CN101487061A - Detection of influenza A virus epidemic isolates, typing gene chip and using method - Google Patents
Detection of influenza A virus epidemic isolates, typing gene chip and using method Download PDFInfo
- Publication number
- CN101487061A CN101487061A CNA2008101948222A CN200810194822A CN101487061A CN 101487061 A CN101487061 A CN 101487061A CN A2008101948222 A CNA2008101948222 A CN A2008101948222A CN 200810194822 A CN200810194822 A CN 200810194822A CN 101487061 A CN101487061 A CN 101487061A
- Authority
- CN
- China
- Prior art keywords
- influenza virus
- probe
- chip
- virus
- influenza
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a genetic chip that implements epidemic strain detection and type classification of A-typed influenza virus and comprises 79 specific oligonucleotide probes that are used for detecting and classifying four subtypes H1N1, H3N2, H5N1 and H9N2, two quality control probes and a carrier, wherein, the two quality control probes include a quality control probe I and a quality control probe II, and the specific oligonucleotide probes and the quality control probe I are distributed on the carrier. The invention further discloses a preparation method of the genetic chip, which comprises following steps: step 1, probe design; step 2, probe synthesis; and step 3, chip preparation. The invention further discloses a use method of the genetic chip, which is characterized in that the use method comprises following steps: step1, extraction of influenza virus RNA; step 2, PCR augmentation of HA and HA genes; step 3, fluorescence labeling; step 4, hybridization; step 5, cleaning of the genetic chip after the hybridization; step 6, scanning; and step 7, data analysis.
Description
Technical field
The present invention relates to the epidemic isolates detection of a kind of A type influenza virus and typing gene chip and using method, belong to the biochip field.
Background technology
Influenza (Influenza) is called for short influenza, is a kind of acute respiratory transmissible disease that is caused by influenza virus (Influenza virus).For a long time, influenza is the serious transmissible disease of harm humans health and public security always, and the annual financial loss that causes thus is also very huge.Estimate that according to the World Health Organization annual global influenza patient is about 6-12 hundred million, it is severe influenza patient that 3-5 1,000,000 is wherein arranged approximately, has every year 30-50 ten thousand people to die from influenza approximately.Influenza virus belongs to orthomyxoviridae family in classification, antigenic different with stromatin (MP) according to nucleoprotein (NP), is divided into first (A), second (B), third (C), three types.A type influenza virus can infect multiple animal, is the main pathogen of people's parainfluenza and animal influenza.A type influenza virus can be divided into different hypotypes according to the antigenic specificity of its surface protein hemagglutinin (HA) and neuraminidase (NA), has found 16 kinds of HA hypotypes and 9 kinds of NA hypotypes at present in aquatic bird.In the century in the past, A type influenza virus causes 4 human flu outbreaks.A type influenza virus is the serotype complexity not only, and heritable variation is also very active, and the mode of variation mainly contains two kinds of the antigen conversions that antigenic drift that Nucleotide point mutation accumulation causes and different strain gene segment reprovisions cause.Studies show that, every 1-2, big antigenic drift all can take place once in H1 and H3 influenza virus under community immunity pressure, vaccine inoculation preventive effect and serodiagnosis result are had a greatly reduced quality.
Closely during the last ten years, avian influenza virus comprises H5N1, H9N2 and H7N7 hypotype, particularly H5N1 subtype virus, continues eruption and prevalence in global poultry.It is generally acknowledged that influenza virus has host restriction, promptly avian influenza virus generally is difficult for breaking through host's species barrier direct infection people.But a lot of avian influenza people have been taken place in recent years and caused disease and even dead example, more and more evidences shows avian influenza virus, and H5N1 virus has particularly progressively obtained direct infection people's ability.From Hong Kong bird flu incident in 1997, by in March, 2008, existing 366 examples in the whole world infected H5N1 virus, wherein dead 232 examples.According to the experience of big influenza and the stem reality that current high pathogenic avian influenza is wreaked havoc in the past, H5N1 virus in case obtain go into the ability propagated between the border or with Human virus's gene resortment of current trend, just may cause new flu outbreak.Therefore the problem that must face is take which kind of strategy and tachnical storage to deal with the big influenza that may arrive.
Effective detection technique of influenza virus is significant for instructing clinical prevention and treatment influenza, also is simultaneously that influenza monitoring and the important technology of controlling worldwide flu outbreak support.Except influenza virus, the pathogenic agent that causes the human respiratory disease clinically also has a lot, comprise some virus, bacterium, mycoplasma, spirochete, parasite etc., therefore light-duty influenza and distribute difficult discriminating of respiratory tract disease that influenza causes with common cold and other cause of disease clinically is to the main dependence of making a definite diagnosis of influenza laboratory detection means.Since influenza virus in 1933 is separated for the first time, develop and many different diagnostic methods, these methods respectively have relative merits.The laboratory diagnostic method of influenza has the molecular biology method of serological method, the antigenic immunological method of detection and the PCR-based of viral separation and Culture, detection antibody at present.Cultivating virus with chicken embryo or cellular segregation is " golden standard " that influenza virus is identified, susceptibility is strong, but needs 3-7 days time, is not suitable for early diagnosis.Serological method can detect antibody, mainly comprises hemagglutination-inhibition test (HI), complement fixation test (CFT) (CF), enzyme immunity test (EIA) and indirect immunofluorescence (IF) etc.Serology detects to be needed to gather patients acuity phase and convalescence paired sera, belongs to retrospective diagnosis, have epidemiological significance, but have little significance for acute early diagnosis, and susceptibility is low.Directly detecting the antigen method has direct or indirect fluorescent test, enzyme linked immune assay etc., and the time is 2 hours-1 day, be fit to early stage quick diagnosis, but susceptibility is low, and can not carry out large sample and detect.Molecular biology method is a series of research techniques that detect at the cause of disease nucleic acid molecule, mainly comprise RT-PCR, multiplex PCR, real-time PCR, NASBA etc., that these methods all have is highly sensitive, high specificity, characteristics fast, can carry out quantitatively and the somatotype evaluation virus, but shortcoming is to carry out parallel detection of while and examination to a large amount of clinical samples.Numerous at influenza virus sub-strain, serotype is complicated and heritable variation characteristics rapidly, press for and set up a kind of sensitivity, special method for quick, can detect a large amount of samples abreast at one time, can carry out the somatotype evaluation to detecting virus simultaneously.The biochip technology that development in recent years is got up will be brought important breakthrough for the detection of influenza virus, can satisfy the above-mentioned requirements that influenza virus is detected fully.
Gene chip, be dna microarray (DNA Microarray) again, from being born, pass through the scientists effort of more than ten years, technology is ripe gradually perfect, the a plurality of fields that have been widely used in medical science comprise molecular diagnosis, drug screening of evaluation, the disease of monitoring, the gene function of genetic expression etc.Compare with traditional method, in the diagnosis of communicable disease, gene chip has shown unrivaled superiority.Gene chip has fast, responsive, special, high-throughout characteristics, can be abreast the polygenic locus of a large amount of cause of diseases and same cause of disease be detected simultaneously, can realize microminiaturization, integrated and automatization in actual applications.The detection of many pathogenic micro-organisms has in recent years all related to the research of gene chip and has obtained stem-winding progress, and some or has realized industrialization, has shown wide application prospect.Gene chip detecting technique is particularly suitable for the characteristics that the influenza virus host range is wide, serotype is many, variation is fast.The probe that calendar year 2001 Li etc. designs 24 couples of about 500nt of mean length first prepares chip, prepares the fluorescent mark target DNA in conjunction with multiple PCR method, by showing and can identify H1, H3, N1, N2 and Type B influenza with the probe hybridization result.The minority scholar uses different gene chip preparation strategies that the somatotype detection of influenza virus is furtherd investigate afterwards, but existing achievement in research ubiquity hybridization time is longer, fluorescent label efficiency is low, a little less than the hybridization signal, the shortcoming that recall rate is low is in addition because the genovariation of influenza virus own is very fast, be difficult to guarantee that its conserved sequence is constant forever, and the number of probes of present chip very little, in case morph in its detection site, then causes the mistake of detected result probably.
Summary of the invention
The invention provides that a kind of A of being used for type influenza virus epidemic isolates detects and the gene chip of somatotype and preparation method thereof and using method, it can successfully have been set up, and a whole set of is quick, special, sensitive is used for the gene chip that A type influenza virus epidemic isolates detects somatotype, and this chip can detect and somatotype A type influenza virus H1N1, H3N2, H5N1, the H9N2 hypotype that comprises different genera sources such as people source, fowl source, pig source simultaneously.
The present invention has adopted following technical scheme: the gene chip of a kind of A type influenza virus epidemic isolates detection and somatotype, it comprises detects and 79 specific oligonucleotide probes of somatotype, two Quality Control probes and carrier H1N1, H3N2, four kinds of hypotypes of H5N1, H9N2, article two, the Quality Control probe is Quality Control probe I and Quality Control probe I I, wherein specific oligonucleotide probe and Quality Control probe I are distributed on the carrier, and H1N1 is detected sequence with the specific oligonucleotide probe of somatotype
| Numbering | Title | Sequence |
| 1 | H1N1-HA-1 | atgccaacaactcaaccgac |
| 2 | H1N1-HA-2 | acttgagaagaatgtgacagtgac |
| 3 | H1N1-HA-3 | acacagaatgccattgacgg |
| 4 | H1N1-HA-4 | gaaattggaaatggctgctttga |
| 5 | H1N1-HA-5 | ctatatgagaaagtaagaagccagc |
| 6 | H1N1-NA-1 | ctagtgggagcagcatttcttt |
| 7 | H1N1-NA-2 | ttgtggcgttgatagtgatactg |
| 8 | H1N1-NA-3 | attcatctctttgttctatcagtgga |
| 9 | H1N1-NA-4 | atacacaaaagacaacagcataagaat |
| 10 | H1N1-NA-5 | ctaatggatggacagataccgatag |
| 11 | H1N1-NA-6 | gattggtcaggatacagtggaag |
H3N2 is detected sequence with the specific oligonucleotide probe of somatotype
| 12 | H3N2-HA-1 | ctgttacccttatgatgtgccg |
| 13 | H3N2-HA-2 | gaacgcagcaaagcctacag |
| 14 | H3N2-HA-3 | attaacagcacagggaatctaattg |
| 15 | H3N2-HA-4 | caataatgagatcagatgcaccca |
| 16 | H3N2-HA-5 | gaacaaagaagcaactgaggga |
| 17 | H3N2-HA-6 | gctgaggatatgggcaatgg |
| 18 | H3N2-HA-7 | atgacaacagcacggcaac |
| 19 | H3N2-HA-8 | caacaggtagaatatgcgacagt |
| 20 | H3N2-HA-9 | ctgttacccttatgatgtgccg |
| 21 | H3N2-HA-10 | ttatgcctcccttaggtcactag |
| 22 | H3N2-HA-11 | ggatgcggaatgtaccagaga |
| 23 | H3N2-HA-12 | aactagaggcatattcggcg |
| 24 | H3N2-HA-13 | gggtcaatcagaaatggaacttatg |
| 25 | H3N2-NA-1 | tgaccaacaccaccatagagaa |
| 26 | H3N2-NA-2 | agcagaatacagaaattggtcaaag |
| 27 | H3N2-NA-3 | atgcgatcctgacaagtgttatc |
| 28 | H3N2-NA-4 | ggacagggaacaacactaaacaa |
| 29 | H3N2-NA-5 | atggagtgaaaggctgggc |
| 30 | H3N2-NA-6 | tcctggtaactactgtaacattgc |
| 31 | H3N2-NA-7 | gccacaatatgcttccttatgc |
| 32 | H3N2-NA-8 | gtatctgaccaacaccaccatag |
| 33 | H3N2-NA-9 | ctgtgtgaaccaacaataatagaaa |
| 34 | H3N2-NA-10 | gctcaagttgtcacgatggaa |
| 35 | H3N2-NA-11 | cctattgatgaatgagttgggtgt |
| 36 | H3N2-NA-12 | gaggcttgtagatagtattggttca |
| 37 | H3N2-NA-13 | catagttgacagaggtaataggtcc |
H5N1 is detected sequence with the specific oligonucleotide probe of somatotype
| 38 | H5N1-HA-1 | cgacagagcaggttgacaca |
| 39 | H5N1-HA-2 | tcaagaaaggggactcagcaa |
| 40 | H5N1-HA-3 | aaggcaatagatggagtcacc |
| 41 | H5N1-HA-4 | gccgttggaagggaatttaataac |
| 42 | H5N1-HA-5 | aacaagaagatggaagacggatt |
| 43 | H5N1-HA-6 | cggaatggtcttacatagtggag |
| 44 | H5N1-HA-7 | ccagccaatgacctctgttac |
| 45 | H5N1-HA-8 | gctacaataataccaaccaagaaga |
| 46 | H5N1-HA-9 | cctaatgatgcggcagagc |
| 47 | H5N1-HA-10 | tgccattccacaacatacacc |
| 48 | H5N1-HA-11 | aagtgaattggaatatggtaactgc |
| 49 | H5N1-HA-12 | ccgcagtattcagaagaagcaa |
| 50 | H5N1-HA-13 | ttattcaacagtggcgagttcc |
| 51 | H5N1-HA-14 | aagaactgaaacacctattgagca |
| 52 | H5N1-NA-1 | tggaggaacaacatactgagaac |
| 53 | H5N1-NA-2 | ggcataataacagacactatcaaga |
| 54 | H5N1-NA-3 | agcactaattccaggagcgg |
| 55 | H5N1-NA-4 | ccagaactgacaggattagattgc |
| 56 | H5N1-NA-5 | attggtcaggatatagcgggag |
| 57 | H5N1-NA-6 | gccgttcatctcatgctcc |
| 58 | H5N1-NA-7 | ttgactcagggagccttgc |
| 59 | H5N1-NA-8 | tggaggaacaacatactgagaac |
| 60 | H5N1-NA-9 | ttactgtaatgactgatggaccaag |
| 61 | H5N1-NA-10 | ttcggagacaatccacgcc |
| 62 | H5N1-NA-11 | tggcatggctcaaatcggc |
| 63 | H5N1-NA-12 | agcactaattccaggagcgg |
| 64 | H5N1-NA-13 | ggtggactggaacggacag |
H9N2 is detected sequence with the specific oligonucleotide probe of somatotype
| 65 | H9N2-HA-1 | gcatcggctaccaatcaacaa |
| 66 | H9N2-HA-2 | tgttcctgtgacacatgcca |
| 67 | H9N2-HA-3 | atgccaaagaattactccacaca |
| 68 | H9N2-HA-4 | agaattgctagtgctgcttgaa |
| 69 | H9N2-HA-5 | caggtcagacattgcgagtg |
| 70 | H9N2-HA-6 | atggtatggacacattctttcagg |
| 71 | H9N2-HA-7 | acaaggactgacacaacaacaa |
| 72 | H9N2-HA-8 | aggtcagacattgcgagtaaga |
| 73 | H9N2-HA-9 | tctatggcaatccttcctgtga |
| 74 | H9N2-HA-10 | tcggattcattctacaggagca |
| 75 | H9N2-HA-11 | aataccacattgccattccaca |
| 76 | H9N2-NA-1 | ggtattctggtatcttctctgttga |
| 77 | H9N2-NA-2 | ccacggctaattccaagtcac |
| 78 | H9N2-NA-3 | aagtggcagaatacaagaattggt |
| 79 | H9N2-NA-4 | gtcaaattacagggttcgctcc |
Article two, the sequence of Quality Control probe
| 80 | I | cgtatataaaacggaacgtcgaagg |
| 81 | II | ccttcgacgttccgttttatatacg |
Described carrier is aldehyde radical modification glass substrate or silicon chip, polystyrene substrate, nylon substrates.
The gene chip preparation method of detection of a kind of A type of the present invention influenza virus epidemic isolates and somatotype, may further comprise the steps: step 1, the design of probe: according to the Influenza Virus Resource database among the NCBI, a large amount of A type influenza virus sequences are compared, find its absolute or relative conserved sequence, design 79 specific oligonucleotide probes and two Quality Control probes then; Step 2, probe synthetic, it is amido modified that 5 ' end of every probe adds C6, so that it can be fixed on the aldehyde radical modification glass substrate; Step 3, the preparation of chip: the probe after will synthesizing is diluted to 40uM with pure water, get 15ul, with equal-volume 2 * chip sampling liquid mixing, make concentration and probe concentration reach 20uM, be loaded on 384 orifice plates, with the chip point sample instrument with probe points on carrier, after point sample is finished chip placed the chip hybridization box, put the 300ul pure water in the hybridizing box bottom simultaneously and be used to keep humidity, with the hybridizing box sealing, 37 ℃ of reaction 18h make probe and chip surface aldehyde radical covalent attachment, clean with 0.2%SDS after hydration is finished and seal with NaBH4, centrifugal drying sticks four sampling-type fences, and 4 ℃ of sealings are preserved.
79 specific oligonucleotide probes and two Quality Control probes in preparation method's step 1 of the present invention, probe length is at 19-25bp, and the Tm value differs within 5 ℃ between every probe.At the carrier described in preparation method's step 2 of the present invention is aldehyde radical glass chip or silicon chip, polystyrene substrate, nylon substrates.
The using method of the gene chip of detection of a kind of A type of the present invention influenza virus epidemic isolates and somatotype is characterized in that it may further comprise the steps: step 1, and the extraction of Influenza Virus RNA uses the TRIZOL ordinary method to extract viral RNA; Step 2, RT-PCR: at first the Influenza Virus RNA reverse transcription is become cDNA with the Uni12 primer, re-use universal primer respectively HA, the NA gene fragment total length of pcr amplification influenza virus, the PCR product after the amplification with QIAGEN PCR Purification Kit to carrying out purifying; Step 3, fluorescent mark: get the PCR product behind the purifying, use Klenow minus enzyme on the PCR product, to carry out fluorescent mark, will have fluorescently-labeled PCR product with QIAGEN PCR Purification Kit purifying; Step 4, hybridization: will have fluorescently-labeled PCR product and a hybridization solution mixing behind the purifying, on gene chip, cover four sampling-type cover plates, 12ul hybridization system is added on the cover plate well makes it be covered in array surface automatically, gene chip is put into the inherent 20-45 ℃ of hybridization 1-5H of hybridizing box; Step 5, gene chip is cleaned in the hybridization back: after gene chip hybridization is finished, chip is respectively cleaned 1-5min successively in washing lotion 0.1%SDS+2 * SSC, 0.1%SDS+0.2 * SSC and 0.2 * SSC, it is centrifugal to remove surface liquid at last gene chip to be put into centrifuge tube; Step 6, scanning: the gene chip after cleaning in the step 5 is scanned by chip scanner, preserve scan image data simultaneously; Step 7, data analysis: according to scan image, determine to occur the fluorescent signal zone, with this determine detected the hypotype that has that it's too late of influenza virus in the sample.
Fluorescent mark in the step 3 of using method of the present invention adopts cy
3Fluorescence dye.The hybridization system component is deionized formamide 1.8ul in the step 4 of using method of the present invention, 20 * SSPE 2.4ul, and 50 * Denhardt ' s 0.6ul, Quality Control probe I I 1ul has fluorescent mark PCR product 3ul, pure water 3.2ul.
The present invention has following beneficial effect: probe broad covered area of the present invention, overcome some chip and only designed a pair of or several shortcomings probe, four hypotypes have all been designed many, can effectively avoid the omission that causes rapidly owing to influenza virus variation probe.Employed fluorescence labeling method efficient height among the present invention, and in the fluorescent mark process, just can carry out effective fragmentation to product to be detected, make hybridization efficient be greatly improved, improve the chip detection susceptibility.The present invention can detect the A type influenza virus in different genera source, comprises people, fowl, pig etc., has very high broad spectrum.
Description of drawings
Fig. 1 is distributed with four identical arrays for the array structure synoptic diagram of A type influenza virus epidemic isolates detection of the present invention and typing gene chip on every chip.
Figure 2 shows that each probe alignment placement on each array.
Figure 3 shows that typical A type influenza virus H1N1 hypotype chip detection result.
Figure 4 shows that typical A type influenza virus H3N2 hypotype chip detection result.
Figure 5 shows that typical A type influenza virus H 5 N 1 hypotype chip detection result.
Figure 6 shows that typical A type influenza virus H9N2 hypotype chip detection result.
Embodiment
Embodiment one: according to illustrated in figures 1 and 2, the invention provides a kind of gene chip that is used for detection of A type influenza virus epidemic isolates and somatotype, it comprises H1N1, H3N2, H5N1, four kinds of hypotypes of H9N2 detect 79 specific oligonucleotide probes with somatotype, article two, Quality Control probe and carrier, article two, the Quality Control probe is Quality Control probe I and Quality Control probe I I, specific oligonucleotide probe and Quality Control probe I are distributed on the carrier, carrier is that aldehyde radical glass is modified substrate, carrier also can be silicon chip, polystyrene substrate or nylon substrates, the sequence that H1N1 is detected with the specific oligonucleotide probe of somatotype sees Table 1, the sequence that H3N2 is detected with the specific oligonucleotide probe of somatotype sees Table 2, the sequence that H5N1 is detected with the specific oligonucleotide probe of somatotype sees Table 3, H9N2 is detected the sequence that sequence with the specific oligonucleotide probe of somatotype sees Table 4, two Quality Control probes see Table 5.
Table 1 couple H1N1 detects the sequence with the specific oligonucleotide probe of somatotype
| Numbering | Title | Sequence |
| 1 | H1N1-HA-1 | atgccaacaactcaaccgac |
| 2 | H1N1-HA-2 | acttgagaagaatgtgacagtgac |
| 3 | H1N1-HA-3 | acacagaatgccattgacgg |
| 4 | H1N1-HA-4 | gaaattggaaatggctgctttga |
| 5 | H1N1-HA-5 | ctatatgagaaagtaagaagccagc |
| 6 | H1N1-NA-1 | ctagtgggagcagcatttcttt |
| 7 | H1N1-NA-2 | ttgtggcgttgatagtgatactg |
| 8 | H1N1-NA-3 | attcatctctttgttctatcagtgga |
| 9 | H1N1-NA-4 | atacacaaaagacaacagcataagaat |
| 10 | H1N1-NA-5 | ctaatggatggacagataccgatag |
| 11 | H1N1-NA-6 | gattggtcaggatacagtggaag |
Table 2 couple H3N2 detects the sequence with the specific oligonucleotide probe of somatotype
| 12 | H3N2-HA-1 | ctgttacccttatgatgtgccg |
| 13 | H3N2-HA-2 | gaacgcagcaaagcctacag |
| 14 | H3N2-HA-3 | attaacagcacagggaatctaattg |
| 15 | H3N2-HA-4 | caataatgagatcagatgcaccca |
| 16 | H3N2-HA-5 | gaacaaagaagcaactgaggga |
| 17 | H3N2-HA-6 | gctgaggatatgggcaatgg |
| 18 | H3N2-HA-7 | atgacaacagcacggcaac |
| 19 | H3N2-HA-8 | caacaggtagaatatgcgacagt |
| 20 | H3N2-HA-9 | ctgttacccttatgatgtgccg |
| 21 | H3N2-HA-10 | ttatgcctcccttaggtcactag |
| 22 | H3N2-HA-11 | ggatgcggaatgtaccagaga |
| 23 | H3N2-HA-12 | aactagaggcatattcggcg |
| 24 | H3N2-HA-13 | gggtcaatcagaaatggaacttatg |
| 25 | H3N2-NA-1 | tgaccaacaccaccatagagaa |
| 26 | H3N2-NA-2 | agcagaatacagaaattggtcaaag |
| 27 | H3N2-NA-3 | atgcgatcctgacaagtgttatc |
| 28 | H3N2-NA-4 | ggacagggaacaacactaaacaa |
| 29 | H3N2-NA-5 | atggagtgaaaggctgggc |
| 30 | H3N2-NA-6 | tcctggtaactactgtaacattgc |
| 31 | H3N2-NA-7 | gccacaatatgcttccttatgc |
| 32 | H3N2-NA-8 | gtatctgaccaacaccaccatag |
| 33 | H3N2-NA-9 | ctgtgtgaaccaacaataatagaaa |
| 34 | H3N2-NA-10 | gctcaagttgtcacgatggaa |
| 35 | H3N2-NA-11 | cctattgatgaatgagttgggtgt |
| 36 | H3N2-NA-12 | gaggcttgtagatagtattggttca |
| 37 | H3N2-NA-13 | catagttgacagaggtaataggtcc |
Table 3 couple H5N1 detects the sequence with the specific oligonucleotide probe of somatotype
| 38 | H5N1-HA-1 | cgacagagcaggttgacaca |
| 39 | H5N1-HA-2 | tcaagaaaggggactcagcaa |
| 40 | H5N1-HA-3 | aaggcaatagatggagtcacc |
| 41 | H5N1-HA-4 | gccgttggaagggaatttaataac |
| 42 | H5N1-HA-5 | aacaagaagatggaagacggatt |
| 43 | H5N1-HA-6 | cggaatggtcttacatagtggag |
| 44 | H5N1-HA-7 | ccagccaatgacctctgttac |
| 45 | H5N1-HA-8 | gctacaataataccaaccaagaaga |
| 46 | H5N1-HA-9 | cctaatgatgcggcagagc |
| 47 | H5N1-HA-10 | tgccattccacaacatacacc |
| 48 | H5N1-HA-11 | aagtgaattggaatatggtaactgc |
| 49 | H5N1-HA-12 | ccgcagtattcagaagaagcaa |
| 50 | H5N1-HA-13 | ttattcaacagtggcgagttcc |
| 51 | H5N1-HA-14 | aagaactgaaacacctattgagca |
| 52 | H5N1-NA-1 | tggaggaacaacatactgagaac |
| 53 | H5N1-NA-2 | ggcataataacagacactatcaaga |
| 54 | H5N1-NA-3 | agcactaattccaggagcgg |
| 55 | H5N1-NA-4 | ccagaactgacaggattagattgc |
| 56 | H5N1-NA-5 | attggtcaggatatagcgggag |
| 57 | H5N1-NA-6 | gccgttcatctcatgctcc |
| 58 | H5N1-NA-7 | ttgactcagggagccttgc |
| 59 | H5N1-NA-8 | tggaggaacaacatactgagaac |
| 60 | H5N1-NA-9 | ttactgtaatgactgatggaccaag |
| 61 | H5N1-NA-10 | ttcggagacaatccacgcc |
| 62 | H5N1-NA-11 | tggcatggctcaaatcggc |
| 63 | H5N1-NA-12 | agcactaattccaggagcgg |
| 64 | H5N1-NA-13 | ggtggactggaacggacag |
Table 4 couple H9N2 detects the sequence with the specific oligonucleotide probe of somatotype
| 65 | H9N2-HA-1 | gcatcggctaccaatcaacaa |
| 66 | H9N2-HA-2 | tgttcctgtgacacatgcca |
| 67 | H9N2-HA-3 | atgccaaagaattactccacaca |
| 68 | H9N2-HA-4 | agaattgctagtgctgcttgaa |
| 69 | H9N2-HA-5 | caggtcagacattgcgagtg |
| 70 | H9N2-HA-6 | atggtatggacacattctttcagg |
| 71 | H9N2-HA-7 | acaaggactgacacaacaacaa |
| 72 | H9N2-HA-8 | aggtcagacattgcgagtaaga |
| 73 | H9N2-HA-9 | tctatggcaatccttcctgtga |
| 74 | H9N2-HA-10 | tcggattcattctacaggagca |
| 75 | H9N2-HA-11 | aataccacattgccattccaca |
| 76 | H9N2-NA-1 | ggtattctggtatcttctctgttga |
| 77 | H9N2-NA-2 | ccacggctaattccaagtcac |
| 78 | H9N2-NA-3 | aagtggcagaatacaagaattggt |
| 79 | H9N2-NA-4 | gtcaaattacagggttcgctcc |
The sequence of two Quality Control probes of table 5
| 80 | PosCtrl-1 | cgtatataaaacggaacgtcgaagg |
| 81 | PosCtrl-2 | ccttcgacgttccgttttatatacg |
The present invention also provides the preparation method of detection of A type influenza virus epidemic isolates and typing gene chip, may further comprise the steps: step 1, the design of probe: according to the Influenza Virus Resource database among the NCBI, utilization Clustalx software is compared to a large amount of A type influenza virus sequences, find its absolute or relative conserved sequence, use Array Designer 4 79 specific oligonucleotide probes of design and two Quality Control probes then, the length of every probe is at 19-25bp, the Tm value differs within 5 ℃ between every probe, and the sequence of the sequence of 79 specific oligonucleotide probes and two Quality Control probes sees Table 1, table 2, table 3, table 4 and table 5; Step 2, probe synthetic, it is amido modified to add C6 at 5 ' end of every probe simultaneously at synthetic, so that it can be fixed on the aldehyde radical modification glass substrate; Step 3, the preparation of chip: the probe after will synthesizing is diluted to 40uM with pure water, get 15ul, adding 2 * chip sampling liquid 15ul manages in PCR, use the rifle mixing, make concentration and probe concentration reach 20uM, be loaded on 384 orifice plates, with the chip point sample instrument with probe points on carrier, every two repetitions, horizontal 14 points on each array, vertical 13 points, 4 repeat arrays of some system on every chip block, after point sample is finished chip is positioned over the chip hybridization box, puts the 300ul pure water in the hybridizing box bottom simultaneously and be used to keep humidity, hybridizing box is sealed, 37 ℃ of reaction 18h, make probe and chip surface aldehyde radical covalent attachment, seal centrifugal drying with the 0.2%SDS cleaning and with NaBH4 after hydration is finished, stick four sampling-type fences, 4 ℃ of sealings are preserved.
According to Fig. 3, Fig. 4, Fig. 5 and Fig. 6 the invention also discloses that a kind of A type influenza virus epidemic isolates detects and the using method of typing gene chip, and it may further comprise the steps:
Step 1, the extraction of Influenza Virus RNA uses the TRIZOL ordinary method to extract viral RNA; Step 2, RT-PCR: at first the Influenza Virus RNA reverse transcription is become cDNA with the Uni12 primer, re-use universal primer respectively HA, the NA gene fragment total length of pcr amplification influenza virus, the PCR product after the amplification with QIAGENPCR Purification Kit to carrying out purifying; Step 3, fluorescent mark: get the PCR product behind the purifying, use Klenow minus enzyme to carry out fluorescent mark on the PCR product, fluorescent mark adopts cy
3Fluorescence dye will have fluorescently-labeled PCR product QIAGEN PCR Purification Kit purifying; Step 4, hybridization: will have fluorescently-labeled PCR product and a hybridization solution mixing behind the purifying, cover four sampling-type cover plates on gene chip, 12ul hybridization system is added on the cover plate well makes it be covered in array surface automatically, hybridization system component is deionized formamide 1.8ul, 20 * SSPE 2.4ul, 50 * Denhardt ' s 0.6ul, Quality Control probe I I 1ul has fluorescent mark PCR product 3ul, pure water 3.2ul puts into the inherent 20-45 ℃ of hybridization 1-5H of hybridizing box with gene chip; Step 5, gene chip is cleaned in the hybridization back: after gene chip hybridization is finished, chip is respectively cleaned 1-5min successively in washing lotion 0.1%SDS+2 * SSC, 0.1%SDS+0.2 * SSC and 0.2 * SSC, it is centrifugal to remove surface liquid at last gene chip to be put into centrifuge tube; Step 6, scanning: the gene chip after cleaning in the step 5 is scanned by chip scanner, preserve scan image data simultaneously; Step 7, data analysis: according to scan image, determine to occur the fluorescent signal zone, with this determine detected the hypotype that has that it's too late of influenza virus in the sample.
The nucleotides sequence tabulation
＜110〉Taizhou Qinheli Bio-Tech Co. Ltd.
＜120〉the epidemic isolates detection of A type influenza virus and typing gene chip and using method
<160>81
<210>1
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>1
atgccaacaactcaaccgac
<210>2
<211>24
<212>DNA
＜213〉A type influenza virus＜Influenza A virus)
<220>
<221>misc_feature
<400>2
acttgagaagaatgtgacagtgac
<210>3
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>3
acacagaatgccattgacgg
<210>4
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>4
gaaattggaaatggctgctttga
<210>5
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>5
ctatatgagaaagtaagaagccagc
<210>6
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>6
ctagtgggagcagcatttcttt
<210>7
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>7
ttgtggcgttgatagtgatactg
<210>8
<211>26
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>8
attcatctctttgttctatcagtgga
<210>9
<211>27
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>9
atacacaaaagacaacagcataagaat
<210>10
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>10
ctaatggatggacagataccgatag
<210>11
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>11
gattggtcaggatacagtggaag
<210>12
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>12
ctgttacccttatgatgtgccg
<210>13
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>13
gaacgcagcaaagcctacag
<210>14
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>14
attaacagcacagggaatctaattg
<210>15
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>15
caataatgagatcagatgcaccca
<210>16
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>16
gaacaaagaagcaactgaggga
<210>17
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>17
gctgaggatatgggcaatgg
<210>18
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>18
atgacaacagcacggcaac
<210>19
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>19
caacaggtagaatatgcgacagt
<210>20
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>20
ctgttacccttatgatgtgccg
<210>21
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>21
ttatgcctcccttaggtcactag
<210>22
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>22
ggatgcggaatgtaccagaga
<210>23
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>23
aactagaggcatattcggcg
<210>24
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>24
gggtcaatcagaaatggaacttatg
<210>25
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>25
tgaccaacaccaccatagagaa
<210>26
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus 〉
<220>
<221>misc_feature
<400>26
agcagaatacagaaattggtcaaag
<210>27
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>27
atgcgatcctgacaagtgttatc
<210>28
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus 〉
<220>
<221>misc_feature
<400>28
ggacagggaacaacactaaacaa
<210>29
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>29
atggagtgaaaggctgggc
<210>30
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>30
tcctggtaactactgtaacattgc
<210>31
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>31
gccacaatatgcttccttatgc
<210>32
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>32
gtatctgaccaacaccaccatag
<210>33
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>33
ctgtgtgaaccaacaataatagaaa
<210>34
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>34
gctcaagttgtcacgatggaa
<210>35
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>35
cctattgatgaatgagttgggtgt
<210>36
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>36
gaggcttgtagatagtattggttca
<210>37
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>37
catagttgacagaggtaataggtcc
<210>38
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus 〉
<220>
<221>misc_feature
<400>38
cgacagagcaggttgacaca
<210>39
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>39
tcaagaaaggggactcagcaa
<210>40
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>40
aaggcaatagatggagtcacc
<210>41
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>41
gccgttggaagggaatttaataac
<210>42
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>42
aacaagaagatggaagacggatt
<210>43
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>43
cggaatggtcttacatagtggag
<210>44
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>44
ccagccaatgacctctgttac
<210>45
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>45
gctacaataataccaaccaagaaga
<210>46
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>46
cctaatgatgcggcagagc
<210>47
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>47
tgccattccacaacatacacc
<210>48
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>48
aagtgaattggaatatggtaactgc
<210>49
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>49
ccgcagtattcagaagaagcaa
<210>50
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>50
ttattcaacagtggcgagttcc
<210>51
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>51
aagaactgaaacacctattgagca
<210>52
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>52
tggaggaacaacatactgagaac
<210>53
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>53
ggcataataacagacactatcaaga
<210>54
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>54
agcactaattccaggagcgg
<210>55
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>55
ccagaactgacaggattagattgc
<210>56
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>56
attggtcaggatatagcgggag
<210>57
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>57
gccgttcatctcatgctcc
<210>58
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>58
ttgactcagggagccttgc
<210>59
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>59
tggaggaacaacatactgagaac
<210>60
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>60
ttactgtaatgactgatggaccaag
<210>61
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>61
ttcggagacaatccacgcc
<210>62
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>62
tggcatggctcaaatcggc
<210>63
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>63
agcactaattccaggagcgg
<210>64
<211>19
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>64
ggtggactggaacggacag
<210>65
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>65
gcatcggctaccaatcaacaa
<210>66
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>66
tgttcctgtgacacatgcca
<210>67
<211>23
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>67
atgccaaagaattactccacaca
<210>68
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>68
agaattgctagtgctgcttgaa
<210>69
<211>20
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>69
caggtcagacattgcgagtg
<210>70
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>70
atggtatggacacattctttcagg
<210>71
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>71
acaaggactgacacaacaacaa
<210>72
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>72
aggtcagacattgcgagtaaga
<210>73
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>73
tctatggcaatccttcctgtga
<210>74
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>74
tcggattcattctacaggagca
<210>75
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>75
aataccacattgccattccaca
<210>76
<211>25
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>76
ggtattctggtatcttctctgttga
<210>77
<211>21
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>77
ccacggctaattccaagtcac
<210>78
<211>24
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>78
aagtggcagaatacaagaattggt
<210>79
<211>22
<212>DNA
＜213〉A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>79
gtcaaattacagggttcgctcc
<210>80
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉pairing designs according to base complementrity, to be used as the positive reference of chip hybridization.
<400>80
cgtatataaaacggaacgtcgaagg
<210>81
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉pairing designs according to base complementrity, to be used as the positive reference of chip hybridization.
<400>81
ccttcgacgttccgttttatatacg
Claims (8)
1, the gene chip of a kind of A type influenza virus epidemic isolates detection and somatotype, it is characterized in that it comprises detects and 79 specific oligonucleotide probes of somatotype, two Quality Control probes and carrier H1N1, H3N2, four kinds of hypotypes of H5N1, H9N2, article two, the Quality Control probe is Quality Control probe I and Quality Control probe I I, wherein specific oligonucleotide probe and Quality Control probe I are distributed on the carrier
H1N1 is detected sequence with the specific oligonucleotide probe of somatotype
H3N2 is detected sequence with the specific oligonucleotide probe of somatotype
H5N1 is detected sequence with the specific oligonucleotide probe of somatotype
H9N2 is detected sequence with the specific oligonucleotide probe of somatotype
Article two, the sequence of Quality Control probe
2, A type influenza virus epidemic isolates according to claim 1 detects and the gene chip of somatotype, it is characterized in that described carrier is aldehyde radical modification glass substrate or silicon chip, polystyrene substrate, nylon substrates.
3, the gene chip preparation method of a kind of A type influenza virus epidemic isolates detection and somatotype may further comprise the steps:
Step 1, the design of probe: according to the Influenza Virus Resource database among the NCBI, a large amount of A type influenza virus sequences are compared, find its absolute or relative conserved sequence, design 79 specific oligonucleotide probes and two Quality Control probes then;
Step 2, probe synthetic, it is amido modified that 5 ' end of every probe adds C6, so that it can be fixed on the aldehyde radical modification glass substrate;
Step 3, the preparation of chip: the probe after will synthesizing is diluted to 40uM with pure water, get 15ul, with equal-volume 2 * chip sampling liquid mixing, make concentration and probe concentration reach 20uM, be loaded on 384 orifice plates, with the chip point sample instrument with probe points on carrier, after point sample is finished chip placed the chip hybridization box, put the 300ul pure water in the hybridizing box bottom simultaneously and be used to keep humidity, with the hybridizing box sealing, 37 ℃ of reaction 18h make probe and chip surface aldehyde radical covalent attachment, clean with 0.2%SDS after hydration is finished and seal with NaBH4, centrifugal drying sticks four sampling-type fences, and 4 ℃ of sealings are preserved.
4, the gene chip preparation method of A type influenza virus epidemic isolates detection according to claim 3 and somatotype, it is characterized in that 79 specific oligonucleotide probes and two Quality Control probes in the step 1, probe length is at 19-25bp, and the Tm value differs within 5 ℃ between every probe.
5, A type influenza virus epidemic isolates according to claim 3 detects and the gene chip preparation method of somatotype, it is characterized in that the carrier described in the step 2 is aldehyde radical glass chip or silicon chip, polystyrene substrate, nylon substrates.
6, the using method of the gene chip of a kind of A type influenza virus epidemic isolates detection and somatotype is characterized in that it may further comprise the steps:
Step 1, the extraction of Influenza Virus RNA uses the TRIZOL ordinary method to extract viral RNA;
Step 2, RT-PCR: at first the Influenza Virus RNA reverse transcription is become cDNA with the Uni12 primer, re-use universal primer respectively HA, the NA gene fragment total length of pcr amplification influenza virus, the PCR product after the amplification with QIAGEN PCR Purification Kit to carrying out purifying;
Step 3, fluorescent mark: get the PCR product behind the purifying, use Klenow minus enzyme on the PCR product, to carry out fluorescent mark, will have fluorescently-labeled PCR product with QIAGEN PCR PurificationKit purifying;
Step 4, hybridization: will have fluorescently-labeled PCR product and a hybridization solution mixing behind the purifying, on gene chip, cover four sampling-type cover plates, 12ul hybridization system is added on the cover plate well makes it be covered in array surface automatically, gene chip is put into the inherent 20-45 ℃ of hybridization 1-5H of hybridizing box;
Step 5, gene chip is cleaned in the hybridization back: after gene chip hybridization is finished, chip is respectively cleaned 1-5min successively in washing lotion 0.1%SDS+2 * SSC, 0.1%SDS+0.2 * SSC and 0.2 * SSC, it is centrifugal to remove surface liquid at last gene chip to be put into centrifuge tube;
Step 6, scanning: the gene chip after cleaning in the step 5 is scanned by chip scanner, preserve scan image data simultaneously;
Step 7, data analysis: according to scan image, determine to occur the fluorescent signal zone, with this determine detected the hypotype that has that it's too late of influenza virus in the sample.
7, the using method of A type influenza virus epidemic isolates detection according to claim 6 and typing gene chip is characterized in that the fluorescent mark in the step 3 adopts cy
3Fluorescence dye.
8, the using method of A type influenza virus epidemic isolates detection according to claim 6 and typing gene chip, it is characterized in that the hybridization system component is deionized formamide 1.8ul in the step 4,20 * SSPE 2.4ul, 50 * Denhardt ' s 0.6ul, Quality Control probe I I 1ul, have fluorescent mark PCR product 3ul, pure water 3.2ul.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810194822.2A CN101487061B (en) | 2008-11-10 | 2008-11-10 | Detection of influenza A virus epidemic isolates, typing gene chip and using method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810194822.2A CN101487061B (en) | 2008-11-10 | 2008-11-10 | Detection of influenza A virus epidemic isolates, typing gene chip and using method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101487061A true CN101487061A (en) | 2009-07-22 |
| CN101487061B CN101487061B (en) | 2014-03-12 |
Family
ID=40890121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810194822.2A Expired - Fee Related CN101487061B (en) | 2008-11-10 | 2008-11-10 | Detection of influenza A virus epidemic isolates, typing gene chip and using method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101487061B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101864495A (en) * | 2010-04-13 | 2010-10-20 | 上海国际旅行卫生保健中心 | Constant-temperature amplification detection kit of influenza A virus and detection method thereof |
| CN101818207B (en) * | 2009-10-26 | 2012-07-25 | 中华人民共和国珠海出入境检验检疫局 | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus |
| CN101649356B (en) * | 2009-07-24 | 2012-09-05 | 浙江省疾病预防控制中心 | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof |
| CN108531648A (en) * | 2018-04-11 | 2018-09-14 | 四川农业大学 | It is a kind of it is synchronous detection the diarrhoeal virus of 4 boars oligonucleotide chip and its application |
| WO2023077490A1 (en) * | 2021-11-06 | 2023-05-11 | 江汉大学 | Combination of mnp markers of influenza a, b and c viruses, primer pair combination, kit, and uses of combination, primer pair combination and kit |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100580092C (en) * | 2007-03-08 | 2010-01-13 | 中国检验检疫科学研究院动植物检疫研究所 | Gene chip for detection and typing of bird flu virus |
-
2008
- 2008-11-10 CN CN200810194822.2A patent/CN101487061B/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101649356B (en) * | 2009-07-24 | 2012-09-05 | 浙江省疾病预防控制中心 | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof |
| CN101818207B (en) * | 2009-10-26 | 2012-07-25 | 中华人民共和国珠海出入境检验检疫局 | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus |
| CN101864495A (en) * | 2010-04-13 | 2010-10-20 | 上海国际旅行卫生保健中心 | Constant-temperature amplification detection kit of influenza A virus and detection method thereof |
| CN101864495B (en) * | 2010-04-13 | 2012-10-03 | 上海国际旅行卫生保健中心 | Constant-temperature amplification detection kit of influenza A virus and detection method thereof |
| CN108531648A (en) * | 2018-04-11 | 2018-09-14 | 四川农业大学 | It is a kind of it is synchronous detection the diarrhoeal virus of 4 boars oligonucleotide chip and its application |
| CN108531648B (en) * | 2018-04-11 | 2022-03-22 | 四川农业大学 | Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof |
| WO2023077490A1 (en) * | 2021-11-06 | 2023-05-11 | 江汉大学 | Combination of mnp markers of influenza a, b and c viruses, primer pair combination, kit, and uses of combination, primer pair combination and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101487061B (en) | 2014-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8568981B2 (en) | Probe and method for detection and discrimination of types and subtypes of influenza viruses | |
| US20080003565A1 (en) | Viral nucleic acid microarray and method of use | |
| Choi et al. | Phylogenetic analysis of H1N2 isolates of influenza A virus from pigs in the United States | |
| Qiu et al. | A reverse transcription-PCR for subtyping of the neuraminidase of avian influenza viruses | |
| CN101942525B (en) | One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit | |
| CN101487061B (en) | Detection of influenza A virus epidemic isolates, typing gene chip and using method | |
| CN104232802B (en) | Detect the test kit of avian infectious laryngotracheitis virus, newcastle disease virus and avian infectious bronchitis virus | |
| CN113005228A (en) | Detection kit for synchronously detecting multiple respiratory pathogens and detection method thereof | |
| US20180265936A1 (en) | Compositions and methods for detection and discrimination of influenza viruses | |
| Ellis et al. | Influenza AH1N2 viruses, United Kingdom, 2001–02 influenza season | |
| US20090088331A1 (en) | Influenza virus nucleic acid microarray and method of use | |
| Sun et al. | DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7 | |
| EP2454386B1 (en) | Influenza detection method and kit therefor | |
| CN101020930A (en) | Gene chip for detection and typing of bird flu virus | |
| US20180163277A1 (en) | Compositions and methods for detection and discrimination of emerging influenza virus subtypes | |
| CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
| Lin et al. | Characterization of the epidemic influenza B viruses isolated during 2004–2005 season in Taiwan | |
| CN103667538A (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN107964567A (en) | Influenza A detects genetic chip | |
| CN102251060A (en) | Preparation and application method for gene chip for detecting drug resistance of A type influenza virus epidemic virus strain | |
| CN1834655A (en) | Method of detecting etiology by tacteriophage immunity PCR | |
| Li et al. | Detection and subtyping of influenza A virus based on a short oligonucleotide microarray | |
| Kelvin et al. | Influenza monitoring in Sardinia, Italy identifies H3 subtype in Mediterranean wild migratory birds | |
| CN110951918A (en) | Kit for jointly detecting influenza A virus and influenza B virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof | |
| KR101809710B1 (en) | Primers for Detecting Avian Influenza Virus Neuramidase Subtype and Uses Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140312 Termination date: 20151110 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |