CN107459574A

CN107459574A - A kind of PRV gB monoclonal antibodies and its application

Info

Publication number: CN107459574A
Application number: CN201710671265.8A
Authority: CN
Inventors: 闫若潜; 班付国; 吴志明; 马震原; 王淑娟; 谢彩华; 王华俊; 王东方; 赵雪丽; 曹伟伟; 方先珍; 赵明军; 刘梅芬; 赵国然; 张淼洁; 孙淑芳; 于辉; 杨海波; 李秀梅; 陈兴安
Original assignee: HENAN PROVINCIAL CENTER FOR ANIMAL DISEASE CONTROL AND PREVENTION
Current assignee: HENAN PROVINCIAL CENTER FOR ANIMAL DISEASE CONTROL AND PREVENTION
Priority date: 2017-08-08
Filing date: 2017-08-08
Publication date: 2017-12-12

Abstract

The invention belongs to immuno-biology technical field, and in particular to a kind of porcine pseudorabies virus（PRV）GB monoclonal antibodies and its patent application of application.The antibody is obtained using hybridoma to PRV variation strain HeNZK 2014 and PRVgB protein screenings.The hybridoma of stably excreting PRVgB protein monoclonal antibodies is obtained by screening, and then the monoclonal antibody for gB albumen of high-titer is obtained, and the kit of finished product and establish supporting one-step method competitive ELISA detection method using the Antibody preparation.Pass through a series of specificity, sensitivity, repeatability checking, as a result show, PRVgB antibody provided in the application and the one-step method competitive ELISA detection method established, with more accurate and relatively stable testing result, the check and evaluation of porcine pseudorabies gB antibody can be preferably used for, and laid the foundation for the prevention and control of porcine pseudorabies.

Description

A kind of PRV gB monoclonal antibodies and its application

Technical field

The invention belongs to immuno-biology technical field, and in particular to a kind of porcine pseudorabies virus（PRV）GB monoclonals Antibody and its patent application of application.

Background technology

Porcine pseudorabies (Porcine Pseudorabies, PR) are one kind by pig herpesvirus 1 type Caused by (Pseudorabies virus, PRV) to generate heat, miscarry, the high degree in contact for main clinic symptoms such as stillborn foetus, urgency Sexually transmitted disease.After pig infection PRV, different symptoms is shown because of different age brackets and different strain virulence, gestation Sow cardinal symptom is miscarriage, produces weak young, stillborn foetus and mummy tire etc.；Acute fatal, which is presented, in newborn piglet more passes through, allusion quotation The nervous symptoms of type, paralysis, the death rate nearly 100%；Adult Pig is subclinical infection state mostly.PRV is worldwide wide General prevalence, huge economic loss is brought to pig industry, be to influence one of serious infectious diseases that pig industry develops in a healthy way.

For PR prevention, vaccinate and carry out immune being still most important technological means.In China, draw from Hungary The Bartha-K61 gE gene delection attenuated live vaccines entered are one of main vaccines, and the control for China's PR epidemic situations plays Important effect.But since 2011, PR is again in many areas in China including Henan, Hebei, Shandong, Shanxi etc. It is popular in formula is broken out in multiple pig farms.It is probably because some amino acid sites hairs of PRV that many researchers, which think this time to break out, Raw mutation, causes variant virulence to strengthen, and existing Bartha-K61 vaccines can not provide enough immune protective efficiencies.

Now there are some researches show PRV viruses, which can encode a considerable amount of glycoprotein and be played in its each stage replicated, to be made With；These glycoprotein are the major targets that host produces immune response.As the member of Alphaherpesviridae, PRV codings 11 membrane glycoproteins, and according to them in I herpes simplex virus types（HSV-1）On homologue be named as gB, gC, GD, gE, gG, gH, gI, gK, gL, gM and gN.GB glycoprotein is the main immunogene of virus, thus is targetedly prepared GB antibody is of great significance for detection PRV infection tools.

In the prior art, for serological diagnostic method such as agar gel diffusion test, indirect ELISA, the latex of PRV antibody Agglutination test, hemagglutination-inhibition test and microneutralization test etc., the purity requirement to antigen is too high, therefore can not avoid clinical inspection The nonspecific reaction often occurred during testing, in turn results in the judgement of false positive results, thus also pole be necessary into One step is improved；Although there are blocking ELISA method and reagent based on monoclonal antibody detection PRV gB, expensive, behaviour in foreign countries at present Make duration, it is difficult to adapt to the demand of the current epidemic disease detection of basic unit.

Monoclonal antibody has the advantages that strong specific, high purity, good homogeneity, is that foundation is special, sensitive, steady The key of qualitative good Serology test and colloidal gold immunochromatographimethod detection method available for field quick detection cause of disease.

Therefore, targetedly existing PRV variation strains are separated, studied and to the PRV virus inspections based on monoclonal antibody Survey method is efficiently modified, and the prevention and preventing and treating for PR have highly important application value.

The content of the invention

The application purpose is higher by using one plant of pathogenicity（TCID₅₀Up to 10^-9.77/0.1 mL）Pig puppet it is mad Dog disease variation strain HeNZK-2014 is prepared for PRVgB monoclonal antibody, and utilizes the Antibody preparation detection of finished product Kit and a kind of detection method of step competition law is constructed, so as to judge for PR detection and treatment lays the foundation.

Details are as follows for the technical scheme of the application.

A kind of PRVgB monoclonal antibodies, the antibody prepared based on porcine pseudorabies variation strain HeNZK-2014 and Into being prepared especially by following steps：

First, PRV（Immunizing antigen）Preparation

Will separate identification PRV variation strain HeNZK-2014 expand culture, concentration and after purification, it is standby；

2nd, PRV PRV gB recombinant proteins are prepared（Antigen）

PRV gB recombinant proteins are prepared using technique for gene engineering, its main process is clone's acquisition gB genes, and with After prokaryotic expression carrier pQE30 connections, BL-21 Host Strains are converted, IPTG induced expressions simultaneously purify acquisition PRV gB albumen；

The base sequence of the gB genes is as shown in SEQ ID NO.1；

When cloning gB genes, primer sequence design is as follows：

Primer P1 sequence is：5’- AATAGGATCCGCGCACGTGAACGACATGCTGA -3’；

Primer P2 sequence is：5’-CGGAAGCTTAATGTCGTAGAACTTGAGCGTGTG -3’；

3rd, prepare and identify the monoclonal antibody obtained for PRVgB albumen

For PRVgB protein monoclonal antibodies acquisition firstly the need of to animal injecting virus（Antigen）It is immunized, makes its production Specific antibody is given birth to, is screened after cell fusion and obtains the specific antibody for gB albumen, key step is as follows：

1st, animal immune

PRV after being concentrated and purified obtained in step 1（Variation strain HeNZK-2014）It is adjusted to sterilizing PBS 1.5 mg/mL, mouse is immunized；

2nd, cell fusion

Splenocyte is merged with myeloma cell, turns out survival（Passed on it is preferred that can stablize）Hybridoma；

3rd, the screening of positive hybridoma cell

Containing（It is coated with）To cultivating hybridoma in step 2 on the ELISA Plate of PRV and PRV gB albumen Screened, and further screening obtains the monoclonal antibody cell line that Swine serum blocking can be immunized by PRV；

When carrying out preliminary screening to hybridoma, monoclonal antibody binding capacity is indicated using sheep anti-mouse igg-HRP, is determined after colour developing OD₄₅₀Value, using myeloma cell's culture supernatant as negative control, works as OD₄₅₀When value is not less than 2.1 times of negative controls, sun is judged to Property, as screening gained target cell strain；

When the monoclonal antibody cell line of Swine serum blocking can be immunized in screening by PRV, PRV and PRV gB albumen are being coated with ELISA Plate on be separately added into PRV Swine serum and SPF Swine serums be immunized, indicate monoclonal antibody binding capacity using sheep anti-mouse igg-HRP, OD is determined after colour developing₄₅₀Value, the OD in Swine serum hole is immunized with PRV₄₅₀Value is used as sieve less than SPF pig blood borehole cleaning OD values half is added Select standard.

, monoclonal antibody ascites preparation

By screening gained cell line injection mouse peritoneal in step 3 and cultivated, after culture terminates, abdomen is extracted out from mouse web portion Water simultaneously purifies acquisition monoclonal antibody；

Gained monoclonal antibody hypotype is IgG-2a in the application, potency 1:20 ~ 400,000 or so；

When being purified to monoclonal antibody, it is sad specifically to use -- and saturated ammonium sulphate method is operated；

Further preferably in operation, enzyme mark is carried out using HRP for prepared monoclonal antibody, to further apply detection Kit application and preparation.

The preparation method of the PRVgB monoclonal antibodies.

Using the detection kit prepared by the PRV gB monoclonal antibodies, the kit is used to detect PRVgB albumen Antibody, specifically include：

96 1 piece of hole ELISA detection plates, the anti-Pseudorabies virus monoclonal antibody of enzyme mark 1 bottle (10mL/ bottles), positive and negative control each 2 Manage (1.5mL/ pipes), 20 times of 1 bottle of concentrated cleaning solutions (30mL/ bottles), TMB nitrite ions, terminate liquid each 1 bottle (10mL/ bottles)；

The 96 hole ELISA detection plates are antigen coated microplate, and it is coated with PRVgB recombinant proteins；

The anti-Pseudorabies virus monoclonal antibody of enzyme mark, it is monoclonal antibody after HRP enzyme marks, during actual use, monoclonal resists Body potency is about 1:1000, used diluent is to contain the Tris-cl buffer solutions that mass fraction is 1% BSA；

The negative control is diluted SPF Swine serums or blood plasma, and positive control contains pseudorabies gB to be diluted The Swine serum or blood plasma of antibody, positive control OD values are about 0.20, and negative control OD value is about 1.30；

20 times of concentrated cleaning solutions are 20 times of PBSs containing 1%Tween-20；

TMB mass concentrations are 0.3g/L in the TMB nitrite ions；

The terminate liquid is：Concentration is 2M H₂SO₄Solution.

Using a kind of one-step method competitive ELISA detection method constructed by the detection kit, following behaviour is specifically included Make step：

（1）Reagent constituents are recovered to room temperature, then take out 96 hole ELISA detection plates, and be marked；

（2）Negative control sera, positive control serum and serum to be checked are added in ELISA detection plates；

（3）The anti-Pseudorabies virus monoclonal antibody of enzyme mark is added, is incubated（Specifically such as：Incubated 30 minutes under the conditions of 37 DEG C）；

（4）After incubation terminates, washed with the cleaning solution of working concentration（Working concentration is the PBS bufferings containing 0.05%Tween-20 Liquid）；

（5）TMB nitrite ions are added, are incubated colour developing；

（6）After colour developing terminates, terminate liquid terminating reaction is added；

（7）Spectrophotometric determination OD₄₅₀Value；

First, negative control average value NC is calculatedWith positive control average value P C, work as PC＜ 0.30, and NC＞ 0.80 When, this detection is effective, otherwise needs to detect again；

Negative control average value NC=(NC1+NC2)/2,

Positive control average value（PC）=( PC1+PC2 )/2；

Secondly, S/N values are calculated, calculation formula is： S/N=（NC-S）/( NC-PC)；

If S/N value >=0.4, sample is determined as antibody positive, i.e., contains PRV in sample；

If S/N values ＜ 0.4, sample should be determined as negative antibody, i.e., PRV is free of in sample.

In general, inventor devises specific primer pair by the labor to PRVgB genes, and to the base Because carrying out protein expression and purifying, and then utilize the PRV variation strain having compared with High pathogenicity newly obtained HeNZK-2014 is antigen basis, and BALB/c mouse are immunized, and with immune mouse spleen cell and SP2/0 myeloma Cell fusion simultaneously screens the hybridoma for obtaining stably excreting PRVgB protein monoclonal antibodies, and then obtains high-titer The monoclonal antibody for gB albumen, and the kit of finished product and establish supporting one-step method using the Antibody preparation Competitive ELISA detection method.Pass through a series of specificity, sensitivity, repeatability checking, the results showed that, carried in the application The PRVgB antibody of confession and the one-step method competitive ELISA detection method established, there is more accurate and relatively stable detection knot It fruit, can preferably be used for the check and evaluation of porcine pseudorabies gB antibody, and be laid the foundation for the prevention and control of porcine pseudorabies.

Brief description of the drawings

Fig. 1 is to the double digestion qualification result of cloning vector, wherein M: DNA Marker；1：pGEM-T-gB；

Fig. 2 is to expression vector double digestion qualification result, wherein M: DNA Marker；1：PQE30 empty carriers；2：pQE30-gB；

Fig. 3 is the testing result of albumen after purification, wherein M：Albumen Marker；1：BL-21 is compareed；2、3：Recombination expression PQE30-gB albumen；4、5：PQE30-gB recombinant proteins after purification；

Fig. 4 is that the SDS-PAGE of monoclonal antibody after purification is identified, wherein M:Protein standard； 1:After purification Monoclonal antibody.

Embodiment

Explanation is further explained to the present invention with reference to embodiment, before specific embodiment is introduced, in the present invention Involved partial material situation is briefly introduced and is described as follows.

Primary biological material：

Antigen：Using PRV variation strain of the Henan Province HeNZK-2014 for voluntarily separating acquisition, specifically used height PRV after concentrating and purifying（Referred on the strain specifying information《Chinese animal and veterinary》2017 annual 7th phases Deliver《Porcine pseudorabies virus variation strain HeNZK-2014 separation and identification》In be discussed in detail, the strain belongs at present It can disclose and obtain strain）；

Cell line：SP2/0 strains myeloma cell is purchased from Wuhan Boster Biological Technology Co., Ltd.；

Experimental animal：6 week old female Balb/c mouse（Cleaning grade）, purchased from experimental animal center of henan province；

Plasmid vector：Prokaryotic expression carrier pQE30 is purchased from QIAGEN

Cell：BL21 (DE3) competent cell is purchased from Beijing Suo Laibao Science and Technology Ltd；

Main agents：

Freund's complete adjuvant, incomplete Freund's adjuvant, polyethylene glycol 2000 (PEG2000), Macrogol 6000 (PEG6000) , 8-anaguanine, 50 × HAT, 50 × HT etc. be purchased from Sigma companies；

Horseradish peroxidase-labeled goat anti-mouse（IgG-HRP）Purchased from company of Zhong Shan Golden Bridge；

DMEM in high glucose nutrient solution, hyclone (FBS), purchased from GIBCO companies；

Enzyme base number of a tender thing TMB, dimethyl sulfoxide (DMSO) (DMSO), dual anti-it is purchased from promega companies；

Mouse monoclonal hypotype identification kit, purchased from the logical experiment material center difficult to understand of Luoyang one hundred；

Pseudorabies virus gB antibody assay kits, pseudorabies virus gPI antibody assay kits, purchased from IDEXX companies；

Main solution and culture medium have：

DMEM complete mediums (contain 8-anaguanine)：15%（Volume ratio）Hyclone, Pen .- Strep mixed solution （100U/mL）, 1 × 8-anaguanine solution（20μg/mL）；

50% PEG2000 solution：10g PEG2000 are weighed, 121 DEG C of high pressure 30min sterilizings, are added when being cooled to 50 DEG C~60 DEG C Incomplete culture medium DMEM after 10mL sterilizings, mixes, is sub-packed in the Eppendorf pipes of the 1.50mL specifications after autoclaving, Often pipe 1mL, -20 DEG C save backup；

HAT selects nutrient solution：1 × HAT solution（50 × HAT dilutes 50 times）, 20%（Volume ratio）Hyclone, penicillin-chain Mycin mixed solution（100U/mL）, it is well mixed, 4 DEG C save backup；

HT nutrient solutions：1 × HT solution（50 × HAT dilutes 50 times）, 20%（Volume ratio）Hyclone, Pen .- Strep mix Close solution（100U/mL）, it is well mixed, 4 DEG C save backup；

Cells frozen storing liquid：90%（Volume ratio）Hyclone, 10%（Volume ratio）DMSO (DMSO), it is well mixed, 4 DEG C of preservations It is standby.

Embodiment 1

The present embodiment is just briefly discussed below for the qualification process for preparing of PRVgB monoclonal antibodies.

First, PRV（Immunizing antigen）Preparation

To PRV（Antigen）Preparation be mainly virus expansion culture, concentration and purifying, correlation step is briefly situated between Continue as follows.

1st, the Henan Province PRV variation strain HeNZK-2014 voluntarily separated is uploaded in PK-15 cells and be commissioned to train Support；

According to Reed-Muench methods, with the cytopathy of PK-15 cells（CPE, cytopathic effect）For result, to this The Preliminary Results of strain show, its TCID₅₀Up to 10^-9.77/0.1 mL；

Virulent nutrient solution multigelation will be contained 3 times by expanding after culture terminates, then molten with 0.1% formaldehyde under the conditions of 37 DEG C Nutrient solution is inactivated 18h by liquid（That is inactivation of viruses）；

2nd, take 500mL to be cultivated after inactivating, 4 DEG C, 2000rpm centrifugation 10min, take supernatant；

3rd, final concentration of 0.5mol/L NaCl is added into supernatant（Contribute to the precipitation of virus）, add final concentration 10%（Mass volume ratio）PEG6000, during addition, side edged is gently mixed mixing, and 4 DEG C of dissolvings are overnight（Ensure that PEG6000 is abundant Dissolving）；

4th, to solution after the precipitation of step 3,4 DEG C, 8500rpm centrifugation 30min, supernatant is abandoned, leaves and takes precipitation；

5th, the precipitation obtained is resuspended with PBS sterile 1.5mL, is transferred in bag filter, is placed in the PBS of 2L precoolings In dialysed；A dialyzate is changed per 4h, to dialysed overnight at the 3rd time；

6th, after dialysis terminates, concentrated with sucrose, be then dispensed into by 500 μ L/ branch in EP pipes, -80 DEG C of preservations；And utilize Ultraviolet specrophotometer and BCA carry out protein quantification, and protein quantification result is 1.5mg/mL.

2nd, PRV PRV gB albumen is prepared（Antigen）

PRV PRV gB albumen（Antigen）Prepared by technique for gene engineering, i.e., first by cloning gB bases Cause, after being then connected with suitable carrier, then convert suitable host carry out accurate translation after, extract simultaneously can further obtain after purification Obtain the gB albumen of high-purity（Antigen）, detailed process is briefly described as follows：

First, still by taking PRV variation strain of Henan Province HeNZK-2014 as an example, PRV DNA is extracted, with This is template, enters performing PCR using following primer sequence, obtains gB Main Antigenic Regions gene（Gene order such as SEQ ID Shown in NO.1）；

Primer P1 sequence is：5’- AATAGGATCCGCGCACGTGAACGACATGCTGA -3’；（Wherein GGATCC parts Sequence is the restriction enzyme sites of BamH I）

Primer P2 sequence is：5’-CGGAAGCTTAATGTCGTAGAACTTGAGCGTGTG -3’；（Wherein AAGCTT parts Sequence is Hind Ш restriction enzyme sites）

Second, using Hind Ш enzymes and the enzymes of BamH I respectively to the cloning vector of connection target gene（Digestion qualification result such as Fig. 1 It is shown）Double digestion is carried out with prokaryotic expression carrier pQE30, is then attached digestion products, prokaryotic expression after structure restructuring Carrier pQE30-gB621（Digestion qualification result is as shown in Figure 2）；

3rd, constructed prokaryotic expression carrier pQE30-gB621 is converted into BL-21 Host Strains, IPTG induced expressions, albumen Size is about 27KDa, in the same size with expection；

4th, after induced expression terminates, extract and purify acquisition gB albumen（Antigen）（Qualification result is as shown in Figure 3）.

3rd, prepare and identify the monoclonal antibody for PRVgB albumen

For PRVgB albumen acquisition firstly the need of to animal injecting virus（Antigen）It is immunized, it is produced antibody, then Screening obtains the specific antibody for gB albumen, and correlation step is summarized as follows.

, animal immune

（1）PRV after being concentrated and purified obtained in step 1（Variation strain HeNZK-2014）Adjusted with sterilizing PBS It is whole to 1.5 mg/mL, take a certain amount of（Such as 100 μ L）Viral solution and the Freund's complete adjuvant of equal volume amounts fully mix breast Change；

（2）Healthy mice 4 is chosen, after it adapts to environment, 200 μ L steps are injected in the subcutaneous branch of every mouse back （1）Virus and Freund's adjuvant mixed liquor after middle emulsification；

（3）Emulsify equivalent virus with incomplete Freund's adjuvant again respectively and be immunized again twice within the 15th, 30 day after first immunisation（Disease Malicious dosage halves relative to first immunisation dosage）, position is immunized and is injected alternately for intraperitoneal injection and subcutaneous branch；

（4）Latter all tail vein bloods are immunized in third time, separate serum, utilize commercialization Pseudorabies virus gB antibody test finished products Kit determines the antibody level in every Mice Body；

It is preferable to immune effect according to the antibody level result of measure（Select antibody titer highest and more than 1:200000）It is small Mouse is in subsequent experimental（Cell fusion is tested）Booster immunization once, 100 μ L of intraperitoneal injection can be used during booster immunization again in first three day It is not added with the viral solution of adjuvant；And the undesirable mouse of immune effect can be carried out four exempt from, five exempt from, immunization method and position are same It is upper described.

, cell fusion

（1）Recovery and culture myeloma cell：In cell fusion the last fortnight or so, start to recover and cultivate myeloma cell SP2/ 0, detailed process is briefly discussed below：

A, by super-clean bench cotton ball soaked in alcohol wiped clean, super-clean bench is irradiated at least 30min with uviol lamp, opens ultra-clean typhoon Machine；

B, the SP2/0 cell cryopreservation tubes frozen are taken out from liquid nitrogen container, is put into rapidly in 37 DEG C of water-baths, is gently shaken and freeze Pipe, make to freeze liquid in pipe and melt completely；

C, cryopreservation tube is taken out, 1000r/min centrifugation 5min, is discarded with suction pipe gentle aspiration supernatant；

D, about 1mL DMEM complete mediums are added, cell has gently been hanged, has moved into ready cell bottle, be supplemented 5mL DMEM complete mediums；

E, Tissue Culture Flask is gently shaken, makes cell distribution uniform, puts 37 DEG C, containing 5% CO₂Cultivated in cell culture incubator, 24h After observe, after cell attachment change cell culture fluid continue to cultivate；

F, the DMEM complete mediums containing 20 μ g/mL8- azaguanine are replaced by within 1 week before cell fusion（To keep HGPRT to lack Swaged）；

G, on the day of fusion, exponential phase will be in, well-grown SP2/0 cells piping and druming is got up, and moves to sterile centrifugation tube In, 1000r/min centrifugation 10min, upper strata culture medium is discarded, collects cell, add the incomplete RPMI-1640 cultures of 20mL Liquid washed once, and cell suspends again after centrifugation, expect blue dyeing with platform, tally living cell counting is standby.

（2）Prepare feeder cells（Macrophage）

8 ~ 10 week old health BALB/c mouse one are taken, eyeball blood sampling, separate negative serum, after mouse loses blood death, leaching Steep and sterilize 5min in 75% alcohol, be fixed in super-clean bench on plastic plate；

Lift skin of abdomen with the pincet after sterilization, with scissors abdominal cut skin（It is careful not to break peritonaeum）, by belly Skin, which pulls open, to be fixed on plastic plate, peritonaeum is fully exposed；

The HAT selection nutrient solutions that 8~10mL precoolings are drawn with sterile disposable syringe are expelled in mouse peritoneal, are kept Syringe is motionless, and the min of belly 1 is gently rubbed with the pincet of sterilizing, then intraperitoneal nutrient solution is suctioned out with syringe, now cultivates Macrophage contained in liquid etc. can be used as feeder cells；

The concentration of feeder cells in culture medium is adjusted, makes it 1 × 10⁵Individual/mL or so, the culture medium for adjusting concentration is put It is standby in plate after sterilization.

（3）Prepare splenocyte

Take the BALB/c mouse being immunized（Immunized mice in step 1,3 days booster immunizations before experiment）, eyeball blood sampling, separation Serum is as positive control；

Mouse cervical dislocation is put to death, is soaked in 75% alcohol and sterilizes 5min, is fixed in super-clean bench on plastic plate；

Lift skin of abdomen with the pincet after sterilization, with scissors abdominal cut skin and peritonaeum, find spleen, with sterile small tweezer Son is removed；

The spleen removed is put into in the sterilized petri dishes for filling incomplete DMEM nutrient solutions slightly clear Xian, peels off surface fat and knot Form tissue；

Then it is placed on the 200 mesh copper mesh that autoclaving is crossed and shreds, the piston crossed with autoclaving grinds spleen, Bian Yan Incomplete DMEM nutrient solutions are added dropwise in edging, until spleen is ground completely, then is cannotd be used up full DMEM nutrient solutions and rinsed screen cloth, make spleen Cell is entered in beaker by screen cloth completely；

Finally, it is the collected nutrient solution 1000r/m centrifugation 10min collection splenocytes containing splenocyte is standby.

（4）Cell fusion

By step（3）The splenocyte and step of preparation（1）The myeloma cell SP2/0 of preparation, by cell quantity 1：5~10 Ratio is well mixed, and then 1000r/m centrifuges 10min, outwells supernatant, flicking ttom of pipe makes its loose；

37 DEG C of distilled water are added in a clean beaker, the centrifuge tube containing cell mixing are placed in water-bath, in 1min 1 mL, 37 DEG C of PEG2000 preheated are added dropwise, the rotating centrifugal pipe when being added dropwise, add the rear s of warm bath 90；

Then 1 mL, 37 DEG C of incomplete DMEM nutrient solutions preheated are added dropwise in 1min；2 are added dropwise in 1min again ML, 37 DEG C of incomplete DMEM nutrient solutions preheated；4 mL are added dropwise in 1min again, the incomplete DMEM of 37 DEG C of preheatings is trained Nutrient solution；Finally added with the incomplete DMEM nutrient solutions of 37 DEG C of preheatings to 20 mL；

Last 1000r/min centrifuges 5 min, outwells supernatant；

Collected cell precipitation is resuspended in the HAT selection nutrient solutions containing 20% hyclone, is well mixed；Simultaneously will system The feeder cells got ready are added by same volume, are well mixed again；

It is transferred to multichannel pipettor in 96 porocyte culture plates, per hole 200 μ L, saturated humidity, 5%CO₂, 37 DEG C of cultures.

, positive hybridoma cell screening and subclone

（1）The screening of positive hybridoma cell

Cell after being merged in step 2 was changed into a subculture every 2~4 days, using partly changing liquid mode when replacing, 100 μ L culture mediums are discarded, add the new HAT selection nutrient solutions of 100 μ L；

After fusion during 7~8d, start to observe cell, the plate for the hybridoma that can stablize passage is marked on Tissue Culture Plate Hole；

When hybridoma covers with bottom hole more than 1/10, PRV antigen is being coated with（It is prepared by step 1）And gB Albumen（It is prepared by step 2）ELISA Plate on be separately added into accordingly containing the cell conditioned medium on Hybridoma Cell Culture plate, 37 DEG C of temperature Educate 1 hour；

Cleaning solution washs five times, adds the sheep anti-mouse igg-HRP, 37 DEG C of reaction 60min of 1: 4000 dilution；

After washing five times again, nitrite ion colour developing 15min is added, after 2M concentrated sulfuric acid terminating reactions, is surveyed with ELIASA per hole OD₄₅₀ Readings；

The culture supernatant of SP2/0 cells is set as negative control simultaneously；Work as OD₄₅₀When value is more than 2.1 times of negative controls, it is judged to It is positive；

Selection growth is vigorous, and the good positive cell hole of form is cloned with limiting dilution assay；

The positive colony hole supernatant screened is examined with PCV2, PPV, O-shaped FMDV, CSFV and PRRSV detection kit respectively Survey its cross reactivity, by with the alternately cell of the hybridoma on the culture plate of this 5 kinds of equal no cross reactions of virus Strain（Screening obtains 38 strain of hybridoma strains altogether）.

（2）The subclone of positive hybridoma cell

By step（1）In culture plate in alternative cell line carry out indirect ELISA detection, positive hybridoma will be detected Cell is blown afloat, and is moved into 24 porocyte culture plates, after it is covered with, blows afloat mixing and cell count again；

After counting, 10 cell/mL are diluted to the HT nutrient solutions containing 20% hyclone, by the cell suspension of this concentration Add to be covered with 96 porocyte culture plates of feeder cells in advance according to 100 μ L/ holes and cultivate.

Above-mentioned screening step is repeated, while is frozen after the remaining cell after each cloning is expanded into culture, in order to avoid lose Lose.

By 5 subclones（Screening）Afterwards, can be true when the supernatant in all cloning cell holes is all positive after testing The fixed cell line for having obtained secrete monoclonal antibody, its final the selection result are as follows：

Culture is further expanded to cell line obtained by above-mentioned screening, it is standby.

（3）The specificity identification of monoclonal antibody

Using indirect elisa method, 6 plants of obtained monoclonal antibodies are utilized（Above-mentioned steps（2）Secreted by screening gained cell line Antibody）It is specific with PRV gE, PCV-2, PPV, CSFV, PRRSV antigen and coli somatic albumen reaction detection, with P/N >=2.1 are judged to the positive, and detection sets blank, the positive, negative control simultaneously and analyzed：

。

（4）The Screening and Identification of monoclonal antibody can be blocked by gB Positive Seras

It is being coated with antigen（Respectively the PRV viral antigens of step 1 and the gB albumen of step 2）ELISA Plate on plus 100 μ L Swine serum and SPF Swine serums, 37 DEG C of incubation 60min are immunized in the PRV diluted；

After washing five times, step is added（2）The middle μ L of supernatant 100 for screening the corresponding culture plate for obtaining cell line, 37 DEG C anti- Answer 60min；

Washing five times, add 1:Sheep anti-mouse igg-the HRP of 4000 dilutions, reacts 30min；

Board-washing five times again, nitrite ion is added, surveyed after 10 minutes with ELIASA per hole OD₄₅₀Readings.

As the OD for adding the immune Swine serum holes of PRV₄₅₀When value is less than SPF pig blood borehole cleaning OD value half or so is added, this list Anti- is the monoclonal antibody that can be blocked by gB Positive Seras（I.e. screening is obtained in cell line supernatant containing corresponding antibody）.

The monoclonal antibody cell that two plants of acquisition can be secreted has identical combination site with gB Positive Seras is named as： PRV-gB-6E9 and PRV-gB-10G4.

（5）Cell cryopreservation

By form is good, eugonic hybridoma（That is step（3）The obtained cell PRV-gB-6E9 of middle screening and PRV-gB-10G4 piping and druming is uniform, 1000r/min centrifugation 5min, collects cell；

Cell is hanged with 1mL cells frozen storing liquids, is added in cell cryopreservation tube, while carries out mark, cryopreservation tube is put in jelly Deposit and put in box in -70 DEG C of low temperature refrigerators overnight, finally put into liquid nitrogen container, and make a record.

4th, the preparation of monoclonal antibody ascites

In inoculation positive hybridoma cell strain（That is above-mentioned steps（5）Middle institute's freeze-stored cell）It is the last week, female to every 8-12 week old Property BALB/c mouse peritoneal injection 0.5mL incomplete Freund's adjuvants；During this period, positive monoclonal hybridoma cell strain is entered Row expands culture；

After one week, the cell that will be enlarged by culture is blown down from cell bottle, is resuspended with serum-free without dual anti-DMEM nutrient solutions, washing Twice time, 1000r/min centrifugations 5min, Trypan Blue are counted, and cell density is adjusted into 1 × 10⁶~2 × 10⁶Individual/mL, often Mouse peritoneal injection 0.5mL cell suspensions；

Observation mouse web portion daily after inoculating cell, treats that mouse web portion substantially expands, during moving difficulty（Probably need 5 ~ 7 days）, Mouse cervical dislocation is put to death, suctions out the liquid of kermesinus, 8000r/min centrifugations from mouse web portion with asepsis injector 10min, limpid supernatant is taken to dispense, mark, -20 DEG C save backup.

, monoclonal antibody characteristic identification

（1）The measure of Subclass of antibody：

Hypotype identification is carried out to monoclonal antibody with mouse monoclonal hypotype identification kit, detailed process is：

The μ L of ascites supernatant 200 are drawn, adds and has been coated with the elisa plate of PRV viruses, 37 DEG C, are incubated 60min；

PBST solution board-washing 5 times, and pat dry；Add 1:The hypotype secondary antibody of 2000 times of dilutions, 37 DEG C, it is incubated 30min；

PBST solution board-washing 5 times, and pat dry；

Tmb substrate is eventually adding, 37 DEG C of 10 ~ 15min of incubation, adds terminate liquid, OD₄₅₀Reading, finally determine that two plants of monoclonals resist Body hypotype is IgG-2a.

（2）The concentrating and purifying of monoclonal antibody ascites and titration

By 1:2 volume ratio, 0.06mol/L acetate buffer solutions are added in prepared ascites in step 4, on magnetic stirring apparatus Slowly mix；

Octanoic acid is slowly added to while stirring in the μ L/mL of final concentration 33 ratio, is added in 30min；4 DEG C, stand 2h, 12000r/ Min centrifuges 30min, abandons precipitation, supernatant is through nylon net filter；

The 0.01mol/L of 1/10 volume PBS is added, pH is adjusted into 7.4,4 DEG C with 1mol/L NaOH slowly adds while stirring Enter saturation（NH₄)₂SO₄(ph=7.4) make（NH₄)₂SO₄Concentration reaches 45%, stands 30min；

4 DEG C, 12000r/min centrifugation 30min, abandon supernatant；Precipitation is resuspended in 0.01M/L PBS；0.01M/L PBS desalinations, Ascites after can finally being concentrated and purified.

To determine Monoclonal Antibodies in Mice Ascites potency, mouse ascites after concentrating and purifying are made into 2 times of gradient dilutions, from 1：800 ~1：1638400 times, with being coated with PRV antigen（It is prepared by step 1）With gB albumen（It is prepared by step 2）Enzyme mark Plate detects titer of ascites；Make negative control with SP2/0 cell conditioned mediums, normal mouse ascites simultaneously, virus-positive serum does the positive Control；Specific criterion is：Ascites maximum dilution multiple during S/N ＞ 2.1 is the ELISA potency of ascites.

Measurement result shows that PRV-gB-6E9 and PRV-gB-10G4 potency are respectively 1:400000 and 1:200000.

（3）The repeated pruning of hybridoma

A, hybridoma subculture in vitro separately is tested

By above-mentioned 2 strain of hybridoma strain after 5 time cloning cultures, 24 orifice plate cultures, continuous passage 2 months, every are transferred to A cells and supernatant is collected every 5 generations, the antibody titer of Hybridoma Cell Culture supernatant is determined using indirect elisa method, Potency situation of change is to analyze the stability of the cell line before and after contrast passage, and the experimental results are shown inthe following table：

Hybridoma subculture in vitro separately experimental result：

The above results show that 2 strain of hybridoma strains can stablize passage in vitro.

, the experiment of hybridoma continuous cryopreservation resuscitation

Recovered after above-mentioned 2 strain of hybridoma is frozen one month, observe cell growth condition, used after its subculture is stable The antibody titer of its culture supernatant of ELISA indirect Determinations, is then frozen again, and recovery is taken out after 1 month, is so continuously frozen multiple Soviet Union 3 times.Analysis is compared to the antibody titer measured value of Hybridoma Cell Culture supernatant, it is as a result as shown in the table：

Hybridoma recovering experiment result：

。

The above results show, 2 strain of hybridoma strains can be in well-grown in recovery 15 times.

C, ascites continuous passage is tested

By 2 strain of hybridoma using ascites method production ascites is induced in vivo, after collecting ascites, gather ascites cells and count, By 1 × 10⁶~5 × 10⁶Individual to be inoculated in mouse peritoneal, continuous to pass for 4 generations, measure mouse respectively enters for the potency of ascites, and by result Row compares, as a result as shown in the table：

Monoclonal antibody is respectively for titer of ascites：

。

The above results show, 2 strain of hybridoma strains equal well-grown in continuous 4 generation ascites succeeding generations.

, monoclonal antibody purifying

Due to often containing non-specific IgG molecules and other unrelated eggs in Mice Body in the ascites containing monoclonal antibody Bai Chengfen, therefore further separation, purification are typically both needed to, in case experiment use.This experiment is using octanoic acid -- and saturated ammonium sulfate sinks Shallow lake method, the ascites containing monoclonal antibody is purified.Concrete operation step is as follows：

（1）The pretreatment of ascites：By the ascites of collection under the conditions of 2~8 DEG C, centrifuged 30 minutes with 8000r/min, remove cell Residue and finely ground particle substance.

（2）Add 2 parts of acetate buffers in the ascites pretreated to 1 part（0.06mol/L, pH value 5.0）, use 0.1mol/L HCl adjust pH value to 4.5.

（3）It is stirred at room temperature down and octanoic acid was added dropwise in 30 minutes, adds 33 μ l by the ascites before every milliliter of dilution, 2 ~8 DEG C stand 2 hours, are centrifuged 30 minutes with 8000r/min, abandon precipitation.

（4）Supernatant filters through sand core funnel, adds the PBS of 1/l0 volumes（0.1mol/L, pH value 7.4）, with lmol/L's NaOH adjusts pH value to 7.4.

（5）30 minutes are stood under 2~8 DEG C of ice baths, 0.277g/mL ammonium sulfate is added, 45% saturation degree, stands 1 More than hour, centrifuged 30 minutes with 8000r/min, abandon supernatant.

（6）Precipitation is dissolved in the PBS of 1/3 ascites volume, and the above-mentioned PBS of 50~100 times of volumes is placed under the conditions of 2~8 DEG C Dialysed 12 hours in liquid, under the conditions of 2~8 DEG C, centrifuged 30 minutes with 8000r/min, remove infusible precipitate.

SDS-PAEG electrophoresis is carried out to the monoclonal antibody of 6E9H7 cell lines after purification, dyes and records result, as a result such as Shown in Fig. 4.

, monoclonal antibody enzyme mark

Enzyme mark is carried out using HRP after purification to 6E9H7 cell lines secrete monoclonal antibody, detailed process is：

（1）Weigh 5mg HRP to be dissolved in 1mL distilled water, add the 0.1mol/LNaIO that 0.2mL newly matches somebody with somebody₄Solution, keep away at room temperature Light stirs 20 minutes；Solution is fitted into bag filter, uses 1mmol/L sodium-acetate buffer（PH value 4.4）Dialysis, 2 DEG C ~ 8 DEG C overnight；

（2）Add 0.2mol/L carbonate buffer solutions（PH value 9.5）20 μ L, the pH value for making above hydroformylation HRP is increased to 9.0~ 9.5, the monoclonal antibody of 10mg purifying is added immediately after, in 1mL carbonate buffer solutions（0.01mol/L）, room temperature lucifuge It is gently mixed 2 hours；

（3）Add the NaBH newly matched somebody with somebody₄Solution（4mg/mL）0.1mL, mix, put at 2 DEG C ~ 8 DEG C 2 hours, then in PBS （0.01mol/L, pH value 7.2）Dialysis, 2 DEG C ~ 8 DEG C overnight；

（4）100g ammonium sulfate is weighed, 90mL water is added and dissolves by heating, room temperature cooling is then placed on, waits ammonium sulfate crystallization to separate out After stable, ammonification water adjusts pH value to 7.6；Then the horseradish peroxidase after dialysis and antibody response liquid（That is step（3）Dialysis Reaction solution afterwards）In, isometric saturated ammonium sulfate is added dropwise while stirring, 2 DEG C ~ 8 DEG C stand 3 hours；

（5）8000r/min is centrifuged 30 minutes, abandons supernatant；Sediment 1mLPBS buffer solutions（0.01mol/L, pH value 7.2）It is molten Solution, backmost rocks side and 0.5mL saturated ammonium sulfates is added dropwise, and its final concentration is reached 33%, and 2 DEG C ~ 8 DEG C stand 3 hours；

（6）8000r/min is centrifuged 30 minutes, abandons supernatant, and precipitation uses 1mL PBS（0.01mol/L, pH value 7.2）Dissolving；

（7）Use PBS（0.01mol/L, pH value 7.2）Dialysis, after removing ammonium ion（Detected with Nai Shi reagents）, with 8000r/min is centrifuged 30 minutes and is removed precipitation, and supernatant is monoclonal antibody linked with peroxidase, and after packing, -20 DEG C save backup.

Embodiment 2

Utilize the monoclonal antibody prepared by embodiment 1（By taking 6E9H7 cell line secrete monoclonal antibodies as an example）It can be used for making Standby typical detection PRV gB antibody one-step method competitive ELISA kit, the kit detect including ELISA The anti-Pseudorabies virus monoclonal antibody of plate, enzyme mark, TMB nitrite ions, terminate liquid etc., are briefly discussed below.

PRV gB antibody one-step method competitive ELISA kit is detected, including：96 hole ELISA detection plates 1 Block, the anti-Pseudorabies virus monoclonal antibody of enzyme mark 1 bottle (10mL/ bottles), each 2 pipe (1.5mL/ pipes) of positive and negative control, 20 times dense 1 bottle of contracting cleaning solution (30mL/ bottles), TMB nitrite ions, terminate liquid each 1 bottle (10mL/ bottles)；

The 96 hole ELISA detection plates are antigen coated microplate, are specifically prepared as follows：By the gB proteantigens of purifying （Embodiment 1）Use carbonate buffer solution（pH9.6）To be coated with μ g/mL of concentration 0.5, be added on polystyrene micropore by 100 μ L/ holes amount Plate（96 hole ELISA detection plates）In, 4 DEG C stand overnight, and wash once；Measured by 150 μ L/ holes and add confining liquid（Contain mass fraction The phosphate buffer of 0.5% casein（PH 7.4 ± 0.1, concentration 0.2mol/L））, 4 DEG C stand overnight；Juxtaposition is dried to dry Room dry, be preferably encased in the packaging containing drier be sealed it is standby；

The anti-Pseudorabies virus monoclonal antibody of enzyme mark, it is monoclonal antibody after the enzyme mark prepared by embodiment 1, actually uses When, often need to suitably it be diluted according to the potency of every batch of enzyme mark monoclonal antibody, potency is about 1 after dilution:1000, it is used dilute during dilution It is containing the Tris-cl buffer solutions that mass fraction is 1% BSA to release liquid；

20 times of concentrated cleaning solutions are 20 times of PBSs containing 1%Tween-20；；

TMB mass concentrations are 0.3g/L in the TMB nitrite ions；

The terminate liquid is：Concentration is 2M H₂SO₄Solution.

The application method of the detection PRV gB antibody one-step method competitive ELISA kit, it is specially：

Before use, all kit components should return to 18 ~ 26 DEG C.Reagent gently should rotate or vibrate mixing, each sample Product use a single suction nozzle.

(1) PRV antigen coated microplates are taken out, in recording sheet（Table）Marked on upper or coating plate and record sample position；

(2) plus 25 μ L negative control seras are to A1, B1 hole, and 25 μ L positive control serums to C1, D1 hole, 25 μ L measuring samples are extremely Corresponding hole；

By taking 96 hole ELISA detection plates as an example, concrete arrangement is as follows：

；

(3) the 50 anti-Pseudorabies virus monoclonal antibodies of μ L enzyme marks are added per hole, are incubated 30 minutes under the conditions of 37 DEG C（± 1 point Clock）；

(4) it is incubated after terminating, about 300 μ L 1 is used per hole:The concentrated cleaning solution washing micropore of 20 times of dilutions 3 ~ 5 times；Every time After washing, the liquid in hole is got rid of, after last time dries, antigen coated microplate is gently detained on absorbent material, is thoroughly removed surplus Remaining liquid；

(5) 100 μ L TMB nitrite ions are added per hole；Room temperature（18~23℃）It is incubated 15 minutes；

(6) 50 μ L terminate liquid terminating reactions are added per hole；

(7) enter line blank setting to ELIASA using air as blank control, measure and record sample under the conditions of 450nm and own The light absorption value OD values of control（OD450nm）, each sample S/N values are calculated according to following formula；

Negative control average value（NC）NC=( NC1+NC2 )/2；

Positive control average value（PC）PC=( PC1+PC2 )/2；

Criterion is set up in experiment：PC＜ 0.30；NC＞ 0.80.If experiment is invalid, the operation in experiment is doubtful, It should reform according to operational manual and once test.

The calculating of S/N values： S/N=（NC-S）/( NC -PC)；（S refers to the OD values of sample to be checked in bracket）

If S/N value >=0.4, sample should be determined as antibody positive；

If S/N values ＜ 0.4, sample should be determined as negative antibody.

Embodiment 3

The application effect of the kit provided for checking embodiment 2, sensitiveness, specificity, accuracy, repetition have been carried out to it Property etc. detection, correlation test is briefly discussed below.

Sensitivity Detection

70 not immune health pigs are divided into 7 groups, the PRV gB antibody of different times swinery after immune swine puppet rabies vaccine is entered Row monitoring, is detected, testing result is as shown in the table with this kit to the serum sample of collection.

Sensitiveness is verified：

。

It is can be seen that from upper table data when immune 14 days most of serum is detected as the positive, sample is whole after 21 days The positive is detected as, illustrates that the sensitivity of kit is preferable.

Specific test

Detect swine fever, pig blue-ear disease, Porcine circovirus desease, the pig parvoviral in commercial kit respectively using kit Disease, the standard positive serum sample of pig O type aftosas, testing result are as shown in the table.

Specificity verification：

。

It is can be seen that from upper table data in addition to S/N value >=0.4 of PRV standard positive serums, remaining serum S/N values exist Between 0.12~0.23, it is determined as feminine gender, shows that kit specificity is good, with other pathogenic autoantibody positive serums without friendship Fork reaction.

Accuracy comparison test

Detected simultaneously from 28 differently with IDEXX gB antibody blocking method antibody assay kits and the kit of the present invention 1025 parts of the clinical pig anteserum sample on city pig farm, wherein 297 parts of child care pig, 563 parts of growing and fattening pigs, 165 parts of sow, calculate Go out respective S/N values, detect the specificity and sensitiveness of this method.Testing result is as shown in the table：

With the airworthiness compliance of commercial kit：

。

As can be seen from the above table, the positive coincidence rate of two kinds of kit detection samples is 98.5%, the coincidence rate of negative sample For 100%, total coincidence rate is 98.9%.

Replica test

30 parts of known background Swine serum is detected respectively with the PRV gB competitive ELISAs antibody assay kit of trial-production, Wherein 10 parts of low value sample, 10 parts of intermediate value sample, 10 parts of high level sample.With 3 batches of kits, 5 kits of every batch of use, to the above 30 parts of blood serum samples carry out 5 repetitions and detected, and calculate 5 repetition average values, draw the coefficient of variation：

。

As a result show, variation within batch coefficient between 3.8% ~ 12.8%, interassay coefficient of variation 9.7% ~ 14.0% it Between, meet the requirements.

SEQUENCE LISTING

<110>Henan Provincial Center for Animal Disease Control and Prevention

<120>A kind of PRV gB monoclonal antibodies and its application

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 603

<212> DNA

<213> Pseudorabies virus HeNZK-2014

<400> 1

gcgcacgtga acgacatgct gagccgcatc gcggccgcct ggtgcgagct gcataacaag 60

gaccgcaccc tgtggggcga gatgtcgcgc ctgaacccca gcgccgtggc cacggccgcg 120

ctgggccagc gcgtctcggc gcgcatgctc ggcgacgtga tggccatctc gcggtgcgtg 180

gaggtgcgcg gcggcgtgta cgtgcagaac tccatgcgcg tgcccggcga gcgcggcacg 240

tgctacagcc gcccgctggt gaccttcgag cacaacggca cgggcgtgat cgagggccag 300

ctcggcgacg acaacgagct cctcatctcg cgcgacctca tcgagccctg caccggcaac 360

caccggcgct actttaagct gggcggcggg tacgtgtact acgaggacta cagctacgtg 420

cgcatggtgg aggtgcccga gacgatcagc acgcgggtga ccctgaacct gacgctgctc 480

gaggaccgcg agttcctgcc cctcgaggtg tacacgcgcg aggagctcgc cgacacgggc 540

ctcctggact acagcgagat ccagcgccgc aaccagctgc acacgctcaa gttctacgac 600

att 603

Claims

1. a kind of PRV gB monoclonal antibodies, it is characterised in that be made by the steps and form：

First, porcine pseudorabies virus is obtained, PRV variation strain HeNZK-2014 is expanded into culture, concentrates and purifies Afterwards, it is standby；

2nd, PRV PRV gB albumen is prepared, PRV gB albumen is prepared using technique for gene engineering, its main mistake Cheng Wei, clone obtain gB genes, and after be connected with expression vector, convert Host Strains, and induced expression simultaneously purifies acquisition PRV gB eggs In vain；

3rd, the monoclonal antibody obtained for PRVgB albumen is prepared and identifies, key step is as follows：

（1）Animal immune, mouse is immunized in PRV after being concentrated and purified obtained in step 1；

（2）Cell fusion, splenocyte is merged with myeloma cell, turns out the hybridoma of survival；

（3）Positive hybridoma cell is screened, to step on the ELISA Plate containing PRV and PRV gB albumen（2）In Cultivated hybridoma is screened, and further screening obtains the monoclonal antibody cell line that can be blocked；

（4）Monoclonal antibody ascites is prepared, by step（3）Cell line injection mouse obtained by middle screening is simultaneously cultivated, culture knot Shu Hou, extract ascites out from mouse web portion and purification obtains monoclonal antibody.

2. PRV gB monoclonal antibodies as claimed in claim 1, it is characterised in that in step 2, the base sequence of the gB genes Row are as shown in SEQ ID NO.1；

When cloning gB genes, primer sequence design is as follows：

Primer P1 sequence is：5’- AATAGGATCCGCGCACGTGAACGACATGCTGA -3’；

Primer P2 sequence is：5’-CGGAAGCTTAATGTCGTAGAACTTGAGCGTGTG -3’.

3. the preparation method of PRV gB monoclonal antibodies described in claim 1, it is characterised in that comprise the following steps：

（3）Screen positive hybridoma cell, on the ELISA Plate containing PRV and PRV gB albumen to step 2 in institute Culture hybridoma is screened, and further screening obtains the monoclonal antibody cell line with blocking effect；

（4）Monoclonal antibody ascites is prepared, by step（3）Cell line injection mouse obtained by middle screening is simultaneously cultivated, culture knot Shu Hou, take out ascites from mouse web portion and purification obtains monoclonal antibody.

4. the preparation method of PRV gB monoclonal antibodies as claimed in claim 3, it is characterised in that step（3）In, to hybridoma When cell carries out preliminary screening, monoclonal antibody binding capacity is indicated using sheep anti-mouse igg-HRP, OD is determined after colour developing₄₅₀Value, with myeloma Cells and supernatant is negative control, works as OD₄₅₀When value is not less than 2.1 times of negative controls, the positive is judged to, as screening gained Target cell strain；

When screening the monoclonal antibody cell line that can be blocked, on the ELISA Plate of PRV and PRVgB albumen is coated with respectively Add PRV and Swine serum and SPF Swine serums is immunized, indicate monoclonal antibody binding capacity using sheep anti-mouse igg-HRP, OD is determined after colour developing₄₅₀ Value, the OD in Swine serum hole is immunized with PRV₄₅₀Value is less than addition SPF pig blood borehole cleaning OD value half as screening criteria.

5. utilize the detection kit prepared by PRV gB monoclonal antibodies described in claim 1, it is characterised in that specific bag Include：

1 piece of ELISA detection plates, the anti-Pseudorabies virus monoclonal antibody of enzyme mark, negative control, positive control, cleaning solution, TMB show Color liquid, terminate liquid；

The ELISA detection plates are antigen coated microplate, and it is coated with PRV gB albumen；

The anti-Pseudorabies virus monoclonal antibody of enzyme mark, it is monoclonal antibody after HRP enzyme marks；

The negative control is diluted SPF Swine serums or blood plasma, and positive control contains pseudorabies gB to be diluted The Swine serum or blood plasma of antibody；

The cleaning solution is the PBS containing 0.05%Tween-20；

TMB mass concentrations are 0.3g/L in the TMB nitrite ions；

The terminate liquid is：Concentration is 2M H₂SO₄Solution.

6. the detection kit prepared by PRV gB monoclonal antibodies is utilized as claimed in claim 5, it is characterised in that specific rule Lattice are, including：

96 1 piece of hole ELISA detection plates, 1 bottle of the anti-Pseudorabies virus monoclonal antibody of enzyme mark of 10mL/ bottles, the feminine gender of 1.5mL/ pipes Control, each 2 pipe of positive control, 1 bottle of 20 times of concentrated cleaning solutions of 30mL/ bottles, each 1 bottle of the TMB nitrite ions of 10mL/ bottles, terminate liquid.

7. a kind of one-step method competitive ELISA detection method constructed by PRV gB monoclonal antibodies described in claim 1 is utilized, its It is characterised by, specifically includes following operating procedure：

（1）ELISA detection plates are taken out, and are marked；

（2）Negative control, positive control, serum to be checked are added in ELISA detection plates；

The negative control is diluted SPF Swine serums or blood plasma, and positive control resists to be diluted containing pseudorabies gB The Swine serum or blood plasma of body；

（3）The anti-Pseudorabies virus monoclonal antibody of enzyme mark is added, is incubated；

（4）After incubation terminates, washed with cleaning solution；

The cleaning solution is the PBS containing 0.05%Tween-20；

（5）TMB nitrite ions are added, are incubated colour developing；

（7）Spectrophotometric determination OD450 values；

First, negative control average value NC is calculatedWith positive control average value P C, work as PC＜ 0.30, and NCDuring ＞ 0.80, This detection is effective, otherwise needs to detect again；

Secondly, S/N values are calculated, if S/N value >=0.4, sample is determined as antibody positive, i.e., contains PRV in sample；If S/N Value ＜ 0.4, sample should be determined as negative antibody, i.e., PRV is free of in sample.