CN108531648A

CN108531648A - It is a kind of it is synchronous detection the diarrhoeal virus of 4 boars oligonucleotide chip and its application

Info

Publication number: CN108531648A
Application number: CN201810321919.9A
Authority: CN
Inventors: 黄小波; 文心田; 曹三杰; 滑翔; 文翼平; 赵勤; 伍锐
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2018-04-11
Filing date: 2018-04-11
Publication date: 2018-09-14
Anticipated expiration: 2038-04-11
Also published as: CN108531648B

Abstract

The present invention provides a kind of oligonucleotide chips of the synchronous detection diarrhoeal virus of 4 boars, including solid phase carrier and the oligonucleotide probe being fixed on the solid phase carrier, the oligonucleotide probe include：SEQ ID NO：Probe shown in 12, SEQ ID NO：Probe shown in 34, SEQ ID NO：Probe shown in 56, SEQ ID NO：Probe shown in 78 is respectively used to detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, pig A rotavirus and pig δ coronavirus.The present invention also provides a kind of kits and detection method of the synchronous detection diarrhoeal virus of 4 boars.Chip of the present invention and method can be applied to a large amount of detections of clinical plague, have a extensive future, it can be achieved that the high throughput of four boar diarrhea virus PEDV, TGEV, GAR and PDCoV is examined altogether.

Description

It is a kind of it is synchronous detection the diarrhoeal virus of 4 boars oligonucleotide chip and its application

Technical field

The invention belongs to molecular biology fields, and in particular to a kind of few nucleosides of the synchronous detection diarrhoeal virus of 4 boars Sour chip and its application.

Background technology

In recent years, the generation of pig transmissible diarrhea disease and popular getting worse, cause to numerous raisers and are difficult to estimate The economic loss of amount.Former in the virus of China's pig transmissible diarrhea disease at present is mainly Porcine epidemic diarrhea virus (Porcine Epidemic diarrhea virus, PEDV), transmissible gastro-enteritis virus (Transmissible Gastroenteritis virus, TGEV), pig A rotavirus (Group A rotavirus, GAR).This three viroids institute External appearance characteristic is substantially similar after caused epidemic disease occurs, and shows as vomiting, water sample injection diarrhea and dehydration etc., especially lactation Piglet morbidity is serious and the death rate is high.Pig δ coronavirus (Porcine Deltacoronavirus, PDCoV) was in head in 2012 Secondary be reported out in Hong Kong has pig farm to find the virus, is then reported out in Ohio, USA and Illinois in 2014 There is pig farm to find this kind of virus, hereafter at least there is this kind of viral report in 19 states.Whole section of small intestine of PDCoV main infections, Especially jejunum and ileum cause diarrhea and vomiting of the serious enteritis disease with piggy.Since diarrhea virus usually occurs The case where mixed infection, and Clinical differential diagnosis is more difficult, the synchronization antidiastole for carrying out four boar diarrhea virus has prevention and control It is significant.

Currently, the diagnostic method for viral disease mainly has Virus Isolation, serological method (immuno-electron microscope Method, immunohistochemistry, immunofluorescence, enzyme-linked immunosorbent assay (ELISA)) and molecular Biological Detection technology (original position Hybridize (ISH), PCR (RT-PCR)) etc., although these methods have obtained certain application, but mixed in diagnosis There are still deficiencies in infection.Such as virus purification is not easy success, Serologic detection sensitivity is low, is susceptible in detection process Cross reaction, the limited sample size of molecular Biological Detection lead to not the quick detection for realizing sample high throughput.These inspections The common defects of survey technology are can not to synchronize, therefore be badly in need of a kind of high-throughput diagnostic technology to carry out four kinds of piglets of antidiastole viral Diarrhoeal diseases.

Biochip technology is the novel high-throughput detection technique developed rapidly in recent years, according to probe Difference can be divided into cDNA chip and oligonucleotide chip.Genetic chip is by substrate, passing through designed probe points system Fluorescein or enzyme etc. mark substance markers to hybridize in the single-stranded upper chip progress nucleic acid completed with preparation of amplified production, then pass through Laser scanner scans the methods of visually observe and to obtain results of hybridization and analyze it.This method, which has, to be automated, is parallel Property and the potential advantages such as high throughput, a variety of diseases can be detected simultaneously, therefore it is widely used in field of biology, dynamic It has a extensive future in terms of the research of object epidemic disease.

The report that diarrhea of pigs virus is detected currently with biochip technology is shown in gliding etc., detects Porcine Epidemic Diarrhea The structure of the cDNA chip of poison, transmissible gastro-enteritis virus and porcine rotavirus, journal of animal science and veterinary medicine, 2015,12:235- 224, for this method only for three boar diarrhea virus, the chip used is cDNA chip, and lowest detection mass concentration is only 20pg·μL^-1, sensitivity is relatively low.

Horse is sharp etc., the research of pig virus diarrhoea disease gold label silver stain visual chip technology experiment condition optimizing and application, agriculture Industry biotechnology journal, 2016,24:1233-1242, discloses a kind of oligonucleotide chip, and this method is equally only capable of detection three The specific diarrhea of pigs virus of kind；And in operation sequence, step is more and complicated, and condition is difficult to control and standardization；In addition right The demand of reagent material is more, and testing cost is high；And in order to make result naked eyes as it can be seen that this method must use spray sample, disposably The sample number of detection is few.

Oligonucleotide chip is fixed on by designing specific oligonucleotides segment on aldehyde radical, and PCR expands after fluorescent marker is used in combination Increase obtained genetic fragment, is mutually paired by base and is detected with fluorescent marker.Because probe is consolidated in the form of single-stranded It is scheduled on substrate, therefore double-strand competitive inhibitory effect, hybridization efficiency and spirit is effectively reduced compared to cDNA chip this method Sensitivity is superior to cDNA chip to a certain extent.But the report that oligonucleotide chip is prepared to diarrhea of pigs disease is had no at present, more not See while detecting the high sensitivity oligonucleotide chip of 4 boar diarrhea virus.

Invention content

The purpose of the present invention is to provide a kind of oligonucleotide chip of synchronous detection diarrhoeal virus of 4 boars and its answer With.

The present invention provides it is a kind of it is synchronous detection the diarrhoeal virus of 4 boars oligonucleotide chip, including solid phase carrier with The oligonucleotide probe being fixed on the solid phase carrier, the oligonucleotide probe include：SEQ ID NO：Probe shown in 1-2, SEQ ID NO：Probe shown in 3-4, SEQ ID NO：Probe shown in 5-6, SEQ ID NO：Probe shown in 7-8 is respectively used to examine Survey Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, pig A rotavirus and pig δ coronavirus.

Wherein, further include Quality Control probe：SEQ ID NO：Positioning probe shown in 9, SEQ ID NO：It is positive shown in 10 Control probe.

Wherein, the solid phase carrier is the aldehyde radical slide that aldehyde radical silicidation is crossed.Such as the rich limited public affairs of biology difficult to understand in Beijing Department's productionAldehyde radical substrate.

The present invention also provides amplification the diarrhoeal viral gene of 4 boars primer pair, include 8 primer pairs, respectively such as SEQ ID NO：Shown in 11-12, SEQ ID NO：Shown in 13-14, SEQ ID NO：Shown in 15-16, SEQ ID NO：Shown in 17-18, SEQ ID NO：Shown in 19-20, SEQ ID NO：Shown in 21-22, SEQ ID NO：Shown in 23-24, SEQ ID NO：25-26 institutes Show.

The present invention also provides a kind of kits of the synchronous detection diarrhoeal virus of 4 boars, it includes claims 1 or 2 Primer pair shown in the oligonucleotide chip and claim 3.

Wherein, it further includes the primer pair for expanding positive gene, sequence such as SEQ ID NO：Shown in 27-28.

The present invention also provides above-mentioned oligonucleotide chip, primer pair or kits to prepare 4 boar diarrhea venereal diseases of detection Purposes in the reagent of poison.

The present invention also provides a kind of methods of the synchronous detection diarrhoeal virus of 4 boars, it includes the following steps：

(1) prepared by viral sample：It is cDNA to take tissue to be checked, extraction RNA and reverse transcription；

(2) prepared by target sequence：Go out target sequence with above-mentioned primer pair amplifies and carries out fluorescent marker；

(3) hybridize：The target sequence for taking step (2) to prepare, is hybridized with above-mentioned oligonucleotide chip；

(4) result detects：Chip after taking step (3) to hybridize is scanned analysis, you can.

Wherein, in step (3), the time of the hybridization is 2-3h, and temperature is 46 DEG C

Wherein, in step (4), the instrument of the scanning is rich Austria Luxscan-10K/A chip scanners.

This research is for S the and M genes of Porcine epidemic diarrhea virus, S the and N genes of transmissible gastroenteritis of swine, pig colyliform The sense strand sequence of the VP7 and NSP4 genes of virus type A and N the and M genes of pig δ coronavirus separately designs respectively specific Oligonucleotide probe, and built with this and can be used for the oligonucleotide chip that PEDV, TGEV, GAR and PDCoV are detected simultaneously, structure The oligonucleotide chip specificity built is good, no cross reaction between internal each target gene, also anti-without intersecting with other encountered pathogenics It answers；Sensitivity is 2pg μ L-1；120d can be at least preserved after the completion of chip point system at 4 DEG C, stability is high, and accuracy is good, can be real The high throughput of existing four boar diarrhea virus PEDV, TGEV, GAR and PDCoV is examined altogether, can be applied to a large amount of detections of clinical plague, It has a extensive future.

Obviously, the above according to the present invention is not being departed from according to the ordinary technical knowledge and customary means of this field Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification, replacement or change of other diversified forms can also be made.

The specific implementation mode of form by the following examples remakes further specifically the above of the present invention It is bright.But the range that this should not be interpreted as to the above-mentioned theme of the present invention is only limitted to example below.It is all to be based on the above of the present invention The technology realized all belongs to the scope of the present invention.

Description of the drawings

Fig. 1 genetic chip matrix spot sample mode figures

Fig. 2 PCR amplification results

(M:2000bp marker, 1:PS, 2:PM, 3：TS, 4:TN, 5:VP7,6:NSP4,7：DN, 8:DM, 9：λ) Fig. 3 is complete Probe scanning

Fig. 4 spotting buffer optimum results

Fig. 5 hydration time optimum results, A:It is hydrated 6h；B:It is hydrated 8h；C:It is hydrated 10h；D:It is hydrated 12h.

Fig. 6 hydration time optimum results curve graphs

Fig. 7 hybridization temperatures optimize, A:38℃；B:42℃；C:46℃；D:50℃.

Fig. 8 hybridization temperature optimum results curve graphs

Fig. 9 hybridization times optimize, A:Hybridize 60min；B:Hybridize 90min；C:Hybridize 120min；D:Hybridize 150min.

Figure 10 hybridization time optimum results curve graphs

Figure 11 chip specificity experiments results of hybridization

A:PEDV specificity experiments results；B:TGEV specificity experiments results；C:GAR specificity experiments results；D:PDCoV Specificity experiments result；E:PRRSV+CSFV+JEV+PCV2 mixed infection specificity experiments results.

Figure 12 chip sensitivity experiment results (A：10⁵It dilutes again；B：10⁶It dilutes again；C：10⁷It dilutes again；D：10⁸It is dilute again It releases)

Figure 13 chip storage life evaluation results (A：30d；B：60d；C：90d；D：120d)

Figure 14 storage life curve graphs

Specific implementation mode

It is described further below with embodiment, but the present invention is not limited to these embodiments.

1 PEDV-TGEV-GAR-PDCoV oligonucleotides of the present invention of embodiment examines the structure of chip altogether

1, biomaterial

1.1 plasmid

Recombinant plasmid pMD-PS, pMD-PM, pMD-TS, pMD-TN, pMD-VP7, pMD-NSP4, pMD-N, pMD-M (are prepared Method is shown in " structures of 2 target gene recombinant plasmids "), pMD- λ (purchased from precious biological (Dalian) bio tech ltd), plasmid It is built and is preserved by this laboratory.

1.2 main agents：

Total RNA extraction reagent box, blood/tissue/cellular genome extracts kit：Tiangeng biochemical technology company；

Mini-scale plasmid extracts kit：Omega bio-tek companies；

PrimeScript^TMRT Reagent Kit, positive quality control (λ DNA)：Precious bioengineering (Dalian) Co., Ltd；

Aldehyde radical substrate, gene chip hybridization buffer solution, optical grade aldehyde radical substrate：Hundred proud bioengineering of Shanghai is limited Company；

Optical grade aldehyde radical substrate,Microarray hybridization box,Multi-example chip fence,It is more Sample chip cover plate,Gene chip sampling liquid：Beijing Bo Ao Bioisystech Co., Ltd.

Other configurations for providing reagent for oneself：

2×SSC：NaCl 17.53g, sodium citrate 8.82g, ddH2O 80ml are settled to NaOH tune pH to 7.0 100.0ml is saved backup after being 0.2nm membrane filtrations with bore dia

10%SDS:SDS 100g are weighed, are dissolved in 900mL ultra-pure waters.

PBS buffer solution：NaCl 30g, KCl 1g, Na2HPO4 7.1g, KH2PO4 1.35g, are settled to 1L；

50×TAE：Tris 121.0g, glacial acetic acid 28.55ml, 0.5molL-1EDTA 50.0ml, using NaOH by pH 8.0 are adjusted to, ddH2O is added to be settled to 500mL.

1.3 key instrument equipment：

POWER Pac^TMElectrophoresis apparatus, MyCycler^TMPCR instrument, Labworks image acquisition and analysis software, SmartSpec^TMPlus nucleic acid Albumen instrument：BIO-RAD companies of the U.S.；Air constant-temperature table, Allegra^TM64R high speed freezing centrifuges, Hybridization Oven：The U.S. Thermo Forma companies；Personal Arrayer^TM16 micro-array chip spotting systems, rich Austria Luxscan-10K/A chips Scanner：Beijing Bo Ao Bioisystech Co., Ltd.

1.4 primers and probe

1 primer information of table

Note：F=sense primers；R=downstream primers.

2 detecting probe information of table

The structure of 2 target gene recombinant plasmids

2.1 design of primers：Multiple alignment analysis is carried out to the gene order included in Genbank respectively with DNAMAN softwares Respective conservative region is selected, specific primer is designed for conservative region with software Primer Premier 5.0, is shown in Table 1.

The extracting of 2.2 target genes：The total serum IgE of target gene is extracted using Tiangeng total RNA extraction reagent box.

2.3RT-PCR amplification

Using the RNA of extracting as template, cDNA is synthesized by primer of Random 6primers, reaction system is as follows：

Total volume (10.0 μ l)：RT Enzyme Mix 0.5μl、Random 6primers 0.5μl、5× 2.0 μ l of PrimeScript RT Buffer, 2.0 RNA μ l, 5.0 μ of RNase-Free ultra-pure waters.

RNA reverse transcriptions are carried out by following program：37 DEG C, 15min；85 DEG C, 5s；Obtained cDNA is preserved at 4 DEG C.

The cDNA obtained using reverse transcription carries out the NP genetic fragments of PCR amplification AIV, reaction system and reaction item as template Part is as follows：

Total volume (15.0 μ l)：2 × Taq PCR Master Mix, 7.5 μ l, 2.0 cDNA μ l, upstream and downstream specificity are drawn Each 0.5 μ l of object (10.0 μm of ol/L), 4.5 μ l of ultra-pure water.

Reaction condition is as follows：95.0 DEG C of denaturation 5min；95.0 DEG C of denaturation 30s, 56.5 DEG C of annealing 30s, 72.0 DEG C extend 30s, 30 cycles；72.0 DEG C of extension 10min, 4 DEG C of preservations.6 μ l amplified productions are taken to be reflected with 2% agarose gel electrophoresis It is fixed.

The glue recycling of 2.4 target genes connection pMD19-T, converts in permissive cell, the identification of target gene recombinant plasmid.

The preservation of 2.5 target gene recombinant plasmid bacterium：The correct probe gene recombination plasmid bacterium of sequencing is expanded culture 12h, then with 20% skimmed milk power and bacterium solution 1:It is drained after 1 mixing, -70 DEG C of preservations.

Probe gene order difference is as follows：

Gene source：PEDV-S, genetic fragment size and sequence：474bp

CGCTAGGCTTGAGTCTGTTGAAGTTAACTCTATGCTTACTATTTCTGAAGAGGCTCTACAGTTAGCTAC CATCAGTTCGTTTAATGGTGATGGATATAACTTTACTAATGTGCTGGGTGTTTCCGTGTACGACCCTGCAAGTGGCA GGGTGGTACAAAAAGGGTCTTTTATTGAAGACCTGCTTTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGAT GAAGACTATAAGCGCTGTTCTAATGGTCGCTCTGTGGCAGATCTAGTCTGTGCGCAGTATTACTCTGGTGTCATGGT ACTACCTGGCGTTGTTGACGCTGAGAAGCTTCAAATGTATAGTGCGTCTCTCATCGGTGGTATGGCGCTAGGAGGTC TTACTACTGCAGCGGCATTGCCTTTTAGCCATGCTGTTCAAGCGAGGCTCAATTATCTTGCTTTACAGACGGATGTT CTACAGCGGAACCAGCAATT

Gene source：PEDV-M, genetic fragment size and sequence：421bp

CTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTATTTTGTCAATAGCATTCGGTTGTGGCGCAGG ACACATTCTTGGTGGTCTTTCAATCCTGAAACTGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGGTCTGCAT TCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGTTTGTAGAGGGCTATAAGGTTG CTACTGGCGTACAGGTAAGTCAATTGCCTGATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTATGGACGT GTTGGTCGTTCAGTCAATGCTTCATCTGGCACTGGTTGGGCTTTCTATGTCCGGTCAAAACACGGCGACTACTCAGC TGTGAGTAATCCGAGTGCGGTTCTCACAGATAGCGAGAAAGTGC

Gene source：TGEV-S, genetic fragment size and sequence：274bp

AGGCTTGACGAATTGAGTGCTGATGCACAAGTTGACAGGCTGATCACAGGAAGACTTACAGCACTTAAT GCATTTGTGTCTCAGACTCTAACCAGACAAGCGGAGGTTAGGGCTAGTAGACAACTTGCCAAAGACAAGGTTAATGA ATGCGTTAGGTCTCAGTCTCAGAGATTCGGATTCTGTGGTAATGGTACACATTTGTTTTCACTCGCAAATGCAGCAC CAAATGGCATGATTTTCTTTCACACAGTGCTATTACCAACGGCTTATGAAACT

Gene source：TGEV-N, genetic fragment size and sequence：362bp

TTCCTGAAAGGTGGTTCTTCTACTACTTAGGTACTGGACCTCATGCAGATGCCAAATTTAAAGATAAAT TAGATGGAGTTGTCTGGGTTGCCAAGGATGGTGCCATGAACAAACCAACCACGCTTGGTAGTCGTGGTGCTAATAAT GAATCCAAAGCTTTGAAATTCGATGGTAAAGTGCCAGGCGAATTTCAACTTGAAGTTAATCAATCAAGAGACAATTC AAGGTCACGCTCTCAATCTAGATCTCGGTCTAGAAATAGATCTCAATCTAGAGGCAGGCAACAATTCAATAACAAGA AGGATGACAGTGTAGAACAAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAA

Gene source：GAR-VP7, genetic fragment size and sequence：381bp

TTGAATGAATGGCTATGTAATCCAaTGgATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGAT ATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGACTCTCGGGATAGGATGTTCGACTACAG ACATAAATTCATTTGAAACAGTGGCCAATGCAGAGAAATTAGCTATAACTGATGTTGTCGATGGAGTCAATCATAAA TTAGACGTAACAACGAGTACATGTACTATAAGAAATTGTAAAAAACTTGGACCAAGAGAAAATGTCGCTGTAATTCA GGTAGGAGGTCCAAACATACTCGACATAACAGCTGATCCAACAACTGCACCACAAACTGAAAGAATGATGCGT

Gene source：GAR-NSP4, genetic fragment size and sequence：270bp

GAACAGGTTACTACTAAGGATGAAATTGAACAACAGATGGACAGAATTGTTAAGGAGATGAGGCGTCAA CTGGAAATGATTGACAAATTGACAACTCGTGAAATTGAACAAGTTGAATTACTTAAGCGTATACATGACAAATTAGC TGCTAGACCAGTTGATGCTATAGATATGTCGAAGGAATTTAATCAGAAAAATATTCGAACGCTAGATGAATGGGAAA GTGGAAAAAATCCATATGAACCGTCGGAAGTAACTGCGTCTATGTGA

Gene source：PPDCoV-N, genetic fragment size and sequence：775bp

TCCATCCTATGCCTTTTATACTGGCACAGGTCCCAGAGGAAATCTTAAGTATGGTGAACTCCCTCCTAA TGATACCCCAGCAACCACTCGTGTTACTTGGGTTAAGGGTTCGGGAGCTGACACTTCTATTAAACCTCATGTTGCCA AACGCAACCCCAACAATCCTAAACATCAGCTGCTACCTCTCCGATTCCCAACCGGAGATGGCCCAGCTCAAGGTTTC AGAGTTGACCCCTTCAACGCTAGAGGAAGACCTCAGGAGCGTGGAAGTGGCCCAAGATCTCAATCTGTTAACTCCAG AGGCACAGGCAATCAGCCCAGGAAACGCGACCAATCTGCACCCGCTGCGGTACGTCGTAAGACCCAACATCAAGCTC CCAAGCGGACTTTACCCAAGGGTAAAACCATTTCTCAGGTATTTGGCAACCGGTCTCGTACTGGTGCCAATGTCGGC TCTGCAGACACTGAGAAGACGGGTATGGCTGATCCTCGCATCATGGCTCTAGCCAGACATGTGCCTGGTGTTCAGGA AATGCTTTTCGCTGGCCACCTTGAGAGCAACTTTCAGGCAGGGGCAATTACCCTTACCTTCTCTTACTCAATCACAG TCAAGGAGGGTTCTCCTGACTATGAGAGACTTAAGGATGCGCTCAATACGGTCGTTAACCAGACCTATGAGCCACCC ACCAAACCAACTAAGGACAAGAAGCCTGACAAACAAGACCAGTCTGCTAAACCCAAACAGCAGAAGAA

Gene source：PPDCoV-M, genetic fragment size and sequence：485bp

GCGTAACCGTGTGATCTATGTTATTAAACTTATTCTGCTTTGGCTGCTCCAACCCTTCACCCTAGTGGT GACCATTTGGACCGCAGTTGACAGATCATCTAAGAAGGACGCAGTTTTCATTGTGTCCATAATTTTTGCCGTACTGA CCTTCATATCCTGGGCCAAGTACTGGTATGACTCAATTCGCTTATTAATGAAAACCAGATCTGCATGGGCACTCTCA CCTGAGAGTAGACTCCTTGCAGGGATTATGGATCCAATGGGTACATGGAGGTGCATTCCCATCGACCACATGGCTCC AATTCTCACACCAGTCGTTAAGCATGGCAAGCTCAAGCTACATGGGCAAGAGCTGGCCAATGGCATATCAGTTAGAA ATCCGCCACAGGATATGGTGATAGTGTCACCAAGTGACACCTTTCACTACACTTTTAAGAAACCTGTGGAATCAAAC AGCGATCCAGAATTCGCTGTTCTGATATACCA

Gene source：λ genes, genetic fragment size and sequence：500bp

GTCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGCGACCGGGCAGGGGCAGAAATC TGCCGGAGATACCAGCTTCACGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCAGGCGCTGCTGGCGTGGTTTAATG AAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGCACCGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCA GGCGCTGCTGGCGTGGTTTAATGAAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGCACCACGGTAACAG CGGCAACCGGCATGACCGTGACGCCTGCCAGCACCTCGGTGGTGAAAGGGCAGAGCACCACGCTGACCGTGGCCTTC CAGCCGGAGGGCGTAACCGACAAGAGCTTTCGTGCGGTGTCTGCGGATAAAACAAAAGCCACCGTGTCGGTCAGTGG TATGACCATCACCGTGAACGGCGTTGCTGCAGGCAAGGTCAACATT

It is prepared by 3 oligonucleotide chips

3.1 oligonucleotide chip point sample programs

The spotting system that this research uses is crystalline substance core Personal Arrayer 16, uses contact spotting system point system The substrate of chip, chip is the rich production difficult to understand in BeijingOptical grade aldehyde radical substrate.Probe and gene location are diluted to 200 μ g·mL^-1, isometric spotting buffer is added.According to the design of chip matrix, it is added respectively to 384 hole sample loading plates in order Probe (being directed to 4 viral 8 detection probes), gene location probe and positive control probe.The humidity of point sample environment is set It sets 45% or more.

After opening 16 operating softwares of crystalline substance core Personal Arrayer, wait for that System self-test is finished into setting interface, dress Spotting needle is carried, 384 hole sample loading plates are placed.The each system position of point sample instrument is demarcated before point sample, respectively cleaning positions, Position, first wave plate position, the sample hole sites orifice plate A24 and emptying position are drained, the X of each position, Y-axis are demarcated first Calibration Z axis position later.Point sample parameter is carried out after the chip that point sample instrument spotted area is placed needed for experiment arranged below:

The number of chips needed for experiment is placed in the chip card slot of point sample instrument, starting slide is set as 1, point sample slide number It is configured according to corresponding number according to after being put into needed for actual tests.It is required according to chip lattice design, sample repeats to count It is 4, it is 50 to select repeat array, pre- points, and pre- point sample spacing is 500 μm；It is cleaned in cleaning is arranged, is ultrasonic, drained and being It is above to ensure the cleaning of spotting needle to repeat 5 wheels by 3s.

15min is stood after chip point system, the UV crosslinking 15min after thorough drying, later in Hybridization Oven 37 DEG C of hydration-treateds are stayed overnight, the chip cleaning 5min that the 0.2 × SSC solution preheated using 37 DEG C finishes hydration-treated, then with The distilled water of 37 DEG C of preheatings cleans 5min, takes confining liquid (0.5%BH4Na, 25%Ethanol, 0.75 × PBS) that core is completely covered Piece matrix is placed in 15min in 37 DEG C of Hybridization Ovens and is closed, cleaned again by pre- hot distilled water, 1300r min^-1Centrifugation is thoroughly dry, is kept in dark place under the conditions of being placed in 4 DEG C spare.

3.2 oligonucleotide chip hybridization procedures

3.2.1 the amplification label of target gene

By 9 plasmids for diluting 100 times as template, the downstream specific primer of fluorescent marker is used to carry out fluorescent marker It expands, is loaded under light protected environment, PCR system is as follows：

Total volume (30.0 μ l)：2 × Taq PCR Master Mix, 15.0 μ l, 2.0 μ l of template, 2.0 μ l of sense primer, 2.0 μ l of fluorescent marker downstream specific primer, 9.0 μ l of ultra-pure water.

Response procedures：95℃5min；95 DEG C of 30sec, 58 DEG C of 30sec, 72.0 DEG C of 45sec, 30 cycles；72 DEG C of 10min, 12 DEG C of preservations.

3.2.2 the hybridization and cleaning of oligonucleotide chip

Pcr amplification product (i.e. probe gene order) is single-stranded in 95 DEG C of denaturation 5min acquisition fluorescent markers, then it is placed in ice Upper cooling 5min prevents multiple chain, and fluorescent marker is single-stranded with hybridization buffer 1:1 mixing, each prepares the oligonucleotides finished 50 μ L mixed liquors are added in the matrix of chip to ensure that matrix can be completely covered.Chip is placed in hybridization cabin and is hybridized in molecule 42 DEG C of hybridization 2-3h are protected from light in instrument.After hybridization, 37 DEG C preheating washing lotions I (2 × SSC+0.2%SDS), washing lotion II (0.2 × SSC) and III ultra-pure water of washing lotion, chip that hybridization finishes is placed in concussion cleaning 5min in washing lotion I, be placed in washing lotion II and shake Cleaning 5min is swung, then is placed in ultra-pure water and cleans 5min, shaking needs to lift chip up and down in cleaning process ensures that chip is completely clear It washes.Dry chip after last 1300rmin-1 centrifugations 10min, is scanned chip and analyzes.This chip can be kept in dark place, It is scanned in 30d effectively.

3.3 oligonucleotide chip scanner uni result judgements

Hybridization cleaning is finished into the oligonucleotide chip after being dried and uses rich Austria Luxscan-10K/A chip scannings Instrument scanning.Luxscan-10K/A chip scanner sweep parameters are arranged：Channel：Green channel；Fluorescent dye： Cyanine3；Power：95；PMT：650；Resolution ratio：10.It waits for whole chip of prescan first after the activation of channel, waits for pre- sweep After retouching, the matrix area chosen in prescan is scanned observable chip hybridization results.

The result of scanning wins the Data Analysis Software that Austria's Luxscan-10K/A chip scanners carry at random using gene LuxScan3.0 is analyzed, and corresponds acquisition data by establishing virtual dot matrix and lattice point in matrix, analysis result is with * .LSR file format preserves.Software data output mode mainly has two kinds of lattice point signal median and lattice point signal averaging.Sample Point signal threshold value concept SNR, is the ratio of position and background signal median in lattice point signal value, as SNR >=2.0 and lattice point exists High-visible in matrix, this research judges the results of hybridization of each sampling point with this.

3.4 oligonucleotide chips detect matrix design arrangement

Since the hybridization fence that laboratory is bought can only separate 4 matrixes, to make the utilization rate of every chip reach maximum Change, this research designs 4 repetition matrixes in every oligonucleotide chip, is separated using fence is hybridized, in order to clinically can be same Shi Jinhang Parallel testings.The matrix of design includes gene location, positive control, probe gene to be checked and is divided into ultra-pure water and point The negative control of sample buffer solution.First row is gene location, and the 6th row is the ultra-pure water and spotting buffer as negative control, Last row's point is positive control, remaining the respectively corresponding probe of row's point and blank control.Every group of lattice point is repeated 4 times in dot matrix, often A matrix includes 8 × 7=56 points.Genetic chip matrix spot sample mode is shown in Fig. 1.

The extraction of 3.5 positive plasmids

Picking freezes the recombinant plasmid bacterium containing target gene in LB liquid medium (Amp for containing 100 μ gmL-1) a little Recovery culture, is placed in 37 DEG C of shaking table shaken cultivation 12h；It crosses and connects on LB solid mediums (Amp for containing 100 μ gmL-1) Kind, 37 DEG C are inverted constant temperature incubation 12h；LB liquid trainings of the 5mL containing Amp is added in picking form and sizeable target single bacterium colony Base is supported, 37 DEG C of constant-temperature table 220rmin-1 shaken cultivations is placed in and stays overnight.It is extracted respectively from the target gene recombinant plasmid of recovery The recombinant plasmid of PEDV-S, PEDV-M, TGEV-S, TGEV-N, GAR-VP7, GAR-NSP4, PDCoV-N, PDCoV-M, λ, operation Step is referring to plasmid extraction kit specification.The 80 μ L ElutionBuffer elutions of extracted Plasmid DNA, take 7 μ L products It is identified using 1% agarose gel electrophoresis, deposition condition：80V, 20min.

3.6 oligonucleotide chip probes and spotting buffer ratio optimization

It is former concentration and probe concentration, 1 to be separately added into gene location probe and spotting buffer ratio to 384 hole load sample plate holes：1、 1：2、1：3、1：The mixed liquor of 4 concentration, each concentration repeats point sample number and is set as 8, to determine probe and spotting buffer most Good ratio carries out point sample, hydration, cleaning by method in 2.1, and gene location probe is by putting system after cy3 fluorescence directly label In chip, there is no need to hybridize, 1300rmin-1 centrifuges dry chip after 10min after cleaning, is swept to chip It retouches, observes simultaneously analysis result.

3.7 oligonucleotide chip hydration times optimize

After the completion of method point sample in this chapter 2.1, the hybridization cabin for placing oligonucleotide chip is placed in dark wet box, respectively Hydration-treated is carried out in 6h, 8h, 10h and 12h in 37 DEG C of Hybridization Ovens, to determine water most suitable in the preparation process of chip Close the time.Closing and carrying out washing treatment are carried out to the chip after hydration, are cleaned and dried and carried out the scanning of chip after hybridization, is seen It examines and analyzes scanning result.

3.8 oligonucleotide chip hybridization temperatures optimize

After being handled the PCR product of 9 kinds of constructed positive plasmid templates according to method in this chapter 2.2.2, amplification is produced Object is with hybridization buffer with 1:Hybridized on the chip that system is completed after 1 mixing.50 μ L mixing are added in each chip matrix Liquid is hybridized in 38 DEG C, 42 DEG C, 46 DEG C at 50 DEG C respectively, and the most suitable hybridization temperature of oligonucleotide chip is determined with this.It is miscellaneous 5min is respectively cleaned using washing lotion I, washing lotion II and ultra-pure water respectively after friendship, 1300rmin-1 centrifugal chips 10min, is waited for thorough later It is scanned after the drying simultaneously of bottom, observes and analyze scanning result.

3.9 oligonucleotide chip hybridization time optimizes

The chip completed with system after being handled PCR product according to method in this chapter 2.2.2 hybridizes, Mei Gexin Piece matrix is added 50 μ L mixed liquors and carries out the hybridizing to determine the optimal time of chip hybridization of 1h, 1.5h, 2h and 2.5h respectively.It is miscellaneous 5min is respectively cleaned using washing lotion I, washing lotion II and ultra-pure water respectively after friendship, to dry after chip 1300rmin-1 centrifugations 10min And it is scanned, observes and analyzes scanning result.

4 results

4.1 positive plasmids extract result

4.1.1 positive plasmid concentration mensuration

The OD260/OD280 that each plasmid is measured using nucleic acid-protein instrument, is converted into concentration, and concentration is respectively PEDV-S (278ng·μL-1)、PEDV-M(283ng·μL-1)、TGEV-S(232ng·μL-1)、TGEV-N(285ng·μL-1)、 GAR-VP7(302ng·μL-1)、GAR-NSP4(289ng·μL-1)、PDCoV-N(215ng·μL-1)、PDCoV-M (221ng μ L-1) and λ (195ng μ L-1).

4.1.2 positive plasmid amplified production is identified

Regular-PCR amplification is carried out according to the positive plasmid of nine genes of PCR system used in 2.2.1 and program pair, Identify its amplified production.The results are shown in Figure 2, and amplified production is consistent with expected size.

The detection of 4.2 oligonucleotide chip full genomes

Cleaning is carried out after oligonucleotide chip hybridizes with centrifugal drying and chip is scanned and is analyzed, as a result See Fig. 3.It can be seen that each lattice point of 4 kinds of viral 8 gene probes have fluorescence signal show and gene location probe with it is positive Control fluorescence signal is apparent, and ultra-pure water and spotting buffer lattice point as negative control do not have fluorescence signal to show, show to make Standby oligonucleotides is examined chip gene probe and is chosen successfully altogether, and chip quality is reliable.

The optimum results of 4.3 spotting buffers

Spotting buffer optimum results by the gene location probe points of different proportion as shown in figure 4, by being formed on few nucleosides Occurs fluorescence signal after scanning on sour chip.When gene location probe and spotting buffer concentration ratio are 1：When 2, dot matrix On fluorescence signal without former concentration and probe concentration and ratio be 1：Hickie in 1 mixed liquor, the fluorescence signal of genetic chip is more Well, therefore to also determine other dot matrix probes and spotting buffer concentration ratio be 1：2.

4.4 oligonucleotide chip hydration time optimum results

Oligonucleotide chip is hydrated 6h, 8h, 10h and 12h under the conditions of 37 DEG C, to the chip after hydration carry out closing with After carrying out washing treatment with fluorescent marker is single-stranded hybridized after cleaned and dried, scan chip after carry out data scanning analysis. The image that hybridizes after 6h hydrations leads to lattice point shape because hydration time is shorter so that probe can not be combined closely with substrate Shape is irregular, and background value is relatively deep and is full of watermark；The high-visible results of hybridization of lattice point can be obtained after hydration 8h and 10h；Work as water It closes after the time is more than 10h, background colour obviously deepens, and lattice point fluorescence signal obscures.Scanning result is shown (Fig. 5)：When with hydration Between growth, hybridization signal is gradually increased；Between when hydrated more than 10h after, background value obviously increases.It is 10h between when hydrated When, the median difference of hybridization signal and background value is maximum, and chip SNR value is maximum (Fig. 6), and hybridization signal is most apparent, therefore really Determining chip, that crossbreeding effect is carried out after hydration-treated 10h is preferable.

4.5 oligonucleotide chip hybridization temperature optimum results

The oligonucleotide chip of same batch point is done after same treatment respectively in 38 DEG C, 42 DEG C, 46 DEG C and 50 DEG C temperature Hybridized with chip under the conditions of degree, carries out cleaning and dry centrifugation after hybridizing 2h, (figure of obtaining a result after data scanning analysis 7)：The dot matrix complete display at 38 DEG C -46 DEG C, when temperature is higher than 50 DEG C, though dot matrix is high-visible, due to miscellaneous in matrix Matter increases the judgement for influencing result.Data scanning interpretation of result is shown：With the raising of hybridization temperature, hybridization signal gradually carries It is high；When hybridization temperature is more than 50 DEG C, hybridization signal starts to reduce.When hybridization temperature is 46 DEG C, hybridization signal and background value Median difference it is maximum, chip SNR value is maximum (Fig. 8), and hybridization signal is most apparent.

4.6 oligonucleotide chip hybridization time optimum results

The oligonucleotide chip of same batch point is done after same treatment hybridize respectively at 46 DEG C 60min, 90min, It carries out cleaning after 120min and 150min to centrifuge with dry, data scanning analysis result shows (Fig. 9)：The extension of hybridization time can It is effectively increased the hybridization efficiency of genetic chip, but background value also has increase simultaneously.Before can be seen that through data scanning interpretation of result 90min hybridization signal value intensity and background value are enhanced, and 90min-120min rear backdrop values enhance unobvious, hybridization signal The still lasting enhancing of value, 120min rear backdrop values increase rapidly, and as chip hybridization 120min, hybridization signal and background value difference are most Greatly, chip SNR value is maximum (Figure 10), and hybridization signal is most apparent, it is thus determined that hybridization 120min is optimal hybridization time.

Therefore, the present invention successfully prepares PEDV-TGEV-GAR-PDCoV oligonucleotides and examines chip altogether, the most suitable water of the chip The conjunction time is 10h；Most suitable hybridization temperature is 46 DEG C；Most suitable hybridization time is 120min.

Beneficial effects of the present invention are illustrated below by way of test example：

1 PEDV-TGEV-GAR-PDCoV oligonucleotides of the present invention of test example examines the evaluation and clinical application of chip altogether

1 clinical sample

The lesion small intestine and small intestine contents for acquiring 209 parts of clinical diarrhea of pigs samples of Sichuan province, are carried out by chip It detects and testing result is compared with conventional RT-PCR result.

2 methods

2.1 genetic chip：The oligonucleotide chip prepared according to 1 method of embodiment.

The extraction of 2.2 sample of nucleic acid

2.2.1 the extraction of RNA virus sample of nucleic acid

Total RNAs extraction is carried out to clinical sample using Tiangeng total RNA extraction reagent box (column) kit.Acquisition virus first (PEDV, TGEV, GAR and PDCoV take the small intestine and small intestine content of inspection pathological material of disease to the more respective target organ-tissue sample of content Object clip；CSFV, PRRSV and JEV take liver,kidney,spleen, lymph node pathological change tissue), 1mL lysate milled processeds are added, are grinding Liquid nitrogen is added during mill, tissue samples thawing is ground to, later according to Tiangeng total RNA extraction reagent box (column) kit Specification carries out the extraction of RNA.

Product RNA extracts kits extracted using the reverse transcription reagent box of TAKARA companies through reverse transcription at cDNA, The cDNA of reverse transcription is to hybridize after template amplification marks by the measurement that concentration and purity are carried out with nucleic acid-protein instrument.Reversion Record operation is carried out according to TAKARA reverse transcription reagent box specifications, and PCR system is as follows：

Total volume (10.0 μ l)：5×PrimeScript RT Buffer 2.0μl、RT Enzyme Mix0.5μl、 Random 6 mers 0.5μl、Total RNA 2.0μl、RNase-Free ddH₂O 5.0μl。

Response procedures：37 DEG C, 15min；85 DEG C, 5sec；4 DEG C of preservations.

2.2.2DNA the extraction of viral nucleic acid sample

PCV nucleic acid is extracted using TIANGEN Genome DNA extractions kit (column), take PCV positive pathological material of diseases spleen, liver, Kidney and lymph node pathological change tissue are shredded to be put into the boiling water of EP pipes inherence and boil 10min, and 20 μ L albumen are added after temperature reduction After enzyme K, 55 DEG C of heating water bath 1h, carry out DNA's according to TIANGEN Genome DNA extractions kit (column) kit specification step Extraction, to the 4 DEG C of preservations of extracted DNA product.

2.3 specific test

PEDV, TGEV, GAR, PDCoV, PRRSV, CSFV, JEV and PCV plasmid are prepared respectively according to method in embodiment 1 Fluorescent marker it is single-stranded, select later PEDV, TGEV, GAR and PDCoV plasmid fluorescent marker is single-stranded and PRRSV, CSFV, JEV Hybridized with the oligonucleotide chip that point system is completed with the single-stranded mixture of fluorescent marker of PCV plasmids.From miscellaneous after hybridization It hands in cartridge bay and takes out chip, be placed in concussion cleaning 5min in washing lotion I, then be placed in concussion cleaning 5min in washing lotion II, then be placed in super 5min is cleaned in pure water, finally uses 1300rmin^-1Dry chip, is scanned chip and analyzes after centrifugation 10min.

2.4 sensitivitys are tested

The OD260/OD280 of each plasmid is measured using nucleic acid-protein instrument, concentration is respectively PEDV-S (278ng μ L- 1)、PEDV-M(283ng·μL-1)、TGEV-S(232ng·μL-1)、TGEV-N(285ng·μL-1)、GAR-VP7 (302ng·μL-1)、GAR-NSP4(289ng·μL-1)、PDCoV-DN(215ng·μL-1)、PDCoV-DM(221ng·μL- And λ (195ng μ L-1) 1).10 times of gradient dilutions are carried out to total positives plasmid respectively, by various concentration cDNA after dilution As template amplification product, it is single-stranded and carry out the hybridization of chip to prepare fluorescent marker according in embodiment 1 2.2 method, hybridizes After carry out the cleaning of chip, 1300rmin-1 centrifuges dry chip after 10min, is scanned and analyzes to chip.

2.5 storage lives are tested

This research will be placed at 4 DEG C according to same series-produced 8 chips of 1 method of embodiment and be sealed preservation.Point Do not extract two chips out from each group in 30d, 60d, 90d, 120d, it is single-stranded miscellaneous with chip progress using positive plasmid fluorescent marker It hands over, chip is scanned and is analyzed after being cleaned and dried chip.

2.6 clinical samples detect

2.7.1RT-PCR clinical sample is detected

Nucleic acid extraction is carried out to clinical 209 parts of samples according to 2.2.1 methods and is transcribed into cDNA, uses fluorescent marker downstream Primer carries out fluorescent marker amplification, is loaded under light protected environment, PCR system is as follows：

Total volume (15.0 μ l)：2 × Taq PCR Master Mix, 7.5 μ l, 1.0 μ l of upstream specific primer, fluorescence mark Remember 1.0 μ l of downstream specific primer, 1.0 μ l of DNA profiling, 4.5 μ l of ultra-pure water.

7 μ L products are taken to be identified using 1% agarose gel electrophoresis, deposition condition：80V, 20min.

2.7.2 oligonucleotide gene chip detects clinical sample

The lesion small intestine and small intestine contents for acquiring 209 parts of Sichuan province clinical sample, use Tiangeng total RNA extraction reagent Box extracts viral RNA, and extracted RNA reverse transcriptions are carried out fluorescence expansion after cDNA with PCR by TAKARA reverse transcription reagent box Hybridization check is carried out after increasing label, is compared with conventional RT-PCR testing result.

3 results

3.1 specificity experiments

Respectively PEDV-TGEV-GAR- is carried out with the virus such as PEDV, TGEV, GAR, PDCoV, PRRSV, CSFV, JEV, PCV The detection of PDCoV oligonucleotide chip hybrid specificities.The result is shown in Figure 11.

Known to：Using the fluorescent marker of the positive plasmid of PEDV, TGEV, GAR and PDCoV it is single-stranded respectively with chip hybridization, There is apparent fluorescence signal with PDCoV in corresponding lattice point in PEDV, TGEV, GAR, and gene location and positive control are glimmering Optical signal is apparent, as a result shows as the positive.By the plasmid encoding luciferase of PRRSV, PCV, CSFV and JEV mark after single-stranded mixing with chip Hybridized, testing result is shown in addition to gene location and positive control fluorescence signal are high-visible, the equal unstressed configuration of remaining lattice point As a result signal shows as feminine gender.

3.2 sensitivitys are tested

Nine kinds of constructed positive plasmids are subjected to ten times of gradient dilutions as template respectively, are 100- by dilution range Each plasmid encoding luciferase of 10-9 marks the single-stranded oligonucleotide chip completed with point system to be hybridized.Results of hybridization choose difference compared with Results of hybridization, such as Figure 12 after being diluted for apparent 105-108 times of plasmid, show that the plasmid being diluted to after 105 chip still can needle Effectively detection is carried out to it and each lattice point is high-visible, and the minimal detectable concentration of the chip is 2pg μ L^-1。

3.3 storage lives are tested

The oligonucleotide gene chip of 8 same batch points is placed at 4 DEG C and is sealed preservation by this research.Respectively Two chips are randomly selected in 30d, 60d, 90d, 120d with the fluorescent marker single stranded product of positive plasmid to be hybridized.As a result see Figure 13-14.

As it can be seen that be detected after 120d, the lattice point of oligonucleotide gene chip remains unchanged high-visible and each lattice point SNR Value is all higher than 2.0, and storage life curve graph shows that the SNR value change curve of the detection chip in 120 days is not obvious, and illustrates originally to grind Long-term preservation can be carried out at 4 DEG C by studying carefully established oligonucleotide gene chip.

3.4 clinical samples detect

The lesion small intestine and small intestine contents of 209 parts of clinical samples of Sichuan province are acquired, reversion is used after extracting total serum IgE It is cDNA that kit, which is recorded, by its reverse transcription, and PCR obtain after amplified fluorescence label that fluorescent marker is single-stranded is hybridized, with routine RT-PCR is compared, and the two result is consistent, and (PEDV positive rates are 68.42%, TGEV positive rates are 4.30%, GAR positive rates It is that 2.87%), testing result see the table below for 0.95%, PDCoV positive rates:

3 clinical sample testing result of table

To sum up, oligonucleotide chip of the present invention and kit can effectively detect Porcine epidemic diarrhea virus (PEDV), pig Infectious gastroenteritis virus (TGEV), pig A rotavirus (GAR) and pig δ coronavirus (PDCoV), it is high specificity, sensitive Degree is high, stability is good, can be used for clinical extensive detection, and application prospect is good.

Sequence table

<110>Sichuan Agricultural University

<120>It is a kind of it is synchronous detection the diarrhoeal virus of 4 boars oligonucleotide chip and its application

<130> GY151-18P1159

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213>PEDV viruses (porcine epidemic diarrhea virus, PS)

<400> 1

cgctgttcta atggtcgctc tgtggc 26

<210> 2

<211> 29

<212> DNA

<213>PEDV viruses (porcine epidemic diarrhea virus, PM)

<400> 2

atctggcact ggttgggctt tctatgtcc 29

<210> 3

<211> 32

<212> DNA

<213>TGEV viruses (transmissible gastroenteritis virus, TS)

<400> 3

caaggttaat gaatgcgtta ggtctcagtc tc 32

<210> 4

<211> 30

<212> DNA

<213>TGEV viruses (transmissible gastroenteritis virus, TN)

<400> 4

acgcttggta gtcgtggtgc taataatgaa 30

<210> 5

<211> 33

<212> DNA

<213>GAR viruses (Group A rotavirus, VP7)

<400> 5

aagagaaaat gtcgctgtaa ttcaggtagg agg 33

<210> 6

<211> 34

<212> DNA

<213>GAR viruses (Group A rotavirus, NSP4)

<400> 6

agaccagttg atgctataga tatgtcgaag gaat 34

<210> 7

<211> 23

<212> DNA

<213>PDCoV viruses (Porcine deltacoronavirus, N)

<400> 7

ctcagtttcg tggcaatgga gtt 23

<210> 8

<211> 28

<212> DNA

<213>PDCoV viruses (Porcine deltacoronavirus, M)

<400> 8

ggtgaccatt tggaccgcag ttgacaga 28

<210> 9

<211> 18

<212> DNA

<213>Positioning probe (Artificial sequence)

<400> 9

gatgccgcaa cactgagt 18

<210> 10

<211> 31

<212> DNA

<213>Positive control probe (Artificial sequence)

<400> 10

ggtggcaaca gtacagaaag acggacgaag g 31

<210> 11

<211> 20

<212> DNA

<213>PEDV viruses (porcine epidemic diarrhea virus, PS sense primer)

<400> 11

cgctaggctt gagtctgttg 20

<210> 12

<211> 20

<212> DNA

<213>PEDV viruses (porcine epidemic diarrhea virus, PS downstream primer)

<400> 12

aattgctggt tccgctgtag 20

<210> 13

<211> 18

<212> DNA

<213>PEDV viruses (porcine epidemic diarrhea virus, PM sense primer)

<400> 13

cttatggctt gcatcact 18

<210> 14

<211> 18

<212> DNA

<213>PEDV viruses (porcine epidemic diarrhea virus, PM downstream primer)

<400> 14

gcactttctc gctatctg 18

<210> 15

<211> 25

<212> DNA

<213>TGEV viruses (transmissible gastroenteritis virus, TS sense primer)

<400> 15

aggcttgacg aattgagtgc tgatg 25

<210> 16

<211> 25

<212> DNA

<213>TGEV viruses (transmissible gastroenteritis virus, TS downstream primer)

<400> 16

agtttcataa gccgttggta atagc 25

<210> 17

<211> 25

<212> DNA

<213>TGEV viruses (transmissible gastroenteritis virus, TN sense primer)

<400> 17

ttcctgaaag gtggttcttc tacta 25

<210> 18

<211> 24

<212> DNA

<213>TGEV viruses (transmissible gastroenteritis virus, TN downstream primer)

<400> 18

ttttctgtgt caacacctaa cttt 24

<210> 19

<211> 23

<212> DNA

<213>GAR viruses (Group A rotavirus, VP7 sense primer)

<400> 19

ttgaatgaat ggctatgtaa tcc 23

<210> 20

<211> 22

<212> DNA

<213>GAR viruses (Group A rotavirus, VP7 downstream primer)

<400> 20

acgcatcatt ctttcagttt gt 22

<210> 21

<211> 22

<212> DNA

<213>GAR viruses (Group A rotavirus, NSP4 sense primer)

<400> 21

gaacaggtta ctactaagga tg 22

<210> 22

<211> 22

<212> DNA

<213>GAR viruses (Group A rotavirus, NSP4 downstream primer)

<400> 22

tcacatagac gcagttactt cc 22

<210> 23

<211> 25

<212> DNA

<213>PDCoV viruses (Porcine deltacoronavirus, N sense primer)

<400> 23

tccatcctat gccttttatt atact 25

<210> 24

<211> 25

<212> DNA

<213>PDCoV viruses (Porcine deltacoronavirus, N downstream primer)

<400> 24

gcagagttac ctttttaggt ttctt 25

<210> 25

<211> 25

<212> DNA

<213>PDCoV viruses (Porcine deltacoronavirus, M sense primer)

<400> 25

gcgtaatcgt gtgatctatg ttatt 25

<210> 26

<211> 25

<212> DNA

<213>PDCoV viruses (Porcine deltacoronavirus, M downstream primer)

<400> 26

tggtatatca gaacagcaaa ttctg 25

<210> 27

<211> 21

<212> DNA

<213>Positive control (Artificial sequence, sense primer)

<400> 27

aaagcgacgc aatgaggcac t 21

<210> 28

<211> 19

<212> DNA

<213>Positive control (Artificial sequence, downstream primer)

<400> 28

gttccacgac cgcaactgc 19

Claims

1. a kind of oligonucleotide chip of the synchronous detection diarrhoeal virus of 4 boars, including solid phase carrier is carried with the solid phase is fixed on Oligonucleotide probe on body, it is characterised in that：The oligonucleotide probe includes：SEQ ID NO：Probe, SEQ shown in 1-2 ID NO：Probe shown in 3-4, SEQ ID NO：Probe shown in 5-6, SEQ ID NO：Probe shown in 7-8 is respectively used to detection pig Epidemic diarrhea virus, transmissible gastro-enteritis virus, pig A rotavirus and pig δ coronavirus.

2. oligonucleotide chip according to claim 1, it is characterised in that：It further include Quality Control probe：SEQ ID NO：9 institutes The positioning probe shown, SEQ ID NO：Positive control probe shown in 10.

3. oligonucleotide chip according to claim 1 or 2, it is characterised in that：The solid phase carrier is at aldehyde radical silication The aldehyde radical slide managed.

4. expanding the primer pair of the diarrhoeal viral gene of 4 boars, it is characterised in that：Including 8 primer pairs, respectively such as SEQ ID NO：Shown in 11-12, SEQ ID NO：Shown in 13-14, SEQ ID NO：Shown in 15-16, SEQ ID NO：Shown in 17-18, SEQ ID NO：Shown in 19-20, SEQ ID NO：Shown in 21-22, SEQ ID NO：Shown in 23-24, SEQ ID NO：Shown in 25-26.

5. a kind of kit of the synchronous detection diarrhoeal virus of 4 boars, it is characterised in that：It includes as claimed in claim 1 or 2 Primer pair shown in oligonucleotide chip and claim 3.

6. kit according to claim 5, it is characterised in that：It further includes the primer pair for expanding positive gene, sequence Such as SEQ ID NO：Shown in 27-28.

7. primer pair or claim 4 shown in the oligonucleotide chip, claim 3 described in claim 1-3 any one Purposes of the kit in the reagent for preparing the detection diarrhoeal virus of 4 boars.

8. a kind of method of the synchronous detection diarrhoeal virus of 4 boars, it is characterised in that：It includes the following steps：

(2) prepared by target sequence：The primer pair amplifies shown in claim 3 go out target sequence and carry out fluorescent marker；

(3) hybridize：The target sequence for taking step (2) to prepare, is hybridized with oligonucleotide chip as claimed in claim 1 or 2；

9. according to the method described in claim 7, it is characterized in that：In step (3), the time of the hybridization is 2-3h, temperature It is 46 DEG C.

10. according to the method described in claim 7, it is characterized in that：In step (4), the instrument of the scanning is rich Austria Luxscan-10K/A chip scanners.