoculation has added 2 μ L in 2mL (50mg·mL^-1) Kanamycin LB fluid medium in, 37 DEG C overnight concussion (220rpm) cultivate.The biggest cultivation

Two kinds of bacterium solution of front cultivation were connect, by 1%, the LB culture fluid that bacterium crosses in autoclave sterilization and (add in advance the same day by induction Enter Kan to final concentration 50 μ g mL^-1In), 260rpm cultivates in 37 DEG C of concussions, about starts during 1h to survey it with ultraviolet spectrophotometer OD value, to OD₆₀₀When reaching 0.7-1, taking out a part of bacterium solution as a control group, remaining bacterium solution is divided into four groups, by 1/1000 Ratio adds derivant IPTG (the 0.001,0.01,0.1,1mol L of variable concentrations^-1), all bacterium solution are put back to again constant temperature training Support 37 DEG C of 260rpm in case and cultivate 1-4h, the expression of two kinds of recombiant proteins of induction.

Incubation time be 2,3,4h time take each sample 1mL respectively and be centrifuged, 13 200rpm are centrifuged 1min, thoroughly go After supernatant, thalline is dissolved in the protein sample-loading buffer of 100 μ L, arises from dry thermostat together with Protein Marker mono- In 100 DEG C process 5min, be immediately placed in cooled on ice after taking-up, finally all samples is taken respectively 5 μ L carry out SDS-PAGE electricity Swimming, detection Bufo siccus PPDPF and the abduction delivering situation of two kinds of recombiant proteins of people PPDPF.

2.2.4SDS-PAGE electrophoresis

1.SDS-PAGE running gel makes:

(1) by two pieces of glass plate overlap lower end alignment of thickness, it is ensured that there is encapsulating gap between glass plate, solid on glue folder After fixed, entirety installs to fixing (being lined with rubber strip) on gum-making rack.

(2) according to the formula (destination protein molecular weight selects the glue of high concentration to carry out electrophoresis) point of 15% separation gel Each composition is not added in small beaker (note: use pH8.8 concentration 1.5mol L^-1Tris-HCl), be eventually adding 10% After APS and TEMED, it is ensured that fully mix with on magnetic stirring apparatus.

(3) pouring between two glass plates by glue rapidly, Altitude control is about the 2/3 of glass plate, remainder ddH₂O Filling up, room temperature stands.(H after separation gel condenses₂An obvious cut-off rule is there will be between O and glue), the most use up two DdH between plate₂O。

(4) according to the formula concentrating glue, respectively each composition is joined (note: use pH6.8 concentration in small beaker 1.0mol·L^-1Tris-HCl), fully mix after adding 10%APS and TEMED equally, pour into rapidly between two glass to full Till.

(5) inserting hole count and sizeable comb, room temperature stands glue to be concentrated and fully condenses.

The expression of two kinds of albumen of 2.SDS-PAGE electrophoresis detection

(1) the most vertically extract SDS-PAGE comb, use ddH₂O cleans glue hole, it is ensured that loading hole without too much foam or Any other foreign body, installs to glass plate, on electrophoresis frame, use ddH₂O hunts leak.

(2) between electrophoresis frame, addition 1 × SDS-PAGE electrophoresis liquid, to filling it up with, takes the sample (100 that 5 μ L handle well DEG C boil 5min) loading respectively, upper excellent electrophoresis frame is carefully moved in electrophoresis tank, supplements electrophoresis liquid to about 2/ to electrophoresis tank 3.Using constant current electrophoresis, arrange size of current with every piece of glue for 10mA standard, it is multiplicable that sample enters separation gel after current.

(3) after electrophoresis terminates, taking out glue in order, simple flushing rear cutout (for avoiding polylith glue to obscure, can be fitted except concentration glue When corner cut is to show difference), separation gel is put in staining dish and uses ddH₂O cleans 2-3 time, each 5min.Add in advance after Xi Jinging The coomassie brilliant blue staining liquid configured, microwave-oven-heating scalds to micro-, gently vibration dyeing 0.5h.

(4) reclaim dyeing liquor (repeatable utilization), add tap water after simple flushing and scald to the most micro-in microwave-oven-heating, shake gently Swing decolouring 20min, change water two to three times repeat the above steps afterwards until background color substantially transparent, observe recombiant protein table Reach situation, and necessary data is preserved and backs up.

2.2.5 the solubility detection of recombiant protein

Through above-mentioned experiment, find that two kinds of albumen all can be expressed smoothly at E.coli, and at derivant IPTG working concentration For 0.1mmol L^-1, when induction time is 4h, expression is the highest, therefore continue to this albumen carry out the further detection of character Necessary.

(1) 1mL is taken respectively through IPTG (final concentration 1mmol L^-1) induction 3h bacterium solution add known weight 1.5ml from Heart pipe, 13 200rpm are centrifuged 1min, remove supernatant, again weigh centrifuge tube weight, draw thalline weight.

(2) adding X-tractor lysate in the corresponding 20 μ L ratios of 1 μ g thalline, fully suspend thalline.Add DNase I about 0.1 μ L avoids solution thickness occur, another addition a certain amount of lysozyme (final concentration of 1mg mL^-1), room temperature places 10min, often 2min turns upside down once.4 DEG C of 13 200rpm is centrifuged 20min.

(3) take supernatant in another centrifuge tube (as Supernatant samples retain detection with), then add in centrifuge tube with The ddH of X-Tractor equivalent₂O, fully suspends precipitation.

(4) taking each 10 μ L of cleer and peaceful precipitation suspension, add 5 × SDS sample-loading buffer of 2.5 μ L, 100 DEG C process 5min After be immediately placed on ice.

(5) take what 5 μ L processed sample and carry out SDS-PAGE electrophoresis detection recombiant protein water solublity.

2.2.6 immunoblotting (Western blotting) detection

(1) SDS-PAGE electrophoresis: about same glue, adds two groups of identical samples, and the left side contaminates for Coomassie brilliant blue Color (examines dye), and the right is used for transferring film, and the sample applied sample amount for transferring film can be examine dye 1/5.

(2) transferring film: SDS-PAGE electrophoresis terminates rear cutout glue, cuts the shape identical PVDF of complete size by blob of viscose size Film and slightly larger filter paper (every piece glue consumption 6), pvdf membrane methanol soaks sponge, pvdf membrane, glue and filter paper after 5-10min Put into together in transfer buffer and soak 15min.It is sequentially placed sponge-filter paper 3 (i.e. by black-red) according to from negative pole to positive pole The order of layer-glue-3 layers-sponge of pvdf membrane-filter paper assembles " sandwich " clamping plate, and guarantees to engage between glue and film closely without appointing What bubble (otherwise can have a strong impact on transferring effect), puts into after assembling in transfer groove and fills it up with transfer buffer, and constant-pressure conditions is used 65V transfers about 2.5h, and depending on the transferring film time is according to the size of albumen, the biggest required transfer time of molecular weight of albumen is the longest.

(3) close: after transfer terminates, ddH₂O washing pvdf membrane 2-3 time, each 5min.After Xi Hao, at confining liquid, (5g takes off Fat breast is dissolved in 100mL TBST solution) in process 1-2h (room temperature can be placed slowly shake), then with TBST jog washing 2 times, often Secondary 5min.

(4) one process resistant: TBST solution or an anti-diluted His-tag antibody 2 000 times, by above-mentioned washed Pvdf membrane is put into wherein, 4 DEG C of overnight jogs.

(5) two process resistant: by pvdf membrane from one anti-take out with TBST jog washing 3 times, each 5min, addition TBST Diluting in two anti-(goat anti-mouse antibody of HRP labelling) solution of 2 000 times, room temperature jog oscillation treatment 1h, TBST jog is washed Washing 5 times, each 5min (must thoroughly clean up).

(6) colour developing: illustrate according to ECL luminescence reagent box, equal-volume mixing after I liquid and II liquid are diluted 6 times the most respectively, Pvdf membrane is placed on clean preservative film, draws mix homogeneously with liquid-transfering gun and be covered on pvdf membrane.

(7) exposure: treat that fluorescence occurs, removes most nitrite ion, puts in magazine after being wrapped by pvdf membrane with preservative film, pressure The X-ray film of upper suitable size, determines time of exposure according to fluorescent brightness, and the brightest time of exposure is the shortest, the time from the several seconds to number Minute.After having exposed, film is put into developer solution, and (guaranteeing that developer solution is pink, brown is oxidation, if tying winter Ice need to shift to an earlier date temperature bath) in, after clear band occurs, put into fixing 2-3min in fixative solution.After film washing is dried, sweep Retouch and image clips.

3 experimental results

The structure of 3.1 prokaryotic expression carriers

After the codon of Bufo siccus PPDPF and people PPDPF ORF is optimized, successfully construct two restructuring matter Grain pET-28 (b⁺)-PPDPF-Bufo and pET-28 (b⁺)-PPDPF-Human。

The abduction delivering situation of 3.2SDS-PAGE detection recombiant protein PPDPF

After two kinds of recombinant plasmid transformed to E.coli competent cell BL21, it is 1 by concentration respectively, 0.1,0.01, 0.001mol·L^-1IPTG add with 1/1000 ratio after Induction Transformation, found that add the bacterium phase of recombiant plasmid of IPTG Have more 1 obvious protein band than the bacterium not adding IPTG induction, and molecular weight and prediction is close, illustrates successfully to have expressed Two kinds of Bufo siccuss carrying His label and the PPDPF recombiant protein of people, the former is higher compared with the latter's expression.

Interpretation of result also finds, variable concentrations IPTG induction under, working concentration is 1mmol L^-1With 0.1mmol·L^-1When two kinds of albumen have expression, the abduction delivering DeGrain of lower concentration, the time is then luring Protein expression best results (seeing shown in Fig. 2 and Fig. 3) when of leading 4 hours

3.3 recombiant protein solubility detects

Select two 0.1mol L^-1The thalline sample of IPTG induction 4h processes, through Xtractor lysate, DNase After I and lysozyme process 10min, this recombiant protein solubility of SDS-PAGE electrophoretic examinations, result shows that this recombiant protein is upper Cleer and peaceful precipitation occurs, but in supernatant in relatively precipitation many (as shown in Figure 4).Illustrate that the inclined water solublity of this albumen (takes difference to lure The time sample of leading carries out testing result and is similar to)

3.4 recombiant protein immunoblottings

For further determining that albumen PPDPF for the purpose of this recombiant protein is whether, little mouse-anti His-tag antibody is used to carry out Western blotting detects, and result shows, the sample before induction occurs without specific band at molecular mass 17kD, only The sample of useful IPTG induction 4h protein band at about 17kD can be by His antibody recognition, with the PPDPF weight of Bufo siccus and people The expection molecular weight of histone coincide, and shows that this albumen is strictly purpose recombiant protein.

4 conclusions and discussion

The present invention, by the codon optimized and gene chemical synthesis to Bufo siccus PPDPF and people PPDPF ORF, successfully builds Bufo siccus pET-28b-PPDPF and people's pET-28b-PPDPF prokaryotic expression carrier, and at competent escherichia coli cell Through probing into, successful expression in BL21, finds that two kinds of recombiant proteins optimal inductive condition at 37 DEG C is: IPTG concentration is 0.1mmol L-1 induction time is 4h (see Fig. 2 and Fig. 3).Western blotting testing result shows only this overexpression Band can be identified by His-tag, show that this albumen is destination protein PPDPF (see Fig. 5 and Fig. 6).

Antiserum be certain destination protein is purified removal other foreign proteins after select suitable animal body

(sheep, horse, chicken, monkey, Cavia porcellus) carries out multiple injection immunity, makes animal body produce antibody and carry out blood collection acquisition The antiserum of anti-destination protein.Antiserum is a kind of serum containing polyclonal antibody, not only facilitates further science and grinds Study carefully work, passive immunity (passive immunity) can be transmitted also by injection antiserum and prevent, diagnose and treat perhaps Many diseases.As antiserum can be used for studying as standard positive serum；The currently the only side that can treat Ebola virus patient Method is through the antiserum injecting previous patient in the patient.

This research department's previous work successfully builds Bufo siccus PPDPF and the prokaryotic expression carrier of people PPDPF, and becomes Merit is expressed and has grasped optimum condition of the expression.For studying further the biological characteristics of this albumen, pre-it is carried out recombiant protein Great expression, purification and the sero-fast preparation of this recombiant protein of little mouse-anti

5 experiment materials and reagent

5.1 major experimental instruments

Ultraviolet spectrophotometer is purchased from Shanghai Spectrum Apparatus Co., Ltd.,2-mL Disposable Gravity Column is purchased from Dalian treasured biological engineering company limited.Remaining equipment needed thereby is with 1.1.

5.2 main material reagent

Laboratory animal and material: white mice and Mus feedstuff are purchased from Zhejiang Province's Experimental Animal Center, the female Mus that 5-6 week old is healthy Separately raise for each with male Mus 4.

Reagent: Freund's complete adjuvant and incomplete Freund's adjuvant are purchased from Sigma company.BeyoGold^TM His-tag Purification Resin is purchased from green skies Bioisystech Co., Ltd.Remaining reagent and 1.2 identical.

5.3 main solution preparations

(1) 20% NaTDC (DOC): claim 2g NaTDC powder to be dissolved in 10mL ddH₂O, room temperature preservation, use Front dilution 10 times.

(2)10mg·mL^-1Lysozyme: claim lysozyme powder 10mg to be dissolved in 1mL ddH₂O ,-20 DEG C save backup.

(3) non denatured lysate: claim NaH₂PO₄6.9g, NaCl 17.54g, is dissolved in 800mLddH₂In O, NaOH regulates PH to 8.0, adds ddH₂O is settled to 1000mL, room temperature preservation.

(4) non denatured cleaning mixture (2mmol L^-1Imidazoles): claim NaH₂PO₄6.9g, NaCl 17.54g, imidazoles (imidazole) 0.136g is dissolved in 800mL ddH₂In O, NaOH regulates pH to 8.0, adds ddH₂O is settled to 1000mL, room temperature Preserve.

(5) non denatured eluent (300mmol L^-1Imidazoles): claim NaH₂PO₄6.9g, NaCl 17.54g, imidazoles (imidazole), during 20.4g is dissolved in 800mL deionized water, NaOH regulates pH to 8.0, adds ddH₂O is settled to 1000mL, room Temperature preserves.

(6) 0.9%NaCl: claim 0.9gNaCl to be dissolved in 100mL ddH₂In O, room temperature preserves.

6 experimental techniques

The purification of 6.1 supernatant recombiant protein PPDPF

Detecting through 3.3 solubilities, this albumen all occurs in upper cleer and peaceful precipitation, in view of in supernatant, expression is more, first adopts Use pureization Bufo and people's PPDPF recombiant protein.

(1) positive colony amplification culture obtaining 400mL bacterium solution, 50mL centrifuge tube carries out bacterium solution and is centrifuged after weighing, 5000rpm 10min, finally weighs the thalline of collection.

(2) press 1g thalline and add 2-5mL lysate addition X-tractor, after thorough suspension thalline, proceed to 10mL centrifuge tube, Ultrasound Instrument (rated power 450W) is adjusted to about 50% i.e. 200-300W, carries out the most ultrasonic about 15-20min until suspension is saturating Till bright, it is ensured that probe end does not contact at the bottom of centrifuge tube pipe or tube wall, work and intermittent time are 3s (if solution too thickness can Appropriate addition RNase10 μ g mL^-1, DNase5 μ g mL^-1)。

(3) 4 DEG C of 13 200rpm are centrifuged 15min.Collecting supernatant and be used for purification, precipitation is then with 2% NaTDC washing one Secondary centrifugal, then with milli-Q water once ,-20 DEG C of preservations.

(4) solid gel by every milliliter can add the gel (BeyoGold of 50% in conjunction with about 3mg protein content^TM His- Tag Purification Resin, gel solids is 1:1 with storage liquid proportional), 4 DEG C of 13200rpm are centrifuged 30s, discard storage Liquid, adds the non denatured lysate balance of 1 times of volume, and 4 DEG C of 13 200rpm is centrifuged 30s, repeats 1-2 time, gel is put into purification Post.

(5) supernatant after ultrasonic degradation is filled post, 3-5 time repeatedly, fully to combine two kinds of restructuring eggs of band His label In vain, collect last percolation liquid and be taken out 4 μ L and carry out electrophoresis detection.

The non denatured cleaning mixture of (6) 2 times of column volumes washes post 5 times, takes 4 μ L sample for subsequent detection every time.

The non denatured elution of (7) 1 times of column volumes 6-10 time, takes 0.5 μ L respectively and detects for SDS-PAGE, the most really Determine concentration and purity.

6.2 cut glue method purification of recombinant proteins PPDPF

In view of supernatant purification result has more miscellaneous band always, the precipitation inclusion body after cracking also has more miscellaneous band, invention People's trial is simultaneous for supernatant protein the most after purification and precipitation inclusion body carries out cutting glue purification, does for follow-up sero-fast preparation Prepare.

(1) SDS-PAGE two kinds of collecting protein liquid after purification and precipitation inclusion body carried out respectively is (still with 15% Separation gel).

(2) take off glue after electrophoresis terminates and directly carry out the 0.25mol L of pre-cooling^-1KCl solution dyeing 10-20min, treat Occurring that the most milky thicker band cuts immediately, the adhesive tape cut uses ultra-pure water concussion washing 5min instead, changes water and repeats 1-2 time, remove KCl.

(3) adhesive tape collecting same albumen is mixed together, and napkin is wrapped with two-layer preservative film after exhausting surface moisture, uses Cut film most advanced level to roll until becoming powder.

(4) buffings is transferred to 2mL centrifuge tube, adds the most isopyknic 0.9%NaCl, with 2mL syringe needle repeatedly Suction, makes that blob of viscose is the most tiny is easy to immunity.

(5) according to the concentration of loading ratio estimation recombiant protein (being fixed in PAGE glue).

6.3 mouse-anti Bufo siccus PPDPF and the sero-fast preparation of people PPDPF

(1) randomly select the mice of 6-8 week old totally 8 be divided into 3 groups, first group two is only used as blank group, second group and the Three groups are three, respectively injection Bufo siccus PPDPF recombiant protein and people's PPDPF recombiant protein, do before immunity on mouse cage Good labelling.

(2) by the albumen glue of the dose dilution 50% of every mice about 20 μ g, first immunisation addition is isopyknic not Family name's Freund's complete adjuvant is fully emulsified, make albumen by Freund's complete adjuvant fully wrapped around till, mice use dorsal sc multi-point injection Immunity.

(3) first time immunity carries out second time immunity after terminating 20 days, and the Freund using addition same volume instead is not exclusively helped Agent emulsifying also carries out immunity, repeats immunity once by secondary method the most week about, altogether immunity four times.

Cross one week Culling heart blood after (4) the 4th immunity, overnight place or straight for 4 DEG C after the blood 37 DEG C gathered is placed 1h Meet 4 DEG C of centrifugal 15min.

6.4Western blotting detects two kinds of antiserum specificitys

Mouse-anti Bufo siccus PPDPF (No. 3 male Mus) and mouse-anti people's PPDPF antiserum (No. 3 female Mus) with preparing are as one respectively Anti-, after diluting 5000 times with an anti-diluent or TBST solution, carry out Western blotting according to the method for .2.2., inspection Survey sero-fast specificity.

7 experimental results

7.1 Bufo siccus PPDPF and the purification of people's PPDPF recombiant protein

7.1.1 purification PPDPF in supernatant and inclusion body

Through BeyoGold^TMTwo kinds of recombiant proteins that His-tag Purification Resin gel-purified obtains, warp SDS-PAGE detects purification effect, and result shows, the protein concentration extracted is higher, but purity also do not reach antiserum preparation want Asking, the precipitation inclusion body after ultrasonic degradation also contains more miscellaneous band (Fig. 7,8), similar through experimental result is repeated several times.

7.1.2 glue method purification PPDPF is cut

Bufo siccus PPDPF the most after purification and people's PPDPF recombiant protein are through a large amount of samples

After SDS-PAGE, use 0.25M L^-1KCl dyeing rear cutout under white purpose band, anti-with syringe needle after thoroughly pulverizing Multiple suction makes that buffings is the most tiny is easy to immunity, obtains higher can the meeting of purity prepare anti-blood through cutting glue purification further The clear two kinds of recombiant proteins (Fig. 9) needed.

7.2Western blotting detects antiserum result

Mouse-anti Bufo siccus restructuring PPDPF is obtained and mouse-anti people recombinates PPDPF antiserum through immunity.With preparation two kinds Antiserum resists respectively as one, Western blotting detection antibody and the idiosyncrasy of antigen, and result proves prepared Antiserum has good specificity, also illustrates that these two kinds of recombiant proteins have preferable immunogenicity (Figure 10,11).

8 conclusions and discussion

The restructuring PPDPF of Bufo siccus and people is expressed smoothly, on Simultaneous purification in cleer and peaceful inclusion body by mass propgation Recombiant protein, albumen after purification is cut glue and reclaims and be further purified, and immune mouse prepares antiserum.Two kinds of anti-blood It is respectively provided with good antigen-recognition specificity clearly through Western blotting detection, upper cleer and peaceful in Bufo siccus antiserum group Deposit sample testing result is the best, thus it is speculated that may be relevant with transferring film efficiency or time of exposure.

Antiserum is respectively provided with considerable effect, as can be used as standard under study for action in scientific research and actual application Positive serum, or be as a kind of therapeutic antibodies in clinical practice.In a word, two kinds sero-fast are successfully prepared as the present After probe into the biological function of PPDPF further and established theoretical basis, the mouse-anti people sero-fast preparation of PPDPF of recombinating more allows PPDPF is applied to the mankind and is possibly realized.

Above content be the preferred implementation combining the invention provided technical scheme is made further in detail Describe in detail bright, it is impossible to assert that the invention is embodied as being confined to these explanations above-mentioned, for technology belonging to the invention For the those of ordinary skill in field, without departing from the concept of the premise of the invention, it is also possible to make some simple deductions Or replace, all should be considered as belonging to the protection domain of the invention.

SEQUENCE LISTING

<110>Zhejiang Pharmaceutical College

<120>cultivation of a kind of prokaryotic expression carrier and sero-fast preparation method thereof

<160> 2

<210> 1

<211> 336

<212> cDNA

<213>artificial sequence

<220>

<222> (1)..(336)

<400> 1

Original ATGGCAGCGATTCCATCCAGTGGCTCACTTGTCGCAACACATGATTACTATCGTAGACGC

Optimized ATGGCCGCCATCCCATCCTCCGGCAGCCTAGTCGCCACCCACGATTATTATCGCAGACGC

M A A I P S S G S L V A T H D Y Y R R R

Original CTGGGATCCACCTCTAGTAACAGCTCATGTGGGAGTGTGGACTACTCTGGAGAGGTCATT

Optimized CTAGGCTCCACCTCCAGCAATAGCTCCTGCGGCAGCGTCGATTATTCCGGCGAGGTCATC

L G S T S S N S S C G S V D Y S G E V I

Original CCTCACCACCCAGGTCTTCCAAAGTCAGATCCTGGTCACTGGTGGGCCAGCTTCTTTTTT

Optimized CCACACCACCCAGGCCTACCAAAGTCCGATCCAGGCCACTGGTGGGCCAGCTTCTTCTTC

P H H P G L P K S D P G H W W A S F F F

Original GGTAAACCATCTCATCCCGTTATGACCACTGTTTCGGAATCCCCGGAGAACTCAGGAAGC

Optimized GGCAAGCCATCCCACCCAGTCATGACCACTGTCTCGGAGTCCCCGGAGAATTCGGGAAGC

G K P S H P V M T T V S E S P E N S G S

Original TTGCGCATGACCAATGGCCTTTTCCCCTGCGGCCTGGCTCAGGAGCCAGTGAGGAAGAAC

Optimized TTGCGCATGACCAATGGCCTATTCCCATGCGGCCTAGCCCAGGAGCCAGTCAGAAAGAAT

L R M T N G L F P C G L A Q E P V R K N

Original AGTCTCAATGAGTCCAAGACTGACTCCAGCACCTAA 336

Optimized AGCCTAAATGAGTCCAAGACTGATTCCAGCACCTAA

S L N E S K T D S S T

<210> 2

<211> 345

<212> cDNA

<213>artificial sequence

<400> 2

Original ATGGCGGCCATCCCCTCCAGCGGCTCGCTCGTGGCCACCCACGACTACTACCGGCGCCGC

Optimized ATGGCCGCCATCCCATCCTCCGGCAGCCTAGTCGCCACCCACGATTATTATCGCAGACGC

M A A I P S S G S L V A T H D Y Y R R R

Original CTGGGTTCCACTTCCAGCAACAGCTCCTGCAGCAGTACCGAGTGCCCCGGGGAAGCCATT

Optimized CTAGGCTCCACCTCCAGCAATAGCTCCTGCTCCAGCACCGAGTGCCCAGGCGAGGCCATC

L G S T S S N S S C S S T E C P G E A I

Original CCCCACCCCCCAGGTCTCCCCAAGGCTGACCCGGGTCATTGGTGGGCCAGCTTCTTTTTC

Optimized CCACACCCGCCAGGCCTACCAAAGGCCGATCCAGGCCACTGGTGGGCCAGCTTCTTCTTC

P H P P G L P K A D P G H W W A S F F F

Original GGGAAGTCCACCCTCCCGTTCATGGCCACGGTGTTGGAGTCCGCAGAGCACTCGGAACCT

Optimized GGCAAGTCCACCCTACCATTCATGGCCACTGTCCTAGAGTCCGCCGAGCACTCGGAGCCG

G K S T L P F M A T V L E S A E H S E P

Original CCCCAGGCCTCCAGCAGCATGACCGCCTGTGGCCTGGCTCGGGACGCCCCGAGGAAGCAG

Optimized CCACAGGCCTCCAGCTCCATGACCGCCTGCGGCCTAGCCAGAGATGCCCCAAGAAAGCAG

P Q A S S S M T A C G L A R D A P R K Q

Original CCCGGCGGTCAGTCCAGCACAGCCAGCGCTGGGCCCCCGTCCTGA 345

Optimized CCAGGCGGCCAGTCCAGCACTGCCTCCGCCGGCCCGCCATCCTAA

P G G Q S S T A S A G P P S

Claims

1. the cultural method of a prokaryotic expression carrier, it is characterised in that:

(1) structure of prokaryotic expression carrier: with the codon of colibacillary " preference " and " repulsion " respectively to people and Bufo siccus The ORF sequence of PPDPF carry out codon optimized and synthesis, and be connected to expression vector pET-28b (+) on, obtain password respectively Son optimizes descendant and Bufo siccusPPDThe restructuring recombiant protein molecular weight of PF recombiant plasmid, Bufo siccus and people be respectively 17.26kD and 17.14kD；

(2) abduction delivering of recombiant protein: by step (1)PPDPF recombinant plasmid transformed in competent escherichia coli cell, 37 DEG C of incubated overnight obtain a large amount of single bacterium colony；Picking list colony inoculation has added the LB liquid culture of 2 μ LKanamycin in 2mL In base, 37 DEG C of overnight concussion 220rpm cultivations form bacterium solution；Bacterium solution connects bacterium by 1% and crosses addition Kan to final concentration 50 μ g in sterilizing mL^-1LB culture fluid in, 260rpm in 37 DEG C concussion cultivate reach 0.7-1 to OD value, take out a part of bacterium solution as comparison Group, remaining bacterium solution is divided into four groups, and the ratio in 1/1000 adds the derivant IPTG that concentration is different, all bacterium solution is put back to again In constant incubator, 37 DEG C of 260rpm cultivate 1-4h, the expression of two kinds of recombiant proteins of induction.

The cultivation of a kind of prokaryotic expression carrier the most as claimed in claim 1 and sero-fast preparation method thereof, it is characterised in that: In step (2), when described single bacterium colony is cultivated in advance, the single bacterium colony turned out to be placed under 8 DEG C of environment standby.

The cultivation of a kind of prokaryotic expression carrier the most as claimed in claim 1 and sero-fast preparation method thereof, it is characterised in that: The interpolation concentration of described derivant IPTG is respectively 0.001 mol L^-1、0.01 mol•L^-1、0.1 mol•L^-1、1mol•L^-1。

The cultivation of a kind of prokaryotic expression carrier the most as claimed in claim 1 and sero-fast preparation method thereof, it is characterised in that: In step (2), the described recombiant protein optimal inductive condition at 37 DEG C is: IPTG concentration is 0.1mmol L^-1Induction time For 4h.

5. the prokaryotic expression carrier that method as described in any one of claim 1-4 is cultivated carries out sero-fast preparation method, and it is special Levy and be:

(1) take supernatant to be purified: use positive colony amplification culture to obtain bacterium solution, carry out thalline after weighing and be centrifuged, 5000rpm 10min, the thalline being finally collected into is weighed；Adding 2-5mL lysate by 1g thalline and add X-tractor, thoroughly suspend thalline After, the ultrasonic 200-300W of being adjusted to carries out the most ultrasonic 15-20min, bright to suspension, and work and intermittent time are 3s；4℃ 13 200rpm are centrifuged 15min, collect supernatant and are used for purification, and precipitation then washed once centrifugal with 2% NaTDC, then with ultrapure Water washed once ,-20 DEG C of preservations；Can be in conjunction with the gel of 3mg protein content addition 50% by the solid gel of every milliliter, 4 DEG C 13200rpm is centrifuged 30s, discards storage liquid, adds the non denatured lysate balance of 1 times of volume, and 4 DEG C of 13200rpm are centrifuged 30s, Repeat 1-2 time, albumen purification column on gel；After gel upper prop, fill post with the supernatant after ultrasonic degradation, collect percolation liquid 3-5 Secondary, fully to combine two kinds of band His label restructuring recombiant proteins, collect last percolation liquid and be taken out 4 μ L and carry out Race glue detects；The non denatured cleaning mixture of 2 times of column volumes washes post 5 times, takes 4 μ L sample for subsequent detection every time；1 times of column volume Non denatured elution 6-10 time, every time with 1 EP pipe subpackage, takes out 0.5 μ L respectively for running SDS-PAGE electrophoresis detection Concentration and purity；

(2) glue method purification of recombinant proteins PPDPF is cut: step (1) two kind collecting protein liquid after purification and precipitation inclusion body are divided Do not carry out the SDS-PAGE electrophoresis of a large amount of sample；Take off glue after running cementing bundle and directly carry out the 0.25M L of pre-cooling^-1KCl solution Dyeing 10-20min, the most milky thicker band to appear cuts immediately, and the adhesive tape cut is used ultra-pure water concussion instead and washed Wash 5min, change water and repeat 1-2 time, remove KCl；The adhesive tape collecting same albumen is mixed together, with protecting after exhausting surface moisture Fresh film is wrapped, and rolls until becoming powder with cutting film most advanced level；Buffings is transferred to 2mL centrifuge tube, adds equal-volume 0.9%NaCl, repeatedly aspirate, make that blob of viscose is the most tiny is easy to immunity；Take the good albumen of purification to carry out in ratio loading estimation glue Protein concentration；

(3) prepared by antiserum: randomly select the mice of 6-8 week old totally 8 be divided into 3 groups, first group two is only used as blank group, second Group injection Bufo siccus PPDPF recombiant protein, the 3rd group is injected people's PPDPF recombiant protein；Dosage by every mice 20 μ g The albumen glue of dilution 50%, it is fully emulsified that first immunisation adds isopyknic Freund's complete adjuvant, makes albumen complete by Freund Till adjuvant is fully wrapped around, mice uses the immunity of dorsal sc multi-point injection；Immunity for the first time carries out second time after terminating 20 days Immunity, the incomplete Freund's adjuvant emulsifying using addition same volume instead carries out immunity, the most week about by secondary method Repeat immunity once, altogether immunity four times；After 4th immunity cross one week Culling heart blood, will gather blood 37 DEG C placement 1h after 4 DEG C overnight place or direct 4 DEG C of centrifugal 15min.