CN101613706A - The colloidal gold labeling lap gene monoclonal antibody measuring Listeria monocytogenes kit - Google Patents

Abstract

A kind of colloidal gold labeling lap gene monoclonal antibody measuring Listeria monocytogenes kit belongs to hygiene inspection and medical test technical field, it is characterized in that: a. design of primers; The reaction conditions of b.PCR amplification; C. the reaction conditions of agarose gel electrophoresis; E. applying heat shock conversion method; F.SDS cracking process purification kit prepares plasmid; G. induction expression of protein; The h.SDS-PAGE electrophoresis; J. from the SDS-PAGE running gel, downcut required band; K. adopt trisodium citrate reduction method and make improvements the preparation Radioactive colloidal gold slightly; Beneficial effect is: improved the limitation of past at the single antigen measuring of single Pseudomonas.Pure antibody, the height of tiring have improved susceptibility and accuracy.Listeria monocytogenes is detected, with ELISA method and PCR method relatively, immune colloidal gold chromatography to listerial detection have fast, advantage easily.

Description

The colloidal gold labeling lap gene monoclonal antibody measuring Listeria monocytogenes kit

Technical field

The invention belongs to hygiene inspection and medical test technical field.

Background technology

Listeria Listeria is divided into 2 groups, 7 kinds.The 1st group comprises listeria monocytogenes L.m onocytogenes (abbreviation Listeria monocytogenes), listeria ivanovii L.ivanovii, listera innocua L.innocua, Webster listeria bacteria L.welshm ei and Sai Shi listeria bacteria L.seeligeri; The 2nd group is more rare listeria grayi L.grayi and the Mohs listeria bacteria L.m urrayi. Listeria monocytogenes main pathogenic bacterium that are considered to cause animal and human's class listeriosis wherein. Listeria monocytogenes (Usteria monocytogenes, Lm) be a kind of short and small gram-positive asporogenous rod, be a kind of pathogenic bacterium of zoonosis, can make humans and animals suffer from listeriosis.Discover that Listeria monocytogenes comprises 3 types of pathogenic, weak pathogenic and non-virulents. Listeria monocytogenes can make people and animals cause a disease, and causes multiple livestock and poultry death such as pig, chicken.The people then mainly shows as meningitis, septicemia and monocytosis after infecting.Infant, pregnant woman and immunological tolerance patient's infection mortality ratio can be up to 20%～30%.Listeria monocytogenes extensively is present in occurring in nature, the meat that people eat, milk, egg, fishery products, vegetables and frozen product etc. all have pollution in various degree, The World Health Organization (WHO) points out in the report about Listeria monocytogenes food poisoning: 4%～8% fishery products, 5%～10% milk and milk preparation, poultry more than 15%, meat product more than 30% and refrigerated products, all by this fungi pollution. there is bigger threat in the Listeria monocytogenes that exists in the food to the mankind's food safety, is one of The main pathogenic fungi that threatens in the frozen product human health.Be listed in one of deadly germ of 7 kinds of main food source property in U.S. listeria bacteria, classified as one of food-borne bacterium of emphasis detection by WHO food safety work program.

Listeria monocytogenes is typical born of the same parents' endophyte, can be in scavenger cell and many non-phagocytic cells (as endotheliocyte, epithelial cell and liver cell) internal breeding.Listeria monocytogenes pathogenic relates to a plurality of virulence factors, as internalization element, hemolysin, p60 albumen etc.P60 albumen is a kind of murein lytic enzyme with high immunogenicity of listeria bacteria excretory, and by the iap genes encoding, relative molecular mass is about 60 000.P60 albumen is made up of 484 amino-acid residues, the signal peptide sequence that the N2 end is made up of 27 amino-acid residues, and common for each kind of listeria, but its sequence has specificity again.The listerial iap gene back of checking order is found that its two ends are conservative region, and the centre is a Variable Area.PCR method according to above-mentioned conserved regions and variable region sequences foundation can be used in listerial kind, belongs to and identifying.There are some researches show that .P60 albumen also is an important antigenic component in to the protective immunity of Listeria monocytogenes, it is to stimulate body T cell and B cell to produce immunoreactive major antigen molecule.

Listeria monocytogenes is aerobic or facultative anaerobe, and growth temperature is 1～45 ℃, and adverse environment is had more intense tolerance, but in 4 ℃ of refrigerators also growth and breeding, in the environment of pH5.0～9.0, still can detect after 1 year.This further increases its hazardness.In addition, the Listeria monocytogenes pathogenic agent is to settle down intracellular, and the effect of therefore using the antibiotic therapy listeriosis is not ideal.Dye the attention that causes countries in the world day by day by microbial disease of Liszt and food source sexuality thereof.To this cause of disease carry out fast, sensitive, to detect accurately be the effectively anti-disease and guarantee the important means of food sanitation safe of effecting a permanent cure. there are some researches show that p60 albumen also is an important antigenic component in to the protective immunity of Listeria monocytogenes, it is to stimulate body B cell and T cell to produce immunoreactive major antigen molecule.This research has been carried out prokaryotic expression, the antigen reactivity and the solubility of expression product has been analyzed Listeria monocytogenes iap gene, lays a good foundation for further studying the Listeria monocytogenes vaccine from now on.

This research is intended to clone and express the iap gene of Listeria monocytogenes, and development is based on the proteic diagnosis of p60 antigen and monoclonal antibody, and analysis and preparation recombinant vaccine lay the foundation so that Listeria monocytogenes is tested.2003, Jung and Frank etc. designed primer with the gene order of inlAB, and PCR method detects 51 parts of listeria bacteria cultures that adhere to different serotypes separately, and detectability can reach 10cfu/ml.ActA albumen is made up of 639 amino acid of actA genes encoding, and sophisticated albumen is 610 amino acid, is divided into 3 structural domains, have research successfully at expression in escherichia coli the actA gene, and develop the ActA monoclonal antibody.Qu Yanyi etc. are to the prokaryotic expression that carries out of listeria monocytogenes iap gene, and expression product relative molecular weight 60 000 exists with soluble form.

Classical listeria bacteria separation and Culture and authenticate technology need the 1-2 time-of-week, and the manpower and materials cost is big, incompatibility actual survey requirements of one's work.At present, to producing the research of monokaryon listeria bacteria method for quick, the overwhelming majority still rests on breadboard conceptual phase, largely be confined to ELISA method and PCR method, and immune colloidal gold chromatography is listerial detection has fast, advantage easily, can be widely used in hospital, commodity inspection, health, safety check, also can be used for family and detect easily.The specificity that it is good, higher sensitivity, circulation ratio and stability provide an even more ideal detection method and thinking for producing the detection of monokaryon listeria bacteria reliably.Used antibody such as the Raleigh is new are for producing monokaryon listeria bacteria antibody (O chain antigen I/II), experiment is only studied at single serotype listeria bacteria, be divided into 13 serotypes and produce the monokaryon listeria bacteria according to thalline (O) antigen and flagellum (H) antigen, so experiment is complete inadequately at the full Pseudomonas of Liszt.

The colloidal gold immunochromatographimethod technology is to grow up the nineties in 20th century, the diagnostic techniques that chromatography is combined with immune colloid gold, have quick, easy and simple to handle, the similar specificity and the advantage of sensitivity, be widely used in the detection of clinical sample to enzyme immunoassay.This experiment is adopted the immune colloidal gold chromatography technology based on above each side factor.To the Listeria monocytogenes analysis of testing, obtained good effect.Immune colloidal gold technique is exempted from (EIA) and has been compared many superiority one at first with enzyme, it does not need desired substrate (developer) in the euzymelinked immunosorbent assay (ELISA), thereby can save the certain operations step, as washing, termination etc., makes simple to operateization.Therefore Radioactive colloidal gold detects only needs 10-20min, and enzyme is exempted from (EIA) and is needed more than the 60min. secondly, colloid dish method is pollution-free, can not endanger operator and contaminate environment, and these problems are exempted from often to run in the method at enzyme: colloidal gold antibody is answered platform thing room temperature storage quite stable under lyophilised state once more, i.e. this based article condition of storage gentleness, the effect phase is longer than enzyme and exempts from method; In addition colloidal gold technique also have detect rapidly, sensitive, do not need advantages such as complex instrument equipment, product is will never fade.

Comprehensive above studying data at home and abroad can find that the detection method of Listeria monocytogenes is still complete inadequately, and still there is the deficiency of following two aspects in existing detection technique method:

1 sample needs the bacterium device that increases of 2-4h to increase the bacterium cultivation.

The sample that 2 present method still infect Listeria monocytogenes only carries out negative examination, and definite test of positive sample still is the evaluation of microbial culture and biochemical reaction.

Summary of the invention

The objective of the invention is: a kind of colloidal gold labeling lap gene monoclonal antibody measuring Listeria monocytogenes kit is provided, it is used for the rapid detection Listeria monocytogenes with the immune colloidal gold chromatography method of labeling lap gene monoclonal antibody, easy to use, simple to operate, reliable results.

Technical scheme of the present invention is:

1 design of primers:

L.monocytogenes Iap protein gene sequence:

ORIGIN

1?atgaatatga?aaaaagcaac?tatcgcggct?acagctggga?ttgcggtaacagcatttgct

61?gctccaacaa?tcgcatccgc?aagcactgta?gtagttgaag?ctggtgatactctttggggt

121?atcgcacaaa?gtaaagggac?tactgttgac?gcaattaaaa?aagcaaacaatttaacaaca

181?gataaaatcg?taccaggtca?aaaattacaa?gtaaatgagg?ttgctgctgctgaaaaaaca

241?gagaaatctg?ttagcgcaac?ttggttaaac?gttcgtagtg?gcgctggtgttgataacagt

301?attattacgt?caatcaaagg?cggaacaaaa?gtaactgttg?aatcaaccgaatctaatggc

361?tggaacaaaa?ttacttacaa?cgacggggaa?actggtttcg?ttaacggtaaatacttaact

421?gacaaagtag?caagcactcc?tgttgcacca?acacaagaag?tgaaaaaagaaactactatt

481?caacaagctg?cacctgctgc?agaaacaaaa?actgaagtaa?aacaaactacacaagcaact

541?acacctgcac?ctaaagtagc?agaaacgaaa?gaaactccag?tggtagatcaaaatgctact

601?acacacgctg?ttaaaagcgg?tgacactatt?tgggctttat?ccgtaaaatacggtgtttcc

661?gttcaagaca?ttatgtcatg?gaataattta?tcttcttctt?ctatttatgtaggtcaaaaa

721?cttgctatta?aacaaacagc?caacacagtt?actccaaaag?cagaagtgaaaaaagaagct

781?ccagcagctg?aaaaacaagc?tgcaccagta?gttaaagaaa?atactaacactaacacaaat

841?actactacag?agaaaaaaga?aacaacacaa?caacaaacag?cacctaaagcaccaacagaa

901?gctgcaaaac?cagctcccgc?accatctaca?aacacaaatg?ctaataaaacgaatacgaat

961?acaaacaata?ctaatacaag?tacaccatct?aaaaatacca?atactaatacaaactccaat

1021?acgaatacaa?actcaaatac?gaatgctaat?caaggttctt?ctaacaataacagcaattca

1081?agtgcaagtg?ctattattgc?tgaagctcaa?aaacaccttg?gaaaagcttattcatggggt

1141?ggtaacggac?caactacatt?tgattgctct?ggttacacta?aatatgtatttgctaaagcg

1201?ggaatctccc?ttccacgtac?ttctggcgca?caatacgcta?gcactacaagaatctctgaa

1261?tctcaagcaa?aacctggtga?tttagtattc?tttgactatg?gtagcggaatttctcacgtt

1321?ggtatctacg?ttggtaatgg?tcaaatgatt?aacgcgcaag?acaatggcgttaaatacgat

1381?aacatccacg?gctctggctg?gggtaaatat?ctagttggct?tcggtcgcgt?ataa//

According to the L.monocytogenes Iap protein gene sequence among the GenBank, use Primer Premier5.0, DNA Club and Oligo 6.0 design Auele Specific Primer P1 and P2, the expection amplification length is 1434bp.After in NCBIGENEBANK, finding gene order, see the restriction enzyme site of selection, in the gene order that will carry out PCR, whether exist; With Primer primer5 the sequence reverse complemental; When using Oligo 6.0 design of primers, the input of upstream and downstream primer total length; Negative value+1 downstream primer the site of all bases that are defined as first base front of 5 ' Side Template in upstream primer site (comprising restriction enzyme site+protection base) be defined as downstream primer-restriction enzyme site-protectiveness base=A, sequence total length-A+1=downstream primer site.

Upstream primer P1:

5′-GC GGATCCATGAATATGAAAAAAGCAACTATCGCGGC-3′；

Downstream primer P2:

5′- CTCGAGTACGCGACCGAAGCCAACTAGATATT-3′

For next step clone needs, in the primer of upstream and downstream, introduce the reaction conditions of BamH I and Xho I restriction enzyme site 2 pcr amplifications respectively:

The PCR reaction conditions is 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 1min, and 55-65 ℃ of annealing 1min, 72 ℃ are extended 2min, 30 circulations of increasing, 72 ℃ are extended 10min.

The reaction conditions of 3 agarose gel electrophoresis:

Analyze PCR product, voltage 100V, electrophoresis 30min with 1.0% agarose gel electrophoresis.

4 downcut target DNA fragment, reclaim test kit with the gel fast purifying and reclaim.The PCR product that reclaims purifying is connected with pMD18-T, and the pMD18-T carrier connects more than 12 hours for 16 ℃.Preparation competent cell: use CaCl ₂The sensitization legal system is equipped with the intestinal bacteria competence, inoculation JM109 bacterial classification, and 37 ℃, after jolting in 225rpm12 hour was cultivated, bacterium liquid was rule on the LB solid medium, 37 ℃ of incubator incubated overnight, screening mono-clonal.Select a single colony inoculation in 5mL LB substratum, cultivate more than 12 hours, culture is inoculated in the LB substratum by 1/100, is cultured to A ₆₀₀Reach 0.45-0.55, use CaCl ₂The sensitization intestinal bacteria.Specific as follows: behind bacterium liquid ice bath 10min, 4 ℃, the centrifugal 20min of 4000rpm collects thalline, adds ice-cold 0.1M CaCl again ₂Sensitization liquid, the suspension thalline, ice bath 10min, collect thalline again after, add ice-cold 0.1M CaCl ₂, resuspended thalline, glycerol adding to final concentration are the packing of 15%, 100 μ L/ pipe ,-70 ℃ of preservations are used for transforming.

5 applying heat shock conversion method, ligation liquid is added in the cell of 100 μ L impression state, add 3 μ lDMSO again to increase transformation efficiency, behind the ice bath 30min, 42 ℃ of shock 45s, rapid then ice bath 5min, again converted product is added in the LB liquid nutrient medium behind the recovery 30min, centrifugal collection thalline is laid on it and contains on the antibiotic LB solid medium of screening, and 37 ℃ of constant temperature incubators are observed changing effect after placing 16h.

6SDS cracking process purification kit prepares plasmid.Carry out enzyme with BamH I and Xho I and cut evaluation and PCR evaluation, filter out positive recombinant plasmid, called after pMD 18-T-Iap.Carry out subclone with BamH I and Xho I, expression vector pET28a and recombinant cloning vector pMD18T-Iap cut processing with BamH I and Xho I, agarose gel electrophoresis, the linear expression vector reclaims test kit with the DNA fast purifying and reclaims, the subclone fragment reclaims with the plastic squeeze method, and subcloning vector is connected with the T4 dna ligase with fragment, connects product and transforms the JM109 competence, extract plasmid, identify positive colony.

7 induction expression of protein

With pET28a-Iap recombinant plasmid transformed BL21 recipient bacterium, select mono-clonal to be inoculated in the 5mL LB nutrient solution, press the traditional way abduction delivering, promptly 37 ℃, the 225rpm shaking culture reaches 0.6-0.8 to A600, adds IPTG to 1mmol/L, control group does not add IPTG, collects bacterium behind the 3h.Bacterial classification is induced in inoculation simultaneously, extracts plasmid, and BamH I and Xho I enzyme are cut after checking really contains the purpose fragment, check order, and carry out the subsequent experimental of recombinant protein after order-checking is correct.

8 SDS-PAGE electrophoresis

To induce back bacterium liquid 30mL 11000rpm centrifugal 2min, and abandon supernatant, and collect thalline, and add 2 * sds gel sample loading buffer, 1000 μ l in bacterial sediment, and carry out the SDS-PAGE electrophoresis after boiling 5min, operating process is as follows:

12% separation gel 15mL: 3.8mL, the 10%SDS 150mL of water 4.9mL, 30% acrylamide 6.0mL, its pH8.8 of 1.5mol/L Tris-HCl, 10% ammonium persulphate 150mL, TEMED 6mL, be poured into the gap of layer glass plate rapidly, careful one deck distilled water that covers on glue, gel vertically places room temperature, after the polymerization fully, pour out the water of covering, water is exhausted with filter paper.Preparation 8mL spacer gel: 1.0mL, the 10%SDS 80mL of water 5.5mL, 30% acrylamide 1.3mL, its pH6.8 of 1.0mol/L Tris-HCl, 10% ammonium persulphate 80mL, TEMED 8mL, directly annotate in the separation gel upper strata, in spacer gel, insert clean Teflon comb immediately, carefully avoid forming bubble.After the spacer gel polymerization fully, carefully shift out the Teflon comb, gel sets on electrophoresis apparatus, is added Tris-glycine electrophoretic buffer 25mmol/L Tris, the 250mmol/L glycine, 0.1%SDS, last electrophoresis sample and protein Marker, voltage 200v electrophoresis 45min, electrophoresis finishes the back gel and adds coomassie brilliant blue staining, after the destainer decolouring, gel is soaked in the water Taking Pictures recording.

9 downcut required band from the SDS-PAGE running gel, approximately use two day time with its freeze-drying, and be crushed into powder.Carry out determination of protein concentration with the Xylene Brilliant Cyanine G method, make the protein standard curve.595nm place colorimetric gets absorbancy, looks into typical curve, obtains protein concentration.Antigen is dissolved in the physiological saline, and compound concentration is 1 μ g/ μ l.The immunity BALB/c mouse.4-6 week, booster immunization.

Inducing of mouse ascites:

Get the healthy BALB/c mouse in 10 ages in week, abdominal injection sterilising liq paraffin is collected hybridoma after 0.5ml.7-10 days for every, and is centrifugal, removes supernatant, adds the substratum that does not contain serum, and regulating cell density is 3 * 10 ⁷Individual/ml, every injected in mice 1ml.If negative control, saline control.After about 10 days, mouse web portion increases, and begins to collect ascites.Penetrate belly with No. 12 syringe needles, extruding is flowed out ascites, is collected into centrifuge tube, and rocks centrifuge tube with strength and prevent that ascites from condensing.1000 left the heart 5 minutes, drew supernatant, noted removing top one deck fat.Packing ,-20 ℃ frozen.

The preparation of 10 Radioactive colloidal golds is adopted trisodium citrate reduction method and is made improvements the preparation Radioactive colloidal gold slightly.Preparation of Colloidal Gold: get 1% chlorauric acid solution 2.5ml and join in the 250ml volumetric flask, add distilled water to the calibrated scale line, the concentration that makes chlorauric acid solution is 1 ‰, and boiling water bath 10min adds 1% citric acid three sodium solution 6.65ml.Stir fast and thoroughly become red-purple until color, continuation boiling water 10min, taking-up.Cool to room temperature, return to original volume with distilled water.Putting 4 ℃ of refrigerators preserves standby.

Measure Radioactive colloidal gold and have maximum absorption band, determine that the Radioactive colloidal gold diameter is 10nm at the 515nm wavelength.

Colloidal gold probe preparation: get the colloidal gold solution 50ml of prepared fresh, add 0.2mol/L K ₂CO3 transfers pH to 8.2, puts magnetic stirring apparatus and raises an amount of rotating speed, adds an amount of good antibody of purifying then.

Make antibody concentration just on the minimum of stabilizing protein.Slowly stir 10min, add bovine serum albumin BSA, the final concentration that makes BSA is I%, continues to stir 10min.Above-mentioned Radioactive colloidal gold one antibody one BsA liquid is carried out the centrifugal 20min of 4 000r/min, collect supernatant.The supernatant of collecting is carried out 4 ℃, the centrifugal 60min of 10 000r/min.Abandon supernatant, the precipitation 0.01mol/L that contains 1%BSA.PH7.4PBS suspends.The same 4 ℃, the centrifugal 60min twice of 10 000r/min will precipitate the dissolving with 5ml PBS-T at last.And adding minor N a ₃N, 4 ℃ of refrigerators are preserved standby.

Chromatograph test strip assembling test strip is made up of water-absorption fiber, nitrocellulose membrane, glass fibre and PVC plate.Nitrocellulose membrane is handled: the stage casing is separated by 5mm respectively with sheep anti-mouse igg control line and the line of monokaryon listeria bacteria antibody detection line, forms the line segment of two wide about 1mm, and dry back is sealed more than 12 hours with the PBS that contains 1%BSA, 37 ℃ of dryings.

Test strip assembling: get clean PVC plate, the nitrocellulose membrane of handling well is bonded at PVC plate middle part correct position; The 2cm water-absorption fiber is bonded at PVC plate upper end also partly is pressed on the nitrocellulose membrane, the 0.8cm glass fibre is bonded at PVC plate lower end and part is pressed on the nitrocellulose membrane, is cut into the band of wide 5mm, is chromatograph test strip; Siccative seals freezing preservation.

The invention has the beneficial effects as follows:

1, according to the L.monocytogenes Iap protein gene sequence of having delivered among the GeneBank, use Primer Premier5.0, DNA Club and Oligo 6.0 design primer voluntarily.

2, P60 albumen is a kind of murein lytic enzyme with high immunogenicity of listeria bacteria excretory, by the iap genes encoding, monocytosis Listeria monocytogenes iap gene is cloned and prokaryotic expression, improved the limitation of past at the single antigen measuring of single Pseudomonas.

3, expression product solubility recombinant protein immune animal BALB/c mouse, preparation hybridoma cell strain, preparation ascites antibody.Pure antibody, the height of tiring with method in the past relatively, have improved susceptibility and accuracy.

4, colloid gold label Listeria monocytogenes Antibody Preparation immunochromatographiassay assay reagent plate detects Listeria monocytogenes, with ELISA method and PCR method relatively, immune colloidal gold chromatography to listerial detection have fast, advantage easily.

Description of drawings

Fig. 1 iap gene PCR product electrophorogram

M：DNA?markerDL2000

1,2,3,4,5,6, the amplified production annealing temperature of 7:iap gene is respectively 65 ℃, 64 ℃, 63 ℃, 61 ℃, 58 ℃, 56 ℃, 55 ℃

Fig. 2 pET 28a-Iap recombinant plasmid electrophorogram

M：DNA?markerDL2000；

1,2:pET 28a-Iap recombinant plasmid gene PCR product;

Fig. 3 pET 28a-Iap recombinant protein SDS-PAGE electrophoresis

M: protein relative molecular mass standard;

The 1:pET228a2iap recombinant plasmid is induced the Westernblotting immune protein engram analysis of 6h Fig. 4 recombinant protein through IPTG in BL21 (DE3) pLysS

M: protein relative molecular mass standard;

1: the relative molecular weight about 60000 that the Westernblotting immune protein engram analysis of recombinant protein is expressed.

Figure 51: ELISA colour developing result after 10000 dilute samples and the negative ascites

1 blank well

2 negative controls

3 ascites samples

The crest that Fig. 6 Radioactive colloidal gold shows

Fig. 7 Radioactive colloidal gold has maximum absorption band at the 515nm wavelength

Fig. 8 Radioactive colloidal gold method detects Listeria monocytogenes positive and negative photo as a result.

1 Radioactive colloidal gold method detects the Listeria monocytogenes negative findings

2 Radioactive colloidal gold methods detect the Listeria monocytogenes positive findings

Embodiment:

Embodiment 1:

Processing condition:

First step is cloned and prokaryotic expression monocytosis Listeria monocytogenes gene.

Main equipment:

Medicine and reagent: bacterial classification and plasmid Listeria monocytogenes bacterial classification (C5305 strain), prokaryotic expression carrier plasmid pET228a are TAKARA company product.Competent cell e. coli jm109, BL21 recipient bacterium are Promega company product.

Enzyme and related reagent Ex Taq polysaccharase, restriction enzyme EcoR I, Xho I and IPTG are Dalian precious biotechnology company limited product.T4 DNA ligase is a Promega company product.The DNA fast purifying reclaims test kit, gel fast purifying recovery test kit is a Dalian precious biotechnology company limited product.

Experimental technique:

One. the preparation of genomic dna

Cultivate the monocytosis Listeria monocytogenes according to a conventional method, the DNA fast purifying reclaims test kit

Two. contain the structure of L.monocytogenes Iap protein gene cloning carrier

2.1 design of primers:

According to the L.monocytogenes Iap protein gene sequence of having delivered among the GenBank, use PrimerPremier5.0, DNA Club and Oligo 6.0 design Auele Specific Primer P1 and P2, the expection amplification length is 1434bp.Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's preparation.

After in NCBI GENEBANK, finding gene order, see the restriction enzyme site of selection, in the gene order that will carry out PCR, whether exist; With Primer primer5 the sequence reverse complemental; When using Oligo 6.0 design of primers, the input of upstream and downstream primer total length; Being defined as of upstream primer site: being defined as of the negative value+1 downstream primer site of all bases of first base front of 5 ' Side Template (comprising restriction enzyme site+protection base): downstream primer-restriction enzyme site-protectiveness base=A, sequence total length-A+1=downstream primer site.To consider in the initial base of sequence and the end base whether comprise initiator codon (ATG) and terminator codon (TAA) in the time of design of primers,, whether need consider deletion or keep if having.The selection of primer length will be considered the CG ratio, and the selection of restriction enzyme site will take into account cheapness, and is commonly used, and will take into account GC ratio variation that it adds the back primer; Whether the sequence that also will consider restriction enzyme site occurs in the complete sequence of PCR, if will select other restriction enzyme site.The front suitably adds base and regulates the GC ratio, and 5 ' end is copied word by word; 3 ' end reverse complemental; Protectiveness base and restriction enzyme site are added in the primer front.Self complementation, dimer (between two primers)＜6, negative value macro-energy more is big more, and annealing temperature is high more, and the mispairing probability is more little.

Upstream primer P1:

5′-GC GGATCCATGAATATGAAAAAAGCAACTATCGCGGC-3′；

Downstream primer P2:

5′- CTCGAGTACGCGACCGAAGCCAACTAGATATT-3′

For next step clone needs, in the primer of upstream and downstream, introduce BamH I and Xho I restriction enzyme site respectively

2.2PCR amplification:

TaqTM PCR test kit with reference to TaKaRa company.The PCR reaction conditions is 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 1min, and 65 ℃ of annealing 1min, 72 ℃ are extended 2min, 30 circulations of increasing, 72 ℃ are extended 10min.

2.3 agarose gel electrophoresis:

Analyze PCR product, voltage 100V, electrophoresis 30min with 1.0% agarose gel electrophoresis.See figure one, the agarose gel electrophoresis result under the different annealing temperature behind the pcr amplification.Determine that 65 ℃ are optimum annealing temperature.

2.4PCR product reclaims:

Downcut target DNA fragment, reclaim test kit with the gel fast purifying and reclaim.

2.5PCR the clone of product:

The PCR product that reclaims purifying is connected with pMD18-T, and 16 ℃ of connections of spending the night of pMD18-T carrier.

2.6 preparation competent cell:

Use CaCl ₂The sensitization legal system is equipped with the intestinal bacteria competence, inoculation JM109 bacterial classification, and 37 ℃, 225rpm spends the night after jolting cultivates, and bacterium liquid is rule on the LB solid medium, 37 ℃ of incubator incubated overnight, screening mono-clonal.Select a single colony inoculation in 5mL LB substratum, incubated overnight, culture is inoculated in the LB substratum by 1/100, is cultured to A ₆₀₀Reach 0.45-0.55, use CaCl ₂The sensitization intestinal bacteria.Specific as follows: behind bacterium liquid ice bath 10min, 4 ℃, the centrifugal 20min of 4000rpm collects thalline, adds ice-cold 0.1M CaCl again ₂Sensitization liquid, the suspension thalline, ice bath 10min, collect thalline again after, add ice-cold 0.1M CaCl ₂, resuspended thalline, glycerol adding to final concentration are the packing of 15%, 100 μ L/ pipe ,-70 ℃ of preservations are used for transforming.

2.7 transform:

Applying heat shock conversion method, ligation liquid is added in the cell of 100 μ L impression state, add 3 μ lDMSO again to increase transformation efficiency, behind the ice bath 30min, 42 ℃ of shock 45s, rapid then ice bath 5min, again converted product is added in the LB liquid nutrient medium behind the recovery 30min, centrifugal collection thalline is laid on it and contains on the antibiotic LB solid medium of screening, and 37 ℃ of constant temperature incubators are observed changing effect after placing 12～16h.

2.8 plasmid DNA SDS cracking process purification kit prepares plasmid.

2.9 identify:

Carry out enzyme with BamH I and Xho I and cut evaluation and PCR evaluation, filter out positive recombinant plasmid, called after pMD18-T-Iap.

2.10pMD18-T-Iap sequencing:

Positive recombinant plasmid pMD18-T-Iap is delivered to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd carry out sequencing, and carry out homology relatively.

Three. the structure of prokaryotic expression carrier pETP60 and Recombinant Protein Expression and detection

3.1 subclone:

Carry out subclone with BamH I and Xho I, expression vector pET28a and recombinant cloning vector pMD18T-Iap cut processing with BamH I and Xho I, agarose gel electrophoresis, the linear expression vector reclaims test kit with the DNA fast purifying and reclaims, the subclone fragment reclaims with the plastic squeeze method, and subcloning vector is connected with the T4 dna ligase with fragment, connects product and transforms the JM109 competence, extract plasmid, identify positive colony.

3.2 induction expression of protein

With pET28a-Iap recombinant plasmid transformed BL21 recipient bacterium, select mono-clonal to be inoculated in the 5mL LB nutrient solution, press the traditional way abduction delivering, promptly 37 ℃, the 225rpm shaking culture reaches 0.6-0.8 to A600, adds IPTG to 1mmol/L, control group does not add IPTG, collects bacterium behind the 3h.Bacterial classification is induced in inoculation simultaneously, extracts plasmid, and BamH I and Xho I enzyme are cut after checking really contains the purpose fragment, and worker's order-checking is given birth in Shanghai, carries out the subsequent experimental of recombinant protein after order-checking is correct.

3.3 the evaluation of recombinant protein

3.3.1SDS-PAGE electrophoresis

To induce back bacterium liquid 2mL 11000rpm centrifugal 2min, and abandon supernatant, and collect thalline, and add 2 * sds gel sample loading buffer, 200 μ l in bacterial sediment, and carry out the SDS-PAGE electrophoresis after boiling 5min, operating process is as follows:

12% separation gel 15mL: water 4.9mL, 30% acrylamide 6.0mL, 1.5mol/L Tris-HCl (pH8.8) 3.8mL, 10%SDS 150mL, 10% ammonium persulphate 150mL, TEMED 6mL, be poured into the gap of layer glass plate rapidly, careful one deck distilled water that covers on glue, gel vertically places room temperature, after the polymerization fully, pour out the water of covering, water is exhausted with filter paper.Preparation 8mL spacer gel: water 5.5mL, 30% acrylamide 1.3mL, 1.0mol/L Tris-HCl (pH6.8) 1.0mL, 10%SDS 80mL, 10% ammonium persulphate 80mL, TEMED 8mL, directly annotate in the separation gel upper strata, in spacer gel, insert clean Teflon comb immediately, carefully avoid forming bubble.After the spacer gel polymerization fully, carefully shift out the Teflon comb, gel sets on electrophoresis apparatus, is added Tris-glycine electrophoretic buffer (25mmol/L Tris, the 250mmol/L glycine, 0.1%SDS), last electrophoresis sample and protein Marker, voltage 200v electrophoresis 45min, electrophoresis finishes the back gel and adds coomassie brilliant blue staining, after the destainer decolouring, gel is soaked in the water Taking Pictures recording.See Fig. 3.

3.3.2Western?blot

Sample on the 12%SDS-PAGE electrophoresis marker zygomorphy, half gel-colored, decolouring, another is done and is used for western blot.Wear gloves and cut 6 Whatman 3MM filter paper and 1 nitrocellulose filter (Millipore HAWP), size is slightly less than gel, cuts filter membrane and serves as a mark for one jiao.Nitrocellulose filter is immersed in the ultrapure water more than the 5min, 6 3MM filter paper are dipped in transfering buffering liquid, with distilled water drip washing graphite cake, wipe drop on the dried graphite cake with filter paper, put 3 3MM filter paper successively at anode, nitrocellulose filter, gel, 3 3MM filter paper, each layer accurately alignment do not stay bubble, the correct electrophoresis apparatus of installing, press the 0.6mA/cm2 making current according to the gel area, after changeing film 2h, gel-colored, whether the commentaries on classics film is observed in decolouring successful, 4 ℃ of sealings of nitrocellulose filter spend the night (confining liquid is for containing 5%[W/V] PBS of skim-milk, the amount of pressing membrane area 0.1mL/cm2 adds), the amount of pressing 0.1mL/cm2 then in confining liquid adds first antibody, room temperature is slowly shaken and is hatched 2h, nitrocellulose filter is (each 5min) after 250mL PBS washing 3 times, transfer to horseradish peroxidase-labeled two anti-in, room temperature is shaken 2h gently, after the same washing, move in the colour developing liquid (DAB 6mg among the PBS of 10mL, 30%H2O2 10mL) room temperature observing response process, the color depth of protein band reaches after the requirement promptly with slightly rinsing of clear water, takes pictures then.

Hybridoma preparation and the monoclonal antibody production and the purifying of the second step listerisa monocytogenes in mjme

1.1.1 from the SDS-PAGE running gel, downcut required band, approximately use two day time with its freeze-drying, and be crushed into powder.

1.1.2 determination of protein concentration (Xylene Brilliant Cyanine G method)

Make the protein standard curve.595nm place colorimetric gets absorbancy, looks into typical curve, obtains protein concentration.

1.2 antigen is dissolved in the physiological saline, and compound concentration is 1 μ g/ μ l.The immunity BALB/c mouse.4-6 week, booster immunization.

2 fusion experiments

2.1 cultivate myeloma cell NS-1

2.2 preparation feeder cell:

It is standby to get plastics tubing.Draw neck to put to death mouse, be soaked in 75% alcohol 2-3 minute.Mouse is moved on the Bechtop, be fixed on dorsal position and separate on the sliced venceer, cut off skin of chest,, expose belly with two hand longitudinal extension skins with eye scissors, and with the cotton ball soaked in alcohol peritonaeum of sterilizing.Draw the HAT nutrient solution with dropper and inject the abdominal cavity, flushing, preprepared plastics tubing is injected in sucking-off, threshes several times, gets a certain amount of Turnover of Mouse Peritoneal Macrophages.Scavenger cell is inoculated in 96 orifice plates.Put 37 ℃, 5%CO ₂Cultivate under the condition.

2.3 splenocyte preparation:

Draw neck to put to death immune mouse, with 75% alcohol-pickled sterilization mouse body surface.In Bechtop, spleen is won in aseptic exposure abdominal cavity, removes fat and reticular tissue, with the flushing of serum nutrient solution.Spleen is moved into the homogenizer that fills serum-free medium to be ground.With serum-free medium flushing, collecting cell suspension, left the heart 5 minutes with 1000, abandoning supernatant is suspended in the incomplete nutrient solution, and note what milliliter splenocytes altogether.The splenocyte counting is got 1 milliliter of splenocyte suspension, adds 1% Glacial acetic acid (broken red blood cell).

2.4 cytogamy experiment:

With myeloma cell and 1: 10 mixed of splenocyte together, the full nutrient solution that toos many or too much for use in 50 milliliters of plastic centrifuge tubes is washed once, and 1100 change centrifugal 5 minutes.Supernatant discarded night, flick the centrifuge tube bottom with forefinger, make the cell precipitation agglomerate loose slightly.Rotate on the other hand evenly centrifuge tube, another hand adds stirring gently with suction pipe while dripping, add 0.5ml-1ml simultaneously, and the 50%PEG effect adds in controlling 1 minute.The incomplete nutrient solution that adds preheating stops the PEG effect, every 2 minutes, adds 1ml, 2ml, 3ml, 4ml, 5ml and 10ml respectively.Centrifugal, 1000 change 5 minutes.Abandon supernatant,, make sure to keep in mind and to blow and beat, in order to avoid fused cell scatters with the nutrient solution that contains calf serum suspendible gently.According to 96 orifice plate culture plate quantity, add nutrient solution.The fused cell suspension is added 96 orifice plates that contain feeder cell, 100ul/ hole, 37 ℃, 5%CO ₂Incubator is cultivated.3 enzyme linked immunosorbent assay (ELISA):

3.1 bag quilt:

Proteantigen adds coating buffer in proportion, and every hole 100ul adds 96 orifice plates, and 4 ℃ of placements are spent the night.PBS washes 4 times.(2 milliliters of tween/1LPBS water).Sealing: 1%BSA (0.01g+100mlPBS) 1 hour.Add negative control, positive sample, every hole 100ul.

3.2PBS the 250ul/ hole, it is inferior to give a baby a bath on the third day after its birth.Sealing: 10% confining liquid (the 1ml calf serum+9mlPBS), sealed 1 hour, and-20 ℃ of preservations are standby by the every hole of 250ul/.Abandon supernatant, PBS gives a baby a bath on the third day after its birth inferior.One anti-add negative control, positive control and needs to detect clone's supernatant sample, and numbering was placed 1 hour, abandoned supernatant, and PBS washes four times.Two antienzyme labeling antibodies, the 2ul+5ml confining liquid was placed 1 hour.PBS washes six times.The every hole 100ul of substrate solution, lucifuge is placed 30min.Add stop buffer and observe, enzyme mark liquid reading.

4 limiting dilution assay clone hybridization oncocytes

4.1 hole that will be to be cloned in 96 well culture plates that detected performs mark.With the cell in the suction pipe piping and druming hole it is scattered, sucking-off 0.1ml cell suspension is counted to 1ml hybrid cell nutrient solution in the hole.Just adjust hybridoma density to 3-10/ml with the HT nutrient solution during time cloning.Every 96 well culture plate is 10ml (clones for the second time or for the third time and can use the hybrid cell nutrient solution instead).The cell that mixes up predetermined density is added to 96 well culture plates that contain feeder cell, and each hole adds 0.1ml.96 well culture plates are put 37 ℃, 5%CO ₂, saturated humidity incubator in cultivate.The 4th day with 1/2 supernatant liquor in the new nutrient solution displacement hole.The 7th day to the 9th day, when hole floor cells colony in 1-2mm when size, the supernatant liquor in sucking-off hybridoma growth hole.Press the antibody in the antibody screening method detection supernatant liquor.Calculate the positive boring ratio rate of hybridoma.The hole inner cell of antibody positive is moved on to 24 well culture plate enlarged culturing 2-4d.By above step,, reach till 100% up to the positive porosity of hybridoma with repeated cloning 2-4 time again of the positive cell after the enlarged culturing.Cell in the hole is the hybridoma after the cloning.After the hybridoma enlarged culturing with cloning, with the centrifugal 5min of 1000r/min.Collect supernatant liquor and do the monoclonal antibody evaluation, frozen sedimentary cell is standby.

Inducing of 5 mouse ascites:

Get the healthy BALB/c mouse in 10 ages in week, abdominal injection sterilising liq paraffin is collected hybridoma after 0.5ml.7-10 days for every, and is centrifugal, removes supernatant, adds the substratum that does not contain serum, and regulating cell density is 3 * 10 ⁷Individual/ml, every injected in mice 1ml.If negative control, saline control.After about 10 days, mouse web portion increases, and begins to collect ascites.Penetrate belly with No. 12 syringe needles, extruding is flowed out ascites, is collected into centrifuge tube, and rocks centrifuge tube with strength and prevent that ascites from condensing.1000 left the heart 5 minutes, drew supernatant, noted removing top one deck fat.Packing ,-20 ℃ frozen.

The experiment of 6 mouse ascites monoclonal antibody indirect ELISA subtype typings

1 centrifugal treating sample, with PBS according to 1000: 1 dilution proportion ascites samples and negative control sample (not immune BalB/C mouse ascites).Get 100ul dilution ascites sample and negative control and wrap respectively by in elisa plate, every kind of sample one row, 6 holes of every row, getting PBS is blank;

2 place 37 ℃ to hatch one hour the elisa plate;

3 usefulness PBST washingss washing elisa plate three times;

4 usefulness PBS join blank well according to 6 antibody subtypes of 10: 1 dilution proportion (being respectively IgA, M, G1,2a, 2b and G3) (SIGMA company, article No. is ISO-2) respectively with every kind of hypotype antibody, in negative control hole and the ascites sample well, and every hole 100ul;

5 room temperatures were placed 30 minutes;

6 usefulness PBST washingss washing elisa plate three times;

The PBS that 7 usefulness contain 0.02%TWEEN-20 is according to the Ma Kangyang of 500: 1 dilution proportion HRP mark two anti-(Beijing ancient cooking vessel state biotechnology leading company, article No.: HD004-1), and it is joined in 18 holes every hole 100ul;

8 room temperatures were placed 15 minutes;

9 usefulness PBST washingss washing elisa plate three times;

10 add the every hole 100 of chromogenic substrate damping fluid little (adopt the OPD Color Appearance System, absorbance value is 490nm);

11 room temperature lucifuges were placed 10 minutes;

12 add stop buffer 50ul;

13 take pictures, with microplate reader at 490nm place read-record.

Table 1:1: OD490 absorbing wavelength result after 10000 dilute samples and the negative ascites

Experimental result is discussed:

Still have absorption through the sample after the dilution in 1: 10000 at 490nm as can be seen from Fig. 5 and table 1, and sample is apparent that IgM and IgG3 with feminine gender comparison difference.

7 Purification of Monoclonal Antibodies:

Mouse ascites can obtain required monoclonal antibody purification by the affinity chromatography method.

The preparation of third step Radioactive colloidal gold and colloidal gold probe

1 materials and methods

1.1 reagent and instrument

The hydrochloro-auric acid analytical pure, 1g adorns (Chemical Reagent Co., Ltd., Sinopharm Group); (0 chain antigen I/II) 14ms/ml * 2ml adorns (purchase in Japan and give birth to the company of grinding) to produce monokaryon listeria bacteria antibody; Examination criteria produces monokaryon listeria bacteria (34922) sample; Nitrocellulose membrane chromatography band 4cm * 200cm (purchasing) in Sartorius AG; Water-absorption fiber, glass fibre and PVC plate (purchase in last current chart and believe Science and Technology Ltd.).

1.2 the preparation of Radioactive colloidal gold is adopted trisodium citrate reduction method and is made improvements the preparation Radioactive colloidal gold slightly.18～20nm Preparation of Colloidal Gold: get 1% chlorauric acid solution 2.5ml and join in the 250ml volumetric flask, add distilled water to the calibrated scale line, the concentration that makes chlorauric acid solution is 1 ‰, and boiling water bath 10min adds 1% citric acid three sodium solution 6.65ml.Stir fast and thoroughly become red-purple until color, continuation boiling water 10min, taking-up.Cool to room temperature, return to original volume with distilled water.Putting 4 ℃ of refrigerators preserves standby.

The Radioactive colloidal gold of 10nm diameter has maximum absorption band at the 515nm wavelength, by the visible light absorbancy of the Radioactive colloidal gold of each method preparation relatively, analyzes its gold grain size and distributes.See Fig. 6,7.

Colloidal gold probe preparation: get the colloidal gold solution 50ml of prepared fresh, add 0.2mol/L K ₂CO3 transfers pH to 8.2, puts magnetic stirring apparatus and raises an amount of rotating speed, adds an amount of good antibody of purifying then.

Make antibody concentration just on the minimum of stabilizing protein.Slowly stir 10min, add bovine serum albumin (BSA), the final concentration that makes BSA is I%, continues to stir 10min.Above-mentioned Radioactive colloidal gold one antibody one BsA liquid is carried out the centrifugal 20min of 4 000r/min, collect supernatant.The supernatant of collecting is carried out 4 ℃, the centrifugal 60min of 10 000r/min.Abandon supernatant, the precipitation 0.01mol/L that contains 1%BSA.PH7.4PBS suspends.The same 4 ℃, the centrifugal 60min twice of 10 000r/min will precipitate the dissolving with 5ml PBS-T at last.And adding minor N a ₃N, 4 ℃ of refrigerators are preserved standby.

In the Preparation of Colloidal Gold process in the mensuration Preparation of Colloidal Gold process of stable colloid gold protein content the determination step of stable colloid gold protein content be: get 9 test tubes.Every pipe adds the 1ml colloidal gold solution. then.The concentration that adds equivalent in each pipe respectively is 5,10,15,20,25,50,75, the 100ug/ml multivalent antibody, and other 1 pipe adds the 1ml deionized water in contrast.Shake up and leave standstill 10min, every pipe adds molten night of 100ul 10%NaCl, shakes up, and leaves standstill 5h, observes the color of each test tube.The result shows.When the antibody concentration in the Radioactive colloidal gold during less than 15ug/ml. the test tube color is purple, and when the antibody concentration in the Radioactive colloidal gold during greater than 20ug/ml, the test tube color is constant.On antibody concentration 20ug/ml basis, add 20%, determine stable colloid gold antibody protein amount just when being 24ug/ml.

Chromatograph test strip assembling test strip is made up of water-absorption fiber, nitrocellulose membrane, glass fibre and PVC plate.Nitrocellulose membrane is handled: the stage casing 5mm of being separated by uses sheep anti-mouse igg (control line) and monokaryon listeria bacteria antibody (detection line) line respectively, forms the line segment of two wide about 1mm, and dry back is used the PBS that contains 1%BSA to seal to spend the night 37 ℃ of dryings.

Test strip assembling: get clean PVC plate, the nitrocellulose membrane of handling well is bonded at PVC plate middle part correct position; The 2cm water-absorption fiber is bonded at PVC plate upper end also partly is pressed on the nitrocellulose membrane, the 0.8cm glass fibre is bonded at PVC plate lower end and part is pressed on the nitrocellulose membrane, is cut into the band of wide 5mm, is chromatograph test strip; Siccative seals freezing preservation.

1.5 detect

Get sample cultivation 48h to be checked, get 0.1ml and add immune colloid gold centrifuge tube mixing vibration 10min, chromatograph test strip is inserted centrifuge tube, as seen mixed solution upwards moves along test strip, in the process of dividing a word with a hyphen at the end of a line be fixed on monokaryon listeria bacteria antibody and sheep anti-mouse igg generation antigen antibody reaction on the nitrocellulose membrane, and producing macroscopic red stripes, process of the test needs 10-20min.

Measurement result is judged: feminine gender, and only control line occurs red; The positive, redness all appears in control line and detection line.See Fig. 8.

Test effect evaluation of the present invention:

2.1 Preparation of Colloidal Gold method and condition

2.1 detection sensitivity, and 10 times of serial dilutions have been carried out.Data all are lower than the required bacterial classification concentration of food poisoning.This shows, can detect by this method for the common because poisoning that Listeria monocytogenes causes.

2.2 specificity with homemade colloidal gold probe respectively with Salmonellas, Shigellae, intestinal bacteria, non-product enterotoxin gold Portugal bacterium and other bacterium totally 10 strains etc. detect, the Listeria monocytogenes colloidal gold probe has specificity very, does not produce non-specific cross reaction with other bacterium basically.

The specific observation of table 2 colloidal gold kit

2.3 effect of the present invention:

2.3.1 detected result sees Table 1.In the positive sample to be checked, be two red line.In the negative sample to be checked, be the red single control line of demonstration.In the uncertain sample, find no and produce the listerial existence of monokaryon, be the red single control line of demonstration.

2.3.2 the every sample of the positive sample to be checked of sensitivity detects for 3 times, in dilution standard specimen of difference and infection food, detects altogether 24 times, sensitivity reaches 95.2%; When the dilution detection is not obvious, needs other householder method to detect and determined.

Table 3 result:

+ detect positive;-detect negative

2.3.3 the immune colloid gold of circulation ratio different batches production has the good detection circulation ratio, no big fluctuation in the detection.

" the C preservation detected contrast with the new system test strip, as a result there was no significant difference to 2,3.4 stability in 3 months 4 with test strip.

Detection makes use-case 1

The check and analysis result selects for use positive standard to be checked for producing the monokaryon listeria bacteria, infects freezing pork, milk, ice cream, and increase the bacterium device and increase bacterium cultivation 2-4h, and each dilution standard specimen of standard; The negative control sample is a tap water, and uncertain sample is a lake water, sanitary sewage, animal excrement.

Using method:

Get sample 0.1ml to be checked and add immune colloid gold centrifuge tube mixing vibration 10min, chromatograph test strip is inserted centrifugal, pipe, as seen mixed solution upwards moves along test strip, in the process of dividing a word with a hyphen at the end of a line be fixed on monokaryon listeria bacteria antibody and sheep anti-mouse igg generation antigen antibody reaction on the nitrocellulose membrane, and producing macroscopic red stripes, the Total Test process only needs 10-20min.

Measurement result is judged: feminine gender, and only control line occurs red; The positive, redness all appears in control line and detection line.

Detection makes use-case 2

The check and analysis result selects for use positive standard to be checked to increase bacterium cultivation 2-4h for product monokaryon listeria bacteria infection blood, cerebrospinal fluid and other sample increase the bacterium device, and the negative control sample is a salt solution.

Using method:

Get sample 0.1ml to be checked and add immune colloid gold centrifuge tube mixing vibration 10min, chromatograph test strip is inserted centrifugal, pipe, as seen mixed solution upwards moves along test strip, in the process of dividing a word with a hyphen at the end of a line be fixed on monokaryon listeria bacteria antibody and sheep anti-mouse igg generation antigen antibody reaction on the nitrocellulose membrane, and producing macroscopic red stripes, process of the test needs 10-20min.

Measurement result is judged: feminine gender, and only control line occurs red; The positive, redness all appears in control line and detection line.

Detection makes use-case 3

The check and analysis result selects for use positive standard to be checked for producing the monokaryon listeria bacteria, dilutes with different extent of dilution with salt solution, and the negative control sample is a salt solution.

Using method:

Get sample 0.1ml to be checked and add immune colloid gold centrifuge tube mixing vibration 10min, chromatograph test strip is inserted centrifugal, pipe, as seen mixed solution upwards moves along test strip, in the process of dividing a word with a hyphen at the end of a line be fixed on monokaryon listeria bacteria antibody and sheep anti-mouse igg generation antigen antibody reaction on the nitrocellulose membrane, and producing macroscopic red stripes, process of the test needs 10-20min.

Measurement result is judged: feminine gender, and only control line occurs red; The positive, redness all appears in control line and detection line.

Claims (1)

1, a kind of colloidal gold labeling lap gene monoclonal antibody measuring Listeria monocytogenes kit is characterized in that:

A, design of primers

L.monocytogenes Iap protein gene sequence

ORIGIN

1?atgaatatga?aaaaagcaac?tatcgcggct?acagctggga?ttgcggtaacagcatttgct

61?gctccaacaa?tcgcatccgc?aagcactgta?gtagttgaag?ctggtgatactctttggggt

121?atcgcacaaa?gtaaagggac?tactgttgac?gcaattaaaa?aagcaaacaatttaacaaca

181?gataaaatcg?taccaggtca?aaaattacaa?gtaaatgagg?ttgctgctgctgaaaaaaca

241?gagaaatctg?ttagcgcaac?ttggttaaac?gttcgtagtg?gcgctggtgttgataacagt

301?attattacgt?caatcaaagg?cggaacaaaa?gtaactgttg?aatcaaccgaatctaatggc

361?tggaacaaaa?ttacttacaa?cgacggggaa?actggtttcg?ttaacggtaaatacttaact

421?gacaaagtag?caagcactcc?tgttgcacca?acacaagaag?tgaaaaaagaaactactatt

481?caacaagctg?cacctgctgc?agaaacaaaa?actgaagtaa?aacaaactacacaagcaact

541?acacctgcac?ctaaagtagc?agaaacgaaa?gaaactccag?tggtagatcaaaatgctact

601?acacacgctg?ttaaaagcgg?tgacactatt?tgggctttat?ccgtaaaatacggtgtttcc

661?gttcaagaca?ttatgtcatg?gaataattta?tcttcttctt?ctatttatgtaggtcaaaaa

721?cttgctatta?aacaaacagc?caacacagtt?actccaaaag?cagaagtgaaaaaagaagct

781?ccagcagctg?aaaaacaagc?tgcaccagta?gttaaagaaa?atactaacactaacacaaat

841?actactacag?agaaaaaaga?aacaacacaa?caacaaacag?cacctaaagcaccaacagaa

901?gctgcaaaac?cagctcccgc?accatctaca?aacacaaatg?ctaataaaacgaatacgaat

961?acaaacaata?ctaatacaag?tacaccatct?aaaaatacca?atactaatacaaactccaat

1021?acgaatacaa?actcaaatac?gaatgctaat?caaggttctt?ctaacaataacagcaattca

1081?agtgcaagtg?ctattattgc?tgaagctcaa?aaacaccttg?gaaaagcttattcatggggt

1141?ggtaacggac?caactacatt?tgattgctct?ggttacacta?aatatgtatttgctaaagcg

1201?ggaatctccc?ttccacgtac?ttctggcgca?caatacgcta?gcactacaagaatctctgaa

1261?tctcaagcaa?aacctggtga?tttagtattc?tttgactatg?gtagcggaatttctcacgtt

1321?ggtatctacg?ttggtaatgg?tcaaatgatt?aacgcgcaag?acaatggcgttaaatacgat

1381?aacatccacg?gctctggctg?gggtaaatat?ctagttggct?tcggtcgcgt?ataa//

L.monocytogenes Iap protein gene sequence among the GenBank, use Primer Premier5.0, DNA Club and Oligo 6.0 design Auele Specific Primer P1 and P2, the expection amplification length is 1434bp, after in NCBIGENEBANK, finding gene order, see the restriction enzyme site of selection, in the gene order that will carry out PCR, whether exist; With Primer primer5 the sequence reverse complemental; When using Oligo 6.0 design of primers, the input of upstream and downstream primer total length; The negative value of all bases that are defined as first base front of 5 ' Side Template in upstream primer site+1 downstream primer site be defined as downstream primer-restriction enzyme site-protectiveness base=A, sequence total length-A+1=downstream primer site;

Upstream primer P1

5′-GC GGATCCATGAATATGAAAAAAGCAACTATCGCGGC-3′；

Downstream primer P2

5′- CTCGAGTACGCGACCGAAGCCAACTAGATATT-3′

For next step clone needs, in the primer of upstream and downstream, introduce BamH I and Xho I restriction enzyme site respectively

The reaction conditions of b, pcr amplification

The PCR reaction conditions is 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 1min, and 55-65 ℃ of annealing 1min, 72 ℃ are extended 2min, 30 circulations of increasing, 72 ℃ are extended 10min;

The reaction conditions of c, agarose gel electrophoresis

Analyze PCR product, voltage 100V, electrophoresis 30min with 1.0% agarose gel electrophoresis;

D, cutting-out target DNA fragment reclaim test kit with the gel fast purifying and reclaim; The PCR product that reclaims purifying is connected with pMD18-T, and the pMD18-T carrier connects more than 12 hours for 16 ℃; Preparation competent cell: use CaCl ₂The sensitization legal system is equipped with the intestinal bacteria competence, inoculation JM109 bacterial classification, and 37 ℃, after jolting in 225rpm12 hour was cultivated, bacterium liquid was rule on the LB solid medium, 37 ℃ of incubator incubated overnight, screening mono-clonal; Select a single colony inoculation in 5mL LB substratum, cultivate more than 12 hours, culture is inoculated in the LB substratum by 1/100, is cultured to A ₆₀₀Reach 0.45-0.55, use CaCl ₂The sensitization intestinal bacteria;

E, applying heat shock conversion method, ligation liquid is added in the cell of 100 μ L impression state, add 3 μ lDMSO again to increase transformation efficiency, behind the ice bath 30min, 42 ℃ of shock 45s, rapid then ice bath 5min, again converted product is added in the LB liquid nutrient medium behind the recovery 30min, centrifugal collection thalline is laid on it and contains on the antibiotic LB solid medium of screening, and 37 ℃ of constant temperature incubators are observed changing effect after placing 16h;

F, SDS cracking process purification kit prepare plasmid; Carry out enzyme with BamH I and Xho I and cut evaluation and PCR evaluation, filter out positive recombinant plasmid, called after pMD18-T-Iap; Carry out subclone with BamH I and Xho I, expression vector pET28a and recombinant cloning vector pMD18T-Iap cut processing with BamH I and Xho I, agarose gel electrophoresis, the linear expression vector reclaims test kit with the DNA fast purifying and reclaims, the subclone fragment reclaims with the plastic squeeze method, and subcloning vector is connected with the T4DNA ligase enzyme with fragment, connects product and transforms the JM109 competence, extract plasmid, identify positive colony;

G, induction expression of protein

With pET28a-Iap recombinant plasmid transformed BL21 recipient bacterium, select mono-clonal to be inoculated in the 5mL LB nutrient solution, press the traditional way abduction delivering, promptly 37 ℃, the 225rpm shaking culture reaches 0.6-0.8 to A600, adds IPTG to 1mmol/L, control group does not add IPTG, collects bacterium behind the 3h; Bacterial classification is induced in inoculation simultaneously, extracts plasmid, and BamH I and Xho I enzyme are cut after checking really contains the purpose fragment, check order, and carry out the subsequent experimental of recombinant protein after order-checking is correct;

H, SDS-PAGE electrophoresis

To induce back bacterium liquid 30mL 11000rpm centrifugal 2min, and abandon supernatant, and collect thalline, and add 2 * sds gel sample loading buffer, 1000 μ l in bacterial sediment, and carry out the SDS-PAGE electrophoresis after boiling 5min, operating process is as follows

12% separation gel 15mL, 3.8mL, the 10%SDS 150mL of water 4.9mL, 30% acrylamide 6.0mL, its pH 8.8 of 1.5mol/L Tris-HCl, 10% ammonium persulphate 150mL, TEMED 6mL, be poured into the gap of layer glass plate rapidly, careful one deck distilled water that covers on glue, gel vertically places room temperature, after the polymerization fully, pour out the water of covering, water is exhausted with filter paper; Preparation 8mL spacer gel, 1.0mL, the 10%SDS 80mL of water 5.5mL, 30% acrylamide 1.3mL, its pH 6.8 of 1.0mol/L Tris-HCl, 10% ammonium persulphate 80mL, TEMED 8mL, directly annotate in the separation gel upper strata, in spacer gel, insert clean Teflon comb immediately, carefully avoid forming bubble; After the spacer gel polymerization fully, carefully shift out the Teflon comb, gel sets on electrophoresis apparatus, is added Tris-glycine electrophoretic buffer 25mmol/L Tris, the 250mmol/L glycine, 0.1%SDS, last electrophoresis sample and protein Marker, voltage 200v electrophoresis 45min, electrophoresis finishes the back gel and adds coomassie brilliant blue staining, after the destainer decolouring, gel is soaked in the water Taking Pictures recording;

J, from the SDS-PAGE running gel, downcut required band, approximately use two day time with its freeze-drying, and be crushed into powder.Carry out determination of protein concentration with the Xylene Brilliant Cyanine G method, make the protein standard curve; 595nm place colorimetric gets absorbancy, looks into typical curve, obtains protein concentration; Antigen is dissolved in the physiological saline, and compound concentration is 1 μ g/ μ l.The immunity BALB/c mouse, 4-6 week, booster immunization;

Inducing of mouse ascites

Get BALB/c mouse, abdominal injection sterilising liq paraffin is collected hybridoma after 0.5ml.7-10 days for every, and is centrifugal, removes supernatant, adds the substratum that does not contain serum, and regulating cell density is 3 * 10 ⁷Individual/ml, every injected in mice 1ml; If negative control, saline control.After about 10 days, mouse web portion increases, and begins to collect ascites; Penetrate belly with No. 12 syringe needles, extruding is flowed out ascites, is collected into centrifuge tube, and rocks centrifuge tube with strength and prevent that ascites from condensing; 1000 left the heart 5 minutes, drew supernatant, noted removing top one deck fat; Packing ,-20 ℃ are frozen;

The preparation of k, Radioactive colloidal gold is adopted trisodium citrate reduction method and is made improvements the preparation Radioactive colloidal gold slightly; Preparation of Colloidal Gold is got 1% chlorauric acid solution 2.5ml and is joined in the 250ml volumetric flask, adds distilled water to the calibrated scale line, and the concentration that makes chlorauric acid solution is 1 ‰, and boiling water bath 10min adds 1% citric acid three sodium solution 6.65ml; Stir fast and thoroughly become red-purple until color, continuation boiling water 10min, taking-up.Cool to room temperature, return to original volume with distilled water; Putting 4 ℃ of refrigerators preserves standby;

Measure Radioactive colloidal gold and have maximum absorption band, determine that the Radioactive colloidal gold diameter is 10nm at the 515nm wavelength;

Colloidal gold probe preparation: get the colloidal gold solution 50ml of prepared fresh, add 0.2mol/L K ₂CO3 transfers pH to 8.2, puts magnetic stirring apparatus and raises an amount of rotating speed, adds an amount of good antibody of purifying then;

Make antibody concentration just on the minimum of stabilizing protein; Slowly stir 10min, add bovine serum albumin BSA, the final concentration that makes BSA is I%, continues to stir 10min.Above-mentioned Radioactive colloidal gold one antibody one BsA liquid is carried out the centrifugal 20min of 4000r/min, collect supernatant.The supernatant of collecting is carried out 4 ℃, the centrifugal 60min of 10000r/min.Abandon supernatant, the precipitation 0.01mol/L that contains 1%BSA; PH7.4PBS suspends; The same 4 ℃, the centrifugal 60min twice of 10000r/min will precipitate the dissolving with 5ml PBS-T at last; And adding minor N a ₃N, 4 ℃ of refrigerators are preserved standby;

Chromatograph test strip assembling test strip is made up of water-absorption fiber, nitrocellulose membrane, glass fibre and PVC plate.Nitrocellulose membrane is handled, and the stage casing is separated by 5mm respectively with sheep anti-mouse igg control line and the line of monokaryon listeria bacteria antibody detection line, forms the line segment of two wide about 1mm, and dry back is sealed more than 12 hours with the PBS that contains 1%BSA, 37 ℃ of dryings;

Clean PVC plate is got in the test strip assembling, and the nitrocellulose membrane of handling well is bonded at PVC plate middle part correct position; The 2cm water-absorption fiber is bonded at PVC plate upper end also partly is pressed on the nitrocellulose membrane, the 0.8cm glass fibre is bonded at PVC plate lower end and part is pressed on the nitrocellulose membrane, is cut into the band of wide 5mm, is chromatograph test strip; Siccative seals freezing preservation.

Images