KR101809710B1 - Primers for Detecting Avian Influenza Virus Neuramidase Subtype and Uses Thereof - Google Patents

Abstract

More particularly, the present invention relates to a primer set for detecting Avian Influenza Virus, a composition for detecting avian influenza virus, avian influenza virus (hereinafter referred to as " avian influenza virus "), A detection kit and a method for detecting avian influenza virus. According to the present invention, not only the avian influenza virus A type itself but also the infection of each subtype of the virus can be simultaneously and easily determined with excellent sensitivity even by a single RT-PCR, It is possible to prevent cross contamination by reaction products and solve the problem of false positive / false negative signal generation.

Description

[0001] Primers for Detection of Avian Influenza Virus Neuramidase [

The present invention relates to a primer for detection of avian influenza virus neuramidase and its use.

Avian influenza is an acute viral infectious disease that affects chickens and turkeys, infecting many kinds of birds such as chickens, turkeys, and wild birds. (H5N1) occurred two times in Korea (from December 2003 to March 2004, November 2006 to March 2007), and the low-pathogenic avian influenza (H9N2) There is a situation in the top.

These influenza viruses are classified into A, B, and C types due to the antigenicity of NP (nuleocapsid) and M (matrix) proteins, which are major causative agents of viral respiratory diseases. Among them, type A is classified from H1 type to H16 type according to the hemagglutinin protein antigen characteristics and from N1 type to N9 type depending on the neuramidase protein antigen characteristics (References : Wiely DC and Skehel T T, Ann Rev Biochem, 56: 365-394, 1987). Each virus subtype has different pathological characteristics and has been developed to focus on H5 and H7 highly pathogenic avian influenza viruses, which cause severe disease in poultry, and real-time PCR (ELISA).

However, in addition to this avian influenza virus, rapid diagnosis of N antigen (N1-N9) is also necessary. Spanish Flu (1918-1920), Asian Flu (1957-1957) and Hong kong Flu (1968-1969), which have historically caused three global pandemics, were caused by influenza A viruses of the H1N1, H2N2 and H3N2 subtypes. In addition, the recent H1N1 pandemic influenza virus in 2009 was also a new strain of influenza A virus that appeared in humans, pigs and avian influenza virus through recombinant processes. In addition, various human avian influenza infections have been reported in Hong Kong (1999, 2003, H9N2), Taiwan (June 2013, H6N1) and China (February 2014, H10N8) No one can predict whether avian influenza will cause human infection.

Due to multiple mutations and evolution, influenza virus develops different subtypes at every epidemic. Rapid detection and detection of aggressive forms of influenza viruses in both humans and birds to monitor and minimize the spread of pandemic, which is likely to be caused by such viruses, as there is global fears that one mutation type can be particularly aggressive. There is an urgent need to isolate.

In order to diagnose such influenza virus, isolation of virus, detection of protein antigen or gene, and serological test are used. The most common method is virus isolation followed by identification using indirect immunofluorescence or hemagglutination inhibition test. Recently, reverse transcription-polymerase (PCR), which detects influenza virus-specific genes, chain reaction, RT-PCR) are widely used for molecular biologic diagnosis. Various RT-PCR methods using primers specific for NP, M, and HA genes can be performed to identify influenza virus types and subtypes using gene detection (Fouchier RAM, J. Clin. Microbiol., 38 (11): 4096-4101). Recently, several gene-based (multiplex) RT-PCR diagnostic methods using primers designed to specifically detect multiple subtypes of genes have been reported by some researchers (see, eg, Stockton J et al., J J. Clin. Microbiol., 33 (5): 180 < RTI ID = 0.0 > Zambon et al., Options for the Control of Influenza III, Elsevier, Amsterdam pp. 607-614, 1996). This multi-gene RT-PCR is a PCR method capable of realizing simultaneous amplification of several target genes in one tube, and is a well-known method in the art to perform gene amplification by adding a plurality of primers to one tube. However, the multiple gene RT-PCR method used for simultaneous differential detection of avian influenza virus has the following serious drawbacks. One of them is that the sensitivity and specificity of detection are greatly reduced when using primers designed based on conserved sequences common to the avian influenza virus type gene. This is because of the very short interval in which avian influenza virus infects several hosts and maintains a conserved sequence due to the rearrangement of the gene (BMC Evol Biol 14: 16, 2014; J Virol 86 (3): 1750 -1757, 2012). The other is that the use of multiple primers results in mutual interference and competition between the primers, resulting in a decrease in the sensitivity and specificity of the detection as well as a false negative result. In the case of clinically important avian influenza viruses, it is necessary to perform cross-validation by amplification of two different specific regions of the N. laminase gene that determine each N-type for more accurate differential detection. There is generally a problem due to mutual interference and competition among the above primers. That is, four primers operate on one segment, which causes this problem.

Therefore, considering the fact that the result of detection of avian influenza virus is accompanied by subsequent work such as mass disposal, this should not be overlooked, and a new technical method is needed to solve this problem.

Therefore, the present inventor has tried to develop a method for rapidly and accurately detecting and simultaneously diagnosing various avian influenza virus subtypes. As a result, a primer set capable of detecting 9 subtypes of avian influenza virus (N antigen, N1-N9) was prepared, and a multi-tube type . The present inventors completed the present invention by confirming that the subtypes can be diagnosed simultaneously with a single experiment without any problem of false negativity with excellent sensitivity.

Accordingly, an object of the present invention is to provide a primer set for detecting Avian Influenza Virus.

Another object of the present invention is to provide a composition for detecting avian influenza virus.

It is still another object of the present invention to provide a kit for detecting avian influenza virus.

It is still another object of the present invention to provide a method for detecting avian influenza virus.

Hereinafter, the present invention will be described in more detail.

According to one aspect of the present invention, there is provided a primer set comprising a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 3 and a primer represented by the nucleotide sequence of SEQ ID NO: 4; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence represented by SEQ ID NO: 6; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 7 and a primer represented by the nucleotide sequence of SEQ ID NO: 8; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 9 and a primer represented by the nucleotide sequence of SEQ ID NO: 10; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 11 and a primer represented by the nucleotide sequence of SEQ ID NO: 12; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 13 and a primer represented by the nucleotide sequence of SEQ ID NO: 14; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 15 and a primer represented by the nucleotide sequence of SEQ ID NO: 16; And a primer set consisting of a primer represented by the nucleotide sequence shown in SEQ ID NO: 17 and a primer represented by the nucleotide sequence shown in SEQ ID NO: 18, and a set of at least one primer selected from the group consisting of primers represented by SEQ ID NOs: Lt; / RTI >

The inventors of the present invention have found that when multitube RT-PCR is performed by dividing subtypes of regions having high mutation among influenza virus glycoprotein genes, mutual interference between primers, It is possible to simultaneously diagnose and distinguish several influenza virus subtypes from the same specimen without false negativity and to be able to diagnose the infection of a specific influenza virus more definitively. Therefore, the nucleotide sequence of the NA gene for the influenza isolates of domestic and foreign influenza , And a corresponding primer was prepared from the nucleotide sequence thereof.

According to a preferred embodiment of the present invention, the primer set includes a primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 3 and a primer represented by the nucleotide sequence of SEQ ID NO: 4; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence represented by SEQ ID NO: 6; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 7 and a primer represented by the nucleotide sequence of SEQ ID NO: 8; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 9 and a primer represented by the nucleotide sequence of SEQ ID NO: 10; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 11 and a primer represented by the nucleotide sequence of SEQ ID NO: 12; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 13 and a primer represented by the nucleotide sequence of SEQ ID NO: 14; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 15 and a primer represented by the nucleotide sequence of SEQ ID NO: 16; And a primer set represented by the nucleotide sequence of SEQ ID NO: 17 and a primer represented by the nucleotide sequence of SEQ ID NO: 18.

According to a preferred embodiment of the present invention, the avian influenza virus is avian avian influenza virus.

According to a preferred embodiment of the present invention, the A type avian influenza virus is selected from the group consisting of NA1, NA2, NA3, NA4, NA5, NA6, NA7, NA8 and NA 9 < / RTI >

As used herein, the term "Influenza Virus A" means a virus having 16 HA (Hemagglutinin, H) subtypes and 9 NA (Neureminidase, N) subtypes among influenza viruses. For the purpose of the present invention, the viral subtype can be used as an object that can be detected through the primer set provided in the present invention, but is not particularly limited thereto.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group and capable of forming a base pair with a complementary template, Refers to a short nucleic acid sequence that functions as a starting point. The primers can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules, chemical groups (e.g., biotin), etc. .

As used herein, the term "primer set " means a set consisting of a forward primer and a reverse primer used for amplifying a desired gene through a polymerase chain reaction, and is compatible with the term" primer pair ".

For the purpose of the present invention, the primers of the present invention can be used for the detection of influenza A virus subtypes. Among the primer sets, the NA1 type primer set is preferably avian influenza virus A type neuramidase ) Primer capable of amplifying the gene (NCBI accession number: KT587288.1), more preferably a forward primer (N1-N1) from the 5'end of the NA gene at positions 1195 to 1214, F) and the reverse primer (N1-R) from position 1303 to 1318 in the same gene, and most preferably, a primer represented by the nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence shown in SEQ ID NO: 2 Primer.

In addition, the NA2 type detecting primer set may preferably be composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: KT699051.1) More preferably, it can be composed of a forward primer (N2-F) from the 5'-end to the 548th position of the NA gene and a reverse primer (N2-R) from the 871st to 887th position in the same gene, Most preferably a primer represented by the nucleotide sequence of SEQ ID NO: 3 and a primer represented by the nucleotide sequence of SEQ ID NO: 4.

Further, the NA3 type detecting primer set can be preferably composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: KR077942.1) (N3-F) from 1121 to 1139 from the 5 'end of the NA gene and a reverse primer (N3-R) from 1331 to 1356 in the same gene, Most preferably a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a primer represented by the nucleotide sequence of SEQ ID NO: 6.

The NA4 type detecting primer set can be composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: CY190333.1) More preferably, it can be composed of a forward primer (N4-F) from the 5'end of the NA gene to 913th to 932th and a reverse primer (N4-R) from the 1348th to 1367th of the same gene, Most preferably, a primer represented by the nucleotide sequence of SEQ ID NO: 7 and a primer represented by the nucleotide sequence of SEQ ID NO: 8.

In addition, the NA5 type detection primer set may preferably be composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: KP288024.1) More preferably, it can be composed of a forward primer (N5-F) from the 5'end of the NA gene to the 701th to 716th and a reverse primer (N5-R) from the 873rd to the 892nd of the same gene, Most preferably a primer represented by the nucleotide sequence of SEQ ID NO: 9 and a primer represented by the nucleotide sequence of SEQ ID NO: 10.

In addition, the NA6 type detecting primer set can preferably be composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: KT589275.1) (N6-F) from the 5 'end of the NA gene to the 37th to 53rd reverse primers (N6-F) and the 280th to 296th reverse primers (N6-R) from the same gene, Most preferably, a primer represented by the nucleotide sequence of SEQ ID NO: 11 and a primer represented by the nucleotide sequence of SEQ ID NO: 12.

In addition, the NA7 type detection primer set can be preferably composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: CY189973.1) (N7-F) from the 5'end of the NA gene to 1199th to 1218th and a reverse primer (N7-R) from the 1361th to 1378th in the same gene. Most preferably a primer represented by the nucleotide sequence of SEQ ID NO: 13 and a primer represented by the nucleotide sequence of SEQ ID NO: 14.

In addition, the NA8 type primer set can be composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: KP861997.1) More preferably, it can be composed of a forward primer (N8-F) from the 5'end of the NA gene to 1198th to 1222th and a reverse primer (N8-R) from the 1321rd to 1339th in the same gene, Most preferably a primer represented by the nucleotide sequence of SEQ ID NO: 15 and a primer represented by the nucleotide sequence of SEQ ID NO: 16.

In addition, the NA9 type detection primer set can preferably be composed of forward and reverse primers capable of amplifying the avian influenza virus type A neuramidase gene (NCBI accession number: KP412426.1) More preferably, it can be composed of a forward primer (N9-F) from the 5'end of the NA gene to 1214th to 1234th and a reverse primer (N9-R) from the 1360th to 1379th in the same gene, Most preferably a primer represented by the nucleotide sequence shown in SEQ ID NO: 17 and a primer represented by the nucleotide sequence shown in SEQ ID NO: 18.

In this specification, ambiguity codes are used in representing the sequence of primers. Thus, in the primer sequence, A represents adenine, G represents guanine, C represents cytosine, T represents thymine, R represents a possible site for both a guanine and an adenine, Y represents a possible site for both cytosine and thymine, and N represents inosine (I, inosine). This applies equally to presenting all the sequences in this specification.

The primer set of the present invention can be used not only for the detection of the avian influenza A virus itself but also for the detection of avian influenza virus subtypes of avian influenza virus NA 1 type, NA 2 type, NA 3 type, NA 4 type, NA 5 type, NA 6 type, NA 7 type, NA 8 type, and NA 9 type influenza virus subtype can be simultaneously and simultaneously detected.

For example, the virulence of influenza virus is associated with the neuramidase protein, which has a specific gene sequence related to pathogenicity. For this reason, the sequence of the gene corresponding to the nailramidease protein segment can be investigated, and it can be confirmed based on this that the highly pathogenic avian influenza virus is infected. In other words, the amplification product of avian influenza virus N1 type (amplification product using the specific primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2) in the influenza virus A type detection and its simultaneous discrimination detection kit of the present invention, And an amplification product for the avian influenza virus N2 type (amplification product using the specific primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4) are the amplification products of the genes corresponding to the neuramidase protein segment Investigations of these gene sequences can confirm whether the avian influenza virus is highly pathogenic.

In the specific primers of the present invention, some of the constitutive base sequences may be changed. Such modifications may be accomplished by partial deletion, addition, substitution, or a combination thereof, of the constitutive nucleotide sequence, but some modifications of such constitutive nucleotide sequences are specific for the template (cDNA or PCR amplification products) of the specific primers It requires considerable care in application because it can damage the bond. On the other hand, in the case of avian influenza virus, since mutation through gene rearrangement is very active through several hosts, it is necessary to periodically search for the latest avian influenza virus gene sequence and reflect it in specific primers, A partial modification of the constitutive base sequence of the siRNA specific primers is inevitable. At this time, it must be experimentally investigated and changed to the extent that the specificity is not impaired. Since these are general matters to those skilled in the art, a detailed description thereof will be omitted. It is most preferred to maintain the sequences of the primers presented in the present invention.

According to a preferred embodiment of the present invention, the primer set of the present invention is a set of primers for performing RT-PCR, most preferably for performing multitube RT-PCR .

In RT-PCR of existing multiple genes (single-tube multiplex), multiple amplification products are mixed, resulting in mutual interference between primers, decreased sensitivity due to competition, and false signals. Further, in order to perform these gene sequence analysis, it is necessary to separate and purify the amplification product, and a complicated process must be performed for this purpose.

However, since the primer set for the detection of influenza virus type A of the present invention and its subtype discrimination detection is applied by a multitube method in which specific primer sets for each subtype are divided and accommodated by tubes, It is possible to solve the problem of sensitivity and specificity degradation or false negative result caused by mutual interference and competition between primers of a plurality of primers in gene RT-PCR.

According to another aspect of the present invention, there is provided a composition for detecting avian influenza virus including the above-described primer set, and a kit for detecting avian influenza virus comprising the composition.

The kit for the detection of avian influenza virus of the present invention is a kit for detecting the avian influenza virus A type and its subtype simultaneous discrimination detection kit. In addition to the above-mentioned specific primer set, sensitivity of the multi-gene RT- PCR for detection of avian influenza virus And the multi-tube method is applied so as to avoid the occurrence of false negatives.

That is, the kit of the present invention is applied to a single kit such that the user can use the single kit to detect the influenza virus itself through a single reaction and to detect the influenza virus subtypes NA1 to NA9 Simultaneous discrimination detection of the type can be performed.

The multi-tube system according to the present invention refers to one strip form composed of eight tubes divided into specific primer pairs.

For example, according to the present invention, specific primers may be separately contained in each of the tubes, but the present invention is not limited thereto. Preferably, a specific primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2 is contained in Tube 1, a specific primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, and a specific primer pair consisting of SEQ ID NO: 17 and SEQ ID NO: 18 No. 5 and SEQ ID No. 6 is accommodated in tube 3, a specific primer pair composed of SEQ ID No. 7 and SEQ ID No. 8 is accommodated in tube 4, and a specific primer pair composed of SEQ ID No. 9 and SEQ ID No. 10 is accommodated in tube 5 No. 11 and SEQ ID NO: 12 is accommodated in tube 6, a specific primer pair consisting of SEQ ID NO: 13 and SEQ ID NO: 14 is accommodated in tube 7, and SEQ ID NO: 15 and SEQ ID NO: A specific primer pair consisting of SEQ ID NO: 16 is accommodated.

As described above, the specific primer pairs are divided into tubes. Thus, mutual interference between primers of a plurality of primers in RT-PCR for detection of existing avian influenza viruses, sensitivity and specificity of the primers due to competition, The problem is solved.

Since the amplification products are recovered in the presence of only a single species of amplification products, the amplification products can be obtained through a relatively simple process. As a result, the genotype of the amplification products can be easily determined, and avian influenza A Subtype analysis and discrimination can be performed.

The detection composition and the detection kit of the present invention may further comprise one or more other component compositions, solutions or devices suitable for the assay method.

Preferably, the composition for detection and the detection kit may include necessary elements for performing the reverse transcription reaction and RT-PCR.

The detection kit and the detection composition of the present invention may further comprise a pair of primers specific for the detection gene, a reverse transcriptase for synthesizing complementary cDNA from RNA which is a gene of influenza virus A, a DNA polymerase for amplifying complementary DNA Enzymes such as enzymes, tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentrations), deoxynucleotides (dNTPs), Hot start Taq polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- water, sterile water, and the like.

The components included in each tube in the present invention include, but are not limited to, reverse transcriptase, DNA polymerase, Tris-HCl, MgCl2, KCl, dATP, dTTP, dGTP, dCTP, RNase inhibitor, DTT and 8-MOP . These should be included in the appropriate concentration range, including 0.1-10 units of reverse transcriptase, 1-10 units of DNA polymerase, 10-300 mM Tris-HCl, 1-50 mM MgCl2, 1-100 mM KCl, 1 -5 mM dATP, 1-5 mM dTTP, 1-5 mM dGTP, 1-5 mM dCTP, 1-10 units of RNase inhibitor, 0.001-0.1 M DTT, 0.5-5 μg of 8-MOP .

On the other hand, the components added to each tube may be prepared in a liquid form or in a dried form in order to improve the stability of the product by lowering the degree of freedom of contained components. In order to produce such a dried form, it is necessary to apply a drying step, and it can be used in the form of warm drying, natural drying, vacuum drying, freeze drying, or a combination thereof.

Since the compositions and kits of the present invention utilize the present primer sets described above, their description is omitted in order to avoid the excessive complexity of the present specification in accordance with the repeating substrate.

According to another aspect of the present invention, the present invention provides a method for detecting Avian Influenza Virus comprising the steps of:

(a) separating RNA from a specimen;

(b) performing reverse transcription-polymerase chain reaction (RT-PCR) using the separated RNA as a template and using the primer set for detecting avian influenza virus to amplify the target sequence; And

(c) detecting the amplification product.

According to a preferred embodiment of the present invention, the specimen can be selected from the group consisting of algae, livestock and humans.

According to a preferred embodiment of the present invention, the detection of the amplification product can be performed by DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

According to a preferred embodiment of the present invention, the RT-PCR can be performed by a multitube method.

According to the present invention, after extracting RNA from a specimen according to a method known in the art, a primer set of the present invention, a composition containing the primer set of the present invention, or a primer set of the present invention is added to an extract containing the extracted RNA Perform multi-tube RT-PCR using the included kit. Agarose gel electrophoresis analysis was performed on the obtained product (reaction solution) after performing multi-tube RT-PCR to detect the avian influenza virus A type and its subtypes based on whether or not the amplification product was generated and its size Simultaneous detection is performed.

For example, when the 134 bp amplification product is observed in the first tube, it means that the avian influenza virus A type exists in the sample. In addition, since an amplification product due to a gene commonly present in the avian influenza virus NA1 type was confirmed, it means that the avian influenza virus A type exists in the sample as an NA1 type subtype.

In this way, the results of the eight tubes can be examined comprehensively to determine the presence or absence of avian influenza virus A in the sample, as well as the subtypes of avian influenza virus A type.

In the present invention, a novel primer set that specifically binds to a subtype of the gene of avian influenza virus NA (Neuramidase, N) was designed and confirmed that the primer set selectively binds to the avian influenza virus subtype, Were used for the detection of avian influenza virus subtypes. Further, since the present invention has a remarkable effect of the simultaneous diagnostic kit applied to the multi-tube detection method of the present invention compared to the existing multiple gene detection method, it can be usefully used for the simultaneous diagnosis of avian influenza A type detection and its subtypes.

Since the compositions and kits of the present invention utilize the present primer sets described above, their description is omitted in order to avoid the excessive complexity of the present specification in accordance with the repeating substrate.

According to the present invention, not only the influenza virus A type itself but also the infection of each subtype of the virus can be easily and easily determined with a single RT-PCR, and simultaneously the sensitivity and specificity can be determined simultaneously. Thereby preventing cross contamination due to the reaction products, thereby solving the problem of false positive / false negative signal generation.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing gene regions for avian influenza virus type NA amplified by a specific primer according to the present invention. FIG.
Fig. 2 is a diagram schematically showing the configuration of a NA (Neuramidase) type simultaneous discrimination detection kit of avian influenza virus type A (NA1 to NA9).
Figure 3 shows the size of fragment bands as a result of RT-PCR using only the respective primers for the avian influenza virus NA type of Figure 2.
Figure 4 shows the results of the sensitivity comparisons in the multi-tube (Figure 4a) and the existing multiplex (Figure 4b) of the present invention.
Fig. 5 shows the results of specificity with other sample samples in the multi-tubes of the present invention.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention as defined by the appended claims. It will be obvious to you.

Example  1. Influenza virus type A ( NA1  To NA9 ) For the NA area primer  Production of sets

The present inventors produced specific primers suitable for the purpose of RT-PCR for the detection of avian influenza virus type A and simultaneous discrimination of its subtypes NA1 to NA9, as shown in Table 1 below.

First, a gene-specific region capable of discriminating NA (Neuramidase, N) gene is selected using the gene information obtained from GenBank, and based on this, NA gene (NA1 type to NA9 type) extracted from avian influenza virus can be amplified Primer was designed.

The NA1 type detection primer set was prepared by using a forward primer (N1-F) from the 5'-end of the avian influenza virus type A Neuramidase gene (NCBI accession number: KT587288.1) And a reverse primer (N1-R) from position 1303 to position 1318 in the same gene.

The NA2 type detection primer set was composed of 5'-548th forward primer (N2-F) from the 5 'end of avian influenza virus type A Neuramidase gene (NCBI accession number: KT699051.1) And reverse primer (N2-R) from 871 to 887 in the same gene.

The NA3 type detection primer set includes a forward primer (N3-F) at positions 1121 to 1139 from the 5 'end of the avian influenza virus type A Neuramidase gene (NCBI accession number: KR077942.1) (N3-R) from the 1331 th to 1356 th genes in the same gene.

The NA4 type detection primer set was composed of a forward primer (N4-F) from the 5'-end of the avian influenza virus type A neuramidase gene (NCBI accession number: CY190333.1) The reverse primer (N4-R) from the 1348th to 1367th was included in the same gene.

The NA5 type detection primer set includes a forward primer (N5-F) from the 5'end of the avian influenza virus type A neuramidase gene (NCBI accession number: KP288024.1) to the 701st to 716th And reverse primer (N5-R) from the 873th to 892nd positions in the same gene.

The NA6 type detection primer set was composed of a forward primer (N6-F) at positions 37 to 53 from the 5 'end of avian influenza virus type A Neuramidase gene (NCBI accession number: KT589275.1) The reverse primer (N6-R) from the 280th to the 296th was included in the same gene.

The primer set for detection of NA7 type was prepared from the 5'end of the avian influenza virus type A neuramidase gene (NCBI accession number: CY189973.1) to the 1199th to 1218th forward primer (N7-F) (N7-R) from the 1361th to 1378th in the same gene.

The NA8 type detection primer set was prepared by using a forward primer (N8-F) at positions 1198 to 1222 from the 5 'end of the avian influenza virus type A neuramidase gene (NCBI accession number: KP861997.1) The reverse primer (N8-R) from the 1321st to 1339th was included in the same gene.

The NA9 type detection primer set includes a forward primer (N9-F) from the 5'end of the avian influenza virus type A neuramidase gene (NCBI accession number: KP412426.1) to the 1214th to 1234th (N9-R) from the 1360th to 1379th in the same gene.

The Tm values of the above primers were all 54 ° C, so that they were simultaneously amplified.

Target SEQ ID NO: name Base sequence NA1 One NA1-F AGGYCTAGRCCTTGYTTCTGGGTTGA 2 NA1-R ACGCGTCTGGCCAAGACCA NA2 3 NA2-F CATGCATGGTCCAGYTCAAGYTG 4 NA2-R GGAATTCCAGTTGTCTCTGCA NA3 5 NA3-F AAGCGCTTTGAARTCATCAAAGT 6 NA3-R AGACGTCTARTCCACAGAAAGTAACTATAC NA4 7 NA4-F TCCATGGATAAGATTCAACAGTGA 8 NA4-R TGATACGTATCAGAATTAACACCACA NA5 9 NA5-F AACGTTATTGGGTAATGACRGAYGGTC 10 NA5-R GACGTCTATTCATTCCATTCCAA NA6 11 NA6-F TTCCTGTACAGGAATGACACTATC 12 NA6-R GCACATATGTGCCATGARTTTAC NA7 13 NA7-F TGTCGACAAYAACAATTGGTCAGG 14 NA7-R GGCCCAACTGRGANTGGGCT NA8 15 NA8-F CCTGATCAGGATAYAGYGGTTCYTTCAC 16 NA8-R GTGCACACATCACAATGGAGCT NA9 17 NA9-F GTGTTAACACNGACTGGAGTGGYTAC 18 NA9-R TCCGGAATTCTGTRCTGGAACAC

R represents a possible site for both a guanamine and an adenine.

Y represents a possible site for both cytosine and thymine.

N represents inosine (I, Inosine).

Example  2. Sample preparation

The sample virus was mainly used for the avian influenza virus standard stocks and the domestic isolates from the National Institute of Environmental Research. RNA extraction for preparation of RNA samples to be used as a template is carried out using 150 μl of the virus strain or the specimen (emulsion solution) according to the product manual using the Patho Gene-spin ™ DNA / RNA Extraction Kit (Intron Biotechnology Co., Ltd.) Respectively. The prepared RNA samples were used as a template for RT-PCR reaction.

Example  3. Avian influenza virus detection and its subtype NA1  To NA9 Simultaneous discrimination detection of mold Of kit  making

Using the specific primer set of the present invention prepared in Example 1, a kit for detection of avian influenza virus type A and simultaneous discrimination detection of its subtype NA1 to NA9 was prepared.

More specifically, all the components necessary for RT-PCR (3 units of reverse transcriptase, 5 units of DNA polymerase (hereinafter referred to as " DNA polymerase ") were added to each tube constituting a strip of the avian influenza virus A type detection and its subtype NA1 to NA9 type simultaneous discrimination detection kit. 50 mM Tris-HCl, 25 mM MgCl ₂ , 10 mM KCl, 2.5 mM dATP, 2.5 mM dTTP, 2.5 mM dGTP, 2.5 mM dCTP, 5 units RNase inhibitor, 0.01 M DTT , 1 [mu] g of 8-MOP), followed by addition of 10 pmoles of forward and reverse primers of SEQ ID NOS: 1 and 2, respectively, to NA1-type virus in tube 1; Tube 2 was supplemented with forward and reverse primers of SEQ ID NOS: 3 and 4 for the NA2 type virus and 10 pmoles of the forward and reverse primers of SEQ ID NOs: 17 and 18 for the NA9 type virus, respectively; Tube 3 was supplemented with 10 pmole each of the forward and reverse primers of SEQ ID NOS: 5 and 6 for the NA3 virus; Tube 4 was loaded with 10 pmole each of the forward and reverse primers of SEQ ID NOS: 7 and 8 for the NA4 virus; Tube 5 was loaded with 10 pmole each of forward and reverse primers of SEQ ID NOs: 9 and 10 for the NA5 virus; Tube 6 was loaded with 10 pmole each of the forward and reverse primers of SEQ ID NOs: 11 and 12 for the NA6 virus; Tube 7 was loaded with 10 pmole each of forward and reverse primers of SEQ ID NOS: 13 and 14 for NA7 virus; Tube 8 was loaded with 10 pmoles of forward and reverse primers of SEQ ID NOs: 15 and 16, respectively, against NA8 virus. At this time, the PCR tube was one strip composed of eight tubes, so that tube 2 contained a primer set for NA type 2 virus and a primer set for NA type 9 virus. And then lyophilized to form a dry formulation.

Example  4. Simultaneous identification of A type of avian influenza virus detection and its subtypes

4-1. The multi-tube ( multitube ) RT- PCR

In order to solve the problem of false positives / false signals generated in a multiplex (multiple gene, single tube) type, the present inventors have developed a multiplex tube (hereinafter, referred to as " primer set " RT-PCR was performed using a multitube kit.

2-3 μl of each RNA extracted in Example 2 and 17-18 μl of water for molecular biological experiments were added to each tube prepared in Example 3, and the final volume was adjusted to 20 μl, followed by RT-PCR . The reverse transcription reaction was carried out at 50 ° C for 30 minutes and denatured at 94 ° C for 5 minutes. Subsequently, the amplification reaction at 94 ° C for 15 seconds, 60 ° C for 30 seconds, and 72 ° C for 60 seconds was repeated four times, followed by amplification reaction at 94 ° C for 15 seconds, 54 ° C for 15 seconds, and 72 ° C for 60 seconds. PCR was carried out in such a manner that PCR was repeated. After completion of the PCR reaction, the PCR reaction solution was maintained at 72 ° C for 5 minutes to complete the PCR. Distilled water was used as a negative control for all reactions.

7 μl of RT-PCR reaction was electrophoresed (1.5% agarose gel w / RedSafe ™ Nucleic Acid Staining Solution (20,000x) or EtBr. 110V, 40 minutes) and observed under UV lamp.

To prevent cross-contamination, amplification products of the remaining amount after reaction and analysis were irradiated with ultraviolet rays for 20 to 30 minutes in a tube state on a bench to be irradiated with ultraviolet rays. This can prevent cross-contamination since 8-MOP is activated and the amplification product can not act as a template.

As a result, as shown in Fig. 3 and Table 2, each of the primers specific to NA (Neuramidase) of avian influenza virus type A prepared in the present invention amplified the products specific to the NA gene of each subtype virus No nonspecific reaction between each subtype was observed. Table 2 specifies the specific sizes of the amplification products.

Therefore, it can be seen that the primer set of the present invention shows a significant specificity for each subtype of avian influenza virus A type.

That is, the avian influenza virus A type detection and each simultaneous discrimination detection kit of the present invention were effective for simultaneous detection and detection of avian influenza virus type A and its subtypes NA1 to NA9.

Target Size (bp) NA-1 126 bp NA-2 / NA-9 362 bp / 166 bp NA-3 247 bp NA-4 456 bp NA-5 193 bp NA-6 265 bp NA-7 183 bp NA-8 145 bp

4-2. Conventional single-tube multiplex RT- PCR

As shown in Example 4-1, when the multitube RT-PCR of the present invention was performed, it was confirmed that each primer set and conditions of the present invention specifically acted on each subtype, Single-tube multiplex RT-PCR was performed under the same conditions as described above in order to compare with the conventional multiplex type in which the primers were simultaneously mixed in one test tube.

2-3 μl of each RNA extracted in Example 2 and 17-18 μl of water for molecular biological experiments were added to a tube containing all of the 9 pairs of primer sets, and the final volume was adjusted to 20 μl, followed by RT-PCR Respectively. The reverse transcription reaction was carried out at 50 ° C for 30 minutes and denatured at 94 ° C for 5 minutes. Subsequently, the amplification reaction at 94 ° C for 15 seconds, 60 ° C for 30 seconds, and 72 ° C for 60 seconds was repeated four times, followed by amplification reaction at 94 ° C for 15 seconds, 54 ° C for 15 seconds, and 72 ° C for 60 seconds. PCR was carried out in such a manner that PCR was repeated. After completion of the PCR reaction, the PCR reaction solution was maintained at 72 ° C for 5 minutes to complete the PCR. Distilled water was used as a negative control for all reactions.

7 μl of RT-PCR reaction was electrophoresed (1.5% agarose gel w / RedSafe ™ Nucleic Acid Staining Solution (20,000x) or EtBr. 110V, 40 minutes) and observed under UV lamp.

To prevent cross-contamination, amplification products of the remaining amount after reaction and analysis were irradiated with ultraviolet rays for 20 to 30 minutes in a tube state on a bench to be irradiated with ultraviolet rays. This can prevent cross-contamination since 8-MOP is activated and the amplification product can not act as a template.

As a result, it was confirmed that the sensitivity and specificity were lower than those of the multi-tube RT-PCR of the present invention.

Accordingly, the multi-tube avian influenza virus A type detection and simultaneous discrimination detection kit of the present invention are capable of simultaneously detecting the avian influenza virus A type and its subtypes NA1 to NA9 in comparison with the conventional single tube type And it was confirmed to be effective in detecting.

Example  5. Multi-tubes of the invention in clinical samples ( multitube ) RT- PCR  And conventional single-tube multiplex RT- PCR Comparison of Effects

We further compared the sensitivity and specificity of the present multitube RT-PCR and conventional single-tube multiplex RT-PCR in actual clinical samples using the National Institute of Environmental Research AIV NA RNA, NDV, and APMV RNA extracted from domestic isolates were tested and tested.

5-1. Sensitivity comparison

For the multi-tube of the present invention, a multi-tube detection kit for AIV NA (1-9) subtype detection prepared in Example 3 was used.

Briefly, 5 μl of sample RNA, 10 pmol of each F / R primer and DNase / RNase free water were added and subjected to PCR under the conditions shown in Table 3 below. Then, electrophoresis (150 V, 30 mins) was performed on 2% agarose gel Respectively. At this time, RNA was serially diluted by 1/2 for sensitivity observation.

RT- PCR  cycle Temperature time 1 cycle Reverse transcription 45 ° C 30 min Inactivation of reverse transcription 94 ° C 5 min 4 cycles Denaturation 94 ° C 15 sec Annealing 60 ° C 30 sec Extension 72 ℃ 60 sec 29 cycles Denaturation 94 ° C 15 sec Annealing 54 ℃ 15 sec Extension 72 ℃ 60 sec 1 cycle Final extension 72 ℃ 5 min

For the conventional single-tube multiplex, a known HiSenScript RH (-) RT-PCR Premix kit (Intron, Cat No. 25135) was used.

Briefly, 5 μl of sample RNA, 10 pmol of each F / R primer and DNase / RNase free water were added and PCR was carried out under the same conditions as those of the above-mentioned multi-tube. Then, electrophoresis (150 V, 30 mins) Respectively. At this time, 2, 3 and 4 multiplexers (primers) were added artificially considering the size of the following sample (Table 4).

Two multiplex types (N1, N3) (N4, N5) (N3, N8) Three multiplex types (N1, N2, N9) (N6, N7, N8) 4 multiplex types (N4, N6, N7, N8)

As a result, as shown in Figs. 4A and 4B, the multi-tubes of the present invention (Fig. 4A) also detected low-concentration sample RNAs as compared to conventional single-tube multiplexes (Fig. 4B).

Thus, it can be seen that the multiple tubes of the present invention exhibit significant sensitivity to each subtype.

That is, the avian influenza virus A type detection and each simultaneous discrimination detection kit of the present invention were effective for simultaneous and sensitive discrimination and detection of avian influenza virus type A detection and its subtypes NA1 to NA9.

5-2. Comparison of specificity

Briefly, in the case of multiple tubes of the present invention, a multi-tube detection kit for AIV NA (1-9) subtype detection prepared in Example 3 was used, APMV and NDV samples received from the National Institute of Environmental Research 5 μl of the sample RNA, 10 pmol of each F / R primer, and DNase / RNase free water were added and PCR was carried out under the conditions shown in Table 4, followed by electrophoresis (150 V, 30 mins) on 2% agarose gel.

That is, other samples such as APMV and NDV, which are highly similar to AIV, were applied to the multi-tube detection kit for AIV NA (1-9) subtype prepared in Example 3, As shown in Fig. 5, no specific reaction with other sample samples was observed.

Thus, it can be seen that the multiple tubes of the invention exhibit significant specificity for AIV NA.

That is, the avian influenza virus A type detection and simultaneous differentiation simultaneous detection kit using the multi-tube method of the present invention is effective for specifically detecting and detecting only the avian influenza A type and its subtypes NA1 to NA9 .

<110> National Institute of Environmental Research          INTRON BIOTECHNOLOGY CO., LTD <120> Primers for Detecting Avian Influenza Virus Neuramidase Subtype          and Uses Thereof <130> INTRON1-1p-1 <150> KR 10-2015-0144258 <151> 2015-10-15 <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> NA1-F <220> <221> misc_feature <222> (1) (26) <223> R denotes G or A, Y denotes T or C. <400> 1 aggyctagrc cttgyttctg ggttga 26 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NA1-R <400> 2 acgcgtctgg ccaagacca 19 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NA2-F <220> <221> misc_feature <222> (1) (23) <223> Y denotes T or C. <400> 3 catgcatggt ccagytcaag ytg 23 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NA2-R <400> 4 ggaattccag ttgtctctgc a 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NA3-F <220> <221> misc_feature <222> (1) (23) <223> R denotes G or A. <400> 5 aagcgctttg aartcatcaa agt 23 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> NA3-R <220> <221> misc_feature &Lt; 222 > (1) <223> R denotes G or A. <400> 6 agacgtctar tccacagaaa gtaactatac 30 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NA4-F <400> 7 tccatggata agattcaaca gtga 24 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> NA4-R <400> 8 tgatacgtat cagaattaac accaca 26 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> NA5-F <220> <221> misc_feature <222> (1) (27) <223> R denotes G or A, Y denotes T or C. <400> 9 aacgttattg ggtaatgacr gayggtc 27 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NA5-R <400> 10 gacgtctatt cattccattc caa 23 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NA6-F <400> 11 ttcctgtaca ggaatgacac tatc 24 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NA6-R <220> <221> misc_feature <222> (1) (23) <223> R denotes G or A. <400> 12 gcacatatgt gccatgartt tac 23 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NA7-F <220> <221> misc_feature <222> (1) <223> Y denotes T or C. <400> 13 tgtcgacaay aacaattggt cagg 24 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NA7-R <220> <221> misc_feature <222> (1) <223> R denotes G or A, N denotes Inosine. <400> 14 ggcccaactg rgantgggct 20 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> NA8-F <220> <221> misc_feature <222> (1) (28) <223> Y denotes T or C. <400> 15 cctgatcagg atayagyggt tcyttcac 28 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NA8-R <400> 16 gtgcacacat cacaatggag ct 22 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> NA9-F <220> <221> misc_feature <222> (1) (26) <223> N denotes Inosine, Y denotes T or C. <400> 17 gtgttaacac ngactggagt ggytac 26 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NA9-R <220> <221> misc_feature <222> (1) (23) <223> R denotes G or A. <400> 18 tccggaattc tgtrctggaa cac 23

Claims (12)

A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 3 and a primer represented by the nucleotide sequence of SEQ ID NO: 4; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence represented by SEQ ID NO: 6; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 7 and a primer represented by the nucleotide sequence of SEQ ID NO: 8; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 9 and a primer represented by the nucleotide sequence of SEQ ID NO: 10; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 11 and a primer represented by the nucleotide sequence of SEQ ID NO: 12; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 13 and a primer represented by the nucleotide sequence of SEQ ID NO: 14; A primer set consisting of a primer represented by the nucleotide sequence of SEQ ID NO: 15 and a primer represented by the nucleotide sequence of SEQ ID NO: 16; And a primer set consisting of a primer represented by the nucleotide sequence shown in SEQ ID NO: 17 and a primer represented by the nucleotide sequence shown in SEQ ID NO: 18. The multi-tube RT- As a primer set for PCR,
Wherein the primer set simultaneously detects NA 1 type, NA 2 type, NA 3 type, NA 4 type, NA 5 type, NA 6 type, NA 7 type, NA 8 type and NA 9 type. delete delete delete delete A composition for detecting avian influenza virus (A) comprising the primer set according to claim 1,
Wherein the primer set simultaneously detects NA 1 type, NA 2 type, NA 3 type, NA 4 type, NA 5 type, NA 6 type, NA 7 type, NA 8 type and NA 9 type. A kit for multitube RT-PCR for detection of Avian Influenza Virus comprising a primer set according to claim 1,
Wherein the primer set simultaneously detects NA 1 type, NA 2 type, NA 3 type, NA 4 type, NA 5 type, NA 6 type, NA 7 type, NA 8 type and NA 9 type. delete Method for detecting avian influenza virus (Avian Influenza Virus) comprising the steps of:
(a) separating RNA from a specimen;
(b) amplifying the target sequence by performing a multitube RT-PCR (RT-PCR) using the separated RNA as a template and using the primer set according to claim 1,
The primer set simultaneously detects NA 1 type, NA 2 type, NA 3 type, NA 4 type, NA 5 type, NA 6 type, NA 7 type, NA 8 type and NA 9 type; And
(c) detecting the amplification product. 10. The method according to claim 9, wherein the specimen is at least one selected from the group consisting of algae, livestock, and human. 10. The method of claim 9, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. delete

Images