CN101487061B - Detection of influenza A virus epidemic isolates, typing gene chip and using method - Google Patents
Detection of influenza A virus epidemic isolates, typing gene chip and using method Download PDFInfo
- Publication number
- CN101487061B CN101487061B CN200810194822.2A CN200810194822A CN101487061B CN 101487061 B CN101487061 B CN 101487061B CN 200810194822 A CN200810194822 A CN 200810194822A CN 101487061 B CN101487061 B CN 101487061B
- Authority
- CN
- China
- Prior art keywords
- probe
- virus
- chip
- influenza
- influenza virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a genetic chip that implements epidemic strain detection and type classification of A-typed influenza virus and comprises 79 specific oligonucleotide probes that are used for detecting and classifying four subtypes H1N1, H3N2, H5N1 and H9N2, two quality control probes and a carrier, wherein, the two quality control probes include a quality control probe I and a quality control probe II, and the specific oligonucleotide probes and the quality control probe I are distributed on the carrier. The invention further discloses a preparation method of the genetic chip, which comprises following steps: step 1, probe design; step 2, probe synthesis; and step 3, chip preparation. The invention further discloses a use method of the genetic chip, which is characterized in that the use method comprises following steps: step1, extraction of influenza virus RNA; step 2, PCR augmentation of HA and HA genes; step 3, fluorescence labeling; step 4, hybridization; step 5, cleaning of the genetic chip after the hybridization; step 6, scanning; and step 7, data analysis.
Description
Technical field
The present invention relates to the epidemic isolates detection of a kind of A type influenza virus and typing gene chip and using method, belong to biochip field.
Background technology
Influenza (Influenza) is called for short influenza, is a kind of Acute respiratory infectious disease being caused by influenza virus (Influenza virus).For a long time, influenza is the serious transmissible disease of harm humans health and public security always, and the financial loss causing thus is every year also very huge.According to the World Health Organization, estimate, annual global influenza patient is about 6-12 hundred million, and wherein approximately having 3-5 1,000,000 is severe influenza patients, approximately has every year 30-50 ten thousand people to die from influenza.Influenza virus belongs to orthomyxoviridae family in classification, according to nucleoprotein (NP) and the antigenic difference of stromatin (MP), is divided into first (A), second (B), third (C) three types.A type influenza virus can infect many animals, is the main pathogen of people's parainfluenza and animal influenza.A type influenza virus, according to the antigenic specificity of its surface protein hemagglutinin (HA) and neuraminidase (NA), can be divided into different hypotypes, has found at present 16 kinds of HA hypotypes and 9 kinds of NA hypotypes in aquatic bird.In the century in the past, A type influenza virus causes 4 mankind's flu outbreaks.A type influenza virus not only serotype is complicated, and heritable variation is also very active, and the mode of variation mainly contains two kinds of the antigen conversions that antigenic drift that Nucleotide point mutation accumulation causes and different strain reassortment cause.Research shows, every 1-2, and all can there is once large antigenic drift in H1 and H3 influenza virus, vaccine inoculation preventive effect and serodiagnosis result are had a greatly reduced quality under community immunity pressure.
Closely during the last ten years, avian influenza virus, comprises H5N1, H9N2 and H7N7 hypotype, particularly H5N1 subtype virus, continues eruption and prevalence in global poultry.It is generally acknowledged that influenza virus has host restriction, avian influenza virus is generally difficult for breaking through host's species barrier direct infection people.But a lot of avian influenza people have occurred in recent years and caused disease and even dead example, increasing evidence shows avian influenza virus, H5N1 virus particularly, progressively obtains direct infection people's ability.From Hong Kong bird flu event in 1997, end in March, 2008, existing 366 examples in the whole world have infected H5N1 virus, wherein dead 232 examples.According to the experience of large influenza and the stem reality that current high pathogenic avian influenza is wreaked havoc in the past, once H5N1 virus obtain enter the ability propagated between border or with Human virus's gene resortment of current trend, just may cause new flu outbreak.Therefore the problem that must face is take which kind of strategy and tachnical storage to deal with the large influenza that may arrive.
Effective detection technique of influenza virus is significant for instructing clinical prevention and treatment influenza, is also that Influenza Surveillance and the important technology of controlling worldwide flu outbreak support simultaneously.Except influenza virus, the pathogenic agent that causes clinically human respiratory disease also has a lot, comprise some virus, bacterium, mycoplasma, spirochete, parasite etc., therefore light-duty influenza and distribute the more difficult discriminating of respiratory tract disease that influenza causes with common cold and other cause of disease clinically, to the main dependence of making a definite diagnosis of influenza laboratory detection means.Since influenza virus in 1933 is by separation for the first time, developed many different diagnostic methods, these methods respectively have relative merits.The laboratory diagnostic method of influenza has the molecular biology method of viral separation and Culture, the detection serological method of antibody, the immunological method of detectable antigens and PCR-based at present.By chicken embryo or cellular segregation, cultivating virus is " golden standard " that influenza virus is identified, susceptibility is strong, but needs 3-7 days time, is not suitable for early diagnosis.Serological method can detect antibody, mainly comprises hemagglutination-inhibition test (HI), complement fixation test (CFT) (CF), enzyme immunity test (EIA) and indirect immunofluorescence (IF) etc.Serology detects need to gather the Acute Stage and convalescence paired sera, belongs to retrospective diagnosis, have epidemiological significance, but have little significance for acute early diagnosis, and susceptibility is low.Direct-detection Antigen Method has direct or indirect fluorescent test, enzyme linked immune assay etc., and the time is 2 hours-1 day, be applicable to Rapid&Early diagnosis, but susceptibility is low, and can not carries out large sample detection.Molecular biology method is the series of experiments means that detect for cause of disease nucleic acid molecule, mainly comprise RT-PCR, multiplex PCR, real-time PCR, NASBA etc., that these methods all have is highly sensitive, high specificity, feature fast, can carry out quantitatively and Classification Identification virus, but shortcoming is to carry out while Parallel testing and examination to a large amount of clinical samples.Numerous for influenza virus sub-strain, serotype is complicated and heritable variation feature rapidly, in the urgent need to setting up a kind of sensitivity, special method for quick, can to a large amount of samples, detect abreast at one time, can carry out Classification Identification to detecting virus simultaneously.The biochip technology that development in recent years is got up, by for the detection of influenza virus brings important breakthrough, can meet the above-mentioned requirements that infected by influenza detects completely.
Gene chip, be again DNA microarray (DNA Microarray), from being born, pass through the scientists effort of more than ten years, technology is ripe perfect gradually, a plurality of fields that have been widely used in medical science, comprise the monitoring of genetic expression, molecular diagnosis of the evaluation of gene function, disease, drug screening etc.Compare with traditional method, in the diagnosis of communicable disease, gene chip has shown unrivaled superiority.Gene chip has fast, responsive, special, high-throughout feature, can to the polygenic locus of a large amount of cause of diseases and same cause of disease, detect abreast simultaneously, can realize in actual applications microminiaturization, integrated and automatization.The detection of many pathogenic micro-organisms in recent years has all related to the research of gene chip and has obtained stem-winding progress, and some or realizes industrialization, has shown wide application prospect.Gene chip detecting technique is particularly suitable for that influenza virus host range is wide, serotype is many, fast feature makes a variation.Calendar year 2001 Li etc. designs first the probe of 24 couples of mean length approximately 500 nt and prepares chip, prepares fluorescent mark target DNA, by showing to identify H1, H3, N1, N2 and Type B influenza with probe hybridization result in conjunction with multiple PCR method.The somatotype that minority scholar uses different gene chips to prepare tactful infected by influenza afterwards detects and conducts in-depth research, but existing achievement in research ubiquity hybridization time is longer, fluorescent label efficiency is low, a little less than hybridization signal, the shortcoming that recall rate is low, in addition because the genovariation of influenza virus own is very fast, be difficult to guarantee that its conserved sequence is forever constant, and the number of probes of current chip very little, once morph in its detection site, probably cause the mistake of detected result.
Summary of the invention
The invention provides a kind of gene chip for the detection of A type influenza virus epidemic isolates and somatotype and preparation method thereof and using method, it can successfully set up a whole set of quick, special, sensitive gene chip for A type influenza virus epidemic isolates detection and genotyping, and this chip can be simultaneously to comprising that A type influenza virus H1N1, H3N2, H5N1, the H9N2 hypotype in the different genera sources such as ,Zhu source, ,Qin source, people source detects and somatotype.
The present invention has adopted following technical scheme: the gene chip of a kind of A type influenza virus epidemic isolates detection and somatotype, it comprises detects and 79 specific oligonucleotide probes of somatotype, two Quality Control probes and carrier H1N1, H3N2, H5N1, tetra-kinds of hypotypes of H9N2, article two, Quality Control probe is Quality Control probe I and Quality Control probe I I, wherein specific oligonucleotide probe and Quality Control probe I are distributed on carrier
H1N1 is detected and the sequence of the specific oligonucleotide probe of somatotype
| Numbering | Title | Sequence |
| 1 | H1N1-HA-1 | atgccaacaactcaaccgac |
| 2 | H1N1-HA-2 | acttgagaagaatgtgacagtgac |
| 3 | H1N1-HA-3 | acacagaatgccattgacgg |
| 4 | H1N1-HA-4 | gaaattggaaatggctgctttga |
| 5 | H1N1-HA-5 | ctatatgagaaagtaagaagccagc |
| 6 | H1N1-NA-1 | ctagtgggagcagcatttcttt |
| 7 | H1N1-NA-2 | ttgtggcgttgatagtgatactg |
| 8 | H1N1-NA-3 | attcatctctttgttctatcagtgga |
| 9 | H1N1-NA-4 | atacacaaaagacaacagcataagaat |
| 10 | H1N1-NA-5 | ctaatggatggacagataccgatag |
| 11 | H1N1-NA-6 | gattggtcaggatacagtggaag |
H3N2 is detected and the sequence of the specific oligonucleotide probe of somatotype
| 12 | H3N2-HA-1 | ctgttacccttatgatgtgccg |
| 13 | H3N2-HA-2 | gaacgcagcaaagcctacag |
| 14 | H3N2-HA-3 | attaacagcacagggaatctaattg |
| 15 | H3N2-HA-4 | caataatgagatcagatgcaccca |
| 16 | H3N2-HA-5 | gaacaaagaagcaactgaggga |
| 17 | H3N2-HA-6 | gctgaggatatgggcaatgg |
| 18 | H3N2-HA-7 | atgacaacagcacggcaac |
| 19 | H3N2-HA-8 | caacaggtagaatatgcgacagt |
| 20 | H3N2-HA-9 | ctgttacccttatgatgtgccg |
| 21 | H3N2-HA-10 | ttatgcctcccttaggtcactag |
| 22 | H3N2-HA-11 | ggatgcggaatgtaccagaga |
| 23 | H3N2-HA-12 | aactagaggcatattcggcg |
| 24 | H3N2-HA-13 | gggtcaatcagaaatggaacttatg |
| 25 | H3N2-NA-1 | tgaccaacaccaccatagagaa |
| 26 | H3N2-NA-2 | agcagaatacagaaattggtcaaag |
| 27 | H3N2-NA-3 | atgcgatcctgacaagtgttatc |
| 28 | H3N2-NA-4 | ggacagggaacaacactaaacaa |
| 29 | H3N2-NA-5 | atggagtgaaaggctgggc |
| 30 | H3N2-NA-6 | tcctggtaactactgtaacattgc |
| 31 | H3N2-NA-7 | gccacaatatgcttccttatgc |
| 32 | H3N2-NA-8 | gtatctgaccaacaccaccatag |
| 33 | H3N2-NA-9 | ctgtgtgaaccaacaataatagaaa |
| 34 | H3N2-NA-10 | gctcaagttgtcacgatggaa |
| 35 | H3N2-NA-11 | cctattgatgaatgagttgggtgt |
| 36 | H3N2-NA-12 | gaggcttgtagatagtattggttca |
| 37 | H3N2-NA-13 | catagttgacagaggtaataggtcc |
H5N1 is detected and the sequence of the specific oligonucleotide probe of somatotype
| 38 | H5N1-HA-1 | cgacagagcaggttgacaca |
| 39 | H5N1-HA-2 | tcaagaaaggggactcagcaa |
| 40 | H5N1-HA-3 | aaggcaatagatggagtcacc |
| 41 | H5N1-HA-4 | gccgttggaagggaatttaataac |
| 42 | H5N1-HA-5 | aacaagaagatggaagacggatt |
| 43 | H5N1-HA-6 | cggaatggtcttacatagtggag |
| 44 | H5N1-HA-7 | ccagccaatgacctctgttac |
| 45 | H5N1-HA-8 | gctacaataataccaaccaagaaga |
| 46 | H5N1-HA-9 | cctaatgatgcggcagagc |
| 47 | H5N1-HA-10 | tgccattccacaacatacacc |
| 48 | H5N1-HA-11 | aagtgaattggaatatggtaactgc |
| 49 | H5N1-HA-12 | ccgcagtattcagaagaagcaa |
| 50 | H5N1-HA-13 | ttattcaacagtggcgagttcc |
| 51 | H5N1-HA-14 | aagaactgaaacacctattgagca |
| 52 | H5N1-NA-1 | tggaggaacaacatactgagaac |
| 53 | H5N1-NA-2 | ggcataataacagacactatcaaga |
| 54 | H5N1-NA-3 | agcactaattccaggagcgg |
| 55 | H5N1-NA-4 | ccagaactgacaggattagattgc |
| 56 | H5N1-NA-5 | attggtcaggatatagcgggag |
| 57 | H5N1-NA-6 | gccgttcatctcatgctcc |
| 58 | H5N1-NA-7 | ttgactcagggagccttgc |
| 59 | H5N1-NA-8 | tggaggaacaacatactgagaac |
| 60 | H5N1-NA-9 | ttactgtaatgactgatggaccaag |
| 61 | H5N1-NA-10 | ttcggagacaatccacgcc |
| 62 | H5N1-NA-11 | tggcatggctcaaatcggc |
| 63 | H5N1-NA-12 | agcactaattccaggagcgg |
| 64 | H5N1-NA-13 | ggtggactggaacggacag |
H9N2 is detected and the sequence of the specific oligonucleotide probe of somatotype
| 65 | H9N2-HA-1 | gcatcggctaccaatcaacaa |
| 66 | H9N2-HA-2 | tgttcctgtgacacatgcca |
| 67 | H9N2-HA-3 | atgccaaagaattactccacaca |
| 68 | H9N2-HA-4 | agaattgctagtgctgcttgaa |
| 69 | H9N2-HA-5 | caggtcagacattgcgagtg |
| 70 | H9N2-HA-6 | atggtatggacacattctttcagg |
| 71 | H9N2-HA-7 | acaaggactgacacaacaacaa |
| 72 | H9N2-HA-8 | aggtcagacattgcgagtaaga |
| 73 | H9N2-HA-9 | tctatggcaatccttcctgtga |
| 74 | H9N2-HA-10 | tcggattcattctacaggagca |
| 75 | H9N2-HA-11 | aataccacattgccattccaca |
| 76 | H9N2-NA-1 | ggtattctggtatcttctctgttga |
| 77 | H9N2-NA-2 | ccacggctaattccaagtcac |
| 78 | H9N2-NA-3 | aagtggcagaatacaagaattggt |
| 79 | H9N2-NA-4 | gtcaaattacagggttcgctcc |
Article two, the sequence of Quality Control probe
| 80 | I | cgtatataaaacggaacgtcgaagg |
| 81 | II | ccttcgacgttccgttttatatacg |
Described carrier is that aldehyde radicalization is modified glass substrate or silicon chip, polystyrene substrate, nylon substrates.
The preparation method of the gene chip of the detection of a kind of A type of the present invention influenza virus epidemic isolates and somatotype, comprise the following steps: step 1, the design of probe: according to the Influenza Virus Resource database in NCBI, a large amount of A type influenza virus sequences are compared, find its absolute or relative conserved sequence, then design 79 specific oligonucleotide probes and two Quality Control probes, step 2, probe synthetic, it is amido modified that 5 ends of every probe add C6, can be fixed on aldehyde radicalization, modifies on glass substrate, step 3, the preparation of chip: the probe after synthetic is diluted to 40uM with pure water, get 15ul, mix with equal-volume 2 * chip sampling liquid, make concentration and probe concentration reach 20uM, be loaded on 384 orifice plates, with chip point sample instrument by probe points on carrier, after point sample completes, chip is placed in to chip hybridization box, in hybridizing box bottom, put 300ul pure water for keeping humidity simultaneously, hybridizing box is sealed, 37 ℃ of reaction 18h, make probe and chip surface aldehyde radical covalent attachment, after hydration completes, with 0.2%SDS, clean and seal with NaBH4, centrifugal drying, stick four sampling-type fences, 4 ℃ of sealings are preserved.
79 specific oligonucleotide probes and two Quality Control probes in preparation method's step 1 of the present invention, probe length is at 19-25bp, and between every probe, Tm value differs within 5 ℃.At the carrier described in preparation method's step 2 of the present invention, be aldehyde radical glass chip or silicon chip, polystyrene substrate, nylon substrates.
The using method of the gene chip of the detection of a kind of A type of the present invention influenza virus epidemic isolates and somatotype, is characterized in that it comprises the following steps: step 1, and the extraction of Influenza Virus RNA, is used TRIZOL ordinary method to extract viral RNA; Step 2, RT-PCR: first with Uni12 primer, Influenza Virus RNA reverse transcription is become to cDNA, re-use universal primer respectively HA, the NA gene fragment total length of pcr amplification influenza virus, the PCR product after amplification with QIAGEN PCR Purification Kit to carrying out purifying; Step 3, fluorescent mark: get the PCR product after purifying, use Klenow minus enzyme to carry out fluorescent mark on PCR product, will purify with QIAGEN PCR Purification Kit with fluorescently-labeled PCR product; Step 4, hybridization: by mixing with fluorescently-labeled PCR product and hybridization solution after purifying, on gene chip, cover four sampling-type cover plates, 12ul hybridization system is added on to cover plate well and makes it automatically be covered in array surface, gene chip is put into the inherent 20-45 ℃ of hybridization 1-5H of hybridizing box; Step 5, after hybridization, clean gene chip: after gene chip hybridization completes, chip is respectively cleaned to 1-5min successively in washing lotion 0.1%SDS+2 * SSC, 0.1%SDS+0.2 * SSC and 0.2 * SSC, finally gene chip is put into centrifuge tube centrifugal to remove surface liquid; Step 6, scanning: the gene chip after cleaning in step 5 is scanned by chip scanner, preserve scan image data simultaneously; Step 7, data analysis: according to scan image, determine and to occur fluorescent signal region, determine the hypotype that has that it's too late of influenza virus in detected sample with this.
Fluorescent mark in the step 3 of using method of the present invention adopts cy
3fluorescence dye.In the step 4 of using method of the present invention, hybridizing system component is deionized formamide 1.8 ul, 20 * SSPE, 2.4 ul, and 50 * Denhardt ' s, 0.6 ul, Quality Control probe I I1 ul, with fluorescent mark PCR product 3 ul, pure water 3.2ul.
The present invention has following beneficial effect: probe broad covered area of the present invention, overcome some chip and only designed a pair of or several shortcomings to probe, four hypotypes have all been designed to multipair probe, can effectively avoid due to rapid cause undetected of influenza virus variation.The fluorescence labeling method efficiency of using in the present invention is high, and just can carry out effective fragmentation to product to be detected in fluorescent mark process, and hybridization efficiency is greatly improved, and improves chip detection susceptibility.The present invention can detect the A type influenza virus in different genera source, comprises people, fowl, pig etc., has very high broad spectrum.
Accompanying drawing explanation
Fig. 1 is the array structure schematic diagram of A type influenza virus epidemic isolates detection of the present invention and typing gene chip, is distributed with four identical arrays on every chip.
Figure 2 shows that each probe alignment placement on each array.
Figure 3 shows that typical A type influenza virus H1N1 hypotype chip detection result.
Figure 4 shows that typical A type influenza virus H3N2 hypotype chip detection result.
Figure 5 shows that typical A type influenza virus H 5 N 1 hypotype chip detection result.
Figure 6 shows that typical A type influenza virus H9N2 hypotype chip detection result.
Embodiment
Embodiment mono-: shown in Fig. 1 and Fig. 2, the invention provides a kind of for the gene chip to the detection of A type influenza virus epidemic isolates and somatotype, it comprises H1N1, H3N2, H5N1, tetra-kinds of hypotypes of H9N2 detect 79 specific oligonucleotide probes with somatotype, article two, Quality Control probe and carrier, article two, Quality Control probe is Quality Control probe I and Quality Control probe I I, specific oligonucleotide probe and Quality Control probe I are distributed on carrier, carrier is that aldehyde radical glass is modified substrate, carrier can be also silicon chip, polystyrene substrate or nylon substrates, to H1N1 detect and the sequence of the specific oligonucleotide probe of somatotype in Table 1, to H3N2 detect and the sequence of the specific oligonucleotide probe of somatotype in Table 2, to H5N1 detect and the sequence of the specific oligonucleotide probe of somatotype in Table 3, to H9N2 detect and the sequence of the specific oligonucleotide probe of somatotype in Table 4, article two, the sequence of Quality Control probe is in Table 5.
Table 1 couple H1N1 detects and the sequence of the specific oligonucleotide probe of somatotype
| Numbering | Title | Sequence |
| 1 | H1N1-HA-1 | atgccaacaactcaaccgac |
| 2 | H1N1-HA-2 | acttgagaagaatgtgacagtgac |
| 3 | H1N1-HA-3 | acacagaatgccattgacgg |
| 4 | H1N1-HA-4 | gaaattggaaatggctgctttga |
| 5 | H1N1-HA-5 | ctatatgagaaagtaagaagccagc |
| 6 | H1N1-NA-1 | ctagtgggagcagcatttcttt |
| 7 | H1N1-NA-2 | ttgtggcgttgatagtgatactg |
| 8 | H1N1-NA-3 | attcatctctttgttctatcagtgga |
| 9 | H1N1-NA-4 | atacacaaaagacaacagcataagaat |
| 10 | H1N1-NA-5 | ctaatggatggacagataccgatag |
| 11 | H1N1-NA-6 | gattggtcaggatacagtggaag |
Table 2 couple H3N2 detects and the sequence of the specific oligonucleotide probe of somatotype
| 12 | H3N2-HA-1 | ctgttacccttatgatgtgccg |
| 13 | H3N2-HA-2 | gaacgcagcaaagcctacag |
| 14 | H3N2-HA-3 | attaacagcacagggaatctaattg |
| 15 | H3N2-HA-4 | caataatgagatcagatgcaccca |
| 16 | H3N2-HA-5 | gaacaaagaagcaactgaggga |
| 17 | H3N2-HA-6 | gctgaggatatgggcaatgg |
| 18 | H3N2-HA-7 | atgacaacagcacggcaac |
| 19 | H3N2-HA-8 | caacaggtagaatatgcgacagt |
| 20 | H3N2-HA-9 | ctgttacccttatgatgtgccg |
| 21 | H3N2-HA-10 | ttatgcctcccttaggtcactag |
| 22 | H3N2-HA-11 | ggatgcggaatgtaccagaga |
| 23 | H3N2-HA-12 | aactagaggcatattcggcg |
| 24 | H3N2-HA-13 | gggtcaatcagaaatggaacttatg |
| 25 | H3N2-NA-1 | tgaccaacaccaccatagagaa |
| 26 | H3N2-NA-2 | agcagaatacagaaattggtcaaag |
| 27 | H3N2-NA-3 | atgcgatcctgacaagtgttatc |
| 28 | H3N2-NA-4 | ggacagggaacaacactaaacaa |
| 29 | H3N2-NA-5 | atggagtgaaaggctgggc |
| 30 | H3N2-NA-6 | tcctggtaactactgtaacattgc |
| 31 | H3N2-NA-7 | gccacaatatgcttccttatgc |
| 32 | H3N2-NA-8 | gtatctgaccaacaccaccatag |
| 33 | H3N2-NA-9 | ctgtgtgaaccaacaataatagaaa |
| 34 | H3N2-NA-10 | gctcaagttgtcacgatggaa |
| 35 | H3N2-NA-11 | cctattgatgaatgagttgggtgt |
| 36 | H3N2-NA-12 | gaggcttgtagatagtattggttca |
| 37 | H3N2-NA-13 | catagttgacagaggtaataggtcc |
Table 3 couple H5N1 detects and the sequence of the specific oligonucleotide probe of somatotype
| 38 | H5N1-HA-1 | cgacagagcaggttgacaca |
| 39 | H5N1-HA-2 | tcaagaaaggggactcagcaa |
| 40 | H5N1-HA-3 | aaggcaatagatggagtcacc |
| 41 | H5N1-HA-4 | gccgttggaagggaatttaataac |
| 42 | H5N1-HA-5 | aacaagaagatggaagacggatt |
| 43 | H5N1-HA-6 | cggaatggtcttacatagtggag |
| 44 | H5N1-HA-7 | ccagccaatgacctctgttac |
| 45 | H5N1-HA-8 | gctacaataataccaaccaagaaga |
| 46 | H5N1-HA-9 | cctaatgatgcggcagagc |
| 47 | H5N1-HA-10 | tgccattccacaacatacacc |
| 48 | H5N1-HA-11 | aagtgaattggaatatggtaactgc |
| 49 | H5N1-HA-12 | ccgcagtattcagaagaagcaa |
| 50 | H5N1-HA-13 | ttattcaacagtggcgagttcc |
| 51 | H5N1-HA-14 | aagaactgaaacacctattgagca |
| 52 | H5N1-NA-1 | tggaggaacaacatactgagaac |
| 53 | H5N1-NA-2 | ggcataataacagacactatcaaga |
| 54 | H5N1-NA-3 | agcactaattccaggagcgg |
| 55 | H5N1-NA-4 | ccagaactgacaggattagattgc |
| 56 | H5N1-NA-5 | attggtcaggatatagcgggag |
| 57 | H5N1-NA-6 | gccgttcatctcatgctcc |
| 58 | H5N1-NA-7 | ttgactcagggagccttgc |
| 59 | H5N1-NA-8 | tggaggaacaacatactgagaac |
| 60 | H5N1-NA-9 | ttactgtaatgactgatggaccaag |
| 61 | H5N1-NA-10 | ttcggagacaatccacgcc |
| 62 | H5N1-NA-11 | tggcatggctcaaatcggc |
| 63 | H5N1-NA-12 | agcactaattccaggagcgg |
| 64 | H5N1-NA-13 | ggtggactggaacggacag |
Table 4 couple H9N2 detects and the sequence of the specific oligonucleotide probe of somatotype
| 65 | H9N2-HA-1 | gcatcggctaccaatcaacaa |
| 66 | H9N2-HA-2 | tgttcctgtgacacatgcca |
| 67 | H9N2-HA-3 | atgccaaagaattactccacaca |
| 68 | H9N2-HA-4 | agaattgctagtgctgcttgaa |
| 69 | H9N2-HA-5 | caggtcagacattgcgagtg |
| 70 | H9N2-HA-6 | atggtatggacacattctttcagg |
| 71 | H9N2-HA-7 | acaaggactgacacaacaacaa |
| 72 | H9N2-HA-8 | aggtcagacattgcgagtaaga |
| 73 | H9N2-HA-9 | tctatggcaatccttcctgtga |
| 74 | H9N2-HA-10 | tcggattcattctacaggagca |
| 75 | H9N2-HA-11 | aataccacattgccattccaca |
| 76 | H9N2-NA-1 | ggtattctggtatcttctctgttga |
| 77 | H9N2-NA-2 | ccacggctaattccaagtcac |
| 78 | H9N2-NA-3 | aagtggcagaatacaagaattggt |
| 79 | H9N2-NA-4 | gtcaaattacagggttcgctcc |
The sequence of two Quality Control probes of table 5
| 80 | PosCtrl-1 | cgtatataaaacggaacgtcgaagg |
| 81 | PosCtrl-2 | ccttcgacgttccgttttatatacg |
The present invention also provides the preparation method of the detection of A type influenza virus epidemic isolates and typing gene chip, comprise the following steps: step 1, the design of probe: according to the Influenza Virus Resource database in NCBI, use Clustalx software to compare to a large amount of A type influenza virus sequences, find its absolute or relative conserved sequence, then use Array Designer 4 79 specific oligonucleotide probes of design and two Quality Control probes, the length of every probe is at 19-25bp, between every probe, Tm value differs within 5 ℃, article 79, the sequence of the sequence of specific oligonucleotide probe and two Quality Control probes is in Table 1, table 2, table 3, table 4 and table 5, step 2, probe synthetic adds C6 at 5 ends of every probe amido modified in synthetic, can be fixed on aldehyde radicalization, modifies on glass substrate, step 3, the preparation of chip: the probe after synthetic is diluted to 40uM with pure water, get 15ul, adding 2 * chip sampling liquid 15ul manages in PCR, with rifle, mix, make concentration and probe concentration reach 20uM, be loaded on 384 orifice plates, with chip point sample instrument by probe points on carrier, every two repetitions, horizontal 14 points on each array, longitudinal 13 points, 4 repeat arrays of some system on every chip block, after point sample completes, chip is positioned over to chip hybridization box, in hybridizing box bottom, put 300ul pure water for keeping humidity simultaneously, hybridizing box is sealed, 37 ℃ of reaction 18h, make probe and chip surface aldehyde radical covalent attachment, after hydration completes, with 0.2%SDS, clean and seal with NaBH4, centrifugal drying, stick four sampling-type fences, 4 ℃ of sealings are preserved.
According to Fig. 3, Fig. 4, Fig. 5 and Fig. 6, the invention also discloses that a kind of A type influenza virus epidemic isolates detects and the using method of typing gene chip, and it comprises the following steps:
Step 1, the extraction of Influenza Virus RNA, is used TRIZOL ordinary method to extract viral RNA; Step 2, RT-PCR: first with Uni12 primer, Influenza Virus RNA reverse transcription is become to cDNA, re-use universal primer respectively HA, the NA gene fragment total length of pcr amplification influenza virus, the PCR product after amplification with QIAGENPCR Purification Kit to carrying out purifying; Step 3, fluorescent mark: get the PCR product after purifying, use Klenow minus enzyme to carry out fluorescent mark on PCR product, fluorescent mark adopts cy
3fluorescence dye, will purify with QIAGEN PCR Purification Kit with fluorescently-labeled PCR product; Step 4, hybridization: by mixing with fluorescently-labeled PCR product and hybridization solution after purifying, on gene chip, cover four sampling-type cover plates, 12ul hybridization system is added on to cover plate well and makes it automatically be covered in array surface, hybridization system component is deionized formamide 1.8 ul, 20 * SSPE, 2.4 ul, 50 * Denhardt ' s 0.6ul, Quality Control probe I I1ul, with fluorescent mark PCR product 3 ul, pure water 3.2 ul, put into the inherent 20-45 ° of C hybridization of hybridizing box 1-5H by gene chip; Step 5, after hybridization, clean gene chip: after gene chip hybridization completes, chip is respectively cleaned to 1-5min successively in washing lotion 0.1%SDS+2 * SSC, 0.1%SDS+0.2 * SSC and 0.2 * SSC, finally gene chip is put into centrifuge tube centrifugal to remove surface liquid; Step 6, scanning: the gene chip after cleaning in step 5 is scanned by chip scanner, preserve scan image data simultaneously; Step 7, data analysis: according to scan image, determine and to occur fluorescent signal region, determine the hypotype that has that it's too late of influenza virus in detected sample with this.
Nucleotides sequence list
<110> Taizhou Qinheli Bio-Tech Co. Ltd.
The epidemic isolates detection of <120>A type influenza virus and typing gene chip and using method
<160>81
<210>1
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>1
atgccaacaactcaaccgac
<210>2
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>2
acttgagaagaatgtgacagtgac
<210>3
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>3
acacagaatgccattgacgg
<210>4
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>4
gaaattggaaatggctgctttga
<210>5
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>5
ctatatgagaaagtaagaagccagc
<210>6
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>6
ctagtgggagcagcatttcttt
<210>7
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>7
ttgtggcgttgatagtgatactg
<210>8
<211>26
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>8
attcatctctttgttctatcagtgga
<210>9
<211>27
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>9
atacacaaaagacaacagcataagaat
<210>10
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>10
ctaatggatggacagataccgatag
<210>11
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>11
gattggtcaggatacagtggaag
<210>12
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>12
ctgttacccttatgatgtgccg
<210>13
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>13
gaacgcagcaaagcctacag
<210>14
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>14
attaacagcacagggaatctaattg
<210>15
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>15
caataatgagatcagatgcaccca
<210>16
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>16
gaacaaagaagcaactgaggga
<210>17
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>17
gctgaggatatgggcaatgg
<210>18
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>18
atgacaacagcacggcaac
<210>19
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>19
caacaggtagaatatgcgacagt
<210>20
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>20
ctgttacccttatgatgtgccg
<210>21
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>21
ttatgcctcccttaggtcactag
<210>22
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>22
ggatgcggaatgtaccagaga
<210>23
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>23
aactagaggcatattcggcg
<210>24
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>24
gggtcaatcagaaatggaacttatg
<210>25
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>25
tgaccaacaccaccatagagaa
<210>26
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>26
agcagaatacagaaattggtcaaag
<210>27
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>27
atgcgatcctgacaagtgttatc
<210>28
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>28
ggacagggaacaacactaaacaa
<210>29
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>29
atggagtgaaaggctgggc
<210>30
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>30
tcctggtaactactgtaacattgc
<210>31
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>31
gccacaatatgcttccttatgc
<210>32
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>32
gtatctgaccaacaccaccatag
<210>33
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>33
ctgtgtgaaccaacaataatagaaa
<210>34
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>34
gctcaagttgtcacgatggaa
<210>35
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>35
cctattgatgaatgagttgggtgt
<210>36
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>36
gaggcttgtagatagtattggttca
<210>37
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>37
catagttgacagaggtaataggtcc
<210>38
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>38
cgacagagcaggttgacaca
<210>39
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>39
tcaagaaaggggactcagcaa
<210>40
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>40
aaggcaatagatggagtcacc
<210>41
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>41
gccgttggaagggaatttaataac
<210>42
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>42
aacaagaagatggaagacggatt
<210>43
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>43
cggaatggtcttacatagtggag
<210>44
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>44
ccagccaatgacctctgttac
<210>45
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>45
gctacaataataccaaccaagaaga
<210>46
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>46
cctaatgatgcggcagagc
<210>47
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>47
tgccattccacaacatacacc
<210>48
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>48
aagtgaattggaatatggtaactgc
<210>49
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>49
ccgcagtattcagaagaagcaa
<210>50
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>50
ttattcaacagtggcgagttcc
<210>51
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>51
aagaactgaaacacctattgagca
<210>52
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>52
tggaggaacaacatactgagaac
<210>53
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>53
ggcataataacagacactatcaaga
<210>54
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>54
agcactaattccaggagcgg
<210>55
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>55
ccagaactgacaggattagattgc
<210>56
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>56
attggtcaggatatagcgggag
<210>57
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>57
gccgttcatctcatgctcc
<210>58
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>58
ttgactcagggagccttgc
<210>59
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>59
tggaggaacaacatactgagaac
<210>60
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>60
ttactgtaatgactgatggaccaag
<210>61
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>61
ttcggagacaatccacgcc
<210>62
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>62
tggcatggctcaaatcggc
<210>63
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>63
agcactaattccaggagcgg
<210>64
<211>19
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>64
ggtggactggaacggacag
<210>65
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>65
gcatcggctaccaatcaacaa
<210>66
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>66
tgttcctgtgacacatgcca
<210>67
<211>23
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>67
atgccaaagaattactccacaca
<210>68
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>68
agaattgctagtgctgcttgaa
<210>69
<211>20
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>69
caggtcagacattgcgagtg
<210>70
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>70
atggtatggacacattctttcagg
<210>71
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>71
acaaggactgacacaacaacaa
<210>72
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>72
aggtcagacattgcgagtaaga
<210>73
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>73
tctatggcaatccttcctgtga
<210>74
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>74
tcggattcattctacaggagca
<210>75
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>75
aataccacattgccattccaca
<210>76
<211>25
<212>DNA
<213>A type influenza virus (Influenza A virus)
220>
<221>misc_feature
<400>76
ggtattctggtatcttctctgttga
<210>77
<211>21
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>77
ccacggctaattccaagtcac
<210>78
<211>24
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>78
aagtggcagaatacaagaattggt
<210>79
<211>22
<212>DNA
<213>A type influenza virus (Influenza A virus)
<220>
<221>misc_feature
<400>79
gtcaaattacagggttcgctcc
<210>80
<211>25
<212>DNA
<213> artificial sequence
<220>
According to base complementrity, pairing designs <223>, to be used as the positive reference of chip hybridization.
<400>80
cgtatataaaacggaacgtcgaagg
<210>81
<211>25
<212>DNA
<213> artificial sequence
<220>
According to base complementrity, pairing designs <223>, to be used as the positive reference of chip hybridization.
<400>81
ccttcgacgttccgttttatatacg
Claims (3)
1. one kind for detecting A type influenza virus epidemic isolates and the gene chip of somatotype, it is characterized in that it comprises detects and 79 specific oligonucleotide probes of somatotype, two Quality Control probes and carrier H1N1, H3N2, H5N1, tetra-kinds of hypotypes of H9N2, article two, Quality Control probe is Quality Control probe I and Quality Control probe I I, wherein specific oligonucleotide probe and Quality Control probe I are distributed on carrier
H1N1 is detected and the sequence of the specific oligonucleotide probe of somatotype
H3N2 is detected and the sequence of the specific oligonucleotide probe of somatotype
H5N1 is detected and the sequence of the specific oligonucleotide probe of somatotype
H9N2 is detected and the sequence of the specific oligonucleotide probe of somatotype
Article two, the sequence of Quality Control probe
80 I CGTATATAAAACGGAACGTCGAAGG
81 II CCTTCGACGTTCCGTTTTATATACG-cy
3
。
2. according to claim 1 for A type influenza virus epidemic isolates being detected and the gene chip of somatotype, the carrier described in it is characterized in that is aldehyde radical glass chip or silicon chip, polystyrene substrate, nylon substrates.
3. according to claim 1 for the gene chip to the detection of A type influenza virus epidemic isolates and somatotype, it is characterized in that the preparation method of this chip comprises the following steps:
Step 1, the design of probe: according to the Influenza Virus Resource database in NCBI, use Clustalx software to compare to a large amount of A type influenza virus sequences, find its absolute or relative conserved sequence, then use Array Designer4 software successfully to design 79 specific oligonucleotide probes and two Quality Control probes;
Step 2, probe synthetic: synthetic by Shanghai Ying Jun Bioisystech Co., Ltd, it is amido modified that 5 ' end of every probe adds C6, modifies on glass substrate can be fixed on aldehyde radicalization;
Step 3, the preparation of chip: the probe after synthetic is diluted to 40uM with pure water, get 15ul, mix with equal-volume 2 * chip sampling liquid, make concentration and probe concentration reach 20uM, be loaded on 384 orifice plates, with SmartArrayer48 chip point sample instrument by probe points on carrier, described point sample instrument is SmartArrayer48 chip point sample instrument, every two repetitions, horizontal 14 points on each array, longitudinal 13 points, 4 repeat arrays of some system on every chip block, after point sample completes, chip is placed in to chip hybridization box, in hybridizing box bottom, put 300ul pure water for keeping humidity simultaneously, hybridizing box is sealed, 37 ℃ of reaction 18h, make probe and chip surface aldehyde radical covalent attachment, after hydration completes, with 0.2%SDS, clean and seal with NaBH4, centrifugal drying, stick four sampling-type fences, 4 ℃ of sealings are preserved.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810194822.2A CN101487061B (en) | 2008-11-10 | 2008-11-10 | Detection of influenza A virus epidemic isolates, typing gene chip and using method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810194822.2A CN101487061B (en) | 2008-11-10 | 2008-11-10 | Detection of influenza A virus epidemic isolates, typing gene chip and using method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101487061A CN101487061A (en) | 2009-07-22 |
| CN101487061B true CN101487061B (en) | 2014-03-12 |
Family
ID=40890121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810194822.2A Expired - Fee Related CN101487061B (en) | 2008-11-10 | 2008-11-10 | Detection of influenza A virus epidemic isolates, typing gene chip and using method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101487061B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101649356B (en) * | 2009-07-24 | 2012-09-05 | 浙江省疾病预防控制中心 | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof |
| CN101818207B (en) * | 2009-10-26 | 2012-07-25 | 中华人民共和国珠海出入境检验检疫局 | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus |
| CN101864495B (en) * | 2010-04-13 | 2012-10-03 | 上海国际旅行卫生保健中心 | Constant-temperature amplification detection kit of influenza A virus and detection method thereof |
| CN108531648B (en) * | 2018-04-11 | 2022-03-22 | 四川农业大学 | Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof |
| WO2023077490A1 (en) * | 2021-11-06 | 2023-05-11 | 江汉大学 | Combination of mnp markers of influenza a, b and c viruses, primer pair combination, kit, and uses of combination, primer pair combination and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101020930A (en) * | 2007-03-08 | 2007-08-22 | 中国检验检疫科学研究院动植物检疫研究所 | Gene chip for detection and typing of bird flu virus |
-
2008
- 2008-11-10 CN CN200810194822.2A patent/CN101487061B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101020930A (en) * | 2007-03-08 | 2007-08-22 | 中国检验检疫科学研究院动植物检疫研究所 | Gene chip for detection and typing of bird flu virus |
Non-Patent Citations (3)
| Title |
|---|
| Dawson DE..MChip: A Tool for Influenza Surveillance.《Anal. Chem.》.2006,7610-7615. * |
| 陈红军.猪流感病毒分型基因芯片的研制与应用.《中国优秀硕士学位论文全文数据库 农业科技辑(月刊)》.2007,(第06期),全文. * |
| 马新颖.10种植物病毒的基因芯片检测技术研究.《植物病理学报》.2007,第37卷(第6期),561-565. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101487061A (en) | 2009-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Munch et al. | Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA | |
| US8241853B2 (en) | Primers and probes for detection and discrimination of types and subtypes of influenza viruses | |
| Qiu et al. | A reverse transcription-PCR for subtyping of the neuraminidase of avian influenza viruses | |
| CA2567793A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| CN101487061B (en) | Detection of influenza A virus epidemic isolates, typing gene chip and using method | |
| Wibawa et al. | A molecular and antigenic survey of H5N1 highly pathogenic avian influenza virus isolates from smallholder duck farms in Central Java, Indonesia during 2007-2008 | |
| US20180265936A1 (en) | Compositions and methods for detection and discrimination of influenza viruses | |
| CN113005228A (en) | Detection kit for synchronously detecting multiple respiratory pathogens and detection method thereof | |
| Ellis et al. | Influenza AH1N2 viruses, United Kingdom, 2001–02 influenza season | |
| US20090088331A1 (en) | Influenza virus nucleic acid microarray and method of use | |
| Sun et al. | DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7 | |
| CN101020930A (en) | Gene chip for detection and typing of bird flu virus | |
| Pourmand et al. | Rapid and highly informative diagnostic assay for H5N1 influenza viruses | |
| US20180163277A1 (en) | Compositions and methods for detection and discrimination of emerging influenza virus subtypes | |
| CN103667538B (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN103667524B (en) | Fluorescent quantitative RT-PCR kit used for detection of Newcastle disease virus class I and application of fluorescent quantitative RT-PCR kit | |
| CN107964567A (en) | Influenza A detects genetic chip | |
| CN102251060A (en) | Preparation and application method for gene chip for detecting drug resistance of A type influenza virus epidemic virus strain | |
| CN1834655A (en) | Method of detecting etiology by tacteriophage immunity PCR | |
| Li et al. | Detection and subtyping of influenza A virus based on a short oligonucleotide microarray | |
| Kelvin et al. | Influenza monitoring in Sardinia, Italy identifies H3 subtype in Mediterranean wild migratory birds | |
| KR101809710B1 (en) | Primers for Detecting Avian Influenza Virus Neuramidase Subtype and Uses Thereof | |
| CN110777219A (en) | Triple PCR detection primer group, kit and method for chicken parvovirus and H9 subtype avian influenza virus | |
| CN110951918A (en) | Kit for jointly detecting influenza A virus and influenza B virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof | |
| CN114457198B (en) | Influenza A virus and multi-typing detection kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140312 Termination date: 20151110 |