CN104232801A

CN104232801A - Kit for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus

Info

Publication number: CN104232801A
Application number: CN201410513343.8A
Authority: CN
Inventors: 文心田; 曹三杰; 黄小波; 胡中凯; 文翼平; 伍锐; 黄宁; 尹人杰; 邓静; 赵松
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2014-09-29
Filing date: 2014-09-29
Publication date: 2014-12-24
Anticipated expiration: 2034-09-29
Also published as: CN104232801B

Abstract

The invention discloses a kit for detecting a porcine epidemic diarrhea virus, a porcine transmissible gastroenteritis virus and a porcine rotavirus. The gene detection kit disclosed by the invention can accurately and effectively detect the porcine epidemic diarrhea virus, the porcine transmissible gastroenteritis virus and the porcine rotavirus, and is strong in specificity, high in sensitivity, short in time consumption, fast in detection and good in application prospects.

Description

Detect the test kit of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus

Technical field

The present invention relates to and a kind ofly detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, the gene chip of porcine rotavirus and test kit.

Background technology

The scale expanding day of raising pigs along with centralization, the diarrhea disease of pig becomes and is on the rise.And cause the cause of disease research confirmation of grice diarrhoea disease to have but also constantly increasing intestinal bacteria, Salmonellas, clostridieum welchii, Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, porcine rotavirus, gentle swine fever, swine dysentery, pig coccidia etc.And the baby pig disease virus diarrhea disease caused by Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, porcine rotavirus increases increasingly, this three classes epidemic disease can cause high incidence and the high mortality of piglet, and have some areas to present the phenomenon of polyinfection and secondary infection, great loss is caused to pig industry.In view of these three kinds of viruses are very harmful to piglet aborning, the many countries and regions comprising China are the main diarrhoea class epidemic disease of prevention and corntrol these three kinds, have dropped into a large amount of human and material resources, financial resources, but have produced little effect.

Because this three class diarrhoea class epidemic disease is all extremely similar in clinical symptom and fashion trend, there is no effective vaccine can control epidemic situation, therefore in clinical diagnosis, treatment, and control has great difficulty.Linchuan symptom is in particular in: within 12-24 hour, there will be vomiting after the Infection in Piglets within general 2 week age, then there is serious water sample or pasty state diarrhoea, ight soil is in yellow, often accompany indigested curd pieces, stench, body weight declines rapidly, and piglet obviously dewaters, fall ill 2-7 days dead, mortality ratio reaches 100%; The piglet in 2-3 age in week, mortality ratio is at 0-10%; Morbidity in 2-4 days after ablactation pig infects, performance watery diarrhea, in spurting, ight soil gray or brown, indivedual pig vomiting, stopping of suffering from diarrhoea after 5-8 days, seldom dead, but weight loss, often show dysplasia, become cad pig; Some resistance to swinerys crossing pig and infect in stealth are also often the malicious pigs of band.

The method of these three kinds of diseases of traditional detection is as Virus Isolation and serum inspection, often consuming time long.RT-PCR/PCR detection method is all established abroad recently with domestic, and multi-PCR detection method, in extensive batch detection, often also there is certain limitation.For this reason, be necessary to set up one to examine chip technology altogether and carry out differential diagnosis to porcine epizootic diarrhea, transmissible gastroenteritis of swine, porcine rotavirus, to realize these 3 kinds sick detections fast and accurately, for taking effective specific aim prophylactico-therapeutic measures as early as possible, reducing these diseases and place mat is carried out to the loss that pig industry causes.In sum, with examining chip detection technology altogether, to carry out other diagnostic method to porcine epizootic diarrhea, transmissible gastroenteritis of swine, porcine rotavirus be very necessary.

With the development of Molecular Biology and technology, chip technology has the advantageous feature of high-throughput, diversity, microminiaturization and automatization in context of detection.In the Molecular Detection to various pathogenic agent, the gene often for pathogenic agent detects.And chip technology can carry out the analysis of quantitative and qualitative analysis to RNA, DNA of various pathogenic agent, thus the kind of the clear and definite disease of assisted diagnosis person and the gradient of infection of disease.Therefore chip technology plays more and more important effect in the diagnosis of communicable disease and the examination of pathogenic agent.

Gene chip, also known as DNA microarray, its principle is by by cDNA or oligonucleotide probe is intensive is fixed on solid phase surface, then carries out hybridization with the target-gene sequence marked.Through scanner scanning display image and software processes analytical data, thus obtain the specific molecular information detecting and comprise in sample, combining image and data judging correspondence detect sample whether containing, amount number.Traditional detection technique time and effort consuming, and be difficult to carry out correlation detection with the common detecting pattern of many cause of diseases.Utilize biochip technology that the specific and conserved sequence fragment of multiple cause of disease is separately fixed at chip surface, hybridize after treatment with the sample that will detect, just can obtain the Detection Information of multiple cause of disease.This detection method opens a new situation to extensive batch detection, and the integrated control for animal epidemic provides effectively and diagnosis and treatment platform fast.

Deng Junhua etc., " structure of TGEV-PEDV-PRV gene chip probes ", animal and veterinary biotechnics branch of animal and veterinary association of China and China Immunology meeting veterinary vaccination branch the 7th Conference Papers collection, in July, 2008, disclose the probe that may be used for detecting Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, but unexposed concrete gene chip and detection kit, also whether unexposed its can detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus special, delicately.

Summary of the invention

In order to solve the problem, the invention provides a kind of high specificity, the highly sensitive test kit that simultaneously can detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus.

The present invention detects the test kit of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, it comprise Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and or the gene amplification reagent of porcine rotavirus and detection gene chip;

The reagent of amplification Porcine epidemic diarrhea virus gene comprises primer pair shown in SEQ ID NO:7 ~ 8 and/or SEQ ID NO:9 ~ 10; The reagent of amplification transmissible gastro-enteritis virus gene comprises primer pair shown in SEQ ID NO:11 ~ 12 and/or SEQ ID NO:13 ~ 14; The reagent of amplification porcine rotavirus gene comprises primer pair shown in SEQ ID NO:15 ~ 16 and/or SEQ ID NO:17 ~ 18; In primer pair, the ratio of upstream primer and downstream primer is 1:1;

Described gene chip comprises solid phase carrier and is fixed on the probe on solid phase carrier; Wherein, probe to comprise shown in SEQ ID NO:1 or 2 any one or two oligonucleotide fragments, any one or two oligonucleotide fragments shown in SEQ ID NO:3 or 4, and any one or two oligonucleotide fragments shown in SEQ ID NO:5 or 6.

Preferably, described amplifing reagent also comprises the dNTP of fluorochrome label.Further preferably, described fluorescence dye is Cy3 fluorescence dye or Cy5 fluorescence dye.

Preferably, described test kit also comprises primer pair shown in SEQ ID NO:20 ~ 21; Described gene chip also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:19.

Preferably, described solid phase carrier is amination substrate.

The invention provides primer pair shown in SEQ ID NO:7 ~ 8 and/or SEQ ID NO:9 ~ 10, primer pair shown in primer pair shown in SEQ ID NO:11 ~ 12 and/or SEQ ID NO:13 ~ 14 and SEQ ID NO:15 ~ 16 and/or SEQ ID NO:17 ~ 18, with any one or two gene fragments SEQ ID NO:1 or 2 Suo Shi, shown in any one or two gene fragments shown in SEQ ID NO:3 or 4 and SEQ ID NO:5 or 6, any one or two gene fragments detect Porcine epidemic diarrhea virus in preparation, purposes in the test kit of transmissible gastro-enteritis virus and/or porcine rotavirus,

Described primer pair is amplifing reagent, and the mol ratio of upstream primer and downstream primer is 1:1; Shown in SEQ ID NO:1 ~ 6, gene fragment is detection probes.

Preferably, described test kit also comprises primer pair shown in SEQ ID NO:20 ~ 21 and the position probe shown in SEQ ID NO:19.

Preferably, described probe is fixed on amination substrate.

Test kit of the present invention can effectively detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, and susceptibility is high, and three kinds of viral minimal detectable concentrations are 20pg/ μ l, high specificity, consuming time short, detect fast, have a good application prospect.

The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following embodiment.The technology that all contents recorded based on claims of the present invention realize all belongs to scope of the present invention.

Accompanying drawing explanation

The arranged situation of Fig. 1 DNA microarray;

Fig. 2 specific detection result;

Fig. 3 sensitivity technique result;

Fig. 4 repeatability detected result.

Embodiment

One, experiment material and instrument

Material prepares

Strain:

Porcine epidemic diarrhea virus (PEDV) strain, transmissible gastro-enteritis virus (TGEV), porcine rotavirus (PoRV strain), purchased from China Veterinary Drugs Supervisory Inst..

Reagent:

Total serum IgE extraction agent box is sky root (Beijing) biochemical technology company limited product; PrimeScriptTMRT reagent Kit (Perfect Real Time) is precious biotechnology (Dalian) company limited product; Mini-scale plasmid extracts test kit, in a small amount glue and reclaims test kit, is OMEGA (U.S.) biotech company product.

amino slide glass, 2 × spotting buffer, pre-hybridization buffer, hybridization buffer, all purchased from Baiao Science and Technology Co. Ltd., Shanghai; Cy3-dCTP:25nmol, PA53021, Lot300989, Amersham Biosciences, UK; Washing lotion I: 0.1%SDS 2 × SSC; Washing lotion II: 0.1%SDS 0.2 × SSC; Washing lotion III: 0.2 × SSC; Washing lotion 4: distilled water.

Instrument:

Bechtop: SW-CJ-2FD, SuZhou Antai Air Tech Co., Ltd.;

Ultrapure water instrument: Milli Qplus, method is domestic;

Grads PCR instrument: P × 2, Thermo hybaid, the U.S. produces;

High speed freezing centrifuge 3K18 type: germany produces;

Mini-SUB gel electrophoresis apparatus: Bio- italy produces;

Electrophoresis apparatus: POWER Pac300, Bio- italy produces;

Gel electrophoresis images analytical system 2000 type: Bio- italy produces;

Constant-temperature table: Thermo Forma, the U.S. produces;

Nucleic acid-protein detector: Bio-RAD, SmartSpaee TM 3010;

Hybridization Oven: Thermo, the U.S. produces;

Multi-example fence, Multi-example fence paste tool, Multi-example fence cover plate, chip hybridization box is Beijing Bo Ao biotech firm;

Brilliant smartArrayer ^tM48, micro-array chip spotting system: Capitalbio Corporation, Beijing Bo Ao biotech firm;

Brilliant luxScan ^tM10K micro-array chip scanner: Capitalbio Corporation, Beijing Bo Ao biotech firm;

Vacuum machine: SinBo, Hong Kong;

CO2 constant incubator: Thermo, the U.S. produces.

The preparation of embodiment 1 test kit of the present invention

1, material and instrument

With aforementioned experiment material and instrument.

2, experimental technique

The preparation of 2.1 PCR primer, detection probes

(1) cause of disease specific probe is designed: by the nucleotide sequence contraposition arrangement analysis to the Porcine epidemic diarrhea virus of including in GenBnak, transmissible gastro-enteritis virus, porcine rotavirus, selected conservative region sequence: PEDV M, S; TGEV N, S; PoRV NSP4, VP7.Detect multipair probe for conserved sequence design, select the probe sequence of high specificity.

(2) Auele Specific Primer of designing probe sequence: for above-mentioned conservative probe sequence, utilizes the design Auele Specific Primers such as bioinformatics software DNAman, Primer5.0.Auele Specific Primer is synthesized by Shanghai bio-engineering corporation.

(3) probe preparation: extract Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, porcine rotavirus with total serum IgE extraction agent box, utilize above-mentioned Auele Specific Primer to carry out RT-PCR amplification to three kinds of cause of disease nucleic acid, purifying concentration determination.

Reverse transcription system and condition (method with reference to PrimeScript RT reagent Kit)

PCR amplification system and condition:

Reaction conditions: l) 94 DEG C of sex change 2min; 2) 94 DEG C of sex change 30S, 50 DEG C of annealing 30S, 72 DEG C extend 30S, totally 35 circulations; 3) 72 DEG C extend 10min, 12 DEG C of maintenances.

4, the screening of probe: synthetic probe is dissolved and makes common inspection chip with gene chip sample applying instrument point on amination glass substrate after appropriate dilution, carry out probe screening by cross experiment, finally obtain detecting special, sensitive probe needed for DNA microarray for the preparation of the present invention: PEDV M, S; TGEV N, S; PoRV NSP4, VP7.

5, the genomic foundation of probe: PEDV M, S of glue being reclaimed purifying; TGEV N, S; PoRV NSP4, VP7 pMD 19-T Vector connects, and linked system is pMD 19-T Vector 0.5ul, and glue reclaims probe 5.0ul, connecting fluid 4.5ul, total amount 10.0ul.Ligation carries out 16h at 16 DEG C; 10.0ul probe being connected product adds in 200ul competent cell DH5 α prepared by Calcium Chloride Method, ice bath 30min after mixing gently, put into ice bath immediately after 42 DEG C of heat-shocked 90s and cool 5min, add 800ulLB liquid nutrient medium, 37 DEG C of slight oscillatory cultivate 3h.Getting 200ul culture coats containing X--Gal, IPTG, LB Agar Plating containing ammonia benzyl, 37 DEG C of overnight incubation, selects white colony and carries out Zengjing Granule and plasmid PCR qualification and the order-checking of Song Bao biotech firm.

6, the genomic preservation of probe: the correct plasmid of order-checking is carried out amplification cultivation, and carries out freeze-drying with 20% skimmed milk as protective material, as-80 DEG C of preservations.

2.2 chip preparations

(1) design of chip matrix: often open chip and be divided into four districts, four districts are four repeat arrays, separate with hybridization fence, to carry out the hybridization of three different samples simultaneously.Each array parameter is: often row's probe gene and gene location are 12 sampling points, various kinds dot center spacing 650um, and spot diameter is 220um.

(2) the some system of DNA microarray is detected:

Spotting buffer is mixed with sampling liquid, Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, porcine rotavirus probe, gene location and negative Quality Control gene quantification will be comprised and be 200ng/ul to working concentration, be heated to 95 DEG C and keep 5min, be then placed in cooled on ice 10min.

By chip design requirement add in 96 (384) hole load sample plate holes dilution sex change good comprise Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, Zhu Lunzhuanbingdu probe, gene location, negative Quality Control gene and blank Quality Control damping fluid, seal orifice plate, with gene chip sample applying system (Microarray Printing System, SpotArrayTM 24) contact point sample on amination substrate.Point sample ambient relative humidity is 55%-65%, temperature 15-30 DEG C.

The chip that point makes leaves standstill abundant dried overnight (at least 6h), then 60-80 DEG C of hydration-treated 10s is used, immediately in being heated to 80 DEG C of In situPCR instrument are dried, after ultraviolet-crosslinkable 30min, with 0.2%SDS liquid washing 5min, again with centrifugal drying after distilled water quick wash, sealing, room temperature preservation is for subsequent use.

The nucleotide sequence of primer and probe is as follows:

SEQ?ID?NO：1(PEDV-M)

Source gene source: PEDV strain isolated

Gene size and sequence: 421bp

CTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTATTTTGTCAATAGCATTCGGTTGTGGCGCAGGACACATTCTTGGTGGTCTTTCAATCCTGAAACTGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGGTCTGCATTCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGTTTGTAGAGGGCTATAAGGTTGCTACTGGCGTACAGGTAAGTCAATTGCCTGATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTATGGACGTGTTGGTCGTTCAGTCAATGCTTCATCTGGCACTGGTTGGGCTTTCTATGTCCGGTCAAAACACGGCGACTACTCAGCTGTGAGTAATCCGAGTGCGGTTCTCACAGATAGCGAGAAAGTGC

SEQ?ID?NO：2(PEDV-S)

Source gene source: PEDV strain isolated

Gene size and sequence: 474bp

CGCTAGGCTTGAGTCTGTTGAAGTTAACTCTATGCTTACTATTTCTGAAGAGGCTCTACAGTTAGCTACCATCAGTTCGTTTAATGGTGATGGATATAACTTTACTAATGTGCTGGGTGTTTCCGTGTACGACCCTGCAAGTGGCAGGGTGGTACAAAAAGGGTCTTTTATTGAAGACCTGCTTTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGATGAAGACTATAAGCGCTGTTCTAATGGTCGCTCTGTGGCAGATCTAGTCTGTGCGCAGTATTACTCTGGTGTCATGGTACTACCTGGCGTTGTTGACGCTGAGAAGCTTCAAATGTATAGTGCGTCTCTCATCGGTGGTATGGCGCTAGGAGGTCTTACTACTGCAGCGGCATTGCCTTTTAGCCATGCTGTTCAAGCGAGGCTCAATTATCTTGCTTTACAGACGGATGTTCTACAGCGGAACCAGCAATT

Seq?ID?NO?3(TGEV-N)

Source gene source: TGEV strain isolated, SC-H strain

Gene size and sequence: 362bp

TTCCTGAAAGGTGGTTCTTCTACTACTTAGGTACTGGACCTCATGCAGATGCCAAATTTAAAGATAAATTAGATGGAGTTGTCTGGGTTGCCAAGGATGGTGCCATGAACAAACCAACCACGCTTGGTAGTCGTGGTGCTAATAATGAATCCAAAGCTTTGAAATTCGATGGTAAAGTGCCAGGCGAATTTCAACTTGAAGTTAATCAATCAAGAGACAATTCAAGGTCACGCTCTCAATCTAGATCTCGGTCTAGAAATAGATCTCAATCTAGAGGCAGGCAACAATTCAATAACAAGAAGGATGACAGTGTAGAACAAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAA

SEQ?ID?NO：4(TGEV-S)

Source gene source: TGEV strain isolated, SC-H strain

Gene size and sequence: 276bp

AGGCTTGACGAATTGAGTGCTGATGCACAAGTTGACAGGCTGATCACAGGAAGACTTACAGCACTTAATGCATTTGTGTCTCAGACTCTAACCAGACAAGCGGAGGTTAGGGCTAGTAGACAACTTGCCAAAGACAAGGTTAATGAATGCGTTAGGTCTCAGTCTCAGAGATTCGGATTCTGTGGTAATGGTACACATTTGTTTTCACTCGCAAATGCAGCACCAAATGGCATGATTTTCTTTCACACAGTGCTATTACCAACGGCTTATGAAACT

SEQ?ID?NO：5(PoRV-NSP4)

The source gene source of clone gene: PoRV, OSU strain

Gene size and sequence: 270bp

GAACAGGTTACTACTAAGGATGAAATTGAACAACAGATGGACAGAATTGTTAAGGAGATGAGGCGTCAACTGGAAATGATTGACAAATTGACAACTCGTGAAATTGAACAAGTTGAATTACTTAAGCGTATACATGACAAATTAGCTGCTAGACCAGTTGATGCTATAGATATGTCGAAGGAATTTAATCAGAAAAATATTCGAACGCTAGATGAATGGGAAAGTGGAAAAAATCCATATGAACCGTCGGAAGTAACTGCGTCTATGTGA

SEQ?ID?NO：6(PoRV-VP7)

Source gene source: PoRV, OSU strain

Gene size and sequence: 381bp

TTGAATGAATGGCTATGTAATCCAaTGgATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGATATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGACTCTCGGGATAGGATGTTCGACTACAGACATAAATTCATTTGAAACAGTGGCCAATGCAGAGAAATTAGCTATAACTGATGTTGTCGATGGAGTCAATCATAAATTAGACGTAACAACGAGTACATGTACTATAAGAAATTGTAAAAAACTTGGACCAAGAGAAAATGTCGCTGTAATTCAGGTAGGAGGTCCAAACATACTCGACATAACAGCTGATCCAACAACTGCACCACAAACTGAAAGAATGATGCGT

SEQ?ID?NO：7～8(PM-primer)

F?5`-CTTATGGCTTGCATCACT-3`

R?5`-GCACTTTCTCGCTATCTG-3`

SEQ?ID?NO：9～10(PS-primer)

F?5`-CGCTAGGCTTGAGTCTGTTG-3`

R?5`-AATTGCTGGTTCCGCTGTAG-3`

SEQ?ID?NO：11～12(TN-primer)

F?5'-TTCCTGAAAGGTGGTTCTTCTACTA-3'

R?5`–TTTTCTGTGTCAACACCTAACTTT-3`

SEQ?ID?NO：13～14(TS-primer)

F?5`-AGGCTTGACGAATTGAGTGCTGATG-3`

R?5`-AGTTTCATAAGCCGTTGGTAATAGC-3`

SEQ?ID?NO：15～16(NSP4-primer)

F?5`-GAACAGGTTACTACTAAGGATG-3`

R?5`-TCACATAGACGCAGTTACTTCC-3`

SEQ?ID?NO：17～18(VP7-primer)

F?5`-TTGAATGAATGGCTATGTAATCC-3`

R?5`-ACGCATCATTCTTTCAGTTTGT-3`

The sequence (SEQ ID NO:19) of gene location

SEQ ID NO:20 ~ 21 (amplimer of gene location complementary sequence)

F：AAAGCGACGCAATGAGGCACT

R：GTTCCACGACCGCAACTGC

The using method of embodiment 2 test kit of the present invention

1, nucleic acid extraction

The extracting of viral RNA: adopt kit method extracting viral RNA, test uses virus/liquid sample RNA extraction agent box in a small amount.By this test kit, extracting RNA is described, method is as follows:

A) get measuring samples 300 μ L and be placed in centrifuge tube, after adding 500 μ L RV liquid, after thermal agitation 2min, room temperature leaves standstill 5min.

B) add 750 μ L Virahols, shake up gently.

C) 800 μ L are pipetted in adsorption column, the centrifugal 30s of 12000rpm at 4 DEG C.

D) abandon liquid in collection tube, remaining lysate is moved in adsorption column, the centrifugal 30s of 12000r at 4 DEG C.

E) add 500 μ L RP liquid after abandoning collection liquid, at 4 DEG C, the centrifugal 30s of 12000rpm removes protein.

F) 500 μ L W3 liquid are added, after leaving standstill lmin, the centrifugal 15s of 12000rpm at 4 DEG C.

G) repeating step f.

H) transferred to by adsorption column in another clean centrifuge tube, add 30 μ L ultrapure waters in adsorption film central authorities, room temperature leaves standstill 2min.

I) the centrifugal 2min of 12000rpm, centrifugate is the RNA extracted, and-70 DEG C save backup.

The reverse transcription of viral RNA: NDV, IBV reverse transcription system 10.0 μ L system:

Reverse transcription reaction program is as follows: 42 DEG C, reverse transcription 30min; 85 DEG C, 30s deactivation ThermoScript II; 4 DEG C of maintenances.

2, the pcr amplification mark of cDNA/DNA

In test, Cy3-dCTP fluorescein uses final concentration to be 2.5umol/L, when adding fluorescein and operation later all carry out in darkroom.Carrying out amplified reaction program by following program is reaction conditions: l) 94 DEG C of sex change 2min; 2) 94 DEG C of sex change 30S, 54 DEG C of annealing 30S, 72 DEG C extend 30S, totally 35 circulations; 3) 72 DEG C extend 10min, 12 DEG C of maintenances.

The multiplexed PCR amplification mark of 3.cDNA

Multiplex PCR mark system:

In test, Cy3-dCTP fluorescein uses final concentration to be 2.5umol/L, when adding fluorescein and operation later all carry out in darkroom.Carrying out amplified reaction program by following program is reaction conditions: l) 94 DEG C of sex change 2min; 2) 94 DEG C of sex change 30S, 50 DEG C of annealing 30S, 72 DEG C extend 30S, totally 35 circulations; 3) 72 DEG C extend 10min, 12 DEG C of maintenances.

4, detect

(1) prehybridization of chip: Example 1 prepares gene chip, in 95-100 DEG C of distilled water, sex change 1-2min. upper and lower extracting is therebetween in order to avoid form bubble in surface of glass slide, put centrifugal drying after cooling fast in 95% ethanol of precooling immediately, gene chip is placed in hybridization cabin, prehybridization solution 25 μ L is added in microarray detection zone, cover glass is put down gently on it, in order to avoid formation bubble, make prehybridization solution uniform fold microarray detection zone, in wet box chip being placed in sealing at 42 DEG C prehybridization 1 h.

(2) hybridization of chip: absorb prehybridization solution, to the nucleic acid samples of nucleic acid samples that the mark of substance PCR is good and multiplex PCR mark be utilized respectively at after 95 DEG C of sex change 3min, put in ice immediately and cool 5min, mix with the hybridization buffer of a certain amount of precooling again, get this mixed solution 20-40 μ L and be added to microarray detection zone, put down gently on it with cover glass, microarray is put into hybridization cabin in a wet box lucifuge hybridization, under 48 DEG C of hybridization temperatures, hybridize the 6h time.

(3) the dry behaviour of the washing of DNA microarray: hybridize complete, washing lotion respectively washs 3min, for scanning analysis after centrifugal drying.Washing completes in darkroom.After hybridization, remove the cover glass of microarray detection zone gently, microarray is placed on slide frame, wash 3min respectively by warm washing lotion 1, washing lotion 2, washing lotion 3 immediately, and then use distilled water rinsing, sweep after centrifugal drying and read to analyze.

(4) the DNA microarray gene chip scanning instrument of scanning analysis centrifugal drying 4000 Scanning Detction.Sweep parameter is Laserpower 95%, PMGT 75%, resolving power 20um, and scanning result preserves image with 16 TIFF and BMP forms.

Embodiment 3 specific test

One, test method

Adopt the test kit of embodiment 1, according to the method for embodiment 2, detect PoRV, TGEV, PEDV, PRRSV (porcine reproductive and respiratory syndrome virus), CSFV (Pestivirus suis), JEV (Latex agglutination test), PRV (PRV (Pseudorabies virus)) 7 kinds of viruses, to verify the specificity of test kit of the present invention.

Two, result

As shown in Figure 2, the inventive method can effectively detect PoRV, TGEV, PEDV of the present invention to experimental result, and can not detect other virus, and e.g., PRRSV, CSFV, JEV, PRV, show the high specificity of the inventive method, and can not increase other viruses.

Embodiment 4 sensitivity test

One, test method

The viral RNA of extracting PEDV, TGEV, PoRV tri-kinds carries out reverse transcription, and with the cDNA of reverse transcription for template, carries out amplification label and make probe.Amplification after product nucleic acid-protein instrument records the OD260 of target gene, be converted into DNA concentration, gradient dilution, concentration after dilution is respectively 3pg/ μ l, 10pg/ μ l, 20pg/ μ l, 50pg/ μ l, 100pg/ μ l, 200pg/ μ l, 500pg/ μ l, 1000pg/ μ l, 10000pg/ μ l, the liquid of each gradient is added the mixing of 5ul position probe, adopt the test kit of embodiment 1, detect according to the method for embodiment 2.

Two, result

As shown in Figure 3, various target gene DNA concentration is when 20pg/ μ l, and the median of gene recombination signal is all greater than 1500, and SNR is greater than 1.5 for result, and known DNA microarray minimal detectable concentration is 20pg/ μ l.

Experimental result illustrates, the minimal detectable concentration that test kit of the present invention detects PEDV, TGEV, PoRV is 20pg/ μ l, highly sensitive.

Embodiment 5 adopts test kit of the present invention to detect pathological material of disease

One, detection method

1) the taking of pathological material of disease: the sample collecting the doubtful porcine epizootic diarrheas in 20 parts, cities and counties of 5, Sichuan Province (Deyang, Mianyang, Ziyang, the red woods in Luzhou, Yongchuan), transmissible gastroenteritis of swine, porcine rotavirus symptom, comprises small intestine and content thereof

2) pre-treatment of pathological material of disease:

1. the process of the dirty tissue of device: ground by the pathological material of disease sterilizing PBS gathered, acts on 30 minutes at 37 DEG C, and multigelation 3 times also uses ultrasonication, centrifugal, supernatant liquor-20 DEG C preservation.

2, adopt the test kit of embodiment 1, detect according to the method for embodiment 2.

Two, detected result

Result is as shown in table 1:

Table 1 clinical sample detected result

?	Positive number	Infection rate/%
			PEDV	20	100
PoRV	13	65
			TGEV	16	80
PEDV+PoRV	13	65
			PEDV+TGEV	16	80
PoRV+TGEV	12	60
			PEDV+ARV+TGEV	12	60

Adopt test kit of the present invention, detect in 20 increment product, have Porcine epidemic diarrhea virus, wherein 13 parts contain pig colyliform disease, and 16 parts contain transmissible gastro-enteritis virus, and are mostly polyinfection.

Experimental result illustrates, test kit of the present invention can effectively detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus.

The preservation period of embodiment 6 test kit of the present invention and repeatability

1, embodiment 1 is prepared the gene chip in test kit by preservation period, is positioned in chip cartridges, with vacuum machine drying sealing, preserves 30 days, 60 days, 90 days, 120 days respectively, verifies according to the method hybridization check of embodiment 2.

Result shows, and gene chip still can effectively detect after preserving 120 days.

2, repeatability

Using PEDV M gene as target gene, that carries out individual chip reuses test.After getting a chip hybridization, scanning obtains results of hybridization, then hybridization spot is eliminated in this chip sex change, the more identical probe of the chip of this after sex change is carried out second time hybridization, and same scanning obtains results of hybridization, so repeats seven times.

Result as shown in Figure 4, reusable at least seven times of this chip.

Experimental result illustrates, the long preservative period of test kit of the present invention is reproducible.

To sum up, test kit of the present invention can effectively detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, and high specificity, susceptibility are high, consuming time short, detects fast, has a good application prospect.

Claims

1. detect a test kit for Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, it is characterized in that: it comprises Porcine epidemic diarrhea virus, the gene amplification reagent of transmissible gastro-enteritis virus and porcine rotavirus and detection gene chip;

2. test kit according to claim 1, is characterized in that: described amplifing reagent also comprises the dNTP of fluorochrome label.

3. test kit according to claim 2, is characterized in that: described fluorescence dye is Cy3 fluorescence dye or Cy5 fluorescence dye.

4. test kit according to claim 1, is characterized in that: described test kit also comprises primer pair shown in SEQ ID NO:20 ~ 21; Described probe also comprises position probe shown in SEQ ID NO:19.

5. test kit according to claim 1, is characterized in that: described solid phase carrier is amination substrate.

Primer pair shown in 6.SEQ ID NO:7 ~ 8 and/or SEQ ID NO:9 ~ 10, primer pair shown in primer pair shown in SEQ ID NO:11 ~ 12 and/or SEQ ID NO:13 ~ 14 and SEQ ID NO:15 ~ 16 and/or SEQ ID NO:17 ~ 18, with any one or two gene fragments SEQ ID NO:1 or 2 Suo Shi, shown in any one or two gene fragments shown in SEQ ID NO:3 or 4 and SEQ ID NO:5 or 6, any one or two gene fragments detect Porcine epidemic diarrhea virus in preparation, purposes in the test kit of transmissible gastro-enteritis virus and/or porcine rotavirus,

7. purposes according to claim 6, is characterized in that: described amplifing reagent also comprises the dNTP of fluorochrome label.

8. purposes according to claim 7, is characterized in that: described fluorescence dye is Cy3 fluorescence dye or Cy5 fluorescence dye.

9. purposes according to claim 6, is characterized in that: described test kit also comprises primer pair shown in SEQ ID NO:20 ~ 21 and the position probe shown in SEQ ID NO:19.

10. the purposes according to claim 6 or 9, is characterized in that: described probe is fixed on amination substrate.