CN113234733A - Related gene for rice chloroplast development, molecular marker and application - Google Patents
Related gene for rice chloroplast development, molecular marker and application Download PDFInfo
- Publication number
- CN113234733A CN113234733A CN202110610998.7A CN202110610998A CN113234733A CN 113234733 A CN113234733 A CN 113234733A CN 202110610998 A CN202110610998 A CN 202110610998A CN 113234733 A CN113234733 A CN 113234733A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- seq
- chloroplast
- chloroplast development
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/20—Reduction of greenhouse gas [GHG] emissions in agriculture, e.g. CO2
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Botany (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a related gene for rice chloroplast development, a molecular marker and application thereof, wherein a nucleotide sequence of the related gene YL22 is shown as SEQ ID No.1, a 222 th base G on a fifth exon is replaced by a base A on the basis of the nucleotide sequence SEQ ID No.1, the mutated nucleotide sequence is shown as SEQ ID No.2, and the change of the YL22 gene can cause yellow leaf phenotype of rice. The nucleotide sequence of the molecular marker for identifying gene YL22 is shown in SEQ ID NO.3 and SEQ ID NO. 4. The nucleotide sequences of the molecular markers for identifying the yellow leaf phenotype are shown in SEQ ID NO.5 and SEQ ID NO. 6. The invention further enriches the rice leaf color germplasm resources, can be used as a leaf color marker to be applied to breeding of new rice varieties, and has important significance for researching a chloroplast development regulation mechanism.
Description
Technical Field
The invention relates to a rice chloroplast development related gene, in particular to a rice chloroplast development related gene YL22, a molecular marker and application.
Background
Photosynthesis is the most important chemical reaction on the earth, green plants convert light energy into chemical energy through a series of biochemical reactions by using carbon dioxide and water and release oxygen, more than 90% of the dry matter yield of crops is from photosynthesis, and the efficiency of the photosynthesis is closely related to the structural integrity of chloroplasts, the development height of the chloroplasts and the like. Therefore, the rice leaf color mutant is an ideal material for exploring physiological processes such as plant photosynthesis, chloroplast development and the like.
Chloroplast development is a complex process, co-regulated by nuclear and chloroplast genes. The CRM domain is an RNA binding domain of approximately 100 amino acids that affects the splicing of group I and group II introns. 14 proteins in rice contain one or more CRM domains, of which CSR2 binds to CAF1 and CAF2, respectively, to form protein complexes CRS2-CAF1 and CRS2-CAF2, which are important for splicing group II introns. AL2 is a rice functional CRS1, and may be involved in splicing of chloroplast group I introns in addition to class II introns. Furthermore, OsCFM2 belongs to the CRS1 subfamily in rice, affecting the splicing of group I and group II introns, and OsCFM3 is involved in the splicing of group II introns. Besides being used for splicing group I and II introns, the CRM domain can also retain the assembling function of ribosome and influence the processing of rRNA in chloroplast. Therefore, CRM domain protein plays an important role in the development of chloroplasts.
Disclosure of Invention
The invention aims to provide a related gene YL22 for rice chloroplast development, a molecular marker and application, wherein the change of the YL22 gene can cause yellow leaf phenotype of rice, so that the leaf color germplasm resources of the rice are further enriched, the gene can be used as a leaf color marker to be applied to breeding of new rice varieties, and the gene has important significance on research on a chloroplast development regulation mechanism.
In order to achieve the aim, the invention provides a related gene YL22 for rice chloroplast development, wherein the nucleotide sequence of the gene YL22 is shown as SEQ ID NO. 1.
Preferably, the mutation of the gene YL22 is to replace the 222 th base G on the fifth exon (i.e. the 2824 th base in the sequence of SEQ ID NO. 1) with the base A on the basis of the nucleotide sequence of SEQ ID NO.1, and the nucleotide sequence after mutation is shown as SEQ ID NO. 2.
Another objective of the invention is to provide a gene related to chloroplast development of rice with yellow leaf phenotype, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2.
Preferably, the gene related to chloroplast development in rice having the yellow leaf phenotype results in decreased chloroplast RNA splicing efficiency.
Preferably, the gene related to chloroplast development in rice having the yellow leaf phenotype is abnormal in chloroplast thylakoid structure.
Another objective of the invention is to provide a plant recombinant vector containing the gene related to chloroplast development of rice with yellow leaf phenotype.
The invention also aims to provide a molecular marker for locating the related gene YL22 for rice chloroplast development, wherein the nucleotide sequence of the upstream sequence of the molecular marker is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID NO. 4.
Another purpose of the invention is to provide a molecular marker for identifying related genes of chloroplast development of yellow leaf phenotype rice, wherein the nucleotide sequence of an upstream sequence of the molecular marker is shown as SEQ ID NO.5, and the nucleotide sequence of a downstream sequence of the molecular marker is shown as SEQ ID NO. 6.
The invention also aims to provide the application of the gene YL22 related to the development of rice chloroplast or the gene related to the development of rice chloroplast of yellow leaf phenotype in breeding new rice varieties.
The invention also aims to provide the application of the gene YL22 related to rice chloroplast development or the gene related to rice chloroplast development with yellow leaf phenotype in rice chloroplast development regulation.
The related gene YL22 for rice chloroplast development, the molecular marker and the application have the following advantages:
the change of the gene YL22 related to rice chloroplast development can cause yellow leaf phenotype of rice, chlorophyll a, chlorophyll b and carotenoid are all obviously lower than wild type in seedling stage, tillering stage and heading stage, the function of the gene is verified by transgene complementation, and the result of a subcellular localization test shows that the gene is expressed in chloroplast. The yellow leaf gene further enriches the germplasm resources of the leaf color of the rice, can be used as a leaf color marker to be applied to breeding of new rice varieties, and has certain significance for analyzing a chloroplast development regulation mechanism.
Drawings
FIG. 1 shows a comparison of the phenotypes of Xiushu 09 and yl22 in example 1 of the present invention.
FIG. 2 shows the location map of the rice gene YL22 of the present invention.
FIG. 3 shows the phenotype and chlorophyll content of the transgenic plants of the present invention.
FIG. 4 shows the chloroplast microstructure of mutant yl22 of the invention.
FIG. 5 shows fluorescence of yl22 chlorophyll according to the present invention.
FIG. 6 shows subcellular localization of YL22 protein of the present invention.
FIG. 7 shows that YL22 gene of the present invention is involved in chloroplast RNA splicing.
FIG. 8 shows the sequencing result of the gene YL22 related to chloroplast development.
FIG. 9 is a schematic structural diagram of a pCAMBIA1305-GFP co-expression vector constructed in the present invention.
Note: in fig. 1, a. plant phenotype at seedling stage; B. the chlorophyll content in the seedling stage; C. plant phenotype at tillering stage; D. chlorophyll content at tillering stage; E. plant phenotype at heading stage; F. chlorophyll content at heading stage; bar 1cm, P < 0.05; p < 0.01; in FIG. 2, the A.YL22 gene is located between the Z-2 and Z-4 markers near the centromere of chromosome 1; B. a mutation site of the candidate gene LOC _ Os01g31110 of the localization interval; in FIG. 4, A. Xiushui 09 seedling stage (0.2 μm); B. xishui 09 tillering stage (0.2 μm); C. xishui 09 heading date (0.5 μm); the seedling stage of yl22 (0.2 μm); the tillering stage of yl22 (0.2 μm); the yyl 22 heading date (0.5 μm); G. a base particle; OG. osmium bodies; in FIG. 5, A. seedling stage leaf Fv/Fm; B. seedling stage leaf Y (NO).
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Experimental example 1: phenotypic identification and genetic analysis of Rice yl22
Mutant yl22 was obtained by chemical mutagenesis of conventional japonica rice Xiuhua 09 with Ethyl Methane Sulfonate (EMS), and the phenotypes of mutant yl22 and Xiuhua 09 at seedling stage, tillering stage and heading stage were observed, and the contents of chlorophyll a (Chl a), chlorophyll b (Chl b) and carotenoid (Car) were detected and counted, and the results are shown in FIG. 1.
The results show that the leaves of mutant yl22 were yellow throughout the growth cycle, and chlorophyll a, chlorophyll b and carotenoids were significantly lower at seedling stage, tillering stage and heading stage than those of control variety xiu shui 09 (WT).
F obtained by crossing mutant yl22 with Xiuhui 091Plant, F1Leaves of the plants are all green, and then F is added1Plant selfing to obtain genetic analysis population F2At F2The character separation of the leaf color phenotype is found in the population, 2751 green leaf seedlings and 857 yellow leaf seedlings exist, and the separation ratio (chi) is 3:12＝2.99<χ20.05-3.84), the trait was determined to be under the control of a single recessive nuclear gene.
Experimental example 2: positioning and complementation verification of chloroplast development related gene YL22
F obtained by crossing mutant yl22 plant with indica restorer line Minghui 861Plant, F1Seed bearing on the plant, after sowing to obtain F2And (5) positioning the population. Through a map-based cloning method, a molecular marker Z-4-F/R is developed for gene localization, and the sequence of the molecular marker Z-4-F: AGGGGTAAACTGAACTACTCCT (SEQ ID NO. 3); sequence of molecular marker Z-4-R: AGAATATCCAAGCGAATTCCCA (SEQ ID NO. 4). The PCR reaction system is as follows: primer 2. mu.L, 2 × Tac MIX 5. mu.L, CDS 1. mu.L, ddH2O2 mu L; the reaction procedure for PCR amplification was as follows: 94 deg.C (3 min); 94 ℃ (30s), 55 ℃ (45s), 72 ℃ (30s), 35 cycles; 72 deg.C (6 min). The chloroplast development related gene of mutant yl22 was located within about 913kb of the region around chromosome 1 centromere, and the candidate gene was identified as LOC _ Os01g31110 by resequencing. Referring to FIG. 2, LOC _ Os01G31110 has five exons, and sequencing results show that a single base substitution occurs in the fifth exon of the gene, from base G to base A, resulting in the substitution of glycine with serine.
For further validation, sequencing molecular marker YL22-5 was designed for gene sequencing, the sequence of molecular marker YL 22-5-F: TGTGATCTTGTCCGGGTTGA (SEQ ID NO. 5); sequence of molecular marker YL 22-5-R: ACTGTTAACACCATCGCTGC (SEQ ID NO. 6). The PCR reaction system is as follows: primer 3. mu.L, F (x) 1. mu.L, DNA 5. mu.L, Buffer 25. mu.L, dNTP 10. mu.L, ddH2O6 mu L; the reaction procedure for PCR amplification was as follows: 94 deg.C (3 min); 98 ℃ (15s), 55 ℃ (30s), 68 ℃ (2min), 35 cycles; 68 deg.C (6 min). The sequencing results are shown in FIG. 8, and the gene encodes a protein containing two Chloroplast RNA splicing and ribosome maturation (CRM) domains.
To further verify whether LOC _ Os01g31110 is a mutant gene of mutant YL22, a transgenic complementation vector pCAMBIA-1305 was constructed by ligating the cDNA sequence of gene YL22 to the vector pCAMBIA-1305, and the transgenic complementation vector was transformed into callus of mutant YL22 by Agrobacterium transfection method to carry out gene function complementation verification. An RNAi vector pTCK303 is constructed, the interference fragment is transformed into a wild type callus of the Xiuhui 09 by an agrobacterium transfection method, YL22 gene is silenced, and an RNAi transgenic positive plant of YL22 is obtained.
Referring to FIG. 3(A, C, E shows the phenotype of the plant at seedling stage, tillering stage and heading stage, B, D, F shows the chlorophyll content of the plant at seedling stage, tillering stage and heading stage, respectively; WT shows water 09, RNAi shows the RNAi transgenic positive plant, YL22 shows the mutant YL22, and Com shows the complementation verification plant), the phenotype of the complementation plant is recovered from yellow leaf phenotype to green leaf normal phenotype, the leaf color and chlorophyll content of the seedling stage are consistent with those of the wild plant, the RNAi transgenic positive plant shows the three-leaf albino lethal phenotype, and LOC _ Os01g31110 is proved to be the chloroplast development related gene YL 22.
Experimental example 3: observation of chloroplast transmission electron microscope
When the ultrastructure of chloroplast in seedling stage, tillering stage and heading stage of mutant yl22 and xishui 09(WT) was observed by transmission electron microscopy, it was found that chloroplast thylakoid lamina structure was looser and the number of stacked basal lamina was reduced in yl22, as shown in fig. 4.
Experimental example 4: chlorophyll fluorescence kinetic imaging
Chlorophyll fluorescence can reflect photosynthesis-related processes such as light energy absorption and photosynthesis energy conversion efficiency, and is related to electron chain transfer, ATP synthesis and CO2And (4) fixing. The chlorophyll fluorescence kinetic parameter Fv/Fm is the maximum photochemical quantum yield of the PS II (photosystem II), the parameter is relatively stable, the light energy conversion efficiency in the PS II reaction center is reflected, and the parameter is obviously reduced under the stress condition, so that the light energy conversion efficiency in the PS II reaction center is reduced. Y (NO) is an important marker of photodamage, and the greater Y (NO) indicates that the incident light is above the level acceptable to the plant, that the plant has been damaged or that continued illumination of the plant will be damaged.
According to the measurement of chlorophyll fluorescence of leaves at seedling stage of Xiushui 09 and mutant yl22, as shown in FIG. 5, it is found that the light energy conversion efficiency of Xiushui 09 is high, and the light damage degree of mutant yl22 is severe, indicating that the photosynthetic system of mutant yl22 is affected, and the photosynthetic efficiency of mutant yl22 is lower compared with that of Xiushui 09.
Experimental example 5: subcellular localization of YL22 protein
In order to determine the subcellular localization of YL22 protein, pCAMBIA-1305 is a vector framework, SpeI and XbaI are double enzyme cutting sites, a cDNA (with a terminator removed) of wild type Xiushui 09 is taken as a target sequence (SEQ ID NO.7), a pCAMBIA1305-GFP co-expression vector is constructed (as shown in figure 9), an empty vector pCAMBIA1305 is taken as a control, seedlings of 7-10 days are selected, protoplasts are prepared, the co-expression vector and the empty vector are transferred into rice protoplasts, the protoplasts are horizontally placed in a centrifuge tube for 12-16 hours at 25 ℃, and fluorescence observation is carried out by using a confocal laser microscope.
The results show that: the fusion of green fluorescence excited by YL22-GFP fusion protein with red fluorescence excited by chloroplasts, indicated that YL22 protein is localized in chloroplasts (see FIG. 6).
Experimental example 6: chloroplast RNA splicing analysis
To investigate whether the YL22 gene affected RNA splicing of chloroplast genes, all the splice site genes in chloroplasts were analyzed, and the rice chloroplast intron I group had only one trnL, and group II included atpF, ndhA, ndhB, petB, petD, rpl2, rpl16, rps12, rps16, trnA, trnG, trnK, trnI, trnV, and yc 3 (15 in total, nucleotide encoded splicing factors in RNA splicing in highher plant organs [ J ] in chloroplast].Mol Plant,2010,3(4):691-705；Comparative and functional anatomy of group II catalytic introns--a review[J]Gene,1989,82(1):5-30), using the NCBI website to look up information on the rice chloroplast genome, the CDS of all splice site genes in Xishui 09 and mutant yl22 was amplified by PCR, with the PCR molecular markers as shown in Table 1 below (SEQ ID NO.8-SEQ ID NO.39), using the following PCR reaction: primer 2. mu.L, 2 × Tac MIX 5. mu.L, CDS 1. mu.L, ddH2O2 mu L; the reaction procedure for amplification was as follows: 94 deg.C (3 min); 94 ℃ (30s), 55 ℃ (45s), 72 ℃ (3min), 35 cycles; 72 deg.C (6 min). When the mutation of YL22 is detected by 1% agarose gel electrophoresis, the splicing efficiency of trnL is reduced, and the substance transport and translation process in chloroplast can be influenced.
TABLE 1 PCR primers
While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.
Sequence listing
<110> Zhejiang province academy of agricultural sciences
<120> related gene of rice chloroplast development, molecular marker and application
<160> 39
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3804
<212> DNA
<213> Artificial Sequence
<400> 1
catttacccg ttgcaatttt tttcagagcg tgtacattcc cgtgtttgtc tgctccggct 60
ccacccgaac tccggcgccc aatccgccgg cctcgacgcc ggttcgatac ccccgatgtt 120
atcctgtggg cggaggacct aatcctatct atcctgttcc ccaacaccca tggcaactag 180
ccacctcacc tctcgctccc tcctcgtcca agcccagtac cccatctcac ggctcccatc 240
caacctccgc ctctccctct cccaccacaa gcaaccagcc gccgtcgcca agcgccgccg 300
agcccccgcc ccctcccacc cggccttctc ttcggtcatc cgcggccgtc ccaagaaagt 360
ccccatcccg gaaaacggcg agccagccgc cggtgtccgc gtcactgaac gtggcctggc 420
ctatcatctt gacggcgcgc ccttcgagtt ccagtacagt tacacagaga cgccgcgcgc 480
gcgccccgtc gcgctccgcg aggccccgtt cctgccgttc gggcctgagg taacgccgcg 540
cccatggacc gggaggaagc cgctccccaa gagccgcaag gaactgcctg agttcgactc 600
cttcatgctc ccgccgccgg gcaagaaggg ggtgaagccc gtgcagtcgc cggggccatt 660
ccttgccggc acggagccga ggtaccaagc ggcgtccagg gaggaggtcc tcggggagcc 720
tctcacaaag gaggaggtcg acgagctcgt caaggcgacc ctcaagacca agcggcagct 780
taatatcggt gagttgcatc tgatgcagca tcactcaatt gtacacatgg aacatcaact 840
aattcgacag ataaatgtct gcaagatttg tttccccctt gggctctggt accctgttat 900
gtctgtctgt gttcttttgt tttctttcct ataaaagact cgtgctctat gtgttttggc 960
tttctttaca aagccagatc aataataaat attgagtaaa tttcacaaaa ctacaggtat 1020
ttttgcacaa tttatcagaa aactacagat ttaagagctt tcgcaaaact acagatttag 1080
tatgtccgtt tattgtacaa tctatcacaa aactacagat ttaagaactt gtttcacaaa 1140
actatagatt tagtgtattc gtttatcaca aaactacata tttagtgtct tcatttatca 1200
caaaacgata aatctagtgt ctccattatc acaaaactac aggttttaac aaggaagggg 1260
atggagaaag aaaaataagt atattttgtt attatactca ccgatcaccg tgacatttat 1320
ctcttgagtt tagttcttat catgtagccg ctttgtcagc cctttcttgt attcctagtc 1380
agtctctcat tgccaacttt tgcaggtaga gatggtctaa cacacaatat gttggagaac 1440
attcattcgc attggaagag gaagagagtg tgcaagataa aatgcaaagg tgtatgcacg 1500
gttgatatgg ataatgtctg ccagcagcta gaggtcaaat tttgctactt acctcagaat 1560
tcttaaaatg catacggtgt actactcagt taaattggtg actgttttat tttttttttc 1620
tttatggacc aatgttctag taactcatct gaaactaata gaatttagaa gttgtcttag 1680
ctctggttat tcattagtga actcctttct gcttgaactt ctgttttcca tttccatatc 1740
tgggagcacc ttatctgtga ctcttccctg attacttcat atcatacatg agcaggagaa 1800
agttggagga aaagtaattc atcatcaggg tggtgtgata tttctctttc gtggtagaaa 1860
ctacaattac agaactcgcc caatctatcc acttatgctt tggaaacctg ctgcaccagt 1920
gtacccccgc ttggttaaaa agatcccaga cggcttaact ccagatgagg cagaagatat 1980
gcgcaagaga ggacgtcagt taccaccaat ttgcaaactc ggtaagtctc tttgtttcca 2040
tgtagttgac tcctttaact gcctttcaaa ttgtggaatc tgcaaatttc atagttaaaa 2100
gaatgaaaaa tatatgcgct agttgccaaa gtttattttt gaaaatatta gtgcctttgc 2160
agccaagagt aatgtccaaa ataggaagta cctgagggag gttgatgtcg aacatgaaac 2220
tactactttt atttgtcaga aacacttgaa atgtggaatt acagttgaac caatgctgct 2280
tcttttgctg agtgtggtac atattgtcta tccacattag cccatcttct tgcatagcac 2340
tgttccatgt ttgtgcagtt tgttgtcatt gtttacattc catttttttt aaaaattttt 2400
aaaggaaaaa atggtgttta tcttaacctc gtgaagcaag ttcgagaagc atttgaagca 2460
tgtgatcttg tccgggttga ttgctcaggt cttaataaaa gtgattgcag aaagatagga 2520
gctaaactta aggtttggta aatgctcaga atattatatc gttatgttat tttgttcaaa 2580
acatgattaa ttctaccttt gcaggatcta gttccctgta ccttactgtc ttttgagttt 2640
gaacatatac tgatgtggag aggaaatgat tggaaatcat cccttcctcc attagaagaa 2700
aatgatttta aagtggcgag cgaccaaatt ttgaatagca aagaagcagg ttctggaagt 2760
gctctgaccc caattgagct ggtcaacaat gccacgtctc tcaagaaatg caacttgatt 2820
gaaggtgcag aaaaattgga agattccatg aagtctagtt ttgaaaatgg tatgattttg 2880
ggttctgcat gtggaaaccc tggagtatgc aactctgaag gtatagatgg aactgagtcc 2940
tcagctgatg ctccaattga attttctcct tcaaattcag caagggattt agatccatct 3000
caaacatcaa cattgtattg ccaaagctcc ctattggaca agagtgaaaa tggagagctc 3060
attgagatgt accctgacag atgtggaaac tcggaacaat ctccagatgt accagaagct 3120
ttaacttgtc taatgggcag cagtgatgag attcatgaat tggaaactat gaggagaaac 3180
tgcaaacatt taaacggcag cgatggtgtt aacagtgatt ccatagtccc ttcctacatg 3240
gaaggaattt tactcctttt caaacaagcc attgacagtg gcatggcact cgtgctgaat 3300
gaaaatgagt ttgctgatgc caattatgtg tatcaaaagt ctgttgcttt tacaaagacg 3360
gctccacgat acctggtact ccggcataca ccaaggaagt cccatggtac ccagaagact 3420
gagccagcca agaatgtaag gataaataag catcttgaag aacataaagt atctgatcat 3480
gtcaaaaaga aagaaattgt catgggagga tcaagaatgc agagaaatga tcacgcacga 3540
gaatttctat cagatgttgt tccacagggt accttaagag tagatgaact tgctaaatta 3600
ctggcttaaa ggtgatcggt cctttattaa ccgaaggtgt gttgcgttat caaccttgaa 3660
ttaacgtgca aagtatatac atgtacattg atatgggacg tataaaactt ttcgtcaatt 3720
tggtcatgct gtgtaactga tcacgctttc tgcattgaaa tgttggaatg taataatatg 3780
gaacggcgaa gcattttcag acaa 3804
<210> 2
<211> 3804
<212> DNA
<213> Artificial Sequence
<400> 2
catttacccg ttgcaatttt tttcagagcg tgtacattcc cgtgtttgtc tgctccggct 60
ccacccgaac tccggcgccc aatccgccgg cctcgacgcc ggttcgatac ccccgatgtt 120
atcctgtggg cggaggacct aatcctatct atcctgttcc ccaacaccca tggcaactag 180
ccacctcacc tctcgctccc tcctcgtcca agcccagtac cccatctcac ggctcccatc 240
caacctccgc ctctccctct cccaccacaa gcaaccagcc gccgtcgcca agcgccgccg 300
agcccccgcc ccctcccacc cggccttctc ttcggtcatc cgcggccgtc ccaagaaagt 360
ccccatcccg gaaaacggcg agccagccgc cggtgtccgc gtcactgaac gtggcctggc 420
ctatcatctt gacggcgcgc ccttcgagtt ccagtacagt tacacagaga cgccgcgcgc 480
gcgccccgtc gcgctccgcg aggccccgtt cctgccgttc gggcctgagg taacgccgcg 540
cccatggacc gggaggaagc cgctccccaa gagccgcaag gaactgcctg agttcgactc 600
cttcatgctc ccgccgccgg gcaagaaggg ggtgaagccc gtgcagtcgc cggggccatt 660
ccttgccggc acggagccga ggtaccaagc ggcgtccagg gaggaggtcc tcggggagcc 720
tctcacaaag gaggaggtcg acgagctcgt caaggcgacc ctcaagacca agcggcagct 780
taatatcggt gagttgcatc tgatgcagca tcactcaatt gtacacatgg aacatcaact 840
aattcgacag ataaatgtct gcaagatttg tttccccctt gggctctggt accctgttat 900
gtctgtctgt gttcttttgt tttctttcct ataaaagact cgtgctctat gtgttttggc 960
tttctttaca aagccagatc aataataaat attgagtaaa tttcacaaaa ctacaggtat 1020
ttttgcacaa tttatcagaa aactacagat ttaagagctt tcgcaaaact acagatttag 1080
tatgtccgtt tattgtacaa tctatcacaa aactacagat ttaagaactt gtttcacaaa 1140
actatagatt tagtgtattc gtttatcaca aaactacata tttagtgtct tcatttatca 1200
caaaacgata aatctagtgt ctccattatc acaaaactac aggttttaac aaggaagggg 1260
atggagaaag aaaaataagt atattttgtt attatactca ccgatcaccg tgacatttat 1320
ctcttgagtt tagttcttat catgtagccg ctttgtcagc cctttcttgt attcctagtc 1380
agtctctcat tgccaacttt tgcaggtaga gatggtctaa cacacaatat gttggagaac 1440
attcattcgc attggaagag gaagagagtg tgcaagataa aatgcaaagg tgtatgcacg 1500
gttgatatgg ataatgtctg ccagcagcta gaggtcaaat tttgctactt acctcagaat 1560
tcttaaaatg catacggtgt actactcagt taaattggtg actgttttat tttttttttc 1620
tttatggacc aatgttctag taactcatct gaaactaata gaatttagaa gttgtcttag 1680
ctctggttat tcattagtga actcctttct gcttgaactt ctgttttcca tttccatatc 1740
tgggagcacc ttatctgtga ctcttccctg attacttcat atcatacatg agcaggagaa 1800
agttggagga aaagtaattc atcatcaggg tggtgtgata tttctctttc gtggtagaaa 1860
ctacaattac agaactcgcc caatctatcc acttatgctt tggaaacctg ctgcaccagt 1920
gtacccccgc ttggttaaaa agatcccaga cggcttaact ccagatgagg cagaagatat 1980
gcgcaagaga ggacgtcagt taccaccaat ttgcaaactc ggtaagtctc tttgtttcca 2040
tgtagttgac tcctttaact gcctttcaaa ttgtggaatc tgcaaatttc atagttaaaa 2100
gaatgaaaaa tatatgcgct agttgccaaa gtttattttt gaaaatatta gtgcctttgc 2160
agccaagagt aatgtccaaa ataggaagta cctgagggag gttgatgtcg aacatgaaac 2220
tactactttt atttgtcaga aacacttgaa atgtggaatt acagttgaac caatgctgct 2280
tcttttgctg agtgtggtac atattgtcta tccacattag cccatcttct tgcatagcac 2340
tgttccatgt ttgtgcagtt tgttgtcatt gtttacattc catttttttt aaaaattttt 2400
aaaggaaaaa atggtgttta tcttaacctc gtgaagcaag ttcgagaagc atttgaagca 2460
tgtgatcttg tccgggttga ttgctcaggt cttaataaaa gtgattgcag aaagatagga 2520
gctaaactta aggtttggta aatgctcaga atattatatc gttatgttat tttgttcaaa 2580
acatgattaa ttctaccttt gcaggatcta gttccctgta ccttactgtc ttttgagttt 2640
gaacatatac tgatgtggag aggaaatgat tggaaatcat cccttcctcc attagaagaa 2700
aatgatttta aagtggcgag cgaccaaatt ttgaatagca aagaagcagg ttctggaagt 2760
gctctgaccc caattgagct ggtcaacaat gccacgtctc tcaagaaatg caacttgatt 2820
gaaagtgcag aaaaattgga agattccatg aagtctagtt ttgaaaatgg tatgattttg 2880
ggttctgcat gtggaaaccc tggagtatgc aactctgaag gtatagatgg aactgagtcc 2940
tcagctgatg ctccaattga attttctcct tcaaattcag caagggattt agatccatct 3000
caaacatcaa cattgtattg ccaaagctcc ctattggaca agagtgaaaa tggagagctc 3060
attgagatgt accctgacag atgtggaaac tcggaacaat ctccagatgt accagaagct 3120
ttaacttgtc taatgggcag cagtgatgag attcatgaat tggaaactat gaggagaaac 3180
tgcaaacatt taaacggcag cgatggtgtt aacagtgatt ccatagtccc ttcctacatg 3240
gaaggaattt tactcctttt caaacaagcc attgacagtg gcatggcact cgtgctgaat 3300
gaaaatgagt ttgctgatgc caattatgtg tatcaaaagt ctgttgcttt tacaaagacg 3360
gctccacgat acctggtact ccggcataca ccaaggaagt cccatggtac ccagaagact 3420
gagccagcca agaatgtaag gataaataag catcttgaag aacataaagt atctgatcat 3480
gtcaaaaaga aagaaattgt catgggagga tcaagaatgc agagaaatga tcacgcacga 3540
gaatttctat cagatgttgt tccacagggt accttaagag tagatgaact tgctaaatta 3600
ctggcttaaa ggtgatcggt cctttattaa ccgaaggtgt gttgcgttat caaccttgaa 3660
ttaacgtgca aagtatatac atgtacattg atatgggacg tataaaactt ttcgtcaatt 3720
tggtcatgct gtgtaactga tcacgctttc tgcattgaaa tgttggaatg taataatatg 3780
gaacggcgaa gcattttcag acaa 3804
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 3
aggggtaaac tgaactactc ct 22
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 4
agaatatcca agcgaattcc ca 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
<210> 7
<211> 2103
<212> DNA
<213> Artificial Sequence
<400> 7
atggcaacta gccacctcac ctctcgctcc ctcctcgtcc aagcccagta ccccatctca 60
cggctcccat ccaacctccg cctctccctc tcccaccaca agcaaccagc cgccgtcgcc 120
aagcgccgcc gagcccccgc cccctcccac ccggccttct cttcggtcat ccgcggccgt 180
cccaagaaag tccccatccc ggaaaacggc gagccagccg ccggtgtccg cgtcactgaa 240
cgtggcctgg cctatcatct tgacggcgcg cccttcgagt tccagtacag ttacacagag 300
acgccgcgcg cgcgccccgt cgcgctccgc gaggccccgt tcctgccgtt cgggcctgag 360
gtaacgccgc gcccatggac cgggaggaag ccgctcccca agagccgcaa ggaactgcct 420
gagttcgact ccttcatgct cccgccgccg ggcaagaagg gggtgaagcc cgtgcagtcg 480
ccggggccat tccttgccgg cacggagccg aggtaccaag cggcgtccag ggaggaggtc 540
ctcggggagc ctctcacaaa ggaggaggtc gacgagctcg tcaaggcgac cctcaagacc 600
aagcggcagc ttaatatcgg tagagatggt ctaacacaca atatgttgga gaacattcat 660
tcgcattgga agaggaagag agtgtgcaag ataaaatgca aaggtgtatg cacggttgat 720
atggataatg tctgccagca gctagaggag aaagttggag gaaaagtaat tcatcatcag 780
ggtggtgtga tatttctctt tcgtggtaga aactacaatt acagaactcg cccaatctat 840
ccacttatgc tttggaaacc tgctgcacca gtgtaccccc gcttggttaa aaagatccca 900
gacggcttaa ctccagatga ggcagaagat atgcgcaaga gaggacgtca gttaccacca 960
atttgcaaac tcggaaaaaa tggtgtttat cttaacctcg tgaagcaagt tcgagaagca 1020
tttgaagcat gtgatcttgt ccgggttgat tgctcaggtc ttaataaaag tgattgcaga 1080
aagataggag ctaaacttaa ggatctagtt ccctgtacct tactgtcttt tgagtttgaa 1140
catatactga tgtggagagg aaatgattgg aaatcatccc ttcctccatt agaagaaaat 1200
gattttaaag tggcgagcga ccaaattttg aatagcaaag aagcaggttc tggaagtgct 1260
ctgaccccaa ttgagctggt caacaatgcc acgtctctca agaaatgcaa cttgattgaa 1320
ggtgcagaaa aattggaaga ttccatgaag tctagttttg aaaatggtat gattttgggt 1380
tctgcatgtg gaaaccctgg agtatgcaac tctgaaggta tagatggaac tgagtcctca 1440
gctgatgctc caattgaatt ttctccttca aattcagcaa gggatttaga tccatctcaa 1500
acatcaacat tgtattgcca aagctcccta ttggacaaga gtgaaaatgg agagctcatt 1560
gagatgtacc ctgacagatg tggaaactcg gaacaatctc cagatgtacc agaagcttta 1620
acttgtctaa tgggcagcag tgatgagatt catgaattgg aaactatgag gagaaactgc 1680
aaacatttaa acggcagcga tggtgttaac agtgattcca tagtcccttc ctacatggaa 1740
ggaattttac tccttttcaa acaagccatt gacagtggca tggcactcgt gctgaatgaa 1800
aatgagtttg ctgatgccaa ttatgtgtat caaaagtctg ttgcttttac aaagacggct 1860
ccacgatacc tggtactccg gcatacacca aggaagtccc atggtaccca gaagactgag 1920
ccagccaaga atgtaaggat aaataagcat cttgaagaac ataaagtatc tgatcatgtc 1980
aaaaagaaag aaattgtcat gggaggatca agaatgcaga gaaatgatca cgcacgagaa 2040
tttctatcag atgttgttcc acagggtacc ttaagagtag atgaacttgc taaattactg 2100
gct 2103
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 8
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 9
tttggctttt tgaccccat 19
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 10
atgaaaaatg taacccattc tt 22
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 11
<210> 12
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 12
atgataatag acagggtaca gg 22
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 13
ttatagtgaa acaagttggg aag 23
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 14
atgatctggc atgtacagaa tg 22
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 15
ctaaaagagg gtatcctgag ca 22
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 16
cggtatctct ggaatatgag t 21
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 20
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 21
ttacttacgg cgacgaagaa ta 22
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 22
atgcttagtc ccaaaagaac 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 23
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 24
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 25
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 26
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 27
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 28
<210> 29
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 29
tggacttgaa ccagagacct c 21
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 30
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 31
<210> 32
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 32
ggttgcccgg gactcgaa 18
<210> 33
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 33
gggttgctaa ctcaatggta gag 23
<210> 34
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 34
ggatatggcg aaatcggta 19
<210> 35
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 35
tggggataga gggacttga 19
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 36
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 37
<210> 38
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 38
atgcctagat cccgtataaa tg 22
<210> 39
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 39
ttattcaaat tcaaagcgct tc 22
Claims (10)
1. A related gene YL22 for rice chloroplast development is characterized in that the nucleotide sequence of the gene YL22 is shown as SEQ ID NO. 1.
2. The gene YL22 related to rice chloroplast development according to claim 1, wherein the mutation of gene YL22 is carried out by replacing the 222 th base G of the fifth exon with the base A on the basis of the nucleotide sequence SEQ ID No.1, and the mutated nucleotide sequence is shown as SEQ ID No. 2.
3. A gene related to chloroplast development of yellow leaf phenotype rice, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2.
4. Use of the gene YL22 related to rice chloroplast development as claimed in claim 1 or the gene related to rice chloroplast development as claimed in claim 3 in breeding new varieties of rice.
5. Use of the gene YL22 related to rice chloroplast development according to claim 1 or the gene related to rice chloroplast development with rice having the yellow leaf phenotype according to claim 3 for controlling rice chloroplast development.
6. The use according to claim 5, wherein the gene involved in chloroplast development in rice having the yellow leaf phenotype results in decreased chloroplast RNA splicing efficiency.
7. The use according to claim 5, wherein the gene involved in chloroplast development in rice with the yellow leaf phenotype is aberrant chloroplast thylakoid structure.
8. A plant recombinant vector comprising the gene involved in chloroplast development in rice having the yellow leaf phenotype according to claim 3.
9. A molecular marker for locating the gene YL22 related to rice chloroplast development as claimed in claim 1, wherein the nucleotide sequence of the upstream sequence of the molecular marker is shown as SEQ ID No.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID No. 4.
10. A molecular marker for identifying genes related to chloroplast development in rice having the yellow leaf phenotype according to claim 3, wherein the nucleotide sequence of the upstream sequence of the molecular marker is represented by SEQ ID No.5, and the nucleotide sequence of the downstream sequence is represented by SEQ ID No. 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110610998.7A CN113234733B (en) | 2021-06-01 | 2021-06-01 | Related gene for rice chloroplast development, molecular marker and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110610998.7A CN113234733B (en) | 2021-06-01 | 2021-06-01 | Related gene for rice chloroplast development, molecular marker and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113234733A true CN113234733A (en) | 2021-08-10 |
| CN113234733B CN113234733B (en) | 2022-06-03 |
Family
ID=77136255
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110610998.7A Active CN113234733B (en) | 2021-06-01 | 2021-06-01 | Related gene for rice chloroplast development, molecular marker and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113234733B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115960951A (en) * | 2022-11-23 | 2023-04-14 | 华南农业大学 | Application of AL7 gene in regulation and control of rice chloroplast development and/or rice leaf color |
| CN117305322A (en) * | 2023-10-09 | 2023-12-29 | 仲恺农业工程学院 | Chloroplast development regulation gene DG143 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101486757A (en) * | 2009-03-06 | 2009-07-22 | 中国农业科学院作物科学研究所 | Plant chloroplast development associated protein, and coding gene and use thereof |
| CN103114076A (en) * | 2013-01-29 | 2013-05-22 | 浙江省农业科学院 | Rice leaf color control gene heme oxygenase2 (HO2) and application thereof |
-
2021
- 2021-06-01 CN CN202110610998.7A patent/CN113234733B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101486757A (en) * | 2009-03-06 | 2009-07-22 | 中国农业科学院作物科学研究所 | Plant chloroplast development associated protein, and coding gene and use thereof |
| CN103114076A (en) * | 2013-01-29 | 2013-05-22 | 浙江省农业科学院 | Rice leaf color control gene heme oxygenase2 (HO2) and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| SRIVASTAVA SUBODH K等: "《A Strategy for Genome-Wide Identification of Gene Based Polymorphisms in Rice Reveals Non-Synonymous Variation and Functional Genotypic Markers》", 《PLOS ONE》 * |
| 李广贤等: "《水稻黄绿叶突变体ygl209的遗传分析与目标基因精细定位》", 《作物学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115960951A (en) * | 2022-11-23 | 2023-04-14 | 华南农业大学 | Application of AL7 gene in regulation and control of rice chloroplast development and/or rice leaf color |
| CN117305322A (en) * | 2023-10-09 | 2023-12-29 | 仲恺农业工程学院 | Chloroplast development regulation gene DG143 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113234733B (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Sweet sorghum originated through selection of Dry, a plant-specific NAC transcription factor gene | |
| EP2893024B1 (en) | Fluorescence activated cell sorting (facs) enrichment to generate plants | |
| JP5850475B2 (en) | Cadmium absorption control genes, proteins, and rice that suppresses cadmium absorption | |
| CN116058286A (en) | Tobacco plant body and preparation method thereof | |
| CN105695478B (en) | Gene for regulating plant type and yield of plant and application thereof | |
| CN111172173B (en) | Method for reducing plant height of corn or delaying flowering | |
| CN113234733B (en) | Related gene for rice chloroplast development, molecular marker and application | |
| CN112457386A (en) | Protein EAD1 related to control of ear length and row grain number of corn as well as coding gene and application thereof | |
| Chien et al. | Phosphate transporter PHT1; 1 is a key determinant of phosphorus acquisition in Arabidopsis natural accessions | |
| CN111732644A (en) | Powdery mildew resistance related protein Pm41, and coding gene and application thereof | |
| CN108064302A (en) | QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage | |
| WO2024108862A1 (en) | Rice white leaf and panicle gene wlp3 and application thereof in rice stress resistance and yield increase | |
| CN108794610B (en) | Corn cross-incompatibility related protein ZmGa1S, and coding gene and application thereof | |
| CN108329383B (en) | Protein related to corn hybridization incompatibility and coding gene and application thereof | |
| CN112195269B (en) | Molecular marker related to rice nuclear male sterility phenotype and application thereof | |
| CN108623667A (en) | A kind of rice hickie leaf controls protein and the application of gene WLML1 and its coding | |
| US6617494B2 (en) | Methods for identifying transgenic plants using morphological markers | |
| CN113151560A (en) | Molecular marker for screening poplar with high pore density and high photosynthetic efficiency as well as method and application thereof | |
| Mohanty et al. | Methods for generation and analysis of fluorescent protein-tagged maize lines | |
| CN111100942A (en) | Molecular marker related to rice photo-thermo-sensitive nuclear male sterility phenotype and application | |
| CN109912706A (en) | A kind of rice weak tendency early ageing related gene, protein, molecular labeling and application | |
| CN111825751B (en) | Clone of land cotton bud yellow gene vsp and its function | |
| CN113462661B (en) | SIZ1 protein separated from corn, encoding gene thereof and application thereof in variety improvement | |
| CN108707596B (en) | Application of metalloprotease WS1B in regulation and control of plant chloroplast metabolism | |
| CN108728429B (en) | Application of metalloprotease WS1A in regulation and control of plant chloroplast metabolism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |