CN101486757A - Plant chloroplast development associated protein, and coding gene and use thereof - Google Patents
Plant chloroplast development associated protein, and coding gene and use thereof Download PDFInfo
- Publication number
- CN101486757A CN101486757A CN 200910079568 CN200910079568A CN101486757A CN 101486757 A CN101486757 A CN 101486757A CN 200910079568 CN200910079568 CN 200910079568 CN 200910079568 A CN200910079568 A CN 200910079568A CN 101486757 A CN101486757 A CN 101486757A
- Authority
- CN
- China
- Prior art keywords
- plant
- sequence
- associated protein
- gene
- chloroplast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a plant chloroplast-related protein and encoding gene and application thereof. The protein has one of the following amino acid residue sequences: 1) an SEQ ID No.1 amino acid residue sequence in a sequence table; and 2) the SEQ ID No.1 amino acid residue sequence in the sequence table is replaced by one or a plurality of amino acid residues and/or lost and/or added with a protein which is derived from SEQ ID No.1 and has relative development functions of plant chloroplast. When the encoding gene of a rice chloroplast development related protein is destroyed, the plant leaf albino can be caused; and the encoding gene can be applied to the work such as plant genetic improvement and the like, and is an important direction gene, for example, the encoding gene can be uses as a target gene for being applied in rice breeding material sterile lines and changing the color of leaves, and can also be used for two-line hybrid rice seed production or genetic breeding.
Description
Technical field
The present invention relates to a kind of plant chloroplast development associated protein and encoding gene and application.
Background technology
Leaf look mutant is the ideal material of a series of physiological metabolism processes such as research photosynthesis of plant, photomorphogenesis, hormone physiology, growth and development of plants.In addition, do mutually owing to existing the complicated adjusting signal between nucleus in the leaf development process and chloroplast(id), the cytoplasmic mutation body is significant to disclosing nuclear-matter Signal Regulation mechanism.Along with mutation mechanism research deepens continuously, the utility value of leaf look mutant receives more and more the concern in recent years.At first, in the crop hybrid breeding, the leaf look can be used as mark property, identifies hybrid purity, in time rejects pseudostationary, guarantees the purity of land for growing field crops hybridisation rice.Secondly, leaf look mutant provides fine germplasm resources for improving crop yield, improvement crop quality and cultivating the ornamental plant new variety, therefore, carries out the research of leaf look mutant and has far-reaching theory and practice meaning.
Paddy rice (Oryza sativa L.) is as one of most important food crop of the China and even the world, and the raising of its output has crucial strategic importance to solving following global food problem.For a long time, traditional cross-breeding means are not obtaining gratifying effect aspect the raising light-use as yet.Leaf look mutant is the ideal material that the research light energy of rice utilizes.At present, the leaf look mutant of having reported in the paddy rice has 77, wherein the white pallette variant of a class green changing type in seedling stage (Virescent) be research blade and chloroplast(id) grow and nuclear-matter between the ideal material of rejecting pseudostationary in the mutual coordinative role of gene and the crop hybrid breeding, because compare with most of albefaction lethal mutation in seedling stage bodies, the white pallette variant of green changing type shows albefaction in seedling stage, be accompanied by growing of seedling, it is green that blade slowly changes, and mutant restore normal growth.14 green changing type mutant having found in the paddy rice all are to utilize morphological markers to be positioned on the karyomit(e), yet there are no the report that the white pallette of the Fine Mapping of utilizing molecule marker and map based cloning green changing type becomes gene.
The characteristic feature of plant PPR protein gene family is that the active site of protein at genes encoding contains the PPR motifs that 35 amino acid link to each other before and after constituting, and each PPR albumen on average contains 2～26 PPR structural domains, and each PPR structural domain contains 2 alpha-helixs.In higher plant, PPR albumen is a superfamily.According to bioinformatic analysis, dicotyledonous model plant Arabidopis thaliana that has checked order and unifacial leaf model plant paddy rice contain the PPR albumen of 450 and 650 nuclear codings respectively, they are positioned in chloroplast(id) and the plastosome mostly, but have only minority PPR gene to obtain separating and its biological function being analyzed at present.
Kodiveri etc. from rice cDNA library screening and cloning to a PPR albumen that is positioned chloroplast(id), name and be OsPPR1, its 810 amino acid of encoding, contain 11 PPR motifs, the OsPPR1 afunction rice conversion plant that utilizes antisense technology to obtain, the chloroplast(id) dysplasia, the albefaction in seedling stage causes death.
Summary of the invention
The purpose of this invention is to provide a kind of plant chloroplast development associated protein and encoding gene and application.
Plant chloroplast development associated protein provided by the present invention derives from Oryza paddy rice (Oryza sativavar.Lansheng), and name is called OsPPR2, is following (a) or protein (b):
(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1.
(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and grow relevant by sequence 1 deutero-protein with plant chloroplast.
The replacement of described one or number several amino acid residues and/or disappearance and/or interpolation are meant replacement and/or disappearance and/or the interpolation that is no more than 10 amino-acid residues.
In order to make the OsPPR2 in (a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table connect label as shown in table 1.
The sequence of table 1 label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being generally 5) | RRRRR |
| Poly-His | 2-10 (being generally 6) | HHHHHH |
| |
8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned (b) but in the OsPPR2 synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.The encoding gene of OsPPR2 in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.
The encoding gene of described plant chloroplast development associated protein (OsPPR2) also belongs to protection scope of the present invention.
The encoding gene of described plant chloroplast development associated protein (OsPPR2) is following 1) or 2) or 3) dna molecular:
1) dna molecular shown in the sequence 2 in the sequence table;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the described plant chloroplast development associated protein of encoding;
3) with sequence table in SEQ ID №: 2 nucleotide sequence has a homology 80% or more and proteins encoded has the nucleotide sequence with plant chloroplast growth correlation function.
Described stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.
The recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain described plant chloroplast development associated protein encoding gene all belong to protection scope of the present invention.
Plant chloroplast development associated protein of the present invention and chloroplast(id) growth, photosynthetic efficiency and relevant photosynthetic index, the encoding gene of this rice chloroplast development associated protein is destroyed to cause the plant leaf albefaction, be applied to work such as genetic modification of plants, it is important indicator, as can be used as goal gene and be applied in the middle of the rice breed sterile line, to change the leaf look of blade, be used for the production of hybrid seeds of paddy rice two-line hybrid rice or genetic breeding.
Description of drawings
Fig. 1 is the partial linkage figure of mutator gene on the 3rd karyomit(e)
Fig. 2 is the Fine Mapping of mutator gene
Fig. 3 trains short 64S for wild-type and mutant Jade Hare S changes green front and back leaf photosynthesis pigment composition measuring result
Fig. 4 trains short 64S for wild-type and mutant Jade Hare S changes green front and back chloroplast(id) electron microscopic observation result
Fig. 5 is for changeing pCAMBIA2300-OsPPR2 plant PCR Molecular Identification result
Fig. 6 is for changeing pCAMBIA2300-OsPPR2 plant phenotypic evaluation result
Fig. 7 is for changeing pCAMBIA2300-OsPPR2 plant chloroplast(id) electron microscopic observation qualification result
Embodiment
Method described in the following embodiment if no special instructions, is ordinary method.
The acquisition and the functional verification thereof of embodiment 1, plant chloroplast development associated protein and encoding gene thereof
One, the acquisition of plant chloroplast development associated protein and encoding gene thereof
1, the white pallette variant of rice seedling green changing type Jade Hare S and genetic analysis thereof
One of this research and utilization by
60The Co-gamma-ray and mutagenesis is trained the white pallette variant of the rice seedling green changing type Jade Hare S that short 64S obtains.Jade Hare S is different with the deadly phenotype of OsPPR1 afunction rice conversion plant, and the principal character of this mutant is: the seedling leaf color albefaction, and green to the leaf looks commentaries on classics of 4 leaf phases, restore normal growth thereafter, other economical character is acted normally.Mutant the 1st～2 spire performance albefaction, only blade tip and leaf sheath show a little green, when the 3rd leaf had just been extracted out, blade tip be white, after slowly change green, after the full exhibition of blade, transfer green to, the 4th leaf begins to return to normal green.Changeing green later mutant leaf look normal, and other economical character and wild-type are similar.Mutant Jade Hare S (available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank) is changeed green front and back leaf photosynthesis pigment composition to be measured, training short 64S (available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank) with the wild-type of same growth period is contrast, and the result as shown in Figure 3.As can be seen from Figure 3, change green premutation body leaf chlorophyll a (Chla), chlorophyll b (Chlb), β-carotenoid (Car), total chlorophyll (Chl) content and all significantly be lower than wild-type (among Fig. 3 a), change 4 kinds of pigment contents of green back mutant and all raise, reach wild-type level (b among Fig. 3).We have also compared the variation of changeing green front and back mutant chlorophyll a/b ratio simultaneously, find all between 3-4 (data are unlisted), and are identical with normal paddy rice.Showing that it is that minimizing owing to total pigment causes that the white pallette variant of green changing type shows white leaf in seedling stage, is not that certain pigment composition lacks in a large number and causes.Chlorophyll a among the figure (Chla), chlorophyll b (Chlb), total chlorophyll (Chl), β-carotenoid (Car), a changes green premutation body in wild-type relatively among Fig. 3, and b is the comparison that mutant changes green back and wild-type among Fig. 3.Utilize transmission electron microscope observing mutant and wild-type changeing green front and back chloroplast(id) form, the chloroplast(id) polus animalium of finding the green premutation body of commentaries on classics is undesired, present the vesica shape of similar proplastid structure, lack the thylakoid and the starch granule structure of the chloroplast(id) that physically well develops in the wild-type; Change green back mutant chloroplast(id) grow intact, with the wild-type chloroplast structure without any difference, specifically see Fig. 4.A among Fig. 4, c, e are respectively the chloroplast(id) electron microscopic observation of wild-type 2 leaf phases, 4 leaf phases and ripe plant, and b among Fig. 4, d, f are the chloroplast(id) electron microscopic observation of mutant 2 leaf phases, 4 leaf phases and ripe plant.
With mutant Jade Hare S available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank) train short 64S (available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank) hybridization with rice varieties crown prince radix polygonati officinalis (available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank), rice varieties 9311 (available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank), rice varieties respectively, the F2 colony that obtains carries out genetic analysis.
Genetic research shows, is that female parent is hybridized the F that obtains with crown prince radix polygonati officinalis, 9311, the short 64S of training respectively with mutant Jade Hare S
1The offspring all shows as normal green, at its selfing F
2Normal plant is separated with mutant plant than near 3:1 (table 1) in the colony, is that male parent is carried out reciprocal cross with the short 64S of training with Jade Hare S, and its offspring colony leaf also shows similar results, shows that the white leaf proterties of green changing type is by a pair of recessive nuclear gene control.
The white pallette variant of table 1. green changing type and normal plant are at different F
2Separation in the colony
| Cross combination | Normal plant | Mutant strain | Total strain number | Card square value (x 2value) |
| Train short 64S/ Jade Hare S | 1169 | 392 | 1561 | 0.004 |
| Jade Hare S/9311 | 1389 | 457 | 1846 | 0.035 |
| Jade Hare S/ trains short 64S | 745 | 238 | 983 | 0.214 |
| Jade Hare crown prince S/ radix polygonati officinalis | 6221 | 2087 | 8308 | 0.043 |
2, mutator gene location
1) mutator gene Primary Location
Be chosen at the SSR mark that extensively distributes on 12 karyomit(e)s of paddy rice parent Jade Hare S and crown prince radix polygonati officinalis are carried out polymorphic screening, picked at random 600 SSR marks crown prince parent radix polygonati officinalis and the white pallette variant of green changing type are carried out polymorphism mark screening, obtaining 95, to be marked between the parent performance polymorphic.The F of polymorphic mark to Jade Hare S and crown prince radix polygonati officinalis arranged
1672 F of colony and picked at random
2White leaf individual plant in the colony, the isoconcentration hybrid dna carries out variance analysis, and the result shows, tentatively mutator gene is positioned on the 3rd karyomit(e) between the mark RM411 and RM6832, and distance is respectively 1.1cM and 1.2cM (as shown in Figure 1).
The method of above-mentioned SSR labeled analysis is as described below:
Extract the above-mentioned total DNA that chooses individual plant as template, concrete grammar is as described below:
1. get the paddy rice young leaflet tablet about 0.2 gram, place 2-mL Eppendorf pipe, place a steel ball in the pipe,, place and pulverize sample 1min on the 2000 type GENO/GRINDER instruments the Eppendorf pipe that installs sample freezing 5min in liquid nitrogen.
2. add 660 μ l extracting solutions (containing 100mM Tris-Hcl (PH 8.0), 20mM EDTA (PH 8.0), 1.4M NaCl, the solution of 0.2g/ml CTAB), violent vortex mixing on the whirlpool device, ice bath 30min.
3. add 40 μ l, 20% SDS, 65 ℃ of temperature are bathed 10min, and mixing gently turned upside down every two minutes.
4. add 100 μ l 5M NaCl, gentle mixing.
5. add 100 μ l, 10 * CTAB, 65 ℃ of temperature are bathed 10min, are interrupted the mixing that turns upside down gently.
6. add 900 μ l chloroforms, abundant mixing, the centrifugal 3min of 12000rpm.
7. shift in supernatant liquor to the 1.5mL Eppendorf pipe, add 600 μ l Virahols, mixing, the centrifugal 5min of 12000rpm.
8. abandon supernatant liquor, precipitate once the room temperature airing with the rinsing of 70% (volumn concentration) ethanol.
9. add 100 μ l, 1 * TE (121 gram Tris are dissolved in 1 premium on currency, the solution of transferring pH value to 8.0 to obtain with hydrochloric acid) dissolving DNA.
10. get 2 μ l electrophoresis detection DNA quality, and with DU800 spectrophotometric determination concentration (BechmanInstrument Inc.U.S.A).
The DNA of said extracted is diluted into about 20ng/ μ l, carry out pcr amplification as template;
PCR reaction system (10 μ l): DNA (20ng/ul) 1ul, upstream primer (2pmol/ul) 1ul, downstream primer (2pmol/ul) 1ul, 10xBuffer (MgCl
2Free) 1ul, dNTP (10mM) 0.2ul, Mg Cl
2(25mM) 0.6ul, rTaq (5u/ul) 0.1ul, ddH
2O 5.1ul, 10ul altogether.
PCR response procedures: 94.0 ℃ of sex change 5min; 94.0 ℃ sex change 30s, 55 ℃ of annealing 30s, 72 ℃ of extension 1min circulate 35 times altogether; 72 ℃ are extended 7min; 10 ℃ of preservations.PCR is reflected in the MJ Research PTC-225 thermal cycler and carries out.
The PCR product of SSR mark detects: amplified production is with 8% native polyacrylamide gel electrophoresis analysis.DNA Ladder with 50bp is the molecular weight size of comparing amplified production, and silver dyes colour developing.
2) mutator gene Fine Mapping
According to the result of Primary Location, near the molecule marker of seeking the mutator gene region on the public collection of illustrative plates, and developing SSR mark voluntarily.With the white leaf individual plant checking in the F2 colony, screen the further positional mutation body of multiple labeling gene at this chromosomal relevant section.At Jade Hare S and crown prince radix polygonati officinalis hybridization deutero-F
2Choose 2240 F in the colony
2The rice plant of the mutant strain phenotype in the colony) is used for the mutator gene Fine Mapping.Utilize the molecule marker on the public collection of illustrative plates and based on the independently developed SSR of Public Rice Genome Sequence Data, CAPS, dCAPS molecule marker mutator gene has been carried out Fine Mapping, and tentatively determine mutator gene according to positioning result, concrete grammar is as described below:
1. SSR marker development
The SSR mark and the rice genome sequence of public collection of illustrative plates are integrated, downloaded near the BAC/PAC cloned sequence in mutational site, with SSR (Li Qiang etc., heredity, 2005,27 (5): 808-810) among the SSRHunter software search clone.By the online screening of blast program 9311 and Nipponbare between the polymorphic SSR of performance, to polymorphic SSR design primer is arranged, as shown in table 2.Go up warm and fine 9311 sequences of Japan according to RGP and compare, developed 78 pairs of SSR marks, obtain 3 the polymorphic 3h65 of being labeled as, 3h83,3h112 (table 2), the distance with mutator gene is 0.7cM, 0.3cM, 0.2cM (Fig. 2) respectively.
Table 2. is designed for the molecule marker of Fine Mapping
| Mark | Primer | Size (bp) | Type | The place clone |
| 3h65 | 5′-ACCCACTTGTCATCACC-3′ 5′-CCCACCCTCAACCTCATC-3′ | 259 | SSR (ctt)13 | OSJNBa0010D22 |
| 3h83 | 5′-ACACGGCAAGGCTATCG-3′ 5′-CCATCAACGGTGAGGGA-3′ | 174 | SSR (ga)14 | OSJNBb0056O10 |
| 3h112 | 5′-ATGAAATACTTTTGACAGGGAA-3′ 5′-TGGATCTTTGTAATAATTGGCT-3′ | 184 | SSR (aag)13 | OSJNBa0087M10 |
| P26 | 5′-TCCTTCCCGCCAACCCTCTC-3′ 5′-TACTGCTGGGCTTCCCGTTC-3′ | 149 | SSR (aat)5 | OSJNBb0042N11 |
| D2 | 5′-CCTCCTCATAGCCCCAATCC-3′ 5′-TCACTCTCCCATAGGTGGTC-3′ | 253 | dCAPS AsuI | OSJNBb0042N11 |
| D8 | 5′-GTGAAGGCTCTAGCGCGACT-3′ 5′-ATGGCGTTGTTTAAGGGGAC-3′ | 277 | dCAPS SpeI | OSJNBa0087M10 |
| P45 | 5′-TTTCACCCTCTTTTCCCCCC-3′ 5′-TCAGACCCGATACATAGCACGAC-3′ | 430 | CAPS NcoI | OSJNBa0087M10 |
| P50 | 5′-CATTATCATTTGTCACGCTCAG-3′ 5′-CTTTGTACTCTTGTGCACTTCCA-3′ | 408 | CAPS ScaI | OSJNBa0087M10 |
2. CAPS, dCAPS marker development
After choosing Nipponbare correlated series that oneself announces and search the short 64S sequence of training that the big gene center of Beijing China provides from the website of rice genome plan (RGP), on the NCBI website, find 9311 sequences again.Search out 9311 and train the SNP that exists between the short 64S, design CAPS or dCAPS mark by analysis.After carrying out polymorphism analysis by two parents, the PCR product that does not have SNP between two parents is cut glue reclaim order-checking, find two parents' SNP, design CAPS or dCAPS mark segregating population.Colony is extended to 2240 F2 individual plants with mutant phenotype, find 5 polymorphic CAPS marks (table 2), mark P50 and mutant gene locus are divided into from (Fig. 2), and mutant gene locus is positioned between the mark D8 and P45 on the BAC OSJNBb0087M10, and physical distance is 45kb.
The PCR reaction system of CAPS/dCAPS labeled analysis: DNA (20ng/ul) 2ul, Primer1 (10pmol/ul) 2ul, Primer2 (10pmol/ul) 2ul, 10xBuffer (MgCl
2Free) 2ul, dNTP (10mM) 0.4ul, MgCl
2(25mM) 1.2ul, rTaq (5u/ul) 0.4ul, ddH
2O
410ul, cumulative volume 20ul.
Amplified reaction carries out on PTC-200 (MJ Research Inc.) PCR instrument: 94 ℃ of 3min; 94 ℃ of 30sec, 55 ℃ of (the primer difference is adjusted to some extent) 45sec, 72 ℃ of 2.5min, 35 circulations; 72 ℃ of 5min.
The PCR product purification reclaims and is undertaken by test kit (Beijing Tiangen company) step.PCR product enzyme is cut after digestion spends the night, with electrophoretic separation in the sepharose of 1-4%, through EB dyeing back in ultraviolet lamp down observation take pictures.DCAPS separates with 8% non-sex change PAGE glue, and silver dyes.
According in the F2 colony seedling stage white leaf individual plant molecular data and phenotypic data, carry out linkage analysis by MAPMAKER/EXP3.0 software, adopt the Kosambi function to convert recombination fraction to genetic distance cM (Centimorgan), with the relative position between the definite mark of " map " order.The result as shown in Figure 2, among Fig. 2 a for the design SSR mark and mutator gene linkage map.B contains the BAC contig of mutator gene, and arrow is illustrated in the mark that BAC goes up design.C utilizes F
22240 linkage maps in the colony with mutant phenotype individual plant Fine Mapping mutator gene, the exchange number of individuals between horizontal line below each mark of numeral and mutant gene locus.
3) acquisition of mutator gene
According to localized site design primer, sequence is as described below: primer1:
5 ' CGC
CCCGGGCCCACCTGTACTTTACTTTAGC3 ' (sequence shown in the underscore is the SmaI enzyme recognition site); Primer2:5 ' CGC
TCTAGAATCCACTCTTTGA GATTTCCC3 ' (sequence shown in the underscore is the XbaI enzyme recognition site).
With primer1 and primer2 is primer, is masterplate with the genomic dna of training short 64S, carries out pcr amplification and obtains goal gene.
Amplified reaction carries out on PTC-200 (MJ Research Inc.) PCR instrument: 94 ℃ of 3min; 94 ℃ of 30sec, 60 ℃ of 45sec, 72 ℃ of 2.5min, 35 circulations; 72 ℃ of 5min.Connect into pBS-T (purchase) sequencing vector after will the PCR product reclaiming purifying, transform DH5 α competent cell from Beijing Tiangen company, select positive colony after, check order.
Sequencing is the result show, the fragment that the PCR reaction obtains has the nucleotide sequence shown in the sequence 2 in the sequence table, be plant chloroplast development related gene of the present invention, its encoding sequence is 5 ' end 1-2229 position nucleotide sequence of sequence 2 in sequence table, 742 amino acid of encoding, this amino acid has the amino acid residue sequence of sequence 1 in the sequence table, contains the albumen of 9 PPR (Pentatricopeptide repeat) structural domain.With this albumen called after OsPPR2.With the above-mentioned recombinant vectors called after pBS-OsPPR2 that contains plant chloroplast development related gene of the present invention.
Two, the functional verification of plant chloroplast development associated protein (OsPPR2) and encoding gene thereof:
1. expression vector establishment
With pBS-OsPPR2 SmaI and XbaI double digestion, the fragment that will contain the OsPPR2 gene reclaims, be connected on the pCAMBIA2300 carrier that SmaI and XbaI double digestion are handled (Australian CAMBI company), the plant expression vector that obtains recombinating, the recombinant vectors that builds transforms DH5a, extract plasmid and be used for the enzyme detection of cutting and check order, detection is shown the correct recombinant vectors called after pCAMBIA2300-OsPPR2 that contains the OsPPR2 gene.
To cut and check order through enzyme with electric shocking method and detect pCAMBIA2300-OsPPR2 and transform Agrobacterium LBA4404 (Invitrogen company, 18313-015) bacterial strain, obtain recombinant bacterial strain, extract that plasmid carries out PCR and enzyme is cut evaluation.PCR identifies that with primer be primer35 ' CCCACCTGTACTTTACTTTAGC3 ' and primer45 ' ATCCACTCTT TGAGATTTCCC3 '; Amplified production is that 2.2kb is the evaluation positive.PCR and enzyme are cut the correct recombinant bacterial strain called after EH-pCAMBIA2300-OsPPR2 of evaluation.
2. agrobacterium mediation converted
Utilize agriculture bacillus mediated with (Jade Hare s is handled through the 60Co-gamma-rays by the Pai64s kind among the EH-pCAMBIA2300-OsPPR2 white green mutant Jade Hare s of commentaries on classics of conversion (available from Institute of Crop Science, Chinese Academy of Agricultural Science's germplasm resource bank) that builds, the mutant with the green feature of white commentaries on classics that obtains through the selfing of 5 generations contains mutator gene OsPPR2 gene through Molecular Identification then) concrete grammar is:
1) cultivated EH-pCAMBIA2300-OsPPR2 16 hours for 28 ℃, collect thalline, and be diluted to the N6 liquid nutrient medium that contains 100 μ mol/L (Sigma company buys, C1416), in to concentration be OD
600≈ 0.5, obtains bacterium liquid;
2) will be cultured to one month paddy rice mature embryo embryo callus and above-mentioned bacterium liquid mixed infection 30min, filter paper changes in the common culture medium (the N6 solid is culture medium altogether, and Sigma company buys) after blotting bacterium liquid, cultivates altogether 3 days for 24 ℃;
3) above-mentioned callus is seeded on the N6 solid screening culture medium that contains 150mg/L Totomycin (purchase of Sigma company) and screened 16 days for the first time;
4) the healthy callus of picking changes programmed screening on the N6 solid screening culture medium of 200mg/L Totomycin over to, and per 15 days subcultures once;
5) the picking kanamycin-resistant callus tissue changes on the division culture medium that contains the 150mg/L Totomycin and breaks up;
6) the reuse water rice plants of seedling differentiation is the commentaries on classics pCAMBIA2300-OsPPR2 plant of the OsPPR2 that is obtained.
3. transfer-gen plant Molecular Identification and OsPPR2 gene function checking
The T of the commentaries on classics pCAMBIA2300-OsPPR2 plant that above-mentioned steps 2 obtains
1Generation (T
0The plant that seed that generation obtains and seed growth obtain) seed (woulding you please confirm whether this descriptions correct), train short 64S (wild-type contrast) seed and Jade Hare S (mutant contrast) seed is being planted in the case of manually growing, the illumination of growth case is 1000lux, temperature is 25 ℃ of 28 ℃/nights in daytime, diurnal cycle is 14h/10h, and relative air humidity is 55%.At seedling 2 leaves 1 heart stage evaluation phenotype and chloroplast(id) electron microscopic observation, sampling is simultaneously extracted DNA and is carried out the PCR Molecular Detection.
The method that the commentaries on classics pCAMBIA2300-OsPPR2 plant that above-mentioned steps 2 is obtained carries out the PCR Molecular Detection is: with Primer1:GAGATGAAGAACAGTGGATGC and Primer2:TTTTCTTGCATAACCCGTCA is that primer is to carrying out pcr amplification, PCR reaction system: DNA (20ng/ul) 2ul, Primer1 (10pmol/ul) 2ul, Primer2 (10pmol/ul) 2ul, 10xBuffer (MgCl
2Free) 2ul, dNTP (10mM) 0.4ul, Mg Cl
2(25mM) 1.2ul, rTaq (5u/ul) 0.4ul, ddH
2O
410ul, cumulative volume 20ul.Amplified reaction carries out on PTC-200 (MJ Research Inc.) PCR instrument: 94 ℃ of 3min; 94 ℃ of 30sec, 55 ℃ of 45sec, 72 ℃ of 1min, 35 circulations; 72 ℃ of 5min.The PCR product purification reclaims and is undertaken by test kit (Beijing Tiangen company) step.The PCR product separates with 8% non-sex change PAGE glue, and silver dyes.The result shows that obtaining 13 strain PCR detects the male plant, and as shown in Figure 5,1 of Fig. 5 is that wild-type is the band that template amplification goes out, the 2nd, and mutant is the band that template amplification goes out, 3-15 is that commentaries on classics pCAMBIA2300-OsPPR2 plant is the band that template amplification goes out.Above-mentioned PCR is detected the male plant carry out phenotype analytical, the plant that obtains complementary phenotype has the band of wild-type and mutant simultaneously, proves that wild type gene is transformed in the mutant.
Above-mentioned PCR is detected male change pCAMBIA2300-OsPPR2 plant phenotypic evaluation result, the same with wild-type, 13 strains change pCAMBIA2300-OsPPR2 plant phenotype be green (b among Fig. 6, c), and the phenotype of mutant Jade Hare S still to be the albefaction seedling (see among Fig. 6 a).Among Fig. 6, a is mutant Jade Hare S, and b is for changeing the pCAMBIA2300-OsPPR2 plant, and c is that wild-type is trained short 64S.
Electron microscopic observation shows that PCR detects the interior utricule film of male commentaries on classics pCAMBIA2300-OsPPR2 plant (b among Fig. 7) chloroplast(id) obviously (a) to be increased among Fig. 7 than mutant Jade Hare S.Among Fig. 7, a is mutant Jade Hare S, and b is for changeing the pCAMBIA2300-OsPPR2 plant.
The result shows, all PCR identify that male change the normal green after the white commentaries on classics green (the OsPPR2 gene is a recessive gene) of its phenotypes of pCAMBIA2300-OsPPR2 rice plant before by transgenosis changes transgenosis into.Verified the preceding green proterties of white commentaries on classics of transgenosis by the OsPPR2 Gene Handling, promptly this OsPPR2 gene is the chloroplast(id) development related gene.
Sequence table
<160>2
<210>1
<211>742
<212>PRT
＜213〉Oryza paddy rice (Oryza sativa var.Lansheng)
<400>1
<210>2
<211>2229
<212>DNA
＜213〉Oryza paddy rice (Oryza sativa var.Lansheng)
<400>2
Claims (9)
1, a kind of plant chloroplast development associated protein is the protein with one of following amino acid residue sequences:
1) amino acid residue sequence of the SEQ ID № .1 in the sequence table;
2) with the SEQ ID № .1 amino acid residue sequence in the sequence table through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have plant chloroplast grow correlation function by SEQ ID №: 1 deutero-protein.
2, the encoding gene of the described plant chloroplast development associated protein of claim 1.
3, encoding gene according to claim 2 is characterized in that: the encoding gene of described plant chloroplast development associated protein has one of following nucleotide sequence:
1) SEQ ID № in the sequence table: 2 nucleotide sequence;
2) can be with 1 under stringent condition) nucleotide sequence of described dna sequence dna hybridization.
3) with sequence table in SEQ ID №: 2 nucleotide sequence has a homology 80% or more and proteins encoded has the nucleotide sequence with plant chloroplast growth correlation function.
4, the recombinant expression vector that contains claim 2 or 3 described plant chloroplast development associated protein encoding genes.
5, the transgenic cell line that contains claim 2 or 3 described plant chloroplast development associated protein encoding genes.
6, the transgenosis reorganization bacterium that contains claim 2 or 3 described plant chloroplast development associated protein encoding genes.
7, claim 2 or the 3 described plant chloroplast development associated protein encoding genes application in the transgenic plant of cultivating the variation of chloroplast(id) development condition.
8, claim 2 or the 3 described plant chloroplast development associated protein encoding genes application in the transgenic plant of cultivating the seedling leaf albefaction.
9, according to claim 7 or 8 described application, it is characterized in that: described plant is a paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100795686A CN101486757B (en) | 2009-03-06 | 2009-03-06 | Plant chloroplast development associated protein, and coding gene and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100795686A CN101486757B (en) | 2009-03-06 | 2009-03-06 | Plant chloroplast development associated protein, and coding gene and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101486757A true CN101486757A (en) | 2009-07-22 |
| CN101486757B CN101486757B (en) | 2012-03-14 |
Family
ID=40889832
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100795686A Expired - Fee Related CN101486757B (en) | 2009-03-06 | 2009-03-06 | Plant chloroplast development associated protein, and coding gene and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101486757B (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212122A (en) * | 2011-05-12 | 2011-10-12 | 浙江省农业科学院 | Mutant lethal gene for controlling development of rice chloroplasts and application thereof |
| CN103014022A (en) * | 2012-12-18 | 2013-04-03 | 上海师范大学 | Gene for controlling early rice chloroplast development and application thereof |
| CN103014021A (en) * | 2012-12-13 | 2013-04-03 | 浙江大学 | Rice chloroplast early development control gene OsMCP-UF and application thereof |
| CN103114076A (en) * | 2013-01-29 | 2013-05-22 | 浙江省农业科学院 | Rice leaf color control gene heme oxygenase2 (HO2) and application thereof |
| CN108220330A (en) * | 2017-12-30 | 2018-06-29 | 青岛袁策生物科技有限公司 | Utilize the method for Albino Seedling initiative rice sterile line |
| CN108374015A (en) * | 2018-03-22 | 2018-08-07 | 广东省农业科学院水稻研究所 | A kind of application of gene Loc_Os01g12810 |
| CN109608531A (en) * | 2019-01-18 | 2019-04-12 | 中国科学院植物研究所 | FPA and FPAL is in the regulation developmental application of plant chloroplast |
| CN110386968A (en) * | 2019-08-12 | 2019-10-29 | 中国农业科学院作物科学研究所 | The application of TaYgl albumen and its encoding gene in regulation wheat leaf color |
| CN110964730A (en) * | 2019-12-11 | 2020-04-07 | 浙江大学 | Application of rice leaf whitening trait gene OsLCD1 in regulation and control of rice leaf color trait |
| WO2020232661A1 (en) * | 2019-05-22 | 2020-11-26 | Sinobioway Bio-Agriculture Group Co., Ltd. | Abiotic stress tolerant plants and methods |
| CN113234733A (en) * | 2021-06-01 | 2021-08-10 | 浙江省农业科学院 | Related gene for rice chloroplast development, molecular marker and application |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420207B (en) * | 2015-12-03 | 2019-01-15 | 南京农业大学 | Albumen relevant to rice chloroplast RNA polymerase PEP and Development of Chloroplasts and its encoding gene and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1223606C (en) * | 2002-08-29 | 2005-10-19 | 清华大学 | Rice DREB transcription factor and its encoding gene and use |
-
2009
- 2009-03-06 CN CN2009100795686A patent/CN101486757B/en not_active Expired - Fee Related
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212122A (en) * | 2011-05-12 | 2011-10-12 | 浙江省农业科学院 | Mutant lethal gene for controlling development of rice chloroplasts and application thereof |
| CN103014021A (en) * | 2012-12-13 | 2013-04-03 | 浙江大学 | Rice chloroplast early development control gene OsMCP-UF and application thereof |
| CN103014021B (en) * | 2012-12-13 | 2014-07-02 | 浙江大学 | Rice chloroplast early development control gene OsMCP-UF and application thereof |
| CN103014022A (en) * | 2012-12-18 | 2013-04-03 | 上海师范大学 | Gene for controlling early rice chloroplast development and application thereof |
| CN103014022B (en) * | 2012-12-18 | 2014-12-17 | 上海师范大学 | Method for detecting gene for controlling early rice chloroplast development |
| CN103114076A (en) * | 2013-01-29 | 2013-05-22 | 浙江省农业科学院 | Rice leaf color control gene heme oxygenase2 (HO2) and application thereof |
| CN108220330A (en) * | 2017-12-30 | 2018-06-29 | 青岛袁策生物科技有限公司 | Utilize the method for Albino Seedling initiative rice sterile line |
| CN108374015A (en) * | 2018-03-22 | 2018-08-07 | 广东省农业科学院水稻研究所 | A kind of application of gene Loc_Os01g12810 |
| CN109608531A (en) * | 2019-01-18 | 2019-04-12 | 中国科学院植物研究所 | FPA and FPAL is in the regulation developmental application of plant chloroplast |
| WO2020232661A1 (en) * | 2019-05-22 | 2020-11-26 | Sinobioway Bio-Agriculture Group Co., Ltd. | Abiotic stress tolerant plants and methods |
| US11976289B2 (en) | 2019-05-22 | 2024-05-07 | Pioneer Overseas Corporation | Abiotic stress tolerant plants and methods |
| CN110386968A (en) * | 2019-08-12 | 2019-10-29 | 中国农业科学院作物科学研究所 | The application of TaYgl albumen and its encoding gene in regulation wheat leaf color |
| CN110964730A (en) * | 2019-12-11 | 2020-04-07 | 浙江大学 | Application of rice leaf whitening trait gene OsLCD1 in regulation and control of rice leaf color trait |
| CN113234733A (en) * | 2021-06-01 | 2021-08-10 | 浙江省农业科学院 | Related gene for rice chloroplast development, molecular marker and application |
| CN113234733B (en) * | 2021-06-01 | 2022-06-03 | 浙江省农业科学院 | Related gene for rice chloroplast development, molecular marker and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101486757B (en) | 2012-03-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101486757B (en) | Plant chloroplast development associated protein, and coding gene and use thereof | |
| CN101698677B (en) | Protein relevant to plant height, coding gene and application thereof | |
| CN101704881B (en) | Plant male fertility-associated protein, coding gene and application thereof | |
| CN108239647A (en) | A kind of gene, molecular labeling and application for controlling rape plant type | |
| CN102311490B (en) | Plant heat-resistant gene JAZ5a and application thereof | |
| CN110183525A (en) | The relevant TXR albumen of wheat stripe rust resisting disease and its encoding gene and application | |
| WO2011072478A1 (en) | Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN106434708A (en) | Rice MSP1 gene mutant, and molecular identification method and application thereof | |
| CN102617717B (en) | Protein OsGPA3 relevant to sorting of plant glutelin, encoding gene of protein OsGPA3 and applications of protein OsGPA3 and encoding gene | |
| CN102311491B (en) | Plant heat-resistant gene HSF1 and application thereof | |
| CN102603878B (en) | Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof | |
| CN106555001A (en) | A kind of molecular labeling of rice blast resistant gene and its application | |
| CN100569949C (en) | Rice chlorophyll synthase mutant gene and genetically engineered thereof are used | |
| CN106086036B (en) | Rice seedling blade albefaction character gene Oscaac1 and its application | |
| CN107475266A (en) | A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application | |
| CN110468150A (en) | RGS1 gene is improving widow according to the application under environment in tomato bacterial leaf spot resistance as negative regulatory factor | |
| CN101701038B (en) | Plant low temperature growth associated protein, code genes and application thereof | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| CN107236810A (en) | Corn male nuclear sterile gene, its molecular labeling and application | |
| CN104341494B (en) | The albumen ZmWAK and its encoding gene of a kind of high anti-head-smut and its application | |
| CN115232823A (en) | Leaf development related gene of Echinacea purpurea and application thereof | |
| CN101704883B (en) | Plant yellow dwarf resistance-associated protein TiDPK1, coding gene and application thereof | |
| CN111534524A (en) | Rice field abortive cytoplasmic male sterility restoring gene RF3 and application thereof | |
| CN105950598B (en) | Rice dormancy-breaking related protein and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120314 Termination date: 20150306 |
|
| EXPY | Termination of patent right or utility model |