CN113234733B - Related gene for rice chloroplast development, molecular marker and application - Google Patents

Related gene for rice chloroplast development, molecular marker and application Download PDF

Info

Publication number
CN113234733B
CN113234733B CN202110610998.7A CN202110610998A CN113234733B CN 113234733 B CN113234733 B CN 113234733B CN 202110610998 A CN202110610998 A CN 202110610998A CN 113234733 B CN113234733 B CN 113234733B
Authority
CN
China
Prior art keywords
rice
seq
gene
chloroplast
chloroplast development
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110610998.7A
Other languages
Chinese (zh)
Other versions
CN113234733A (en
Inventor
张小明
张萍
柳梦林
叶胜海
翟荣荣
朱国富
叶靖
巫明明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Academy of Agricultural Sciences
Original Assignee
Zhejiang Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Academy of Agricultural Sciences filed Critical Zhejiang Academy of Agricultural Sciences
Priority to CN202110610998.7A priority Critical patent/CN113234733B/en
Publication of CN113234733A publication Critical patent/CN113234733A/en
Application granted granted Critical
Publication of CN113234733B publication Critical patent/CN113234733B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/20—Reduction of greenhouse gas [GHG] emissions in agriculture, e.g. CO2

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a related gene for rice chloroplast development, a molecular marker and application thereof, wherein a nucleotide sequence of the related gene YL22 is shown as SEQ ID No.1, a 222 th base G on a fifth exon is replaced by a base A on the basis of the nucleotide sequence SEQ ID No.1, the mutated nucleotide sequence is shown as SEQ ID No.2, and the change of the YL22 gene can cause yellow leaf phenotype of rice. The nucleotide sequence of the molecular marker for identifying gene YL22 is shown in SEQ ID NO.3 and SEQ ID NO. 4. The nucleotide sequences of the molecular markers for identifying the yellow leaf phenotype are shown in SEQ ID NO.5 and SEQ ID NO. 6. The invention further enriches the rice leaf color germplasm resources, can be used as a leaf color marker to be applied to breeding of new rice varieties, and has important significance on research of a chloroplast development regulation mechanism.

Description

Related gene for rice chloroplast development, molecular marker and application
Technical Field
The invention relates to a rice chloroplast development related gene, in particular to a rice chloroplast development related geneYL22And molecular markers and applications.
Background
Photosynthesis is the most important chemical reaction on the earth, green plants convert light energy into chemical energy through a series of biochemical reactions by using carbon dioxide and water and release oxygen, more than 90% of the dry matter yield of crops is from photosynthesis, and the photosynthesis efficiency is closely related to the chloroplast structural integrity, the chloroplast development height and the like. Therefore, the rice leaf color mutant is an ideal material for exploring physiological processes such as plant photosynthesis, chloroplast development and the like.
Chloroplast development is a complex process, co-regulated by nuclear and chloroplast genes. The CRM domain is an RNA binding domain of approximately 100 amino acids that affects the splicing of group I and group II introns. 14 proteins in rice contain one or more CRM domains, of which CSR2 binds to CAF1 and CAF2, respectively, to form protein complexes CRS2-CAF1 and CRS2-CAF2, which are important for splicing group II introns. AL2 is a rice functional CRS1, and may be involved in splicing of chloroplast group I introns in addition to class II introns. Furthermore, OsCFM2 belongs to the CRS1 subfamily in rice, affecting the splicing of group I and group II introns, and OsCFM3 is involved in the splicing of group II introns. Besides being used for splicing I and II group introns, the CRM structural domain can also retain the assembling function of ribosome and influence the processing of rRNA in chloroplast in plants. Therefore, CRM domain protein plays an important role in the development of chloroplasts.
Disclosure of Invention
The invention aims to provide a related gene for rice chloroplast developmentYL22As well as a molecular marker and an application thereof,YL22the change of the gene can cause the rice to have yellow leaf phenotype, so that the rice leaf color germplasm resources are further enriched, can be used as a leaf color marker to be applied to breeding of new rice varieties, and has important significance on the research of a chloroplast development regulation mechanism.
In order to achieve the purpose, the invention provides a related gene for rice chloroplast developmentYL22The geneYL22The nucleotide sequence of (A) is shown in SEQ ID NO. 1.
Preferably, the geneYL22On the basis of the nucleotide sequence SEQ ID NO.1, the 222 th base on the fifth exon (i.e. the 2824 th base in the sequence SEQ ID NO. 1) is mutatedThe base G is replaced by the base A, and the mutated nucleotide sequence is shown as SEQ ID NO. 2.
Another objective of the invention is to provide a gene related to chloroplast development of rice with yellow leaf phenotype, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2.
Preferably, the gene related to chloroplast development in rice having the yellow leaf phenotype results in decreased chloroplast RNA splicing efficiency.
Preferably, the gene related to chloroplast development in rice having the yellow leaf phenotype is abnormal in chloroplast thylakoid structure.
Another objective of the invention is to provide a plant recombinant vector containing the gene related to chloroplast development of rice with the yellow leaf phenotype.
Another purpose of the invention is to provide a related gene for positioning the rice chloroplast developmentYL22The nucleotide sequence of the upstream sequence of the molecular marker is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID NO. 4.
Another purpose of the invention is to provide a molecular marker for identifying related genes of chloroplast development of yellow leaf phenotype rice, wherein the nucleotide sequence of an upstream sequence of the molecular marker is shown as SEQ ID NO.5, and the nucleotide sequence of a downstream sequence of the molecular marker is shown as SEQ ID NO. 6.
Another purpose of the invention is to provide the related gene for rice chloroplast developmentYL22Or the related gene of chloroplast development of yellow leaf phenotype rice is applied to breeding new rice varieties.
Another purpose of the invention is to provide the related gene for rice chloroplast developmentYL22Or the related gene of chloroplast development of the yellow leaf phenotype rice is applied to the rice chloroplast development regulation.
The related gene of rice chloroplast developmentYL22And molecular markers and applications, have the following advantages:
the related gene of rice chloroplast developmentYL22The change can cause the rice to have yellow leaf phenotype, chlorophyll a and chlorophyll bAnd carotenoid is obviously lower than a wild type in seedling stage, tillering stage and heading stage, the function of the gene is verified by transgene complementation, and the result of a subcellular localization test shows that the gene is expressed in chloroplast. The yellow leaf gene further enriches the germplasm resources of the leaf color of the rice, can be used as a leaf color marker to be applied to breeding of new rice varieties, and has certain significance for analyzing a chloroplast development regulation mechanism.
Drawings
FIG. 1 shows water 09 andyl22comparison of phenotypes.
FIG. 2 shows the rice gene of the present inventionYL22And (6) positioning.
FIG. 3 shows the phenotype and chlorophyll content of the transgenic plants of the present invention.
FIG. 4 shows mutants of the present inventionyl22Chloroplast microstructure.
FIG. 5 shows the present inventionyl22Chlorophyll fluorescence.
FIG. 6 shows subcellular localization of YL22 protein of the present invention.
FIG. 7 shows the present inventionYL22The gene is involved in chloroplast RNA splicing.
FIG. 8 shows the genes involved in chloroplast development according to the inventionYL22The sequencing result of (3).
FIG. 9 is a schematic structural diagram of a pCAMBIA1305-GFP co-expression vector constructed in the present invention.
Note: in fig. 1, a. plant phenotype at seedling stage; B. chlorophyll content in seedling stage; C. plant phenotype at tillering stage; D. chlorophyll content at tillering stage; E. plant phenotype at heading stage; F. chlorophyll content at heading stage; bar = 1 cmP < 0.05; **P<0.01; in fig. 2, a.YL22The gene is located between Z-2 and Z-4 markers near the centromere of chromosome 1, and B. candidate genes for the localization intervalLOC_Os01g31110The mutation site of (3); in FIG. 4, A. Xiushui 09 seedling stage (0.2 μm); B. xishui 09 tillering stage (0.2 μm); C. xishui 09 heading date (0.5 μm); D.yl22seedling stage (0.2 μm); E.yl22tillering stage (0.2 μm); F.yl22heading period (0.5 μm); wherein G represents a substrate; OG stands for osmyl corpuscle; in FIG. 5, A. seedling stage leaf Fv/Fm; B. seedling stage leafY（NO）。
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Experimental example 1: rice (Oryza sativa L.) with improved resistance to stressyl22Phenotypic identification and genetic analysis of
Mutantsyl22Is prepared by chemical mutagenesis of conventional japonica rice Xiuhui 09 by Ethyl Methyl Sulfonate (EMS), and mutants are observedyl22And the phenotypes of the Xiuhua 09 at the seedling stage, tiller stage and heading stage, and the contents of chlorophyll a (Chl a), chlorophyll b (Chl b) and carotenoid (Car) were measured and counted, and the results are shown in FIG. 1.
The results show that the mutantsyl22The leaves in the whole growth cycle are yellow, and the chlorophyll a, the chlorophyll b and the carotenoid in the leaves are obviously lower than those in the seedling stage, the tillering stage and the heading stage of a control variety Xiuhui 09 (WT).
The mutant is subjected toyl22F obtained by hybridization with Xiuhui 091Plant, F1Leaves of the plants are all green, and then F is added1Plant selfing to obtain genetic analysis population F2At F2The character separation of leaf color phenotype is found in the colony, 2751 green leaf seedlings and 857 yellow leaf seedlings exist, and the separation ratio (chi) is 3:12=2.99<χ20.05= 3.84), the trait was determined to be under the control of a single recessive nuclear gene.
Experimental example 2: chloroplast development related geneYL22Positioning and complementation verification of
The mutantyl22F obtained by crossing plant with indica type restorer line Minghui 861Plant, F1Seed bearing on the plant, after sowing to obtain F2And (5) positioning the population. Through a map-based cloning method, a molecular marker Z-4-F/R is developed for gene localization, and the sequence of the molecular marker Z-4-F: AGGGGTAAACTGAACTACTCCT (SEQ ID NO. 3)(ii) a Sequence of molecular marker Z-4-R: AGAATATCCAAGCGAATTCCCA (SEQ ID NO. 4). The PCR reaction system is as follows: primer 2. mu.L, 2 × Tac MIX 5. mu.L, CDS 1. mu.L, ddH2O2 mu L; the reaction procedure for PCR amplification was as follows: 94 deg.C (3 min); 94 ℃ (30 s), 55 ℃ (45 s), 72 ℃ (30 s), 35 cycles; 72 deg.C (6 min). The mutantyl22The chloroplast development-associated gene(s) is located in an approximately 913 kb interval around chromosome 1 centromere, and the candidate gene(s) is/are further identified as a candidate gene(s) by a re-sequencing methodLOC_Os01g31110. With reference to figure 2 of the drawings,LOC_Os01g31110there are five exons, and sequencing results show that a single base substitution occurs within the fifth exon of the gene, from base G to base A, resulting in the substitution of glycine by serine.
For further validation, sequencing molecular marker YL22-5 was designed for gene sequencing, the sequence of molecular marker YL 22-5-F: TGTGATCTTGTCCGGGTTGA (SEQ ID NO. 5); sequence of molecular marker YL 22-5-R: ACTGTTAACACCATCGCTGC (SEQ ID NO. 6). The PCR reaction system is as follows: primer 3. mu.L, F (x) 1. mu.L, DNA 5. mu.L, Buffer 25. mu.L, dNTP 10. mu.L, ddH2O6 mu L; the reaction procedure for PCR amplification was as follows: 94 deg.C (3 min); 98 ℃ (15 s), 55 ℃ (30 s), 68 ℃ (2 min), 35 cycles; 68 deg.C (6 min). The sequencing results are shown in FIG. 8, and the gene encodes a protein containing two Chloroplast RNA splicing and ribosome maturation (CRM) domains.
To further verifyLOC_Os01g31110Whether or not it is a mutantyl22By mutating the gene of (1)YL22The cDNA sequence is connected with a vector pCAMBIA-1305 to construct a transgenic complementary vector pCAMBIA-1305, and the transgenic complementary vector is transformed into a mutant by an agrobacterium transfection methodyl22Performing gene function complementation verification on the callus. The interference fragment was transformed into the callus of wild type Xiushui 09 by Agrobacterium transfection by constructing RNAi vector pTCK303YL22Gene silencing obtainsYL22The RNAi transgenic positive plant of (1).
See figure 3 (a for plant phenotype at seedling stage, B for chlorophyll content of plant at seedling stage; WT for xiuhua 09,RNAi is a positive plant of RNAi transgene,yl22as mutantsyl22Com is a complementation verification plant), and the result shows that the phenotype of the complementation plant is recovered to a normal green leaf phenotype from a yellow leaf phenotype, the color of the leaf at the seedling stage and the chlorophyll content are consistent with those of a wild plant, and the RNAi transgenic positive plant is a trilobate albino lethal phenotype, so that the verification proves that the phenotype of the complementation plant is recovered to a normal green leaf phenotype, the color of the leaf at the seedling stage and the chlorophyll content of the leaf are consistent with those of the wild plant, and the positive plant is the trilobate albino lethal phenotypeLOC_Os01g31110Is a chloroplast development related geneYL22。
Experimental example 3: observation of chloroplast transmission electron microscope
By pairing mutantsyl22The ultrastructures of chloroplasts at the seedling stage, tillering stage and heading stage of Xiushui 09 (WT) were observed by a transmission electron microscope, and as a result, as shown in FIG. 4, it was found thatyl22The structure of the mesochloroplast thylakoid lamina is looser, and the stacking number of the basal granule lamina is reduced.
Experimental example 4: chlorophyll fluorescence kinetic imaging
Chlorophyll fluorescence can reflect photosynthesis-related processes such as light energy absorption and photosynthesis energy conversion efficiency, and is related to electron chain transfer, ATP synthesis and CO2And (4) fixing. The chlorophyll fluorescence kinetic parameter Fv/Fm is the maximum photochemical quantum yield of the PS II (photosystem II), the parameter is relatively stable, the light energy conversion efficiency in the PS II reaction center is reflected, and the parameter is obviously reduced under the stress condition, so that the light energy conversion efficiency in the PS II reaction center is reduced. Y (NO) is an important marker of photodamage, and the greater Y (NO) indicates that the incident light is above the level acceptable to the plant, that the plant has been damaged or that continued illumination of the plant will be damaged.
The invention relates to the seedling stage and the mutant of the Xiushui 09yl22The measurement of chlorophyll fluorescence of seedling leaves is shown in figure 5, and the observation shows that the light energy conversion efficiency of the Xiuhui 09 is higher, and the mutantyl22The degree of photodamage is more severe, indicating that the mutant isyl22The photosynthetic system of (1) was affected, compared to Xiuhui 09, mutantyl22The photosynthetic efficiency of (2) is low.
Experimental example 5: subcellular localization of YL22 protein
In order to determine the subcellular localization of YL22 protein, pCAMBIA-1305 is used as a carrier skeleton,SpeIandXbaIis a double enzymeCutting sites, constructing pCAMBIA1305-GFP co-expression vector (shown in figure 9) by taking cDNA (removing terminator) of wild type Xiuhui 09 as a target sequence (SEQ ID NO. 7), taking an empty vector pCAMBIA1305 as a control, selecting seedlings of 7-10 days, preparing protoplast, transferring the co-expression vector and the empty vector into the rice protoplast, horizontally placing the protoplast in a centrifuge tube at 25 ℃ for 12-16 hours, and carrying out fluorescence observation by using a laser confocal microscope.
The results show that: fusion of green fluorescence excited by YL22-GFP fusion protein with red fluorescence excited by chloroplasts demonstrated that YL22 protein was localized in chloroplasts (see fig. 6).
Experimental example 6: chloroplast RNA splicing analysis
For the study ofYL22Whether the gene affects the RNA splicing of chloroplast genes or not is analyzed for all the splice site genes in the chloroplast, and only group I genes of rice chloroplast introns aretrnLOne, group II includesatpF、ndhA、ndhB、petB、petD、rpl2、rpl16、rps12、rps16、trnA、trnG、trnK、trnI、trnVAndycf315 in total (nucleic acid encoded encoding factors in RNA encoding in high plant organs [ J ]]. Mol Plant, 2010, 3(4): 691-705；Comparative and functional anatomy of group II catalytic introns--a review [J]Gene, 1989, 82(1): 5-30), using the NCBI website to find information on the rice chloroplast genome, and PCR to amplify the Xiushu 09 and mutantsyl22The CDS and PCR molecular markers of all splice site genes are shown in the following table 1 (SEQ ID NO.8-SEQ ID NO. 39), and the PCR reaction system is as follows: primer 2. mu.L, 2 × Tac MIX 5. mu.L, CDS 1. mu.L, ddH2O2 mu L; the reaction procedure for amplification was as follows: 94 deg.C (3 min); 94 ℃ (30 s), 55 ℃ (45 s), 72 ℃ (3 min), 35 cycles; 72 deg.C (6 min). Detected by 1% agarose gel electrophoresis, and found thatYL22After the mutation, the mutant is subjected to a mutation treatment,trnLthe efficiency of splicing is reduced, and the substance transportation and translation process in chloroplasts can be influenced.
TABLE 1 PCR primers
Figure 277172DEST_PATH_IMAGE001
Figure 194313DEST_PATH_IMAGE002
While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be limited only by the attached claims.
Sequence listing
<110> Zhejiang province academy of agricultural sciences
<120> related gene of rice chloroplast development, molecular marker and application
<160> 39
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3804
<212> DNA
<213> Artificial Sequence
<400> 1
catttacccg ttgcaatttt tttcagagcg tgtacattcc cgtgtttgtc tgctccggct 60
ccacccgaac tccggcgccc aatccgccgg cctcgacgcc ggttcgatac ccccgatgtt 120
atcctgtggg cggaggacct aatcctatct atcctgttcc ccaacaccca tggcaactag 180
ccacctcacc tctcgctccc tcctcgtcca agcccagtac cccatctcac ggctcccatc 240
caacctccgc ctctccctct cccaccacaa gcaaccagcc gccgtcgcca agcgccgccg 300
agcccccgcc ccctcccacc cggccttctc ttcggtcatc cgcggccgtc ccaagaaagt 360
ccccatcccg gaaaacggcg agccagccgc cggtgtccgc gtcactgaac gtggcctggc 420
ctatcatctt gacggcgcgc ccttcgagtt ccagtacagt tacacagaga cgccgcgcgc 480
gcgccccgtc gcgctccgcg aggccccgtt cctgccgttc gggcctgagg taacgccgcg 540
cccatggacc gggaggaagc cgctccccaa gagccgcaag gaactgcctg agttcgactc 600
cttcatgctc ccgccgccgg gcaagaaggg ggtgaagccc gtgcagtcgc cggggccatt 660
ccttgccggc acggagccga ggtaccaagc ggcgtccagg gaggaggtcc tcggggagcc 720
tctcacaaag gaggaggtcg acgagctcgt caaggcgacc ctcaagacca agcggcagct 780
taatatcggt gagttgcatc tgatgcagca tcactcaatt gtacacatgg aacatcaact 840
aattcgacag ataaatgtct gcaagatttg tttccccctt gggctctggt accctgttat 900
gtctgtctgt gttcttttgt tttctttcct ataaaagact cgtgctctat gtgttttggc 960
tttctttaca aagccagatc aataataaat attgagtaaa tttcacaaaa ctacaggtat 1020
ttttgcacaa tttatcagaa aactacagat ttaagagctt tcgcaaaact acagatttag 1080
tatgtccgtt tattgtacaa tctatcacaa aactacagat ttaagaactt gtttcacaaa 1140
actatagatt tagtgtattc gtttatcaca aaactacata tttagtgtct tcatttatca 1200
caaaacgata aatctagtgt ctccattatc acaaaactac aggttttaac aaggaagggg 1260
atggagaaag aaaaataagt atattttgtt attatactca ccgatcaccg tgacatttat 1320
ctcttgagtt tagttcttat catgtagccg ctttgtcagc cctttcttgt attcctagtc 1380
agtctctcat tgccaacttt tgcaggtaga gatggtctaa cacacaatat gttggagaac 1440
attcattcgc attggaagag gaagagagtg tgcaagataa aatgcaaagg tgtatgcacg 1500
gttgatatgg ataatgtctg ccagcagcta gaggtcaaat tttgctactt acctcagaat 1560
tcttaaaatg catacggtgt actactcagt taaattggtg actgttttat tttttttttc 1620
tttatggacc aatgttctag taactcatct gaaactaata gaatttagaa gttgtcttag 1680
ctctggttat tcattagtga actcctttct gcttgaactt ctgttttcca tttccatatc 1740
tgggagcacc ttatctgtga ctcttccctg attacttcat atcatacatg agcaggagaa 1800
agttggagga aaagtaattc atcatcaggg tggtgtgata tttctctttc gtggtagaaa 1860
ctacaattac agaactcgcc caatctatcc acttatgctt tggaaacctg ctgcaccagt 1920
gtacccccgc ttggttaaaa agatcccaga cggcttaact ccagatgagg cagaagatat 1980
gcgcaagaga ggacgtcagt taccaccaat ttgcaaactc ggtaagtctc tttgtttcca 2040
tgtagttgac tcctttaact gcctttcaaa ttgtggaatc tgcaaatttc atagttaaaa 2100
gaatgaaaaa tatatgcgct agttgccaaa gtttattttt gaaaatatta gtgcctttgc 2160
agccaagagt aatgtccaaa ataggaagta cctgagggag gttgatgtcg aacatgaaac 2220
tactactttt atttgtcaga aacacttgaa atgtggaatt acagttgaac caatgctgct 2280
tcttttgctg agtgtggtac atattgtcta tccacattag cccatcttct tgcatagcac 2340
tgttccatgt ttgtgcagtt tgttgtcatt gtttacattc catttttttt aaaaattttt 2400
aaaggaaaaa atggtgttta tcttaacctc gtgaagcaag ttcgagaagc atttgaagca 2460
tgtgatcttg tccgggttga ttgctcaggt cttaataaaa gtgattgcag aaagatagga 2520
gctaaactta aggtttggta aatgctcaga atattatatc gttatgttat tttgttcaaa 2580
acatgattaa ttctaccttt gcaggatcta gttccctgta ccttactgtc ttttgagttt 2640
gaacatatac tgatgtggag aggaaatgat tggaaatcat cccttcctcc attagaagaa 2700
aatgatttta aagtggcgag cgaccaaatt ttgaatagca aagaagcagg ttctggaagt 2760
gctctgaccc caattgagct ggtcaacaat gccacgtctc tcaagaaatg caacttgatt 2820
gaaggtgcag aaaaattgga agattccatg aagtctagtt ttgaaaatgg tatgattttg 2880
ggttctgcat gtggaaaccc tggagtatgc aactctgaag gtatagatgg aactgagtcc 2940
tcagctgatg ctccaattga attttctcct tcaaattcag caagggattt agatccatct 3000
caaacatcaa cattgtattg ccaaagctcc ctattggaca agagtgaaaa tggagagctc 3060
attgagatgt accctgacag atgtggaaac tcggaacaat ctccagatgt accagaagct 3120
ttaacttgtc taatgggcag cagtgatgag attcatgaat tggaaactat gaggagaaac 3180
tgcaaacatt taaacggcag cgatggtgtt aacagtgatt ccatagtccc ttcctacatg 3240
gaaggaattt tactcctttt caaacaagcc attgacagtg gcatggcact cgtgctgaat 3300
gaaaatgagt ttgctgatgc caattatgtg tatcaaaagt ctgttgcttt tacaaagacg 3360
gctccacgat acctggtact ccggcataca ccaaggaagt cccatggtac ccagaagact 3420
gagccagcca agaatgtaag gataaataag catcttgaag aacataaagt atctgatcat 3480
gtcaaaaaga aagaaattgt catgggagga tcaagaatgc agagaaatga tcacgcacga 3540
gaatttctat cagatgttgt tccacagggt accttaagag tagatgaact tgctaaatta 3600
ctggcttaaa ggtgatcggt cctttattaa ccgaaggtgt gttgcgttat caaccttgaa 3660
ttaacgtgca aagtatatac atgtacattg atatgggacg tataaaactt ttcgtcaatt 3720
tggtcatgct gtgtaactga tcacgctttc tgcattgaaa tgttggaatg taataatatg 3780
gaacggcgaa gcattttcag acaa 3804
<210> 2
<211> 3804
<212> DNA
<213> Artificial Sequence
<400> 2
catttacccg ttgcaatttt tttcagagcg tgtacattcc cgtgtttgtc tgctccggct 60
ccacccgaac tccggcgccc aatccgccgg cctcgacgcc ggttcgatac ccccgatgtt 120
atcctgtggg cggaggacct aatcctatct atcctgttcc ccaacaccca tggcaactag 180
ccacctcacc tctcgctccc tcctcgtcca agcccagtac cccatctcac ggctcccatc 240
caacctccgc ctctccctct cccaccacaa gcaaccagcc gccgtcgcca agcgccgccg 300
agcccccgcc ccctcccacc cggccttctc ttcggtcatc cgcggccgtc ccaagaaagt 360
ccccatcccg gaaaacggcg agccagccgc cggtgtccgc gtcactgaac gtggcctggc 420
ctatcatctt gacggcgcgc ccttcgagtt ccagtacagt tacacagaga cgccgcgcgc 480
gcgccccgtc gcgctccgcg aggccccgtt cctgccgttc gggcctgagg taacgccgcg 540
cccatggacc gggaggaagc cgctccccaa gagccgcaag gaactgcctg agttcgactc 600
cttcatgctc ccgccgccgg gcaagaaggg ggtgaagccc gtgcagtcgc cggggccatt 660
ccttgccggc acggagccga ggtaccaagc ggcgtccagg gaggaggtcc tcggggagcc 720
tctcacaaag gaggaggtcg acgagctcgt caaggcgacc ctcaagacca agcggcagct 780
taatatcggt gagttgcatc tgatgcagca tcactcaatt gtacacatgg aacatcaact 840
aattcgacag ataaatgtct gcaagatttg tttccccctt gggctctggt accctgttat 900
gtctgtctgt gttcttttgt tttctttcct ataaaagact cgtgctctat gtgttttggc 960
tttctttaca aagccagatc aataataaat attgagtaaa tttcacaaaa ctacaggtat 1020
ttttgcacaa tttatcagaa aactacagat ttaagagctt tcgcaaaact acagatttag 1080
tatgtccgtt tattgtacaa tctatcacaa aactacagat ttaagaactt gtttcacaaa 1140
actatagatt tagtgtattc gtttatcaca aaactacata tttagtgtct tcatttatca 1200
caaaacgata aatctagtgt ctccattatc acaaaactac aggttttaac aaggaagggg 1260
atggagaaag aaaaataagt atattttgtt attatactca ccgatcaccg tgacatttat 1320
ctcttgagtt tagttcttat catgtagccg ctttgtcagc cctttcttgt attcctagtc 1380
agtctctcat tgccaacttt tgcaggtaga gatggtctaa cacacaatat gttggagaac 1440
attcattcgc attggaagag gaagagagtg tgcaagataa aatgcaaagg tgtatgcacg 1500
gttgatatgg ataatgtctg ccagcagcta gaggtcaaat tttgctactt acctcagaat 1560
tcttaaaatg catacggtgt actactcagt taaattggtg actgttttat tttttttttc 1620
tttatggacc aatgttctag taactcatct gaaactaata gaatttagaa gttgtcttag 1680
ctctggttat tcattagtga actcctttct gcttgaactt ctgttttcca tttccatatc 1740
tgggagcacc ttatctgtga ctcttccctg attacttcat atcatacatg agcaggagaa 1800
agttggagga aaagtaattc atcatcaggg tggtgtgata tttctctttc gtggtagaaa 1860
ctacaattac agaactcgcc caatctatcc acttatgctt tggaaacctg ctgcaccagt 1920
gtacccccgc ttggttaaaa agatcccaga cggcttaact ccagatgagg cagaagatat 1980
gcgcaagaga ggacgtcagt taccaccaat ttgcaaactc ggtaagtctc tttgtttcca 2040
tgtagttgac tcctttaact gcctttcaaa ttgtggaatc tgcaaatttc atagttaaaa 2100
gaatgaaaaa tatatgcgct agttgccaaa gtttattttt gaaaatatta gtgcctttgc 2160
agccaagagt aatgtccaaa ataggaagta cctgagggag gttgatgtcg aacatgaaac 2220
tactactttt atttgtcaga aacacttgaa atgtggaatt acagttgaac caatgctgct 2280
tcttttgctg agtgtggtac atattgtcta tccacattag cccatcttct tgcatagcac 2340
tgttccatgt ttgtgcagtt tgttgtcatt gtttacattc catttttttt aaaaattttt 2400
aaaggaaaaa atggtgttta tcttaacctc gtgaagcaag ttcgagaagc atttgaagca 2460
tgtgatcttg tccgggttga ttgctcaggt cttaataaaa gtgattgcag aaagatagga 2520
gctaaactta aggtttggta aatgctcaga atattatatc gttatgttat tttgttcaaa 2580
acatgattaa ttctaccttt gcaggatcta gttccctgta ccttactgtc ttttgagttt 2640
gaacatatac tgatgtggag aggaaatgat tggaaatcat cccttcctcc attagaagaa 2700
aatgatttta aagtggcgag cgaccaaatt ttgaatagca aagaagcagg ttctggaagt 2760
gctctgaccc caattgagct ggtcaacaat gccacgtctc tcaagaaatg caacttgatt 2820
gaaagtgcag aaaaattgga agattccatg aagtctagtt ttgaaaatgg tatgattttg 2880
ggttctgcat gtggaaaccc tggagtatgc aactctgaag gtatagatgg aactgagtcc 2940
tcagctgatg ctccaattga attttctcct tcaaattcag caagggattt agatccatct 3000
caaacatcaa cattgtattg ccaaagctcc ctattggaca agagtgaaaa tggagagctc 3060
attgagatgt accctgacag atgtggaaac tcggaacaat ctccagatgt accagaagct 3120
ttaacttgtc taatgggcag cagtgatgag attcatgaat tggaaactat gaggagaaac 3180
tgcaaacatt taaacggcag cgatggtgtt aacagtgatt ccatagtccc ttcctacatg 3240
gaaggaattt tactcctttt caaacaagcc attgacagtg gcatggcact cgtgctgaat 3300
gaaaatgagt ttgctgatgc caattatgtg tatcaaaagt ctgttgcttt tacaaagacg 3360
gctccacgat acctggtact ccggcataca ccaaggaagt cccatggtac ccagaagact 3420
gagccagcca agaatgtaag gataaataag catcttgaag aacataaagt atctgatcat 3480
gtcaaaaaga aagaaattgt catgggagga tcaagaatgc agagaaatga tcacgcacga 3540
gaatttctat cagatgttgt tccacagggt accttaagag tagatgaact tgctaaatta 3600
ctggcttaaa ggtgatcggt cctttattaa ccgaaggtgt gttgcgttat caaccttgaa 3660
ttaacgtgca aagtatatac atgtacattg atatgggacg tataaaactt ttcgtcaatt 3720
tggtcatgct gtgtaactga tcacgctttc tgcattgaaa tgttggaatg taataatatg 3780
gaacggcgaa gcattttcag acaa 3804
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 3
aggggtaaac tgaactactc ct 22
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 4
agaatatcca agcgaattcc ca 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 5
tgtgatcttg tccgggttga 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
actgttaaca ccatcgctgc 20
<210> 7
<211> 2103
<212> DNA
<213> Artificial Sequence
<400> 7
atggcaacta gccacctcac ctctcgctcc ctcctcgtcc aagcccagta ccccatctca 60
cggctcccat ccaacctccg cctctccctc tcccaccaca agcaaccagc cgccgtcgcc 120
aagcgccgcc gagcccccgc cccctcccac ccggccttct cttcggtcat ccgcggccgt 180
cccaagaaag tccccatccc ggaaaacggc gagccagccg ccggtgtccg cgtcactgaa 240
cgtggcctgg cctatcatct tgacggcgcg cccttcgagt tccagtacag ttacacagag 300
acgccgcgcg cgcgccccgt cgcgctccgc gaggccccgt tcctgccgtt cgggcctgag 360
gtaacgccgc gcccatggac cgggaggaag ccgctcccca agagccgcaa ggaactgcct 420
gagttcgact ccttcatgct cccgccgccg ggcaagaagg gggtgaagcc cgtgcagtcg 480
ccggggccat tccttgccgg cacggagccg aggtaccaag cggcgtccag ggaggaggtc 540
ctcggggagc ctctcacaaa ggaggaggtc gacgagctcg tcaaggcgac cctcaagacc 600
aagcggcagc ttaatatcgg tagagatggt ctaacacaca atatgttgga gaacattcat 660
tcgcattgga agaggaagag agtgtgcaag ataaaatgca aaggtgtatg cacggttgat 720
atggataatg tctgccagca gctagaggag aaagttggag gaaaagtaat tcatcatcag 780
ggtggtgtga tatttctctt tcgtggtaga aactacaatt acagaactcg cccaatctat 840
ccacttatgc tttggaaacc tgctgcacca gtgtaccccc gcttggttaa aaagatccca 900
gacggcttaa ctccagatga ggcagaagat atgcgcaaga gaggacgtca gttaccacca 960
atttgcaaac tcggaaaaaa tggtgtttat cttaacctcg tgaagcaagt tcgagaagca 1020
tttgaagcat gtgatcttgt ccgggttgat tgctcaggtc ttaataaaag tgattgcaga 1080
aagataggag ctaaacttaa ggatctagtt ccctgtacct tactgtcttt tgagtttgaa 1140
catatactga tgtggagagg aaatgattgg aaatcatccc ttcctccatt agaagaaaat 1200
gattttaaag tggcgagcga ccaaattttg aatagcaaag aagcaggttc tggaagtgct 1260
ctgaccccaa ttgagctggt caacaatgcc acgtctctca agaaatgcaa cttgattgaa 1320
ggtgcagaaa aattggaaga ttccatgaag tctagttttg aaaatggtat gattttgggt 1380
tctgcatgtg gaaaccctgg agtatgcaac tctgaaggta tagatggaac tgagtcctca 1440
gctgatgctc caattgaatt ttctccttca aattcagcaa gggatttaga tccatctcaa 1500
acatcaacat tgtattgcca aagctcccta ttggacaaga gtgaaaatgg agagctcatt 1560
gagatgtacc ctgacagatg tggaaactcg gaacaatctc cagatgtacc agaagcttta 1620
acttgtctaa tgggcagcag tgatgagatt catgaattgg aaactatgag gagaaactgc 1680
aaacatttaa acggcagcga tggtgttaac agtgattcca tagtcccttc ctacatggaa 1740
ggaattttac tccttttcaa acaagccatt gacagtggca tggcactcgt gctgaatgaa 1800
aatgagtttg ctgatgccaa ttatgtgtat caaaagtctg ttgcttttac aaagacggct 1860
ccacgatacc tggtactccg gcatacacca aggaagtccc atggtaccca gaagactgag 1920
ccagccaaga atgtaaggat aaataagcat cttgaagaac ataaagtatc tgatcatgtc 1980
aaaaagaaag aaattgtcat gggaggatca agaatgcaga gaaatgatca cgcacgagaa 2040
tttctatcag atgttgttcc acagggtacc ttaagagtag atgaacttgc taaattactg 2100
gct 2103
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 8
actatcaacc ccaaaaaacc 20
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 9
tttggctttt tgaccccat 19
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 10
atgaaaaatg taacccattc tt 22
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 11
cctctacgca attcttccga 20
<210> 12
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 12
atgataatag acagggtaca gg 22
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 13
ttatagtgaa acaagttggg aag 23
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 14
atgatctggc atgtacagaa tg 22
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 15
ctaaaagagg gtatcctgag ca 22
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 16
cggtatctct ggaatatgag t 21
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 17
taaagggccc gaaatacctt 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 18
atgggagtaa caaagaaacc 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 19
tgttgctcca atacctaacc 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 20
acggcgaaac atttatacaa 20
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 21
ttacttacgg cgacgaagaa ta 22
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 22
atgcttagtc ccaaaagaac 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 23
aaccgaagaa attgacttcg 20
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 24
aaaacgatgt ggtagaaagc 20
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 25
agaattccgc cttccttaaa 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 26
ggggatatag ctcagttggt 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 27
tggagataag cggactcgaa 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 28
gggctattag ctcagtggta 20
<210> 29
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 29
tggacttgaa ccagagacct c 21
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 30
tcgttagctt ggaaggctag 20
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 31
gcgggtatag tttagtggta 20
<210> 32
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 32
ggttgcccgg gactcgaa 18
<210> 33
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 33
gggttgctaa ctcaatggta gag 23
<210> 34
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 34
ggatatggcg aaatcggta 19
<210> 35
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 35
tggggataga gggacttga 19
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 36
tagggctata cggattcgaa 20
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 37
agggctatag ctcagttcgg 20
<210> 38
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 38
atgcctagat cccgtataaa tg 22
<210> 39
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 39
ttattcaaat tcaaagcgct tc 22

Claims (8)

1. A gene related to chloroplast development of yellow leaf phenotype rice, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2.
2. Use of the gene involved in chloroplast development in yellow leaf phenotype rice according to claim 1 in breeding of a new variety of rice.
3. Use of the gene involved in chloroplast development in rice having the yellow leaf phenotype according to claim 1 in the regulation of chloroplast development in rice.
4. The use according to claim 3, wherein the gene involved in chloroplast development in rice having the yellow leaf phenotype results in decreased chloroplast RNA splicing efficiency.
5. The use according to claim 3, wherein the gene involved in chloroplast development in rice with the yellow leaf phenotype is aberrant chloroplast thylakoid structure.
6. A recombinant vector comprising the gene involved in chloroplast development in rice having the yellow leaf phenotype according to claim 1.
7. A molecular marker for locating a related gene of rice chloroplast development is characterized in that the nucleotide sequence of an upstream primer of the molecular marker is shown as SEQ ID NO.3, and the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 4.
8. A molecular marker for identifying genes related to chloroplast development in rice having the yellow leaf phenotype according to claim 1, wherein the nucleotide sequence of an upstream primer of the molecular marker is represented by SEQ ID No.5, and the nucleotide sequence of a downstream primer is represented by SEQ ID No. 6.
CN202110610998.7A 2021-06-01 2021-06-01 Related gene for rice chloroplast development, molecular marker and application Active CN113234733B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110610998.7A CN113234733B (en) 2021-06-01 2021-06-01 Related gene for rice chloroplast development, molecular marker and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110610998.7A CN113234733B (en) 2021-06-01 2021-06-01 Related gene for rice chloroplast development, molecular marker and application

Publications (2)

Publication Number Publication Date
CN113234733A CN113234733A (en) 2021-08-10
CN113234733B true CN113234733B (en) 2022-06-03

Family

ID=77136255

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110610998.7A Active CN113234733B (en) 2021-06-01 2021-06-01 Related gene for rice chloroplast development, molecular marker and application

Country Status (1)

Country Link
CN (1) CN113234733B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115960951B (en) * 2022-11-23 2024-07-12 华南农业大学 Application of AL7 gene in regulation and control of rice chloroplast development and/or rice leaf color
CN117305322B (en) * 2023-10-09 2024-06-18 仲恺农业工程学院 Chloroplast development regulation gene DG143 and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101486757A (en) * 2009-03-06 2009-07-22 中国农业科学院作物科学研究所 Plant chloroplast development associated protein, and coding gene and use thereof
CN103114076A (en) * 2013-01-29 2013-05-22 浙江省农业科学院 Rice leaf color control gene heme oxygenase2 (HO2) and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101486757A (en) * 2009-03-06 2009-07-22 中国农业科学院作物科学研究所 Plant chloroplast development associated protein, and coding gene and use thereof
CN103114076A (en) * 2013-01-29 2013-05-22 浙江省农业科学院 Rice leaf color control gene heme oxygenase2 (HO2) and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
《A Strategy for Genome-Wide Identification of Gene Based Polymorphisms in Rice Reveals Non-Synonymous Variation and Functional Genotypic Markers》;Srivastava Subodh K等;《PLOS ONE》;20141231;第9卷(第9期);第1-13页 *
《水稻黄绿叶突变体ygl209的遗传分析与目标基因精细定位》;李广贤等;《作物学报》;20151231;第41卷(第10期);第1603-1611页 *

Also Published As

Publication number Publication date
CN113234733A (en) 2021-08-10

Similar Documents

Publication Publication Date Title
Hayes et al. Recombination within a nucleotide-binding-site/leucine-rich-repeat gene cluster produces new variants conditioning resistance to soybean mosaic virus in soybeans
KR101303110B1 (en) Corn Event MIR604
JP5850475B2 (en) Cadmium absorption control genes, proteins, and rice that suppresses cadmium absorption
CN105695478B (en) Gene for regulating plant type and yield of plant and application thereof
CN113234733B (en) Related gene for rice chloroplast development, molecular marker and application
CN104067944B (en) Rice fertility regulates and controls construct and its transformation event and application
Fletcher et al. Development of a next-generation NIL library in Arabidopsis thaliana for dissecting complex traits
CN112457386A (en) Protein EAD1 related to control of ear length and row grain number of corn as well as coding gene and application thereof
CN111732644B (en) Powdery mildew resistance related protein Pm41, and coding gene and application thereof
CN107338254A (en) For the polynucleotides and method of the plant for preparing resistant to fungal pathogens
Kadirjan-Kalbach et al. Allelic variation in the chloroplast division gene FtsZ2-2 leads to natural variation in chloroplast size
CN112609017B (en) Molecular marker for detecting rice grain shape, corresponding gene and application
WO2024108862A1 (en) Rice white leaf and panicle gene wlp3 and application thereof in rice stress resistance and yield increase
CN108794610B (en) Corn cross-incompatibility related protein ZmGa1S, and coding gene and application thereof
CN108329383B (en) Protein related to corn hybridization incompatibility and coding gene and application thereof
CN113151560B (en) Molecular marker for screening poplar with high pore density and high photosynthetic efficiency as well as method and application thereof
Sharon et al. A single NLR gene confers resistance to leaf and stripe rust in wheat
CN112195269B (en) Molecular marker related to rice nuclear male sterility phenotype and application thereof
CN111876433B (en) Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof
CN111100869B (en) Molecular marker co-separated from rice photo-thermo-sensitive nuclear male sterility character and application
Huang et al. Microarray expression analysis of the main inflorescence in Brassica napus
CN111100942A (en) Molecular marker related to rice photo-thermo-sensitive nuclear male sterility phenotype and application
Zhao et al. Validating a Major Quantitative Trait Locus and Predicting Candidate Genes Associated With Kernel Width Through QTL Mapping and RNA-Sequencing Technology Using Near-Isogenic Lines in Maize
CN112011565B (en) Cotton transformation event KJC003 and application thereof
CN111825751B (en) Clone of land cotton bud yellow gene vsp and its function

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant