CN108531648B

CN108531648B - Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof

Info

Publication number: CN108531648B
Application number: CN201810321919.9A
Authority: CN
Inventors: 黄小波; 文心田; 曹三杰; 滑翔; 文翼平; 赵勤; 伍锐
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2018-04-11
Filing date: 2018-04-11
Publication date: 2022-03-22
Anticipated expiration: 2038-04-11
Also published as: CN108531648A

Abstract

The invention provides an oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses, which comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises: SEQ ID NO: 1-2, and the probe shown in SEQ ID NO: 3-4, and the probe shown in SEQ ID NO: 5-6, SEQ ID NO: 7-8, which are respectively used for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine group A rotavirus and porcine delta coronavirus. The invention also provides a kit and a detection method for synchronously detecting the 4 porcine diarrheal viruses. The chip and the method can realize high-throughput co-detection of the four porcine diarrhea viruses PEDV, TGEV, GAR and PDCoV, can be applied to large-scale detection of clinical epidemic diseases, and have wide application prospect.

Description

Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to an oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof.

Background

In recent years, the occurrence and prevalence of infectious diarrhea diseases of pigs are becoming serious, and immeasurable economic losses are caused to vast farmers. At present, the viral sources of the Porcine infectious diarrhea diseases in China are mainly Porcine Epidemic Diarrhea Virus (PEDV), Porcine Transmissible gastroenteritis virus (TGEV) and Porcine Group A Rotavirus (GAR). After epidemic diseases caused by the three viruses occur, the appearance characteristics are basically similar, the disease is manifested by vomiting, watery jet diarrhea, dehydration and the like, and particularly, the disease of the suckling piglets is serious and the mortality rate is high. Porcine delta coronavirus (PDCoV) was first reported to be found in the pig farm in hong kong in 2012, then reported to be found in the pig farm in 2014 in ohio and illinois in the usa, and thereafter reported to be in at least 19 states. PDCoV is primarily sensitive to the small intestine, especially the jejunum and ileum, of the dyeing and finishing tract, causing severe enteritis accompanied by diarrhea and vomiting in piglets. Because the diarrhea virus often has the condition of mixed infection and the clinical differential diagnosis is difficult, the development of the synchronous differential diagnosis of the four porcine diarrhea viruses has important significance for prevention and control.

At present, virus separation identification, serological methods (an immune electron microscopy, immunohistochemistry, immunofluorescence, enzyme-linked immunosorbent assay (ELISA)), molecular biological detection technologies (in situ hybridization (ISH), polymerase chain reaction (RT-PCR)) and the like are mainly used for diagnosing viral diseases, and although the methods are applied to a certain extent, the methods still have defects in diagnosing mixed infection. For example, virus separation is not easy to succeed, serological detection sensitivity is low, cross reaction is easy to occur in the detection process, and the high-flux rapid detection of samples cannot be realized due to the limited number of samples for molecular biological detection. The common defect of the detection technologies is that synchronization cannot be realized, so that a high-throughput diagnosis technology is urgently needed for differential diagnosis of the four piglet viral diarrhea diseases.

The gene chip technology is a new high-throughput detection technology rapidly developed in recent years, and can be divided into cDNA chips and oligonucleotide chips according to the difference of probes. The gene chip is prepared through making designed probe on substrate, labeling the amplified product with fluorescein or enzyme and other labeling matter on the single strand, hybridizing with the prepared chip, scanning with laser scanner, visual observation and other steps to obtain the hybridized result, and analyzing. The method has the potential advantages of automation, parallelism, high flux and the like, can detect various diseases simultaneously, and therefore, the method is widely applied to the field of biology and has wide prospect in the aspect of animal epidemic disease research.

The report of utilizing the gene chip technology to detect the porcine diarrhea virus at present is shown in glidesday and the like, the construction of cDNA chips for detecting the porcine epidemic diarrhea virus, the porcine transmissible gastroenteritis virus and the porcine rotavirus is shown in animal husbandry and veterinary science, 2015, 12: 235-one 224, the method only aims at three porcine diarrhea viruses, the used chips are cDNA chips, the minimum detection mass concentration is only 20 pg. mu.L^-1The sensitivity is lower.

Malui et al, pig viral diarrhea virus gold-labeled silver staining visualization chip technology experiment condition optimization research and application, agricultural biotechnology report 2016,24: 1233-; in addition, the operation procedures are multiple and complex, and the conditions are difficult to control and standardize; in addition, the requirement on reagent materials is high, and the detection cost is high; and in order to make the result visible to the naked eye, the method must use a spray sample, and the number of samples detected at one time is small.

The oligonucleotide chip is characterized in that specific oligonucleotide fragments are designed and fixed on aldehyde groups, gene fragments obtained by PCR amplification after fluorescent labeling are detected through base pairing and fluorescent labeling. Because the probe is fixed on the substrate in a single-stranded form, compared with a cDNA chip, the method effectively reduces the double-stranded competitive inhibition effect, and the hybridization efficiency and the sensitivity are superior to the cDNA chip to a certain extent. However, no report on preparation of oligonucleotide chip for porcine diarrhea virus exists at present, and no high-sensitivity oligonucleotide chip for simultaneously detecting 4 porcine diarrhea viruses is available.

Disclosure of Invention

The invention aims to provide an oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof.

The invention provides an oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses, which comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises: SEQ ID NO: 1-2, and the probe shown in SEQ ID NO: 3-4, and the probe shown in SEQ ID NO: 5-6, SEQ ID NO: 7-8, which are respectively used for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine group A rotavirus and porcine delta coronavirus.

Wherein, still include the matter accuse probe: SEQ ID NO: 9, SEQ ID NO: 10, positive control probe.

Wherein the solid phase carrier is an aldehyde group glass slide which is subjected to aldehyde group silicification treatment. E.g. produced by Beijing Boao Biometrics Ltd

An aldehyde-based substrate.

The invention also provides a primer pair for amplifying 4 porcine diarrheal virus genes, which comprises 8 primer pairs, wherein the primer pairs are respectively shown as SEQ ID NO: 11-12, SEQ ID NO: 13-14, SEQ ID NO: 15-16, SEQ ID NO: 17-18, SEQ ID NO: 19-20, SEQ ID NO: 21-22, SEQ ID NO: 23-24, SEQ ID NO: 25-26.

The invention also provides a kit for synchronously detecting 4 porcine diarrheal viruses, which comprises the oligonucleotide chip of

claim

1 or 2 and the primer pair shown in claim 3.

Wherein, it also includes the primer pair of the positive gene amplification, the sequence is shown as SEQ ID NO: 27-28.

The invention also provides application of the oligonucleotide chip, the primer pair or the kit in preparing a reagent for detecting 4 porcine diarrheal viruses.

The invention also provides a method for synchronously detecting the 4 porcine diarrheal viruses, which comprises the following steps:

(1) preparing a virus sample: taking a tissue to be detected, extracting RNA and carrying out reverse transcription to obtain cDNA;

(2) preparation of target sequence: amplifying a target sequence by using the primer pair and carrying out fluorescence labeling;

(3) and (3) hybridization: hybridizing the target sequence prepared in the step (2) with the oligonucleotide chip;

(4) and (4) detecting a result: and (4) scanning and analyzing the hybridized chip in the step (3).

Wherein in the step (3), the hybridization time is 2-3h and the temperature is 46 DEG C

Wherein, in the step (4), the scanning instrument is a Boo Luxscan-10K/A chip scanner.

The research respectively designs respective specific oligonucleotide probes aiming at the S and M genes of the porcine epidemic diarrhea virus, the S and N genes of the porcine transmissible gastroenteritis, the VP7 and NSP4 genes of the porcine rotavirus A and the sense chain sequences of the N and M genes of the porcine delta coronavirus, and constructs an oligonucleotide chip which can be used for simultaneously detecting PEDV, TGEV, GAR and PDCoV, wherein the constructed oligonucleotide chip has good specificity, and has no cross reaction among all internal target genes and other common pathogens; the sensitivity is 2 pg. mu.L-1; the chip can be stored for at least 120 days at 4 ℃ after being spotted, has high stability and good accuracy, can realize high-flux co-detection of the four porcine diarrhea viruses PEDV, TGEV, GAR and PDCoV, can be applied to large-scale detection of clinical epidemic diseases, and has wide application prospect.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 is a schematic diagram of gene chip matrix spotting

FIG. 2PCR amplification results

(M:2000bp marker, 1: PS, 2: PM, 3: TS, 4: TN, 5: VP7, 6: NSP4, 7: DN, 8: DM, 9: λ) FIG. 3 Whole Probe scanning

FIG. 4 spotting buffer optimization results

FIG. 5 hydration time optimization results, A: hydration for 6 h; b, hydrating for 8 hours; c, hydrating for 10 hours; d, hydrating for 12 hours.

FIG. 6 hydration time optimization results graph

FIG. 7 hybridization temperature optimization, A:38 ℃; b, 42 ℃; c, 46 ℃; d, 50 ℃.

FIG. 8 hybridization temperature optimization results graph

FIG. 9 hybridization time optimization, A: hybridization for 60 min; b, hybridizing for 90 min; c, hybridizing for 120 min; and D, hybridizing for 150min.

FIG. 10 hybridization time optimization results graph

FIG. 11 hybridization results of chip-specific experiments

A, PEDV specificity experiment results; b, TGEV specificity experiment results; c, GAR specificity experiment results; d, PDCoV specificity experiment results; e, PRRSV + CSFV + JEV + PCV2 mixed infection specificity experiment result.

FIG. 12 results of chip sensitivity experiment (A: 10)⁵Carrying out dilution; b: 10⁶Carrying out dilution; c: 10⁷Carrying out dilution; d: 10⁸Dilute)

FIG. 13 evaluation results of chip shelf life (A: 30D; B: 60D; C: 90D; D: 120D)

FIG. 14 shelf life graph

Detailed Description

The following examples are further illustrative, but the present invention is not limited to these examples.

EXAMPLE 1 construction of PEDV-TGEV-GAR-PDCoV oligonucleotide co-detection chip of the present invention

1. Biological material

1.1 plasmids

Recombinant plasmids pMD-PS, pMD-PM, pMD-TS, pMD-TN, pMD-VP7, pMD-NSP4, pMD-N, pMD-M (the preparation method is shown in the construction of 2-purpose gene recombinant plasmid), pMD-lambda (purchased from Takara Bio (Dalian) Biotech Co., Ltd.), the plasmids are constructed and stored in the laboratory.

1.2 main reagents:

total RNA extraction kit, blood/tissue/cell genome extraction kit: tiangen Biochemical technology Corp;

small plasmid extraction kit: omega bio-tek company;

PrimeScript^TMRT Reagent Kit, positive quality control (λ DNA): bao bioengineering (Dalian) Limited;

aldehyde substrate, gene chip hybridization buffer, optical grade aldehyde substrate: shanghai Baiao bioengineering, Inc.;

an optical grade aldehyde-based substrate,

A microarray chip hybridization box,

A multi-sample chip fence,

A cover plate of the multi-sample chip,

Gene chip sampling solution: beijing Boao Biotechnology Ltd.

Configuration of other self-contained reagents:

2 XSSC: NaCl 17.53g, sodium citrate 8.82g and ddH2O 80ml, adjusting pH to 7.0 with NaOH, diluting to 100.0ml, filtering with filter membrane with pore diameter of 0.2nm, and storing

10% SDS 100g of SDS was weighed and dissolved in 900mL of ultrapure water.

PBS buffer: 30g of NaCl, 1g of KCl, 47.1g of Na2HPO47, and 1L of KH2PO41.35g of constant volume;

50 × TAE: tris 121.0g, glacial acetic acid 28.55mL, 0.5 mol. L-1EDTA 50.0mL, pH adjusted to 8.0 using NaOH, ddH2O added to make 500mL volume.

1.3 main equipment:

POWER Pac^TMelectrophoresis apparatus, MyCycler^TMPCR instrument, gel imaging analysis system, SmartSpec^TMPlus nucleic acid protein instrument: BIO-RAD, USA; air constant temperature shaking table and Allegra^TM64R high-speed refrigerated centrifuge, molecular hybridization apparatus: thermo Forma corporation, usa; personal array^TM16 microarray chip spotting system, boao Luxscan-10K/a chip scanner: beijing Boao Biotechnology Ltd.

1.4 primers and probes

TABLE 1 primer information

Note: f is an upstream primer; r is the downstream primer.

TABLE 2 Probe information

Construction of recombinant plasmid for target Gene

2.1 primer design: the gene sequences recorded in Genbank are respectively subjected to multiple alignment analysis by using DNAMAN software to select respective conserved regions, and specific primers are designed aiming at the conserved regions by using software Primer Premier 5.0, which is shown in Table 1.

2.2 extraction of the target Gene: extracting the total RNA of the target gene by adopting a total RNA extraction kit of the radix tiangen.

2.3RT-PCR amplification

The extracted RNA is taken as a template, Random 6primers are taken as primers to synthesize cDNA, and the reaction system is as follows:

total volume (10.0 μ Ι): RT Enzyme Mix 0.5. mu.l, Random 6primers 0.5. mu.l, 5 XPrimeScript RT Buffer 2.0. mu.l, RNA 2.0. mu.l, RNase-Free ultrapure water 5.0. mu.l.

Reverse transcription of RNA was performed as follows: 15min at 37 ℃; 5s at 85 ℃; the resulting cDNA was stored at 4 ℃.

Taking cDNA obtained by reverse transcription as a template, carrying out PCR amplification on the NP gene fragment of AIV, wherein the reaction system and the reaction conditions are as follows:

total volume (15.0 μ Ι): 2 XTaq PCR Master Mix 7.5. mu.l, cDNA 2.0. mu.l, upstream and downstream specific primers (10.0. mu. mol/L) each 0.5. mu.l, and ultrapure water 4.5. mu.l.

The reaction conditions were as follows: denaturation at 95.0 deg.C for 5 min; denaturation at 95.0 ℃ for 30s, annealing at 56.5 ℃ for 30s, extension at 72.0 ℃ for 30s, 30 cycles; extending at 72.0 deg.C for 10min, and storing at 4 deg.C. Mu.l of the amplification product was identified by 2% agarose gel electrophoresis.

2.4 gel recovery of the target gene, ligation of pMD19-T, transformation of the competent cells, identification of the recombinant plasmid of the target gene.

2.5 preservation of the target Gene recombinant plasmid bacteria: and (3) carrying out amplification culture on the probe gene recombinant plasmid bacteria with correct sequence determination for 12h, then uniformly mixing 20% of skimmed milk powder with the bacterial liquid in a ratio of 1:1, pumping out, and storing at-70 ℃.

The probe gene sequences are respectively as follows:

the gene source is as follows: PEDV-S, gene fragment size and sequence: 474bp

CGCTAGGCTTGAGTCTGTTGAAGTTAACTCTATGCTTACTATTTCTGAAGAGGCTCTACAGTTAGCTACCATCAGTTCGTTTAATGGTGATGGATATAACTTTACTAATGTGCTGGGTGTTTCCGTGTACGACCCTGCAAGTGGCAGGGTGGTACAAAAAGGGTCTTTTATTGAAGACCTGCTTTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGATGAAGACTATAAGCGCTGTTCTAATGGTCGCTCTGTGGCAGATCTAGTCTGTGCGCAGTATTACTCTGGTGTCATGGTACTACCTGGCGTTGTTGACGCTGAGAAGCTTCAAATGTATAGTGCGTCTCTCATCGGTGGTATGGCGCTAGGAGGTCTTACTACTGCAGCGGCATTGCCTTTTAGCCATGCTGTTCAAGCGAGGCTCAATTATCTTGCTTTACAGACGGATGTTCTACAGCGGAACCAGCAATT

The gene source is as follows: PEDV-M, gene fragment size and sequence: 421bp

CTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTATTTTGTCAATAGCATTCGGTTGTGGCGCAGGACACATTCTTGGTGGTCTTTCAATCCTGAAACTGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGGTCTGCATTCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGTTTGTAGAGGGCTATAAGGTTGCTACTGGCGTACAGGTAAGTCAATTGCCTGATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTATGGACGTGTTGGTCGTTCAGTCAATGCTTCATCTGGCACTGGTTGGGCTTTCTATGTCCGGTCAAAACACGGCGACTACTCAGCTGTGAGTAATCCGAGTGCGGTTCTCACAGATAGCGAGAAAGTGC

The gene source is as follows: TGEV-S, gene fragment size and sequence: 274bp

AGGCTTGACGAATTGAGTGCTGATGCACAAGTTGACAGGCTGATCACAGGAAGACTTACAGCACTTAATGCATTTGTGTCTCAGACTCTAACCAGACAAGCGGAGGTTAGGGCTAGTAGACAACTTGCCAAAGACAAGGTTAATGAATGCGTTAGGTCTCAGTCTCAGAGATTCGGATTCTGTGGTAATGGTACACATTTGTTTTCACTCGCAAATGCAGCACCAAATGGCATGATTTTCTTTCACACAGTGCTATTACCAACGGCTTATGAAACT

The gene source is as follows: TGEV-N, gene fragment size and sequence: 362bp

TTCCTGAAAGGTGGTTCTTCTACTACTTAGGTACTGGACCTCATGCAGATGCCAAATTTAAAGATAAATTAGATGGAGTTGTCTGGGTTGCCAAGGATGGTGCCATGAACAAACCAACCACGCTTGGTAGTCGTGGTGCTAATAATGAATCCAAAGCTTTGAAATTCGATGGTAAAGTGCCAGGCGAATTTCAACTTGAAGTTAATCAATCAAGAGACAATTCAAGGTCACGCTCTCAATCTAGATCTCGGTCTAGAAATAGATCTCAATCTAGAGGCAGGCAACAATTCAATAACAAGAAGGATGACAGTGTAGAACAAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAA

The gene source is as follows: GAR-VP7, gene fragment size and sequence: 381bp

TTGAATGAATGGCTATGTAATCCAaTGgATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGATATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGACTCTCGGGATAGGATGTTCGACTACAGACATAAATTCATTTGAAACAGTGGCCAATGCAGAGAAATTAGCTATAACTGATGTTGTCGATGGAGTCAATCATAAATTAGACGTAACAACGAGTACATGTACTATAAGAAATTGTAAAAAACTTGGACCAAGAGAAAATGTCGCTGTAATTCAGGTAGGAGGTCCAAACATACTCGACATAACAGCTGATCCAACAACTGCACCACAAACTGAAAGAATGATGCGT

The gene source is as follows: GAR-NSP4, gene fragment size and sequence: 270bp

GAACAGGTTACTACTAAGGATGAAATTGAACAACAGATGGACAGAATTGTTAAGGAGATGAGGCGTCAACTGGAAATGATTGACAAATTGACAACTCGTGAAATTGAACAAGTTGAATTACTTAAGCGTATACATGACAAATTAGCTGCTAGACCAGTTGATGCTATAGATATGTCGAAGGAATTTAATCAGAAAAATATTCGAACGCTAGATGAATGGGAAAGTGGAAAAAATCCATATGAACCGTCGGAAGTAACTGCGTCTATGTGA

The gene source is as follows: pPDCoV-N, gene fragment size and sequence: 775bp

TCCATCCTATGCCTTTTATACTGGCACAGGTCCCAGAGGAAATCTTAAGTATGGTGAACTCCCTCCTAATGATACCCCAGCAACCACTCGTGTTACTTGGGTTAAGGGTTCGGGAGCTGACACTTCTATTAAACCTCATGTTGCCAAACGCAACCCCAACAATCCTAAACATCAGCTGCTACCTCTCCGATTCCCAACCGGAGATGGCCCAGCTCAAGGTTTCAGAGTTGACCCCTTCAACGCTAGAGGAAGACCTCAGGAGCGTGGAAGTGGCCCAAGATCTCAATCTGTTAACTCCAGAGGCACAGGCAATCAGCCCAGGAAACGCGACCAATCTGCACCCGCTGCGGTACGTCGTAAGACCCAACATCAAGCTCCCAAGCGGACTTTACCCAAGGGTAAAACCATTTCTCAGGTATTTGGCAACCGGTCTCGTACTGGTGCCAATGTCGGCTCTGCAGACACTGAGAAGACGGGTATGGCTGATCCTCGCATCATGGCTCTAGCCAGACATGTGCCTGGTGTTCAGGAAATGCTTTTCGCTGGCCACCTTGAGAGCAACTTTCAGGCAGGGGCAATTACCCTTACCTTCTCTTACTCAATCACAGTCAAGGAGGGTTCTCCTGACTATGAGAGACTTAAGGATGCGCTCAATACGGTCGTTAACCAGACCTATGAGCCACCCACCAAACCAACTAAGGACAAGAAGCCTGACAAACAAGACCAGTCTGCTAAACCCAAACAGCAGAAGAA

The gene source is as follows: pPDCoV-M, gene fragment size and sequence: 485bp

GCGTAACCGTGTGATCTATGTTATTAAACTTATTCTGCTTTGGCTGCTCCAACCCTTCACCCTAGTGGTGACCATTTGGACCGCAGTTGACAGATCATCTAAGAAGGACGCAGTTTTCATTGTGTCCATAATTTTTGCCGTACTGACCTTCATATCCTGGGCCAAGTACTGGTATGACTCAATTCGCTTATTAATGAAAACCAGATCTGCATGGGCACTCTCACCTGAGAGTAGACTCCTTGCAGGGATTATGGATCCAATGGGTACATGGAGGTGCATTCCCATCGACCACATGGCTCCAATTCTCACACCAGTCGTTAAGCATGGCAAGCTCAAGCTACATGGGCAAGAGCTGGCCAATGGCATATCAGTTAGAAATCCGCCACAGGATATGGTGATAGTGTCACCAAGTGACACCTTTCACTACACTTTTAAGAAACCTGTGGAATCAAACAGCGATCCAGAATTCGCTGTTCTGATATACCA

The gene source is as follows: lambda gene, gene fragment size and sequence: 500bp

GTCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGCGACCGGGCAGGGGCAGAAATCTGCCGGAGATACCAGCTTCACGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCAGGCGCTGCTGGCGTGGTTTAATGAAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGCACCGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCAGGCGCTGCTGGCGTGGTTTAATGAAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGCACCACGGTAACAGCGGCAACCGGCATGACCGTGACGCCTGCCAGCACCTCGGTGGTGAAAGGGCAGAGCACCACGCTGACCGTGGCCTTCCAGCCGGAGGGCGTAACCGACAAGAGCTTTCGTGCGGTGTCTGCGGATAAAACAAAAGCCACCGTGTCGGTCAGTGGTATGACCATCACCGTGAACGGCGTTGCTGCAGGCAAGGTCAACATT

3 oligonucleotide chip preparation

3.1 oligonucleotide chip spotting procedure

The sample application system used in this study was a crystal core Personal array 16, and a contact sample application system was used to apply a chip whose substrate was produced by Beijing Boo-ao

An optical grade aldehyde substrate. The probe and the targeting gene were diluted to 200. mu.g.mL^-1An equal volume of spotting buffer was added. Probes (i.e., 8 detection probes for 4 viruses), a localization gene probe, and a positive control probe were added to the 384-well template in order, respectively, according to the design of the chip matrix. The humidity of the spotting environment was set above 45%.

After the operating software of the chip Personal array 16 is opened, the system enters a setting interface after self-checking is finished, a sample application needle is loaded, and a 384-hole sample application plate is placed. Calibrating the system positions of the sample applicator before sample application, namely a cleaning position, a draining position, a first wave plate position, a sample orifice plate A24 position and an emptying position, and calibrating the Z-axis position after calibrating the X, Y axis of each position. After placing a chip required by the test in a sample application area of the sample applicator, setting sample application parameters as follows:

the number of chips required by the test is placed in a chip card groove of the sample applicator, the initial slide is set to be 1, and the number of sample application slides is set according to the corresponding number after the sample application slides are placed according to the actual test requirement. According to the design requirement of a chip dot matrix, the number of sample repetition points is 4, a repetition array is selected, the number of pre-points is 50, and the pre-spotting distance is 500 mu m; in the cleaning setting, the cleaning, the ultrasonic treatment and the pumping-out are all 3s, and the process is repeated for more than 5 rounds to ensure the cleanness of the sample application needle.

Standing for 15min after the chip is spotted, carrying out ultraviolet crosslinking for 15min after complete drying, then hydrating at 37 ℃ in a molecular hybridization instrument overnight, washing the hydrated chip for 5min by using a 0.2 XSSC solution preheated at 37 ℃, then washing for 5min by using distilled water preheated at 37 ℃, completely covering the chip matrix with a sealing solution (0.5 percent BH4Na, 25 percent Ethanol and 0.75 XSSC), sealing in the molecular hybridization instrument at 37 ℃ for 15min, washing again by using preheated distilled water, and 1300 r.min^-1And (4) completely drying by centrifugation, and storing at 4 ℃ in a dark place for later use.

3.2 oligonucleotide chip hybridization procedure

3.2.1 amplification labelling of target genes

Using 9 plasmids diluted by 100 times as templates, performing fluorescence labeling amplification by using a fluorescence-labeled downstream specific primer, and loading samples in a dark environment, wherein a PCR system comprises the following steps:

total volume (30.0 μ Ι): 2 XTaq PCR Master Mix 15.0. mu.l, template 2.0. mu.l, upstream primer 2.0. mu.l, fluorescence labeling downstream specificity primer 2.0. mu.l, and ultrapure water 9.0. mu.l.

Reaction procedure: 5min at 95 ℃; 30 cycles at 95 ℃ 30sec, 58 ℃ 30sec, 72.0 ℃ 45 sec; preserving at 72 deg.C for 10min and 12 deg.C.

3.2.2 hybridization and washing of oligonucleotide chips

The PCR amplification product (i.e. the probe gene sequence) is denatured at 95 ℃ for 5min to obtain fluorescence labeling single chains, then the fluorescence labeling single chains are placed on ice and cooled for 5min to prevent double chains, the fluorescence labeling single chains are mixed with hybridization buffer solution 1:1, and 50 mu L of mixed solution is added into the matrix of each prepared oligonucleotide chip to ensure that the matrix can be completely covered. The chip is placed in a hybridization cabin and hybridized for 2 to 3 hours in a molecular hybridization instrument at the temperature of 42 ℃ in a dark place. After hybridization, washing liquor I (2 XSSC + 0.2% SDS), washing liquor II (0.2 XSSC) and washing liquor III ultrapure water are preheated at 37 ℃, the hybridized chip is placed in the washing liquor I to be washed for 5min in a vibration mode, then placed in the washing liquor II to be washed for 5min in a vibration mode, then placed in the ultrapure water to be washed for 5min, and the chip is required to be lifted up and down in the vibration washing process to ensure that the chip is completely washed. Finally, the chip is dried after 1300 r.min-1 is centrifuged for 10min, and the chip is scanned and analyzed. The chip can be stored in dark and is effective in scanning within 30 d.

3.3 oligonucleotide chip scanning and result determination

And scanning and observing the oligonucleotide chip after hybridization washing and drying treatment by using a Boo Luxscan-10K/A chip scanner. Setting the scanning parameters of a Luxscan-10K/A chip scanner: a channel: a green light channel; fluorescent dye: cyanine 3; power: 95; PMT: 650; resolution ratio: 10. after the channel activation is finished, the whole chip is firstly prescanning, and after the prescanning is finished, the matrix area in the prescanning is selected for scanning to observe the chip hybridization result.

The scanning result is analyzed by using the random self-contained data analysis software LuxScan3.0 of the gene Bo' ao Luxscan-10K/A chip scanner, data are obtained by establishing a one-to-one correspondence between the virtual dot matrix and the matrix inner dot matrix, and the analysis result is stored in a file format of a dot LSR. The software data output mode mainly comprises two modes of a lattice point signal median value and a lattice point signal average value. The concept SNR of the sample point signal threshold is the ratio of the median of the array point signal value to the median of the background signal, when the SNR is more than or equal to 2.0, and the array point is clearly visible in the matrix, the research judges the hybridization result of each sample point according to the SNR.

3.4 oligonucleotide chip detection matrix design arrangement

Since hybridization pens purchased in the laboratory can only be divided into 4 matrices, in order to maximize the utilization rate of each chip, the present study designed 4 repetitive matrices on each oligonucleotide chip, separated by hybridization pens, so that parallel detection could be performed simultaneously clinically. The designed matrix comprises a positioning gene, a positive control, a probe gene to be detected and a negative control which is divided into ultrapure water and sample application buffer solution. The first row is a positioning gene, the sixth row is ultrapure water and spotting buffer solution which are used as negative control, the last row is positive control, and the other rows are provided with corresponding probes and blank control. Each set of lattice points in the lattice is repeated 4 times, and each matrix contains 8 × 7 ═ 56 points. The pattern of gene chip matrix spotting is shown in FIG. 1.

3.5 extraction of Positive plasmids

Selecting a little of frozen recombinant plasmid bacteria containing target genes, resuscitating and culturing in an LB liquid culture medium (Amp containing 100 mu g.mL < -1 >), and placing in a shaking table at 37 ℃ for 12 h; streaking on LB solid culture medium (Amp containing 100 mug. mL < -1 >), and culturing at 37 ℃ for 12h in an inverted constant temperature manner; selecting a target single colony with proper shape and size, adding 5mL LB liquid culture medium containing Amp, placing on a constant temperature shaking table at 37 ℃ for 220 r.min < -1 > and shaking culture overnight. Extracting recombinant plasmids of PEDV-S, PEDV-M, TGEV-S, TGEV-N, GAR-VP7, GAR-NSP4, PDCoV-N, PDCoV-M and lambda from the recovered target gene recombinant plasmids respectively, wherein the operation steps are shown in the specification of a plasmid extraction kit. The extracted plasmid DNA was eluted with 80. mu.L of ElutionBuffer, and 7. mu.L of the product was identified by 1% agarose gel electrophoresis under the conditions: 80V, 20 min.

3.6 oligonucleotide chip Probe and spotting buffer solution matching optimization

Adding a positioning gene probe and a sample application buffer solution into 384-hole sample loading sample plate holes respectively according to the proportion of original probe concentration to 1: 1. 1: 2. 1: 3. 1: the mixed solution with 4 concentrations is set to be 8 in each concentration repeated sample application number so as to determine the optimal proportion of the probe and the sample application buffer solution, sample application, hydration and cleaning are carried out according to the method in 2.1, the positioning gene probe is directly marked by cy3 fluorescence and then is spotted on a chip, therefore, hybridization is not needed, the chip is dried after the 1300 r.min < -1 > centrifugation for 10min after the cleaning is finished, the chip is scanned, and the result is observed and analyzed.

3.7 oligonucleotide chip hydration time optimization

After spotting is completed according to the method in section 2.1, the hybridization chamber in which the oligonucleotide chip is placed in a dark and wet box, and hydration treatment is performed for 6h, 8h, 10h and 12h in a 37 ℃ molecular hybridization instrument respectively, so as to determine the optimal hydration time in the preparation process of the chip. And (3) sealing and washing the hydrated chip, washing and drying the hydrated chip after hybridization, scanning the chip, and observing and analyzing the scanning result.

3.8 oligonucleotide chip hybridization temperature optimization

After the PCR products of the constructed 9 positive plasmid templates were processed according to the method in this chapter 2.2.2, the amplification products were mixed with hybridization buffer at 1:1 and hybridized on the spotted chips. The optimal hybridization temperature of the oligonucleotide chip was determined by adding 50. mu.L of the mixture to each array and hybridizing at 38 ℃, 42 ℃, 46 ℃ and 50 ℃. And after hybridization, respectively washing the chip for 5min by using a washing solution I, a washing solution II and ultrapure water, then centrifuging the chip for 10min at 1300 r.min < -1 >, completely drying the chip, then scanning the chip, and observing and analyzing the scanning result.

3.9 oligonucleotide chip hybridization time optimization

The PCR product is treated according to the method in the chapter 2.2.2 and then hybridized with the chips which are finished by pointing, 50 mu L of mixed liquor is added into each chip matrix to perform hybridization for 1h, 1.5h, 2h and 2.5h respectively so as to determine the optimal time for chip hybridization. After hybridization, washing liquid I, washing liquid II and ultrapure water are respectively used for washing for 5min, the chip is dried and scanned after being centrifuged for 10min at 1300 r.min < -1 >, and the scanning result is observed and analyzed.

4 results

4.1 Positive plasmid extraction results

4.1.1 Positive plasmid concentration determination

OD260/OD280 of each plasmid was measured by a nucleic acid protein analyzer and converted into concentrations of PEDV-S (278 ng. mu.L-1), PEDV-M (283 ng. mu.L-1), TGEV-S (232 ng. mu.L-1), TGEV-N (285 ng. mu.L-1), GAR-VP7(302 ng. mu.L-1), GAR-NSP4(289 ng. mu.L-1), PDCoV-N (215 ng. mu.L-1), PDCoV-M (221 ng. mu.L-1) and lambda (195 ng. mu.L-1), respectively.

4.1.2 identification of Positive plasmid amplification products

The positive plasmids of nine genes were subjected to ordinary PCR amplification according to the PCR system and procedure used in 2.2.1, and the amplification products thereof were identified. The results are shown in FIG. 2, where the amplification product corresponds to the expected size.

4.2 detection of Whole Gene on oligonucleotide chip

After the hybridization of the oligonucleotide chip, the chip was washed and dried by centrifugation and the chip was scanned and analyzed, and the results are shown in FIG. 3. It can be seen that each lattice point of 8 gene probes of 4 viruses has fluorescence signal display and the fluorescence signals of the positioning gene probe and the positive control are obvious, and the ultra-pure water and the spotting buffer solution lattice point as the negative control have no fluorescence signal display, thus showing that the gene probe of the prepared oligonucleotide co-detection chip is successfully selected and the chip quality is reliable.

4.3 optimization of spotting buffers

Spotting buffer optimization results as shown in figure 4, fluorescent signals were generated after scanning by spotting mapping gene probes of different ratios onto oligonucleotide chips. When the concentration ratio of the positioning gene probe to the spotting buffer solution is 1: 2, the fluorescent signal on the lattice has no original probe concentration and the ratio is 1:1, the fluorescence signal of the gene chip is better, so that the concentration ratios of other dot matrix probes to the spotting buffer solution are determined to be 1: 2.

4.4 oligonucleotide chip hydration time optimization results

Hydrating the oligonucleotide chip for 6h, 8h, 10h and 12h at 37 ℃, sealing and washing the hydrated chip, hybridizing the hydrated chip with the fluorescence labeling single strand, cleaning and drying the hydrated chip, and scanning the chip for data scanning analysis. The hybridization after 6h hydration leads the probe not to be tightly combined with the substrate because of short hydration time, thus leading the shape of the array point to be irregular, leading the background value to be deep and filling with watermarks; the hybridization result with clear and visible lattice points can be obtained after 8h and 10h of hydration; when the hydration time exceeds 10h, the background color becomes dark obviously, and the fluorescent signal of the array point is fuzzy. The scanning results show (fig. 5): the hybridization signal gradually increases with the increase of the hydration time; when the hydration time exceeded 10h, the background value increased significantly. When the hydration time is 10h, the median difference between the hybridization signal and the background value is the largest, the chip SNR value is the largest (figure 6), and the hybridization signal is the most obvious, so that the hybridization effect of the chip after 10h of hydration treatment is better.

4.5 oligonucleotide chip hybridization temperature optimization results

The same treatment is carried out on the oligonucleotide chips which are spotted in the same batch, then the oligonucleotide chips are hybridized with the chips under the conditions of 38 ℃, 42 ℃, 46 ℃ and 50 ℃, the hybridization is carried out for 2h, then the washing, the drying and the centrifugation are carried out, and the data scanning analysis is carried out to obtain the result (figure 7): the lattice is clear and complete at 38-46 ℃, and when the temperature is higher than 50 ℃, although the lattice is clear and visible, the judgment of the result is influenced by the increase of impurities in the matrix. The analysis of the data scanning results shows that: the hybridization signal gradually increases with the increase of the hybridization temperature; when the hybridization temperature is more than 50 ℃, the hybridization signal starts to decrease. When the hybridization temperature was 46 ℃, the median difference between the hybridization signal and the background value was the largest, the chip SNR value was the largest (fig. 8), and the hybridization signal was the most significant.

4.6 oligonucleotide chip hybridization time optimization results

The same treatment is carried out on the oligonucleotide chips spotted in the same batch, and then the oligonucleotide chips are respectively hybridized for 60min, 90min, 120min and 150min at 46 ℃, and then cleaning, drying and centrifuging are carried out, and the data scanning analysis result shows that (figure 9): the prolonged hybridization time can effectively increase the hybridization efficiency of the gene chip, but the background value is also increased. As can be seen from the analysis of the data scanning result, the intensity of the hybridization signal value and the background value are enhanced in the first 90min, the enhancement of the background value is not obvious after 90min to 120min, the hybridization signal value is still continuously enhanced, the background value is rapidly increased after 120min, when the chip is hybridized for 120min, the difference value between the hybridization signal and the background value is the largest, the SNR value of the chip is the largest (figure 10), and the hybridization signal is the most obvious, so that the hybridization time of 120min is determined to be the optimal hybridization time.

Therefore, the PEDV-TGEV-GAR-PDCoV oligonucleotide co-detection chip is successfully prepared, and the optimal hydration time of the chip is 10 h; the optimal hybridization temperature is 46 ℃; the optimal hybridization time is 120 min.

The following test examples specifically illustrate the advantageous effects of the present invention:

test example 1 evaluation and clinical application of PEDV-TGEV-GAR-PDCoV oligonucleotide co-detection chip of the present invention

1 clinical samples

The method comprises the steps of collecting 209 clinical pig diarrhea samples in Sichuan area, detecting contents of diseased small intestines and small intestines, and comparing a detection result with a conventional RT-PCR result.

2 method

2.1 Gene chip: an oligonucleotide chip was prepared according to the method of example 1.

2.2 extraction of nucleic acid samples

2.2.1 extraction of RNA viral nucleic acid samples

Total RNA extraction is carried out on clinical samples by adopting a Tiangen total RNA extraction kit (column) kit. Firstly, collecting corresponding target organ tissue samples with more virus content (PEDV, TGEV, GAR and PDCoV adopt small intestines and small intestine contents which are used for detecting pathological materials to be cut off; CSFV, PRRSV and JEV adopt liver, kidney, spleen and lymph node pathological tissues), adding 1mL of lysate to grind, adding liquid nitrogen in the grinding process, grinding until the tissue samples are melted, and then extracting RNA according to the specification of a Tiangen total RNA extraction kit (column) kit.

The reverse transcription kit of TAKARA is used to reverse transcribe the product extracted from the RNA extraction kit into cDNA, the concentration and purity are measured with nucleic acid protein instrument, and the reverse transcribed cDNA is used as template for amplification and labeling and then hybridized. The reverse transcription was performed according to the TAKARA reverse transcription kit instructions, and the PCR system was as follows:

total volume (10.0 μ Ι): 5 XPrimeScript RT Buffer 2.0. mu.l, RT Enzyme mix 0.5. mu.l, Random 6 mers 0.5. mu.l, Total RNA 2.0. mu.l, RNase-Free ddH₂O 5.0μl。

Reaction procedure: 15min at 37 ℃; 85 ℃ for 5 sec; storing at 4 ℃.

2.2.2 extraction of DNA Virus nucleic acid samples

Extracting PCV nucleic acid by using a TIANGEN total DNA extraction kit (column), taking PCV positive pathological spleen, liver, kidney and lymph node pathological change tissues, shearing the PCV positive pathological change tissues, putting the PCV positive pathological change tissues into an EP tube, boiling the PCV positive pathological change tissues in boiling water for 10min, adding 20 mu L of proteinase K after the temperature is reduced, heating the PCV positive pathological change tissues in water bath at 55 ℃ for 1h, extracting DNA according to the steps of the TIANGEN total DNA extraction kit (column) kit specification, and storing extracted DNA products at 4 ℃.

2.3 specificity test

Fluorescent-labeled single chains of PEDV, TGEV, GAR, PDCoV, PRRSV, CSFV, JEV and PCV plasmids were prepared respectively according to the method in example 1, and then fluorescent-labeled single chains of PEDV, TGEV, GAR and PDCoV plasmids and a mixture of fluorescent-labeled single chains of PRRSV, CSFV, JEV and PCV plasmids were selected and hybridized with the spotted oligonucleotide chip. Taking out the chip from the hybridization box cabin after hybridization, placing the chip in washing liquor I for vibration washing for 5min, placing the chip in washing liquor II for vibration washing for 5min, and then placing the chip in the washing liquor II for vibration washingCleaning in ultrapure water for 5min, and cleaning with 1300r min^-1After centrifugation for 10min, the chip was dried, scanned and analyzed.

2.4 sensitivity test

OD260/OD280 of each plasmid was measured by a nucleic acid protein analyzer at PEDV-S (278 ng. mu.L-1), PEDV-M (283 ng. mu.L-1), TGEV-S (232 ng. mu.L-1), TGEV-N (285 ng. mu.L-1), GAR-VP7(302 ng. mu.L-1), GAR-NSP4(289 ng. mu.L-1), PDCoV-DN (215 ng. mu.L-1), PDCoV-DM (221 ng. mu.L-1) and lambda (195 ng. mu.L-1), respectively. All positive plasmids were diluted 10-fold in a gradient, and cDNA of different concentrations after dilution was used as template amplification products, fluorescence-labeled single strands were prepared and hybridized with the chip by the method 2.2 in example 1, and after hybridization, the chip was washed, centrifuged at 1300 r.min-1 for 10min, and then dried, and the chip was scanned and analyzed.

2.5 shelf life test

In this study, 8 chips produced in the same batch according to the method of example 1 were stored in a sealed state at 4 ℃. Two chips were extracted from each group at 30d, 60d, 90d, and 120d, respectively, hybridized with positive plasmid fluorescent-labeled single strands, washed and dried, and then scanned and analyzed.

2.6 clinical sample testing

2.7.1RT-PCR assay clinical samples

Extracting nucleic acid from 209 clinical samples according to a method of 2.2.1, transcribing the nucleic acid into cDNA, performing fluorescence labeling amplification by using a fluorescence labeling downstream primer, and adding samples in a dark environment, wherein a PCR system comprises the following steps:

total volume (15.0 μ Ι): 2 XTaq PCR Master Mix 7.5. mu.l, upstream specific primer 1.0. mu.l, fluorescence labeling downstream specific primer 1.0. mu.l, DNA template 1.0. mu.l, ultrapure water 4.5. mu.l.

7 μ L of the product was identified by electrophoresis on a 1% agarose gel under the following conditions: 80V, 20 min.

2.7.2 oligonucleotide Gene chip assay clinical samples

Collecting the contents of lesion small intestine and small intestine of 209 clinical samples in Sichuan area, extracting virus RNA by using a Tiangen total RNA extraction kit, carrying out reverse transcription on the extracted RNA into cDNA by a TAKARA reverse transcription kit, carrying out fluorescence amplification labeling by PCR, carrying out hybridization detection, and comparing with the detection result of conventional RT-PCR.

3 results

3.1 specificity test

PEDV-TGEV-GAR-PDCoV oligonucleotide chip hybridization specificity detection is carried out by respectively using viruses such as PEDV, TGEV, GAR, PDCoV, PRRSV, CSFV, JEV, PCV and the like. The results are shown in FIG. 11.

Therefore, the following steps are carried out: fluorescent labeling single chains of positive plasmids of PEDV, TGEV, GAR and PDCoV are respectively hybridized with the chip, the PEDV, the TGEV, the GAR and the PDCoV have obvious fluorescent signals at corresponding lattice points, the positioning genes and the positive control fluorescent signals are obvious, and the result shows positive. The plasmid fluorescent labeling single chains of PRRSV, PCV, CSFV and JEV are mixed and hybridized with the chip, and the detection result shows that except that the positioning gene and the positive control fluorescent signal are clear and visible, the rest lattice points have no fluorescent signal, and the result shows negative.

3.2 sensitivity test

Ten times of gradient dilution is respectively carried out on the nine constructed positive plasmids to be used as templates, and the fluorescence labeling single strand of each plasmid with the dilution range of 100-10-9 is hybridized with the spotted oligonucleotide chip. The hybridization result is obtained by diluting 105-fold 108-fold plasmids with obvious differences, as shown in FIG. 12, which shows that the chip can still effectively detect the plasmids after being diluted to 105, and each lattice point is clearly visible, and the lowest detection concentration of the chip is 2 pg. mu.L^-1。

3.3 shelf life test

In this study, 8 oligonucleotide gene chips prepared in the same batch were stored in a sealed state at 4 ℃. Two chips are randomly selected at 30d, 60d, 90d and 120d respectively to be hybridized with the fluorescence labeling single-chain product of the positive plasmid. The results are shown in FIGS. 13-14.

As can be seen, the array points of the oligonucleotide gene chip are still clearly visible and the SNR value of each array point is more than 2.0 after the detection is carried out for 120 days, and the retention period curve graph shows that the change curve of the SNR value of the detection chip is not obvious in 120 days, which indicates that the oligonucleotide gene chip established in the research can be stored for a long time at 4 ℃.

3.4 clinical sample testing

Collecting the contents of lesion small intestine and small intestine of 209 clinical samples in Sichuan area, extracting total RNA, then reverse transcribing the total RNA into cDNA by using a reverse transcription kit, carrying out fluorescence amplification labeling by PCR to obtain fluorescence labeling single chain for hybridization, comparing the hybridization result with the conventional RT-PCR, wherein the results of the two are consistent (PEDV positive rate is 68.42%, TGEV positive rate is 4.30%, GAR positive rate is 0.95%, PDCoV positive rate is 2.87%), and the detection results are shown in the following table:

TABLE 3 clinical specimen test results

In conclusion, the oligonucleotide chip and the kit can effectively detect the Porcine Epidemic Diarrhea Virus (PEDV), the porcine transmissible gastroenteritis virus (TGEV), the porcine Group A Rotavirus (GAR) and the porcine delta coronavirus (PDCoV), have strong specificity, high sensitivity and good stability, can be used for clinical large-scale detection, and have good application prospect.

Sequence listing

<110> Sichuan university of agriculture

<120> oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof

<130> GY151-18P1159

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> PEDV Virus (PS)

<400> 1

cgctgttcta atggtcgctc tgtggc 26

<210> 2

<211> 29

<212> DNA

<213> PEDV Virus (PM)

<400> 2

atctggcact ggttgggctt tctatgtcc 29

<210> 3

<211> 32

<212> DNA

<213> TGEV virus (transmissible gastroenteritides virus, TS)

<400> 3

caaggttaat gaatgcgtta ggtctcagtc tc 32

<210> 4

<211> 30

<212> DNA

<213> TGEV virus (transmissible gastroenteritides virus, TN)

<400> 4

acgcttggta gtcgtggtgc taataatgaa 30

<210> 5

<211> 33

<212> DNA

<213> GAR Virus (Group A rotaviruses, VP7)

<400> 5

aagagaaaat gtcgctgtaa ttcaggtagg agg 33

<210> 6

<211> 34

<212> DNA

<213> GAR Virus (Group A rotavirus, NSP4)

<400> 6

agaccagttg atgctataga tatgtcgaag gaat 34

<210> 7

<211> 23

<212> DNA

<213> PDCoV Virus (Porcine deltacoronavirus, N)

<400> 7

ctcagtttcg tggcaatgga gtt 23

<210> 8

<211> 28

<212> DNA

<213> PDCoV Virus (Porcine deltacoronavirus, M)

<400> 8

ggtgaccatt tggaccgcag ttgacaga 28

<210> 9

<211> 18

<212> DNA

<213> mapping Probe (Artificial sequence,)

<400> 9

gatgccgcaa cactgagt 18

<210> 10

<211> 31

<212> DNA

<213> Positive Probe (Artificial sequence,)

<400> 10

ggtggcaaca gtacagaaag acggacgaag g 31

<210> 11

<211> 20

<212> DNA

<213> PEDV Virus (PCR antigenic diarrhea virus, PS upstream primer)

<400> 11

cgctaggctt gagtctgttg 20

<210> 12

<211> 20

<212> DNA

<213> PEDV Virus (PCR antigenic Diarrhea virus, PS downstream primer)

<400> 12

aattgctggt tccgctgtag 20

<210> 13

<211> 18

<212> DNA

<213> PEDV Virus (particulate infectious diarrhea virus, PM upstream primer)

<400> 13

cttatggctt gcatcact 18

<210> 14

<211> 18

<212> DNA

<213> PEDV Virus (particulate infectious diarrhea virus, PM downstream primer)

<400> 14

gcactttctc gctatctg 18

<210> 15

<211> 25

<212> DNA

<213> TGEV virus (transmissible viral infection, TS upstream primer)

<400> 15

aggcttgacg aattgagtgc tgatg 25

<210> 16

<211> 25

<212> DNA

<213> TGEV virus (transmissible viral infection, TS downstream primer)

<400> 16

agtttcataa gccgttggta atagc 25

<210> 17

<211> 25

<212> DNA

<213> TGEV virus (transmissible viral infection, TN upstream primer)

<400> 17

ttcctgaaag gtggttcttc tacta 25

<210> 18

<211> 24

<212> DNA

<213> TGEV virus (transmissible viral infection, TN downstream primer)

<400> 18

ttttctgtgt caacacctaa cttt 24

<210> 19

<211> 23

<212> DNA

<213> GAR Virus (Group A rotavirus, VP7 upstream primer)

<400> 19

ttgaatgaat ggctatgtaa tcc 23

<210> 20

<211> 22

<212> DNA

<213> GAR Virus (Group A rotavirus, VP7 downstream primer)

<400> 20

acgcatcatt ctttcagttt gt 22

<210> 21

<211> 22

<212> DNA

<213> GAR Virus (Group A rotavirus, NSP4 upstream primer)

<400> 21

gaacaggtta ctactaagga tg 22

<210> 22

<211> 22

<212> DNA

<213> GAR Virus (Group A rotavirus, NSP4 downstream primer)

<400> 22

tcacatagac gcagttactt cc 22

<210> 23

<211> 25

<212> DNA

<213> PDCoV Virus (Porcine deltacoronavirus, N upstream primer)

<400> 23

tccatcctat gccttttatt atact 25

<210> 24

<211> 25

<212> DNA

<213> PDCoV Virus (Porcine deltacoronavirus, N downstream primer)

<400> 24

gcagagttac ctttttaggt ttctt 25

<210> 25

<211> 25

<212> DNA

<213> PDCoV Virus (Porcine deltacoronavirus, M upstream primer)

<400> 25

gcgtaatcgt gtgatctatg ttatt 25

<210> 26

<211> 25

<212> DNA

<213> PDCoV Virus (Porcine deltacoronavirus, M downstream primer)

<400> 26

tggtatatca gaacagcaaa ttctg 25

<210> 27

<211> 21

<212> DNA

<213> Positive control (Artificial sequence, upstream primer)

<400> 27

aaagcgacgc aatgaggcac t 21

<210> 28

<211> 19

<212> DNA

<213> Positive control (Artificial sequence, downstream primer)

<400> 28

gttccacgac cgcaactgc 19

Claims

1. A kit for synchronously detecting 4 porcine diarrheal viruses is characterized in that: it comprises an oligonucleotide chip and a primer pair;

the oligonucleotide chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, and is characterized in that: the oligonucleotide probe comprises: SEQ ID NO: 1-2, and the probe shown in SEQ ID NO: 3-4, and the probe shown in SEQ ID NO: 5-6, SEQ ID NO: 7-8, which are respectively used for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine group A rotavirus and porcine delta coronavirus;

still include the matter accuse probe: SEQ ID NO: 9, SEQ ID NO: 10, a positive control probe; the solid phase carrier is an aldehyde group glass slide which is subjected to aldehyde group silicification treatment;

the primer pair comprises 8 primer pairs which are respectively shown as SEQ ID NO: 11-12, SEQ ID NO: 13-14, SEQ ID NO: 15-16, SEQ ID NO: 17-18, SEQ ID NO: 19-20, SEQ ID NO: 21-22, SEQ ID NO: 23-24, SEQ ID NO: 25-26.

2. The kit of claim 1, wherein: it also comprises a primer pair for amplifying positive genes, and the sequence is shown as SEQ ID NO: 27-28.

3. Use of the kit of claim 1 or 2 for the preparation of a reagent for the detection of 4 porcine diarrheal viruses.