CN104232801B - Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus - Google Patents
Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus Download PDFInfo
- Publication number
- CN104232801B CN104232801B CN201410513343.8A CN201410513343A CN104232801B CN 104232801 B CN104232801 B CN 104232801B CN 201410513343 A CN201410513343 A CN 201410513343A CN 104232801 B CN104232801 B CN 104232801B
- Authority
- CN
- China
- Prior art keywords
- seq
- kit
- primer
- probe
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The invention discloses the kit of a kind of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus.Base detection kit of the present invention can be accurate and effective detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, and high specificity, highly sensitive, the shortest, quickly, application prospect is good in detection.
Description
Technical field
The present invention relates to a kind of base detecting Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, porcine rotavirus
Because of chip and kit.
Background technology
The scale expanding day raised pigs along with centralization, the diarrhea disease of pig becomes to be on the rise.And cause grice diarrhoea
The cause of disease research confirmation of disease has but also is being continuously increased Escherichia coli, salmonella, clostridieum welchii, Porcine Epidemic Diarrhea
Poison, transmissible gastro-enteritis virus, porcine rotavirus, gentle swine fever, swine dysentery, pig coccidia etc..And by Porcine Epidemic Diarrhea
The baby pig disease virus diarrhea disease that poison, transmissible gastro-enteritis virus, porcine rotavirus cause increases increasingly, this three classes epidemic disease energy
Cause high incidence and the high mortality of piglet, and have some areas to present the phenomenon of mixed infection and scabies secondary infection,
Pig industry is caused loss greatly.In view of these three virus is very harmful to piglet, including China aborning
Many countries and regions are prevention and control the diarrhoea class epidemic disease that these three is main, have put into substantial amounts of human and material resources, financial resources,
But produce little effect.
Due to this three class diarrhoea class epidemic disease in clinical symptoms and fashion trend the most similar, there is no effective vaccine can be by
Epidemic situation controls, and therefore in clinical diagnosis, treatment, and has great difficulty in preventing and treating.Linchuan symptom is in particular in: general 2
Within after Infection in Piglets within week old 12-24 hour, there will be vomiting, serious water sample or pasty state diarrhoea then occur, ight soil is Huang
Look, often accompanies indigested ziega, stench, and body weight declines rapidly, and piglet is substantially dehydrated, and death in 2-7 days of falling ill, the death rate reaches
100%；The piglet of 2-3 week old, the death rate is at 0-10%；Within after ablactation pig infects 2-4 days, fall ill, show watery diarrhea, in spurting,
Ight soil gray or brown, indivedual pigs vomit, and after 5-8 days, diarrhoea stops, seldom dead, but Body weight loss, often show growth
Bad, become cad pig；Some resistance to pigs excessively and the swinery infected in stealth are the most also band poison pigs.
The method such as Virus Isolation of traditional detection these three disease and serum inspection, the most long.Recently
Abroad with the domestic RT-PCR/PCR detection method that all establishes, and multi-PCR detection method, past in extensive batch detection
Toward also there being certain limitation.For this reason, it is necessary to set up one to examine chip technology altogether to pig epidemic diarrhea, pig transmissible stomach and intestine
Scorching, porcine rotavirus carries out antidiastole, to realize these 3 kinds sick detections fast and accurately, effective for taking as early as possible
Specific aim prophylactico-therapeutic measures, reduces the loss that pig industry causes by these diseases and carries out place mat.In sum, with examining chip detection altogether
It is the most necessary that technology carries out other diagnostic method to pig epidemic diarrhea, transmissible gastroenteritis of swine, porcine rotavirus.
With Molecular Biology and the development of technology, chip technology has high flux, diversity, micro-in context of detection
Type and the advantageous feature of automation.In the Molecular Detection to various pathogen, often the gene for pathogen is examined
Survey.And RNA, DNA of various pathogen can be carried out qualitative and determine quantitative analysis by chip technology, thus the clear and definite disease of assisted diagnosis person
Sick kind and the gradient of infection of disease.Therefore chip technology plays in the diagnosis of communicable disease and the examination of pathogen
The most important effect.
Genetic chip, also known as DNA microarray, its principle is by being fixed on solid phase by intensive to cDNA or oligonucleotide probe
Surface, then carry out hybridization reaction with the most labeled good target-gene sequence.It is scanned through instrument scanning display image and software processes
Analyze data, thus obtain the specific molecular information comprised in detection sample, in conjunction with image detection corresponding with data judging sample
Whether contain, the number of amount.Traditional detection technique time and effort consuming, and be difficult to jointly detect pattern with many cause of diseases and carry out
Coherent detection.Utilize biochip technology that the specific and conserved sequence fragment of multiple cause of disease is separately fixed at chip surface, with
Sample to be detected hybridizes after treatment, just can obtain the detection information of multiple cause of disease.This detection method is to extensive batch
Amount detection opens a new situation, and the integrated control for animal epidemic provides effective and quick diagnosis and treatment platform.
Deng Junhua etc., " structure of TGEV-PEDV-PRV gene chip probes ", animal and veterinary association of China animal and veterinary is raw
The 7th Conference Papers collection of thing technology branch and China Immunology meeting veterinary vaccination branch, in July, 2008, discloses possibility
For detecting the probe of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, but undisclosed concrete
Genetic chip and detection kit, be also not disclosed whether it can detect Porcine epidemic diarrhea virus, pig special, delicately
TGE and porcine rotavirus.
Summary of the invention
In order to solve the problems referred to above, the invention provides a kind of high specificity, highly sensitive can to detect pig popular simultaneously
Property diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus.
The present invention detects the kit of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, it
Including Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and or the gene amplification reagent of porcine rotavirus and detection use
Genetic chip；
The reagent of amplification Porcine epidemic diarrhea virus gene includes SEQ ID NO:7～8 and/or SEQ ID NO:9～10
Shown primer pair；The reagent of amplification transmissible gastro-enteritis virus gene includes SEQ ID NO:11～12 and/or SEQ ID
Primer pair shown in NO:13～14；The reagent of amplification porcine rotavirus gene includes SEQ ID NO:15～16 and/or SEQ ID
Primer pair shown in NO:17～18；Primer centering, upstream primer is 1:1 with the ratio of downstream primer；
Described genetic chip includes solid phase carrier and the probe being fixed on solid phase carrier；Wherein, probe includes SEQ
Any one or two oligonucleotide fragments shown in ID NO:1 or 2, any one or two shown in SEQ ID NO:3 or 4
Oligonucleotide fragment, and any one or two oligonucleotide fragments shown in SEQ ID NO:5 or 6.
Preferably, described amplifing reagent also includes the dNTP of fluorochrome label.It is further preferred that described fluorescent dye
For Cy3 fluorescent dye or Cy5 fluorescent dye.
Preferably, described kit also includes primer pair shown in SEQ ID NO:20～21；Described genetic chip also includes
Location probe, location probe is the genetic fragment shown in SEQ ID NO:19.
Preferably, described solid phase carrier is amination substrate.
The invention provides primer shown in SEQ ID NO:7～8 and/or SEQ ID NO:9～10 to, SEQ ID NO:11
～12 and/or SEQ ID NO:13～14 shown in primer to and SEQ ID NO:15～16 and/or SEQ ID NO:17～18
Shown primer pair, appoints shown in any one or two genetic fragments, SEQ ID NO:3 or 4 with SEQ ID NO:1 or 2 Suo Shi
Shown in one or two genetic fragments of anticipating and SEQ ID NO:5 or 6, any one or two genetic fragments are in preparation inspection
Survey the purposes in the kit of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and/or porcine rotavirus；
Described primer is 1:1 to the mol ratio for amplifing reagent, upstream primer and downstream primer；SEQ ID NO:1～6 institute
Show that genetic fragment is detection probe.
Preferably, described amplifing reagent also includes the dNTP of fluorochrome label.It is further preferred that described fluorescent dye
For Cy3 fluorescent dye or Cy5 fluorescent dye.
Preferably, described kit also include primer shown in SEQ ID NO:20～21 to and SEQ ID NO:19 shown in
Location probe.
Preferably, described probe is fixed on amination substrate.
It is sick that kit of the present invention can effectively detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and pig colyliform
Poison, sensitiveness is high, and three kinds of viral minimal detectable concentrations are 20pg/ μ l, high specificity, and the shortest, detection quickly, has good
Good application prospect.
The detailed description of the invention of form by the following examples, makees the most specifically the foregoing of the present invention
Bright.But this should not being interpreted as, the scope of the above-mentioned theme of the present invention is only limitted to below example.All based on right of the present invention want
The technology that the content asking secretary to carry is realized belongs to the scope of the present invention.
Accompanying drawing explanation
The matrix arrangement situation of Fig. 1 DNA microarray；
Fig. 2 specific detection result；
Fig. 3 sensitivity technique result；
Fig. 4 repeatability testing result.
Detailed description of the invention
One, experiment material and instrument
Material prepares
Strain:
Porcine epidemic diarrhea virus (PEDV) strain, transmissible gastro-enteritis virus (TGEV), porcine rotavirus (PoRV poison
Strain), purchased from China Veterinary Drugs Supervisory Inst..
Reagent:
Total serum IgE extraction agent box, for sky root (Beijing) biochemical technology Co., Ltd product；PrimeScriptTMRT
Reagent Kit (Perfect Real Time), for precious bioengineering (Dalian) Co., Ltd product；Mini-scale plasmid extracts examination
Agent box, in a small amount glue reclaim kit, are OMEGA (U.S.) biotech company product.
Amino slide,2 × spotting buffer,Pre-hybridization buffer,Hybridization
Buffer solution, is purchased from Baiao Science and Technology Co. Ltd., Shanghai；Cy3-dCTP:25nmol, PA53021, Lot300989, Amersham
Biosciences, UK；Washing lotion I: 0.1%SDS 2 × SSC；Washing lotion II: 0.1%SDS 0.2 × SSC；Washing lotion III: 0.2 ×
SSC；Washing lotion 4: distilled water.
Instrument:
Superclean bench: SW-CJ-2FD, SuZhou Antai Air Tech Co., Ltd.；
Ultra-pure water instrument: Milli Qplus, method is domestic；
Grads PCR instrument: P × 2, Thermo hybaid, the U.S. produces；
High speed freezing centrifuge 3K18 type:Germany produces；
Mini-SUB gel electrophoresis apparatus: Bio-Italy produces；
Electrophoresis apparatus: POWER Pac300, Bio-Italy produces；
Gel electrophoresis images analyzes system 2000 type: Bio-Italy produces；
Constant-temperature table: Thermo Forma, the U.S. produces；
Nucleic acid-protein detector: Bio-RAD, SmartSpaee TM 3010；
Hybridization Oven: Thermo, the U.S. produces；
Multi-example fence, Multi-example fence paste tool, Multi-example fence cover plate, chip hybridization box is Beijing Bo Aosheng
Thing company；
BrilliantSmartArrayerTM48, micro-array chip spotting system: Capitalbio Corporation, Beijing
Bo Ao biotech firm；
BrilliantLuxScanTM10K micro-array chip scanner: Capitalbio Corporation, Beijing Bo Aosheng
Thing company；
Vacuum machine: SinBo, Hong Kong；
CO2 constant incubator: Thermo, the U.S. produces.
The preparation of embodiment 1 kit of the present invention
1, material and instrument
With aforementioned experiment material and instrument.
2, experimental technique
2.1 PCR primer, the preparation of detection probe
(1) design cause of disease specific probe: by the Porcine epidemic diarrhea virus included in GenBnak, pig transmissible
Marcy agent, the nucleotide sequence contraposition arrangement analysis of porcine rotavirus, selected conservative region sequence: PEDV M, S；TGEV N、
S；PoRV NSP4、VP7.Detect multipair probe for conserved sequence design, select the probe sequence of high specificity.
(2) specific primer of probe sequence is designed: for above-mentioned conservative probe sequence, utilize bioinformatics software
DNAman, Primer5.0 etc. design specific primer.Specific primer is synthesized by Shanghai bio-engineering corporation.
(3) prepared by probe: with total serum IgE extraction agent box extract Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus,
Porcine rotavirus, utilizes above-mentioned specific primer that three kinds of cause of disease nucleic acid carry out RT-PCR amplification, purifies concentration and measures.
Reverse transcription system and condition (with reference to the method for PrimeScript RT reagent Kit)
PCR amplification system and condition:
Reaction condition: l) 94 DEG C of sex change 2min；2) 94 DEG C of sex change 30S, 50 DEG C of annealing 30S, 72 DEG C of extension 30S, totally 35
Circulation；3) 72 DEG C extend 10min, 12 DEG C of holdings.
4, the screening of probe: with gene chip sample applying instrument point in amination after synthetic probe is dissolved and dilutes in right amount
Make common inspection chip on glass substrate, carry out probe screening by cross experiment, finally give and detect DNA for preparing the present invention
Special, sensitive probe needed for microarray: PEDV M, S；TGEV N、S；PoRV NSP4、VP7.
5, the foundation of probe genome: glue is reclaimed PEDV M, the S purified；TGEV N、S；PoRV NSP4, VP7 pMD
19-T Vector is attached, and linked system is pMD 19-T Vector 0.5ul, and glue reclaims probe 5.0ul, connects liquid
4.5ul, total amount 10.0ul.Coupled reaction carries out 16h at 16 DEG C；10.0ul probe connects product addition Calcium Chloride Method prepare
200ul competent cell DH5 α in, gently mixing after ice bath 30min, be immediately placed in ice bath cooling after 42 DEG C of heat shocks 90s
5min, adds 800ulLB fluid nutrient medium, and 37 DEG C of slight oscillatory cultivate 3h.Take 200ul culture coat containing X--Gal,
IPTG, LB Agar Plating containing ammonia benzyl, 37 DEG C of overnight incubation, select white colony and carry out Zengjing Granule and plasmid PCR
Identify and the order-checking of Song Bao biotech firm.
6, the preservation of probe genome: correct plasmid carries out amplification cultivation by checking order, and with 20% skim milk conduct
Protective agent is lyophilized, as-80 DEG C of preservations.
Prepared by 2.2 chips
(1) design of chip matrix: every chip is divided into four districts, four districts to be four repeat arrays, with hybridization fence
Separate, in order to carry out the hybridization reaction of three different samples simultaneously.Each array parameter is: often row's probe gene and gene location
Being 12 sampling points, various kinds dot center spacing 650um, spot diameter is 220um.
(2) the some system of detection DNA microarray:
Spotting buffer is configured to sampling liquid, will include Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, pig wheel
Shape Viral Probe, gene location and negative Quality Control gene quantification are 200ng/ul to concentration, are heated to 95 DEG C of holdings
5min, is subsequently placed in cooled on ice 10min.
By chip design requirements add in 96 (384) hole load sample plate holes dilute sex change good include Porcine Epidemic Diarrhea
Poison, transmissible gastro-enteritis virus, porcine rotavirus probe, gene location, negative Quality Control gene and blank Quality Control buffer solution,
Seal orifice plate, by gene chip sample applying system (Microarray Printing System, SpotArrayTM 24) at amino
Change contact point sample on substrate.Point sample envionmental humidity is 55%-65%, temperature 15-30 DEG C.
The chip that makes of point stands and is fully dried overnight (at least 6h), then by 60-80 DEG C of hydration-treated 10s, immediately in
It is heated on 80 DEG C of In situPCR instrument drying, after ultraviolet-crosslinkable 30min, washs 5min with 0.2%SDS liquid, faster with distilled water
Speed washing after centrifugal drying, seal, room temperature preservation standby.
The nucleotide sequence of primer and probe is as follows:
SEQ ID NO:1 (PEDV-M)
Source gene source: PEDV separates strain
Gene size and sequence: 421bp
CTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTATTTTGTCAATAGCATTCGGTTGTGGCGCAGGACACATTC
TTGGTGGTCTTTCAATCCTGAAACTGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGGTCTGCATTCCAGTGC
TTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGTTTGTAGAGGGCTATAAGGTTGCTACTGGC
GTACAGGTAAGTCAATTGCCTGATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTATGGACGTGTTGGTCG
TTCAGTCAATGCTTCATCTGGCACTGGTTGGGCTTTCTATGTCCGGTCAAAACACGGCGACTACTCAGCTGTGAGTA
ATCCGAGTGCGGTTCTCACAGATAGCGAGAAAGTGC
SEQ ID NO:2 (PEDV-S)
Source gene source: PEDV separates strain
Gene size and sequence: 474bp
CGCTAGGCTTGAGTCTGTTGAAGTTAACTCTATGCTTACTATTTCTGAAGAGGCTCTACAGTTAGCTACCATCAGTT
CGTTTAATGGTGATGGATATAACTTTACTAATGTGCTGGGTGTTTCCGTGTACGACCCTGCAAGTGGCAGGGTGGTA
CAAAAAGGGTCTTTTATTGAAGACCTGCTTTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGATGAAGACTA
TAAGCGCTGTTCTAATGGTCGCTCTGTGGCAGATCTAGTCTGTGCGCAGTATTACTCTGGTGTCATGGTACTACCTG
GCGTTGTTGACGCTGAGAAGCTTCAAATGTATAGTGCGTCTCTCATCGGTGGTATGGCGCTAGGAGGTCTTACTACT
GCAGCGGCATTGCCTTTTAGCCATGCTGTTCAAGCGAGGCTCAATTATCTTGCTTTACAGACGGATGTTCTACAGCG
GAACCAGCAATT
Seq ID NO 3(TGEV-N)
Source gene source: TGEV separates strain, SC-H strain
Gene size and sequence: 362bp
TTCCTGAAAGGTGGTTCTTCTACTACTTAGGTACTGGACCTCATGCAGATGCCAAATTTAAAGATAAATTAGATGGA
GTTGTCTGGGTTGCCAAGGATGGTGCCATGAACAAACCAACCACGCTTGGTAGTCGTGGTGCTAATAATGAATCCAA
AGCTTTGAAATTCGATGGTAAAGTGCCAGGCGAATTTCAACTTGAAGTTAATCAATCAAGAGACAATTCAAGGTCAC
GCTCTCAATCTAGATCTCGGTCTAGAAATAGATCTCAATCTAGAGGCAGGCAACAATTCAATAACAAGAAGGATGAC
AGTGTAGAACAAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAA
SEQ ID NO:4 (TGEV-S)
Source gene source: TGEV separates strain, SC-H strain
Gene size and sequence: 276bp
AGGCTTGACGAATTGAGTGCTGATGCACAAGTTGACAGGCTGATCACAGGAAGACTTACAGCACTTAATGCATTTGT
GTCTCAGACTCTAACCAGACAAGCGGAGGTTAGGGCTAGTAGACAACTTGCCAAAGACAAGGTTAATGAATGCGTTA
GGTCTCAGTCTCAGAGATTCGGATTCTGTGGTAATGGTACACATTTGTTTTCACTCGCAAATGCAGCACCAAATGGC
ATGATTTTCTTTCACACAGTGCTATTACCAACGGCTTATGAAACT
SEQ ID NO:5 (PoRV-NSP4)
The source gene source of clone gene: PoRV, OSU strain
Gene size and sequence: 270bp
GAACAGGTTACTACTAAGGATGAAATTGAACAACAGATGGACAGAATTGTTAAGGAGATGAGGCGTCAACTGGAAAT
GATTGACAAATTGACAACTCGTGAAATTGAACAAGTTGAATTACTTAAGCGTATACATGACAAATTAGCTGCTAGAC
CAGTTGATGCTATAGATATGTCGAAGGAATTTAATCAGAAAAATATTCGAACGCTAGATGAATGGGAAAGTGGAAAA
AATCCATATGAACCGTCGGAAGTAACTGCGTCTATGTGA
SEQ ID NO:6 (PoRV-VP7)
Source gene source: PoRV, OSU strain
Gene size and sequence: 381bp
TTGAATGAATGGCTATGTAATCCAaTGgATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGAT
ATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGACTCTCGGGATAGGATGTTCGACTACAG
ACATAAATTCATTTGAAACAGTGGCCAATGCAGAGAAATTAGCTATAACTGATGTTGTCGATGGAGTCAATCATAAA
TTAGACGTAACAACGAGTACATGTACTATAAGAAATTGTAAAAAACTTGGACCAAGAGAAAATGTCGCTGTAATTCA
GGTAGGAGGTCCAAACATACTCGACATAACAGCTGATCCAACAACTGCACCACAAACTGAAAGAATGATGCGT
SEQ ID NO:7～8 (PM-primer)
F 5`-CTTATGGCTTGCATCACT-3`
R 5`-GCACTTTCTCGCTATCTG-3`
SEQ ID NO:9～10 (PS-primer)
F 5`-CGCTAGGCTTGAGTCTGTTG-3`
R 5`-AATTGCTGGTTCCGCTGTAG-3`
SEQ ID NO:11～12 (TN-primer)
F 5'-TTCCTGAAAGGTGGTTCTTCTACTA-3'
R 5`–TTTTCTGTGTCAACACCTAACTTT-3`
SEQ ID NO:13～14 (TS-primer)
F 5`-AGGCTTGACGAATTGAGTGCTGATG-3`
R 5`-AGTTTCATAAGCCGTTGGTAATAGC-3`
SEQ ID NO:15～16 (NSP4-primer)
F 5`-GAACAGGTTACTACTAAGGATG-3`
R 5`-TCACATAGACGCAGTTACTTCC-3`
SEQ ID NO:17～18 (VP7-primer)
F 5`-TTGAATGAATGGCTATGTAATCC-3`
R 5`-ACGCATCATTCTTTCAGTTTGT-3`
The sequence (SEQ ID NO:19) of gene location
SEQ ID NO:20～21 (amplimer of gene location complementary series)
F:AAAGCGACGCAATGAGGCACT
R:GTTCCACGACCGCAACTGC
The using method of embodiment 2 kit of the present invention
1, nucleic acid extraction
The extracting of viral RNA: use kit method extracting viral RNA, test uses virus/fluid sample RNA in a small amount
Extraction agent box.By this kit, extracting RNA being described, method is as follows:
A) taking measuring samples 300 μ L to be placed in centrifuge tube, acutely vibrating after adding 500 μ L RV liquid, 2min rear chamber is gentle and quiet puts
5min。
B) add 750 μ L isopropanols, shake up gently.
C) pipetting 800 μ L in adsorption column, at 4 DEG C, 12000rpm is centrifuged 30s.
D) abandoning liquid in collecting pipe, moved in adsorption column by remaining lysate, at 4 DEG C, 12000r is centrifuged 30s.
E) adding 500 μ L RP liquid after abandoning collection liquid, at 4 DEG C, 12000rpm is centrifuged 30s and removes isolating protein.
F) adding 500 μ L W3 liquid, after standing lmin, at 4 DEG C, 12000rpm is centrifuged 15s.
G) step f is repeated.
H) being transferred to by adsorption column in another clean centrifuge tube, add 30 μ L ultra-pure waters in adsorbed film central authorities, room temperature is quiet
Put 2min.
I) 12000rpm is centrifuged 2min, and centrifugate is the RNA extracted, and-70 DEG C save backup.
The reverse transcription of viral RNA: NDV, IBV reverse transcription system 10.0 μ L system:
Reverse transcription reaction program is as follows: 42 DEG C, reverse transcription 30min；85 DEG C, 30s inactivates reverse transcriptase；4 DEG C of holdings.
2, the PCR amplification label of cDNA/DNA
In test, Cy3-dCTP fluorescein uses final concentration of 2.5umol/L, when adding fluorescein and operates later and all exists
Darkroom is carried out.Carrying out amplified reaction program by following program is reaction condition: l) 94 DEG C of sex change 2min；2) 94 DEG C of sex change 30S,
54 DEG C of annealing 30S, 72 DEG C extend 30S, totally 35 circulations；3) 72 DEG C extend 10min, 12 DEG C of holdings.
The multiplexed PCR amplification mark of 3.cDNA
Multiplex PCR mark system:
In test, Cy3-dCTP fluorescein uses final concentration of 2.5umol/L, when adding fluorescein and operates later and all exists
Darkroom is carried out.Carrying out amplified reaction program by following program is reaction condition: l) 94 DEG C of sex change 2min；2) 94 DEG C of sex change 30S,
50 DEG C of annealing 30S, 72 DEG C extend 30S, totally 35 circulations；3) 72 DEG C extend 10min, 12 DEG C of holdings.
4, detection
(1) prehybridization of chip: Example 1 prepares genetic chip, in 95-100 DEG C of distilled water, sex change 1-2min. is therebetween
Extracting is in order to avoid forming bubble in surface of glass slide up and down, puts centrifugal drying after quickly cooling down in 95% ethanol of precooling immediately, by base
Because chip is placed in hybridization cabin, adds prehybridization solution 25 μ L in microarray detection zone, cover glass is put down gently on it, in order to avoid forming gas
Bubble, makes prehybridization solution uniform fold microarray detection zone, and chip is placed in the wet box of sealing prehybridization 1 h at 42 DEG C.
(2) hybridization of chip: absorb prehybridization solution, the nucleic acid samples marked and the multiplex PCR mark of substance PCR will be utilized
The nucleic acid samples of note, after 95 DEG C of sex change 3min, puts in ice cooling 5min immediately, then with the Hybridization Buffer of a certain amount of precooling
Liquid mixes, and takes this mixed liquor 20-40 μ L and is added to microarray detection zone, puts down gently on it with cover glass, and microarray is put into hybridization cabin
Interior lucifuge hybridization in a wet box, hybridizes the 6h time under 48 DEG C of hybridization temperatures.
(3) the dry behaviour of the washing of DNA microarray: hybridizing complete, washing lotion respectively washs 3min, for scanning point after centrifugal drying
Analysis.Washing completes in darkroom.After hybridization, remove the cover glass of microarray detection zone gently, microarray is placed on glass
On horse, wash 3min respectively by the washing lotion 1 of warm, washing lotion 2, washing lotion 3 immediately, rinse with distilled water the most again, centrifugal drying
After sweep reading analyze.
(4) the DNA microarray gene chip scanning instrument of scanning analysis centrifugal drying4000 scanning inspections
Survey.Sweep parameter is Laserpower 95%, PMGT 75%, resolution ratio 20um, and scanning result is with 16 TIFF and BMP forms
Preserve image.
Embodiment 3 specific test
One, test method
Using the kit of embodiment 1, according to the method for embodiment 2, (pig breeds for detection PoRV, TGEV, PEDV, PRRSV
With breath syndrome virus), CSFV (CSFV), JEV (Latex agglutination test), 7 kinds of diseases of PRV (PRV)
Poison, to verify the specific of kit of the present invention.
Two, result
Experimental result is as in figure 2 it is shown, the inventive method can effectively detect PoRV, TGEV, PEDV of the present invention, without examining
Go out other virus, e.g., PRRSV, CSFV, JEV, PRV, show the high specificity of the inventive method, other virus will not be expanded.
Embodiment 4 sensitivity test
One, test method
Extracting tri-kinds of viral RNA of PEDV, TGEV, PoRV carry out reverse transcription, and with the cDNA of reverse transcription as template, carry out
Amplification label makes probe.Amplification afterproduct nucleic acid-protein instrument records the OD260 of target gene, is converted into DNA concentration, and gradient is dilute
Releasing, the concentration after dilution is respectively 3pg/ μ l, 10pg/ μ l, 20pg/ μ l, 50pg/ μ l, 100pg/ μ l, 200pg/ μ l, 500pg/ μ
L, 1000pg/ μ l, 10000pg/ μ l, add the liquid of each gradient the probe mixing of 5ul location, use the reagent of embodiment 1
Box, detects according to the method for embodiment 2.
Two, result
Result is as it is shown on figure 3, various target gene DNA concentration is when 20pg/ μ l, and the median of gene recombination signal is all higher than
1500, and SNR is more than 1.5, it is known that DNA microarray minimal detectable concentration is 20pg/ μ l.
Experimental result illustrates, the minimal detectable concentration of kit of the present invention detection PEDV, TGEV, PoRV is 20pg/ μ l, spirit
Sensitivity is high.
Embodiment 5 uses kit of the present invention to detect pathological material of disease
One, detection method
1) the taking of pathological material of disease: collect 20 parts, cities and counties of 5, Sichuan Province (Deyang, Mianyang, Ziyang, Luzhou pellet woods, Yongchuan) doubtful
Pig epidemic diarrhea, transmissible gastroenteritis of swine, the sample of porcine rotavirus symptom, including small intestine and content thereof
2) pretreatment of pathological material of disease:
1. the process of the dirty tissue of device: the pathological material of disease sterilizing PBS gathered is ground, acts on 30 minutes at 37 DEG C, multigelation 3
Secondary and process with ultrasonic wave, centrifugal, supernatant-20 DEG C preservation.
2, use the kit of embodiment 1, detect according to the method for embodiment 2.
Two, testing result
Result is as shown in table 1:
Table 1 clinical sample testing result
| Positive number | Infection rate/% | |
| PEDV | 20 | 100 |
| PoRV | 13 | 65 |
| TGEV | 16 | 80 |
| PEDV+PoRV | 13 | 65 |
| PEDV+TGEV | 16 | 80 |
| PoRV+TGEV | 12 | 60 |
| PEDV+ARV+TGEV | 12 | 60 |
Using kit of the present invention, detect in 20 parts of samples, have Porcine epidemic diarrhea virus, wherein 13 parts contain pig
Colyliform is sick, and 16 parts contain transmissible gastro-enteritis virus, and are mostly mixed infection.
Experimental result illustrates, kit of the present invention can effectively detect Porcine epidemic diarrhea virus, transmissible gastroenteritis of swine
Virus and porcine rotavirus.
The storage life of embodiment 6 kit of the present invention and repeatability
1, embodiment 1 is prepared the genetic chip in kit by storage life, is positioned in chip cartridges, is dried close with vacuum machine
Envelope, preserves 30 days, 60 days, 90 days, 120 days respectively, verifies according to the method hybridization check of embodiment 2.
Result shows, genetic chip remains able to effectively detect after preserving 120 days.
2, repeatability
As target gene as a example by PEDV M gene, carry out individual chip reuses test.Take a chip hybridization
After, scanning obtains results of hybridization, then this chip sex change is eliminated hybridization spot, then by this chip after sex change with identical
Probe carries out second time and hybridizes, and same scanning obtains results of hybridization, so repeats seven times.
Result as shown in Figure 4, reusable at least seven times of this chip.
Experimental result illustrates, the long shelf-life of kit of the present invention is reproducible.
To sum up, kit of the present invention can effectively detect Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and pig
Rotavirus, high specificity, sensitiveness are high, the shortest, and detection quickly, has a good application prospect.
Claims (10)
1. detect a kit for Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus, its feature
Be: it include Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus gene amplification reagent and
Detection genetic chip；
The reagent of amplification Porcine epidemic diarrhea virus gene includes by SEQ ID NO:7～8 and/or SEQ ID NO:9～10 institute
Show primer pair；The reagent of amplification transmissible gastro-enteritis virus gene includes by SEQ ID NO:11～12 and/or SEQ ID
Primer pair shown in NO:13～14；The reagent of amplification porcine rotavirus gene includes by SEQ ID NO:15～16 and/or SEQ ID
Primer pair shown in NO:17～18；Primer centering, upstream primer is 1:1 with the ratio of downstream primer；
Described genetic chip includes solid phase carrier and the probe being fixed on solid phase carrier；Wherein, probe is by SEQ ID
Any one or two oligonucleotide fragments shown in NO:1 or 2, by any one or two SEQ ID NO:3 or 4 Suo Shi
Oligonucleotide fragment, and by any one or two oligonucleotide fragments SEQ ID NO:5 or 6 Suo Shi.
Kit the most according to claim 1, it is characterised in that: described amplifing reagent also includes fluorochrome label
dNTP。
Kit the most according to claim 2, it is characterised in that: described fluorescent dye be Cy3 fluorescent dye or Cy5 glimmering
Photoinitiator dye.
Kit the most according to claim 1, it is characterised in that: described kit also includes by SEQ ID NO:20～21
Shown primer pair；Described probe also includes positioning probe, and location probe is for by oligonucleotide fragment shown in SEQ ID NO:19.
Kit the most according to claim 1, it is characterised in that: described solid phase carrier is amination substrate.
6. by primer shown in SEQ ID NO:7～8 and/or SEQ ID NO:9～10 to, by SEQ ID NO:11～12 and/or
Primer shown in SEQ ID NO:13～14 to and by primer shown in SEQ ID NO:15～16 and/or SEQ ID NO:17～18
Right, and by any one or two genetic fragments SEQ ID NO:1 or 2 Suo Shi, by any one shown in SEQ ID NO:3 or 4
Individual or two genetic fragments and by any one or two genetic fragments SEQ ID NO:5 or 6 Suo Shi in preparation detection
Purposes in the kit of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and/or porcine rotavirus；
Described primer is 1:1 to the mol ratio for amplifing reagent, upstream primer and downstream primer；Base shown in SEQ ID NO:1～6
Because fragment is detection probe.
Purposes the most according to claim 6, it is characterised in that: described amplifing reagent also includes fluorochrome label
dNTP。
Purposes the most according to claim 7, it is characterised in that: described fluorescent dye is Cy3 fluorescent dye or Cy5 fluorescence
Dyestuff.
Purposes the most according to claim 6, it is characterised in that: described kit also includes by SEQ ID NO:20～21 institute
Show primer to and by the location probe shown in SEQ ID NO:19.
10. according to the purposes described in claim 6 or 9, it is characterised in that: described probe is fixed on amination substrate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410513343.8A CN104232801B (en) | 2014-09-29 | 2014-09-29 | Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410513343.8A CN104232801B (en) | 2014-09-29 | 2014-09-29 | Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104232801A CN104232801A (en) | 2014-12-24 |
| CN104232801B true CN104232801B (en) | 2016-08-24 |
Family
ID=52221691
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410513343.8A Active CN104232801B (en) | 2014-09-29 | 2014-09-29 | Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232801B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611466B (en) * | 2015-02-04 | 2018-02-23 | 四川农业大学 | A kind of molecular agents box of three kinds of piglet virus diarrheas of quick discriminating and application |
| CN105154589B (en) * | 2015-09-18 | 2018-07-06 | 广东省实验动物监测所 | A kind of multi-fluorescence immunoassay method of quick differentiation PEDV, TGEV, PoRV |
| CN105671207B (en) * | 2016-03-28 | 2020-01-07 | 上海市农业科学院 | Liquid-phase chip detection method for four pathogens of porcine viral diarrhea |
| CN108531649B (en) * | 2018-04-11 | 2022-03-22 | 四川农业大学 | Enzymatic visual oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof |
| CN109652596A (en) * | 2019-01-30 | 2019-04-19 | 珠海出入境检验检疫局检验检疫技术中心 | Triple real-time RT-PCR primer sets, kit and the method for PEDV, TGEV and PoRV |
| CN113801951A (en) * | 2021-11-02 | 2021-12-17 | 中国动物卫生与流行病学中心 | Primer probe set and kit for simultaneously detecting multiple pig-death pathogenic microorganisms and application of primer probe set and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1616682A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig virus disease and its use |
-
2014
- 2014-09-29 CN CN201410513343.8A patent/CN104232801B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1616682A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig virus disease and its use |
Non-Patent Citations (1)
| Title |
|---|
| TGEV-PEDV-PRV基因芯片探针的构建;邓俊花等;《中国畜牧兽医学会畜牧兽医生物技术分会暨中国免疫学会第七次研讨会论文集》;20080701;383-386 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104232801A (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104232801B (en) | Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus | |
| CN104293977B (en) | The genetic chip of detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus and kit | |
| CN106399590A (en) | General nucleic acid isothermal detection reagent of respiratory tract infection associated adenoviruses | |
| CN104946795B (en) | Primer, probe and kit for Site Detection various serotype foot and mouth disease virus | |
| CN108060269A (en) | DPO primer sets and its application for the detection of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| CN109609695A (en) | Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus | |
| CN106435033A (en) | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit | |
| CN105400910B (en) | Pig Delta coronavirus and transmissible gastro-enteritis virus multiple RT-PCR detection primer and detection method | |
| CN109097495A (en) | Senecan virus and foot and mouth disease virus dual real-time fluorescence quantitative PCR detection kit | |
| CN104388594B (en) | A kind of Taqman Real-time PCR kit for detecting PRV (Pseudorabies virus) | |
| CN104293976B (en) | Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus | |
| CN108330211A (en) | A group rotavirus/astrovirus/intestinal adenovirus nucleic acid multiple fluorescence PCR detection reagent box and application thereof | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN108315481A (en) | A kind of diagnostic method and dedicated kit detecting Porcine epidemic diarrhea virus using direct expansion method | |
| CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
| CN110438264A (en) | Utilize the method for double real-time fluorescence quantitative RT-PCR detection Porcine epidemic diarrhea virus and Type B pig enterovirus | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN110305986A (en) | SVA, the triple real-time fluorescence quantitative PCR detection primers of one-step method of O-shaped FMDV and A type FMDV and probe | |
| CN108913815A (en) | A kind of primer sets and dual RT-PCR method detecting ox norovirus and bovine coronavirus | |
| CN108913770A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
| CN110257560B (en) | Reagent for bluetongue virus type 8 detection, detection method and application | |
| CN105018643A (en) | Visual gene chip and kit used for detecting porcine epidemic encephalitis b viruses and/or hog cholera viruses | |
| CN106636394A (en) | Isothermal amplication detection kit for nucleic acid of aeromonas and detection method of isothermal amplication detection kit | |
| CN105861750A (en) | Gene chip and kit for detecting human papilloma virus types in high-throughput manner |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |