CN111876433B - Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof - Google Patents
Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof Download PDFInfo
- Publication number
- CN111876433B CN111876433B CN202010789346.XA CN202010789346A CN111876433B CN 111876433 B CN111876433 B CN 111876433B CN 202010789346 A CN202010789346 A CN 202010789346A CN 111876433 B CN111876433 B CN 111876433B
- Authority
- CN
- China
- Prior art keywords
- wheat
- gene
- mutant
- nucleotide sequence
- tayg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y606/00—Ligases forming nitrogen-metal bonds (6.6)
- C12Y606/01—Ligases forming nitrogen-metal bonds (6.6) forming coordination complexes (6.6.1)
- C12Y606/01001—Magnesium chelatase (6.6.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a wheat staged color-changing mutant gene with both marker identification and ornamental values and application thereof, wherein the gene has the nucleotide sequence shown in SEQ ID NO: 1, the seedling stage leaves of the wheat with the mutant gene are yellow green, the heading stage leaves turn green, and the yield of the wheat is kept unchanged. In the process of crossbreeding, the gene is introduced into a crossbred parent to be used as a marker character, the target character is selected in the seedling stage, a powerful tool is provided for the breeding of ornamental wheat, and the leaf color is used as the marker character to screen mutants to search mutant genes and research the functions of the mutant genes.
Description
Technical Field
The invention relates to the technical field of agricultural planting and genetic engineering, in particular to a wheat staged color-changing mutant gene with both marker identification and ornamental values and application thereof in genetic engineering and molecular breeding.
Background
The magnesium chelatase is a key enzyme in the chlorophyll synthesis process, consists of three subunits (ChlH, ChlD and ChlI) of a catalytic subunit H and an AAA + subunit I, D, and catalyzes protoporphyrin IX and Mg2+Chelation forms magnesium protoporphyrin IX. Protoporphyrin IX is a common precursor for the last step of chlorophyll and heme biosynthesis. The lack of chlorophyll in higher plants results in a yellowish green phenotype of the leaves. The extremely rapid development of the sightseeing leisure agriculture has increasing demand on ornamental wheat, and has very important significance for expanding the function of the wheat, improving the economic benefit of the wheat, developing the tourism of the country, assisting the 'country happiness' and meeting the demand of people on the colorful leaf ornamental wheat, breeding the wheat with stable inheritance and ornamental value and having no obvious influence on the yield of the wheat.
Disclosure of Invention
The invention aims to solve the technical problem of providing a wheat staged color-changing mutant gene with both marker identification and ornamental values and application thereof.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows.
The wheat staged color-changing mutant gene with both marker identification and ornamental values has the nucleotide sequence shown in SEQ ID NO: 1. The specific gene fragment of the gene has the nucleotide sequence shown in SEQ ID NO: 4.
The invention also includes mRNA encoded by the nucleotide sequence, which has the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3.
The invention also includes the expression product of the above nucleotide sequence and its biological effect.
The invention also comprises a recombinant expression vector, a transformant and a transgenic plant containing the nucleotide sequence.
The invention also comprises a specific primer of the gene, which has the sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7.
The invention also comprises the application of the nucleotide sequence in wheat molecular marker assisted breeding.
The invention also comprises the application of the nucleotide sequence in cultivating wheat with ornamental value and normal yield, and the wheat strain containing the nucleotide sequence is cultivated through genetic engineering or hybridization transformation, the leaves of the wheat strain are yellow-green in seedling stage, the leaf color of the wheat strain is green in heading stage, and the yield of the wheat is kept unchanged.
Adopt the produced beneficial effect of above-mentioned technical scheme to lie in: the wheat magnesium chelatase I subunit gene CHLI2 encodes a chloroplast protein, which is an important enzyme in the synthesis process of chlorophyll and has a total length of 1440 bp. The invention provides a wheat leaf color mutant with high ornamental value, which has a single base mutation from G to T at 119 th base of a magnesium chelatase subunit CHLI2 gene, has a DNA sequence shown as SEQID NO.1 and is named as TaYG, the mutation occurs at a shearing site of a first exon and a first intron of the gene, the misrecognition of an mRNA shearing process is caused, the first intron is not sheared, and a translated expression protein is terminated at the 50 th amino acid in advance and is expressed as yellow green at a seedling stage.
In the process of cross breeding, the gene is introduced into a cross parent to be used as a marker character, and a target character is selected in the seedling stage, so that a powerful tool is provided for the breeding of ornamental wheat; based on the development and the demand of sightseeing leisure agriculture, the ornamental wheat with ornamental value and unaffected yield is cultivated by the method, and the method has very important significance for expanding the functions of the wheat, improving the economic benefit of the wheat, developing the tourism in the village, assisting the joy in the village and the like. In addition, the mutant with the mutant gene TaYG is yellow green, and has important significance for researching the synthesis or degradation process of chlorophyll of plants; meanwhile, the leaf color is used as a marker character to screen mutants to search mutant genes and research the functions of the mutant genes.
Drawings
FIG. 1 is a comparison of wheat leaf color mutant tayg and contrast shan 302518 plants and mature seeds in different growth periods; in the figure: (A) a seedling stage; (B) overwintering period; (C) a jointing stage; (D) heading period; (E) a maturation period; (F) (G) seed grains; the left side of the plant picture is shan 302518, and the right side is mutant tayg.
FIG. 2 is a graph for measuring the chlorophyll content SPAD value of the mutant tayg and the control shan 302518 leaf.
FIG. 3 is a fine positioning diagram of TaYG; showing the gene distribution of the target gene candidate segment and related linkage markers.
FIG. 4 is a screenshot of the alignment of CHLI2 and TaYG genes; in the figure, the difference sites are marked by boxes; wherein two repeats of Shan-1 and Shan-2 are DNA sequences of CHLI2 gene, two repeats of yg-1 and yg-2 are DNA sequences of TaYG gene, and CS is transcriptome sequence of Chinese spring sequence.
FIG. 5 is a diagram showing the verification of the complementary function of the TaYG gene; t for transformation of the tayg mutant with the complementation vector0Phenotype of the plants of the generations.
FIG. 6 is a structure diagram of chloroplast structure of wild type shan 302518 and mutant tayg second leaf in three-leaf stage; (A, C) chloroplast of wild type shan 302518; (B, D) mutant tayg chloroplasts, wherein the scales of A and B are 250 nm; and the scale of C and D is 500 nm.
FIG. 7 is a graph of the transient expression of wheat CHLI2 protein and the mutant protein TaYG in Arabidopsis protoplasts.
Detailed Description
The following examples illustrate the invention in detail. The raw materials and various devices used in the invention are conventional commercially available products, and can be directly obtained by market purchase.
In the following description of embodiments, for purposes of explanation and not limitation, specific details are set forth, such as particular system structures, techniques, etc. in order to provide a thorough understanding of the embodiments of the present application. It will be apparent, however, to one skilled in the art that the present application may be practiced in other embodiments that depart from these specific details.
It will be understood that the terms "comprises" and/or "comprising," when used in this specification and the appended claims, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
It should also be understood that the term "and/or" as used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.
Furthermore, in the description of the present application and the appended claims, the terms "first," "second," "third," and the like are used for distinguishing between descriptions and not necessarily for describing or implying relative importance.
Reference throughout this specification to "one embodiment" or "some embodiments," or the like, means that a particular feature, structure, or characteristic described in connection with the embodiment is included in one or more embodiments of the present application. Thus, appearances of the phrases "in one embodiment," "in some embodiments," "in other embodiments," or the like, in various places throughout this specification are not necessarily all referring to the same embodiment, but rather "one or more but not all embodiments" unless specifically stated otherwise. The terms "comprising," "including," "having," and variations thereof mean "including, but not limited to," unless expressly specified otherwise.
In the study, the magnesium chelatase I subunit gene CHLI2, which encodes a chloroplast protein, is an important enzyme in the chlorophyll synthesis process and has a total length of 1440 bp. The research provides a wheat leaf color mutant gene TaYG with high ornamental value, the DNA sequence of which is shown in SEQ ID NO.1, the gene is a single base mutation from G to T at 119 th base of a magnesium ion chelatase subunit gene CHLI2, the mutation occurs at a first exon and a first intron shearing site of the gene CHLI2, mRNA error shearing occurs in the gene, the 1 st intron is retained, the reading frame of the encoded gene is changed, and the encoded protein is terminated early. The gene can cause the yellow-green leaves of the wheat at the seedling stage and the green leaves at the heading stage to turn green, has no influence on the yield, can be applied to the molecular marker assisted breeding of the wheat and breeds a wheat variety with great ornamental value.
The research also provides a specific gene segment of the mutant gene TaYG, and the sequence is shown in SEQ ID NO. 4. The research also provides a specific KASP primer for detecting the specific gene fragment of the leaf color mutant gene TaYG, which is shown in SEQ ID NO: 5. SEQ ID NO: 6 and SEQ ID NO: shown at 7.
The research also provides application of the magnesium chelatase I subunit gene CHLI2, the leaf color mutant gene TaYG, specific gene fragments thereof or specific primers thereof in wheat breeding. The research also provides application of the magnesium chelatase I subunit gene CHLI2, the leaf color mutant gene TaYG, the specific gene fragment thereof or the specific primer thereof in the detection of wheat yellow-green seedling genes.
In the process of cross breeding, the gene is introduced into a cross parent to be used as a marker character, and the target character is selected in the seedling stage, so that a powerful tool is provided for the breeding of ornamental wheat. In addition, the mutant with the mutant gene TaYG shows yellow green leaf color, and has important significance for researching the chlorophyll synthesis or degradation process of plants; the method also has important significance for screening mutants by using leaf color as a marker character to search mutant genes and researching the functions of the mutant genes.
Specific experimental studies of the present invention are shown in the following examples.
Example 1 phenotypic and genetic analysis of wheat leaf color mutant tayg
(1) The wheat center of agriculture and forestry science research institute in Shijiazhuang city utilizes a tissue culture means to culture anthers of wheat resource Shaan 302518, and a yellow-green leaf color mutant (named as tayg) is found in regenerated seedlings. Under the field planting condition, the mutant has obvious yellow green leaves in the seedling stage in the growth period, the leaf color after heading is normal green, the mutant is not different from that of a normal plant, the early senescence is shown by contrasting with the leaves of a wild type shan 302518 in the late stage of filling, the green-keeping property of the mutant is better, the grain width of the mutant grains is obviously widened compared with that of the wild type, and the grain length is not obviously changed (figures 1A-G).
(2) Determination of wheat leaf color mutant tayg chlorophyll content
The chlorophyll content SPAD value determination is respectively carried out on the leaf of the striking flower variant tayg and the comparison shan 302518, the results show that the chlorophyll content of the mutant is obviously lower than that of the leaf of the comparison shan 302518 before heading, the chlorophyll content of the mutant is equivalent to that of the comparison shan 302518 after heading, and the chlorophyll content of the mutant is higher than that of the comparison shan 302518 plant in the late stage of filling (see figure 2).
(3) Genetic analysis of mutant tayg
Wild type shan 302518 is hybridized with mutant tagy, and the first filial generation F1Intermediate characters of two parents are expressed, and the mutant phenotype is controlled by a semi-dominant gene. F2Leaf color separation evident in later population development, in which hybrid F2Passage normal individuals (130 strains): intermediate type (294 strain): the mutant individuals (136 strains) met the separation ratio (χ) of 1:2:12＝1.53＜χ2 0.055.99, df 2), the results indicate that the mutant phenotype is a semi-dominant trait controlled by a single gene.
Example 2 map-based cloning of the mutant Gene TaYG
(1) Primary positioning: for tayg mutant F2:3And (3) carrying out 660K chip sequencing on the homozygous green and yellow-green leaf color pools of the family, analyzing the sequencing result, and mainly focusing the differential SNP in the 600-649Mb interval range at the tail end of the 7BL chromosome. In the 600-649Mb interval, 7 effective chromosome-specific KASP markers are developed according to 660K chip data for polymorphism verification, and then 10 effective SSR markers are further developed. Using the above-mentioned marks at 100F2Genotyping validation was performed in the progeny cohort, mapping TaYG to within about 40Mb (644.1-673.8Mb) of the 7BL chromosome based on linkage.
(2) Fine positioning: hybridizing the yellow-green leaf color mutant tayg with stone 4185 to obtain F1Generation, F1Selfing to obtain F2And (4) a group. Use of 3438 Strain F2Extracting leaf DNA of a single plant at the tillering stage for fine positioning, and further developing SSR markers M-23(644.1Mb) and M-18(655.6Mb) for F2Performing linkage exchange analysis on the generation plants, and obtaining 156 single plants with recombination between two markers after primary screening; after further developing and encrypting KASP markers M-31(645.3Mb), M-80(647.8Mb), M-164(648.4Mb), AX-110034657(648.65Mb), AX-111526601(649.3Mb), M-89(650.3Mb) and M-59(653Mb), AX-110034657 is encrypted at F2The gene of interest was co-segregating with the trait in the population and located between the molecular markers M-164(648.4Mb) and AX-111526601(649.3 Mb).
(3) And (3) gene prediction: according to the Chinese spring reference genome sequence and the fine localization result, candidate genes of TaYG are predicted, the localization interval corresponds to 917.6kb in the Chinese spring genome, and 10 predicted protein coding genes (refer to Chinese spring notes) are arranged in the interval (figure 3). RT-PCR amplification analysis of these 10 candidate genes revealed that the genes TravesCS 7B02G382600, TravesCS 7B02G382900, TravesCS 7B02G383400 and TravesCS 7B02G383500 were not expressed in both mutant and wild type; expression levels of TravesCS 7B02G382700, TravesCS 7B02G383100, TravesCS 7B02G383200, and TravesCS 7B02G383300 were very low and were not significantly different from each other; the gene, TravesCS 7B01G382800, showed significant down-regulation in the mutant, about 5-fold down-regulation, and TravesCS 7B02G383000 showed significant up-regulation, about 4-fold up-regulation (FIG. 7). Since the TravesCS 7B01G382800 gene is annotated as encoding the magnesium chelatase subunit CHLI2 in the chlorophyll synthesis process and is an important enzyme in the chlorophyll synthesis process, CHLI2 is listed as an important candidate gene, and TravesCS 7B02G383000 which up-regulates expression is used as a candidate gene.
Designing primers by referring to a Chinese spring sequence, amplifying a target gene Traes CS7B01G382800 of a wild type shan 302518 and a mutant TaYG, searching for DNA polymorphism difference between the two, finding that the two have a G-T point mutation at the boundary of a first exon and a first intron through gene amplification and sequencing comparison, wherein a mutant TaYG gene has a nucleotide sequence shown as SEQ ID No.1, extracting RNA from leaves of the wild type shan 302518 and the TaYG mutant respectively, synthesizing cDNA through reverse transcription by taking the extracted RNA of the wild type and the mutant as templates, amplifying 5 'and 3' ends of the cDNA by using a cDNA end rapid amplification technology (RACE), and sequencing to show that mRNA of the mutant TaYG gene has a nucleotide sequence shown as SEQ ID No.2 or SEQ ID No.3, compared with the wild type shan 302518, generating error recognition of mRNA shearing at a point mutation site of the mutant, and retaining a1 st intron, thereby causing a frameshift mutation (fig. 4).
Example 3 complementation experiment of candidate genes
Genome DNA of wild type shan 302518 young tissue is extracted by referring to CTAB method, and primer is designed
F:AATTCGAGCTCGGTACCCGGGCGCGGACAAAAGTATGATCTCCC(SEQ ID NO：8)；
TGTAAAACGACGGCCAGTGCCAACAGAACTGGCGAATATCCC (SEQ ID NO: 9), amplifying 1791bp promoter at the 5' end of CHLI2 and 1440bp DNA of CHLI2 total length, carrying out double enzyme digestion on a binary expression vector pCAMBIA1300 empty vector by HindIII and BamHI, fusing the promoter and DNA sequence with the double enzyme digested pCAMBIA1300 vector, transforming Escherichia coli competence DH5a, verifying positive bacterial plaque by PCR, and verifying the accuracy of the sequence by sequencing. The correct plasmid is transformed into agrobacterium tumefaciens EHA105, and is introduced into a mutant tayg by an agrobacterium-mediated method, and 4 positive single plants are screened together by hygromycin resistance screening, and the result shows that the leaf color of the transgenic plant shows a normal green phenotype (figure 5). The results further indicate that TravesCS 7B02G383000 is the TaYG gene.
Example 4 ultramicromorphic Structure of chloroplast
The ultramicro-morphological structure of chloroplasts in leaf cells was observed by electron transmission microscopy, and as a result, it was found that the chloroplast endomembrane system in the tayg mutant was not sufficiently developed, and only a few intima folds and sheets were present (FIG. 6). (A) (C) comparing the chloroplast ultrastructure of wild type shan 302518; (B) (D) mutant tayg chloroplast ultrastructure.
Example 5 subcellular localization analysis of CHLI2 and TaYG
Amplifying sequences before CHLI2 gene and TaYG gene terminator by using cDNA of contrast wild type shan 302518 and mutant TaYG as templates, wherein CHLI2 gene primer is
CHLI2F: ttgctccgtggatccATGGCCATGGCCTCCCC (SEQ ID NO: 10), CHLI2R: cttgctcacaggcctGCCAAAGACTTCATAAAACTTCTCAACTAC (SEQ ID NO: 11); the primers for the TaYG gene are: TaYGF: ttgctccgtggatccATGGCCATGGCCTCCCC (SEQ ID NO: 12), TaYGR: cttgctcacaggcctAATTAGAGGGCAGGGGGAAGAG (SEQ ID NO: 13); BamHI and StuI are used for carrying out double enzyme digestion on a plant protoplast transient transformation vector pHBT-GFP-NOS, an amplification sequence is fused with the pHBT-GFP-NOS vector subjected to double enzyme digestion, escherichia coli competence DH5a is transformed, positive bacterial plaque is verified by PCR, the sequence accuracy is verified by sequencing, and plasmids are greatly extracted. Preparing arabidopsis thaliana protoplast, cutting arabidopsis thaliana leaves by using a blade, performing enzymolysis on the protoplast by using cellulase, performing plasmid transformation, performing instantaneous expression of wheat CHLI2 protein and TaYG mutant protein in the arabidopsis thaliana protoplast, wherein the transformation result is shown as figure 7, and the transverse row is sequentially a GFP fluorescence of target protein, an autofluorescence of chloroplast, a light visual field and a fusion diagram of the former three. The normal CHLI2 protein was distributed in chloroplasts, and the TaYG mutein lost its ability to enter chloroplasts, mainly distributed in the cytoplasm.
The above-mentioned embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; such modifications and substitutions do not substantially depart from the spirit and scope of the embodiments of the present invention, and are intended to be included within the scope of the present invention.
Sequence listing
<110> Shijiazhuang city farm and forestry science research institute
<120> wheat stage discoloration mutant gene with both marker identification and ornamental value and application thereof
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1440
<212> DNA
<213> wheat (Triticum aestivuml)
<400> 1
atggccatgg cctccccgtt ctccccggcc tcggccgccg ccgcctcgcc ggccctcttc 60
tccgtctcca cctcccgccc tctctccctc accaccgccg cgaccgccgc cgtctcagtt 120
accgcctctt ccccctgccc tctaatttga aatccaggaa tgcggaatct ccaaaggctc 180
cctcccagtt cactcacccg agctctctcc caccacgcgc agcccgggct ccgtgcaggg 240
gcagcagagg attccgccgc ggccgcttcg ccgtctgcaa tgtcgccgcc ccctccgccg 300
ccgtgcaggt accagcgcgc ccccaaaccc tcaaatctgt ccaacccact atgttctgca 360
ggctctgacg tatgtttgta ggagaccaag ccggcggcgg ctgcgaagga gagccagcgg 420
ccggtgtacc cgttcccggc gatcgtgggg caggacgaga tgaagctctg cctgctgctc 480
aacgtcatcg accccaagat cggcggcgtc atgatcatgg gcgaccgggg caccggcaag 540
tccaccaccg tccgctccct cgtcgacctg ctcccggaca tcagcgtcgt tgtcggcgac 600
ccgttcaact ccgaccccta cgaccccgag gtcatgggcc ccgaggtccg cgaccgcctc 660
ctcaagggcg aggaccttac cgtcaccacc accaagatca ccatggtcga cctgcccctc 720
ggcgccaccg aggacagggt gtgcggcacc atcgacattg agaaggcgct caccgaaggt 780
gtcaaggcgt tcgagccagg cctgcttgcc aaggccaaca gggggatact gtatgtggac 840
gaggttaatc tgctggacga ccatctggtg gatgttctgc tggattccgc ggcttccggg 900
tggaacacgg tggagaggga gggcatctcc atctcccacc ctgcgcggtt catcctcatt 960
gggtccggta acccggagga aggcgagctc cggccacagc tgctggaccg gttcgggatg 1020
cacgcgcagg tcggcacggt cagggatgcg gagctgaggg tgaagattgt agaggagagg 1080
gctcggttcg acaaggaccc gaaaacgttc cggcagtcct acttggagga gcaagggaag 1140
ctccaggatc agatcacatc ggctcggagc aacctcggtt ctgtgcagct cgaccatgat 1200
ctccgggtta agatatccca ggtgtgttct gagctgaatg tggatgggct gagaggagac 1260
attgtcacta acagggctgc caaggcgttg gctgccttga aaggaaggga cattgtgaca 1320
gtggaggaca ttgccactgt gatccccaac tgtttgaggc atcggctccg taaagacccg 1380
ctcgaatcga tcgactcggg cttgcttgta gttgagaagt tttatgaagt ctttggctag 1440
<210> 2
<211> 1367
<212> RNA
<213> wheat (Triticum aestivuml)
<400> 2
auggccaugg ccuccccguu cuccccggcc ucggccgccg ccgccucgcc ggcccucuuc 60
uccgucucca ccucccgccc ucucucccuc accaccgccg cgaccgccgc cgucucaguu 120
accgccucuu cccccugccc ucuaauuuga aauccaggaa ugcggaaucu ccaaaggcuc 180
ccucccaguu cacucacccg agcucucucc caccacgcgc agcccgggcu ccgugcaggg 240
gcagcagagg auuccgccgc ggccgcuucg ccgucugcaa ugucgccgcc cccuccgccg 300
ccgugcagga gaccaagccg gcggcggcug cgaaggagag ccagcggccg guguacccgu 360
ucccggcgau cguggggcag gacgagauga agcucugccu gcugcucaac gucaucgacc 420
ccaagaucgg cggcgucaug aucaugggcg accggggcac cggcaagucc accaccgucc 480
gcucccucgu cgaccugcuc ccggacauca gcgucguugu cggcgacccg uucaacuccg 540
accccuacga ccccgagguc augggccccg agguccgcga ccgccuccuc aagggcgagg 600
accuuaccgu caccaccacc aagaucacca uggucgaccu gccccucggc gccaccgagg 660
acagggugug cggcaccauc gacauugaga aggcgcucac cgaagguguc aaggcguucg 720
agccaggccu gcuugccaag gccaacaggg ggauacugua uguggacgag guuaaucugc 780
uggacgacca ucugguggau guucugcugg auuccgcggc uuccgggugg aacacggugg 840
agagggaggg caucuccauc ucccacccug cgcgguucau ccucauuggg uccgguaacc 900
cggaggaagg cgagcuccgg ccacagcugc uggaccgguu cgggaugcac gcgcaggucg 960
gcacggucag ggaugcggag cugaggguga agauuguaga ggagagggcu cgguucgaca 1020
aggacccgaa aacguuccgg caguccuacu uggaggagca agggaagcuc caggaucaga 1080
ucacaucggc ucggagcaac cucgguucug ugcagcucga ccaugaucuc cggguuaaga 1140
uaucccaggu guguucugag cugaaugugg augggcugag aggagacauu gucacuaaca 1200
gggcugccaa ggcguuggcu gccuugaaag gaagggacau ugugacagug gaggacauug 1260
ccacugugau ccccaacugu uugaggcauc ggcuccguaa agacccgcuc gaaucgaucg 1320
acucgggcuu gcuuguaguu gagaaguuuu augaagucuu uggcuag 1367
<210> 3
<211> 1440
<212> RNA
<213> wheat (Triticum aestivuml)
<400> 3
auggccaugg ccuccccguu cuccccggcc ucggccgccg ccgccucgcc ggcccucuuc 60
uccgucucca ccucccgccc ucucucccuc accaccgccg cgaccgccgc cgucucaguu 120
accgccucuu cccccugccc ucuaauuuga aauccaggaa ugcggaaucu ccaaaggcuc 180
ccucccaguu cacucacccg agcucucucc caccacgcgc agcccgggcu ccgugcaggg 240
gcagcagagg auuccgccgc ggccgcuucg ccgucugcaa ugucgccgcc cccuccgccg 300
ccgugcaggu accagcgcgc ccccaaaccc ucaaaucugu ccaacccacu auguucugca 360
ggcucugacg uauguuugua ggagaccaag ccggcggcgg cugcgaagga gagccagcgg 420
ccgguguacc cguucccggc gaucgugggg caggacgaga ugaagcucug ccugcugcuc 480
aacgucaucg accccaagau cggcggcguc augaucaugg gcgaccgggg caccggcaag 540
uccaccaccg uccgcucccu cgucgaccug cucccggaca ucagcgucgu ugucggcgac 600
ccguucaacu ccgaccccua cgaccccgag gucaugggcc ccgagguccg cgaccgccuc 660
cucaagggcg aggaccuuac cgucaccacc accaagauca ccauggucga ccugccccuc 720
ggcgccaccg aggacagggu gugcggcacc aucgacauug agaaggcgcu caccgaaggu 780
gucaaggcgu ucgagccagg ccugcuugcc aaggccaaca gggggauacu guauguggac 840
gagguuaauc ugcuggacga ccaucuggug gauguucugc uggauuccgc ggcuuccggg 900
uggaacacgg uggagaggga gggcaucucc aucucccacc cugcgcgguu cauccucauu 960
ggguccggua acccggagga aggcgagcuc cggccacagc ugcuggaccg guucgggaug 1020
cacgcgcagg ucggcacggu cagggaugcg gagcugaggg ugaagauugu agaggagagg 1080
gcucgguucg acaaggaccc gaaaacguuc cggcaguccu acuuggagga gcaagggaag 1140
cuccaggauc agaucacauc ggcucggagc aaccucgguu cugugcagcu cgaccaugau 1200
cuccggguua agauauccca gguguguucu gagcugaaug uggaugggcu gagaggagac 1260
auugucacua acagggcugc caaggcguug gcugccuuga aaggaaggga cauugugaca 1320
guggaggaca uugccacugu gauccccaac uguuugaggc aucggcuccg uaaagacccg 1380
cucgaaucga ucgacucggg cuugcuugua guugagaagu uuuaugaagu cuuuggcuag 1440
<210> 4
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
cgccgcgacc gccgccgtct cagt 24
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
gaaggtcgga gtcaacggat tcgccgcgac cgccgccgtc tcagt 45
<210> 6
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
gaaggtgacc aagttcatgc tcgccgcgac cgccgccgtc tcagg 45
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
agagggcagg gggaagaggc ggta 24
<210> 8
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
aattcgagct cggtacccgg gcgcggacaa aagtatgatc tccc 44
<210> 9
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
tgtaaaacga cggccagtgc caacagaact ggcgaatatc cc 42
<210> 10
<211> 32
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
ttgctccgtg gatccatggc catggcctcc cc 32
<210> 11
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
cttgctcaca ggcctgccaa agacttcata aaacttctca actac 45
<210> 12
<211> 32
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
ttgctccgtg gatccatggc catggcctcc cc 32
<210> 13
<211> 37
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
cttgctcaca ggcctaatta gagggcaggg ggaagag 37
Claims (7)
1. The wheat staged color-changing mutant gene with both marker recognition and ornamental value is characterized in that: the nucleotide sequence of the gene is shown as SEQ ID NO: 1 is shown.
2. The mRNA encoded by the nucleotide sequence of claim 1, which has the nucleotide sequence shown as SEQ ID NO: 2 or SEQ ID NO: 3, respectively.
3. An expression product of the nucleotide sequence of claim 1.
4. A recombinant expression vector comprising the nucleotide sequence of claim 1.
5. A transformant comprising the nucleotide sequence of claim 1.
6. Use of the nucleotide sequence of claim 1 or 2 in wheat molecular marker assisted breeding.
7. Use of the nucleotide sequence of claim 1 or 2 for breeding wheat with ornamental value and normal yield, breeding wheat lines containing the nucleotide sequence by genetic engineering or hybridization, wherein the leaves of the wheat lines are yellow-green at seedling stage, the leaves of the wheat lines are green at heading stage, and the yield of the wheat is kept unchanged.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010789346.XA CN111876433B (en) | 2020-08-07 | 2020-08-07 | Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010789346.XA CN111876433B (en) | 2020-08-07 | 2020-08-07 | Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111876433A CN111876433A (en) | 2020-11-03 |
| CN111876433B true CN111876433B (en) | 2021-11-16 |
Family
ID=73211093
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010789346.XA Active CN111876433B (en) | 2020-08-07 | 2020-08-07 | Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111876433B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113025556B (en) * | 2021-04-26 | 2023-08-29 | 东北师范大学 | Separation method of wheat protoplast, cytoplasm and chloroplast |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1253592A (en) * | 1997-04-25 | 2000-05-17 | 赫彻斯特-舍林农业发展有限公司 | DNA sequences coding for subunit child of plant magnesium chelatases and method for determining their action |
| WO2000075340A2 (en) * | 1999-06-04 | 2000-12-14 | E.I. Du Pont De Nemours And Company | Magnesium chelatase |
| WO2007065878A2 (en) * | 2005-12-09 | 2007-06-14 | Basf Plant Science Gmbh | Nucleic acid molecules encoding polypeptides involved in regulation of sugar and lipid metabolism and methods of use viii |
| WO2011114313A1 (en) * | 2010-03-19 | 2011-09-22 | Basf Plant Science Company Gmbh | Plants having enhanced yield-related traits and method for making the same |
| CN110386968A (en) * | 2019-08-12 | 2019-10-29 | 中国农业科学院作物科学研究所 | The application of TaYgl albumen and its encoding gene in regulation wheat leaf color |
-
2020
- 2020-08-07 CN CN202010789346.XA patent/CN111876433B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1253592A (en) * | 1997-04-25 | 2000-05-17 | 赫彻斯特-舍林农业发展有限公司 | DNA sequences coding for subunit child of plant magnesium chelatases and method for determining their action |
| WO2000075340A2 (en) * | 1999-06-04 | 2000-12-14 | E.I. Du Pont De Nemours And Company | Magnesium chelatase |
| WO2007065878A2 (en) * | 2005-12-09 | 2007-06-14 | Basf Plant Science Gmbh | Nucleic acid molecules encoding polypeptides involved in regulation of sugar and lipid metabolism and methods of use viii |
| WO2011114313A1 (en) * | 2010-03-19 | 2011-09-22 | Basf Plant Science Company Gmbh | Plants having enhanced yield-related traits and method for making the same |
| CN102892891A (en) * | 2010-03-19 | 2013-01-23 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and method for making the same |
| CN110386968A (en) * | 2019-08-12 | 2019-10-29 | 中国农业科学院作物科学研究所 | The application of TaYgl albumen and its encoding gene in regulation wheat leaf color |
Non-Patent Citations (5)
| Title |
|---|
| GenBank登录号：KF974532.1;NCBI;《NCBI GenBank》;20140516;第1-1462位 * |
| Genetics and mapping of the novel leaf-colour mutant gene yglw-1 on wheat chromosome arm 2BS;X. J. Li等;《Crop & Pasture Science》;20181001;第1-11页 * |
| Single Nucleotide Mutagenesis of the TaCHLI Gene Suppressed Chlorophyll and Fatty Acid Biosynthesis in Common Wheat Seedlings;Chaojie Wang等;《Frontiers in Plant Science》;20200220;第11卷;第1-14页 * |
| 小麦叶绿素缺失突变体B23的鉴定及基因定位;蒋宏宝;《中国优秀硕士学位论文全文数据库 农业科技辑》;20181115;第D047-12页 * |
| 小麦黄绿突变体特性研究与遗传分析;李宁;《中国博士学位论文全文数据库 农业科技辑》;20130815;第D047-5页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111876433A (en) | 2020-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| MX2015002964A (en) | Fluorescence activated cell sorting (facs) enrichment to generate plants. | |
| CN106998665A (en) | The generation of haplophyte | |
| CN108165554B (en) | Corn leaf width control gene ZmNL4 and application thereof | |
| CN110157726A (en) | The method of Plant Genome fixed point replacement | |
| CN105884874A (en) | Protein relevant with male fertility of plants as well as coding gene and application of protein | |
| CN108291234A (en) | Multiple sporinite forms gene | |
| Sheng et al. | Yellow-Leaf 1 encodes a magnesium-protoporphyrin IX monomethyl ester cyclase, involved in chlorophyll biosynthesis in rice (Oryza sativa L.) | |
| US20180116141A1 (en) | Haploid induction | |
| CN112457386A (en) | Protein EAD1 related to control of ear length and row grain number of corn as well as coding gene and application thereof | |
| CN111876433B (en) | Wheat staged color-changing mutant gene with both marker recognition and ornamental values and application thereof | |
| CN110195122A (en) | It is a kind of for detecting the nucleic acid sequence and its detection method of corn plant T anti-4 | |
| CN107418971B (en) | Cloning and application of maize kernel carotenoid defect gene SCD | |
| Li et al. | A valine residue deletion in ZmSig2A, a sigma factor, accounts for a revertible leaf-color mutation in maize | |
| CN108064302A (en) | QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage | |
| AU2018263195A1 (en) | Methods for isolating cells without the use of transgenic marker sequences | |
| CN115552038A (en) | Enhancement of maize disease resistance to northern leaf blight by QTL on chromosome 4 | |
| CN110407921B (en) | Plant grain development related protein SGDW1 derived from foxtail millet and encoding gene and application thereof | |
| CN108794610B (en) | Corn cross-incompatibility related protein ZmGa1S, and coding gene and application thereof | |
| CN108329383B (en) | Protein related to corn hybridization incompatibility and coding gene and application thereof | |
| EP3571925A1 (en) | Artificial marker allele | |
| CN113817033B (en) | Application of ZmELF3.1 protein and its functional deletion mutant in regulating and controlling crop aerial root number or layer number | |
| CN115894646A (en) | OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight | |
| CN114395580A (en) | Gene for controlling plant height of corn | |
| CN112662687A (en) | Method, kit and gene for postponing maize florescence | |
| CN113528512B (en) | Flanking sequence of soybean GmWRI1b-OX6 with transferred GmWRI1b gene, primer pair for detection and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |