CN108707596B - Application of metalloprotease WS1B in regulation and control of plant chloroplast metabolism - Google Patents

Abstract

The invention discloses an application of metalloprotease WS1B in regulation and control of plant chloroplast metabolism. The WS1B protein of the invention is a protein of a) or b) or c) or d) as follows: a) the amino acid sequence is a protein shown in a sequence 6; b) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 6; c) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 6; d) and (b) a protein having a homology of 75% or more than 75% with the amino acid sequence shown in sequence No.6 and having the same function. By analyzing the biological function of WS1B, the method discloses the way of participating in chlorophyll metabolism, and provides a new idea for the deep research of molecular mechanism of chlorophyll metabolism.

Description

Application of metalloprotease WS1B in regulation and control of plant chloroplast metabolism

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of metalloprotease WS1B in regulation and control of plant chloroplast metabolism.

Background

Chlorophyll is an important pigment which is involved in photosynthesis in green plant chlorophyll and plays a key role in energy capture and energy transfer of photosynthesis. Since photosynthesis is important for maintaining the stability of global ecosystem, chlorophyll is also considered as one of the most important substances on earth (Liu et al 2007). The deep research on the molecular mechanism of chlorophyll metabolism has important significance for comprehensively understanding the mechanism of photosynthesis, promoting the sustainable development of agriculture and accelerating the research and utilization of biomass energy.

The study on chlorophyll metabolism generally starts with the change of leaf color, because the change of chlorophyll content often causes abnormal phenotypes such as albinism, etiolation, light green, dark green, etc. on plant leaves (Kurata et al 2005). Over the last decades, a large number of leaf color mutants have been identified in plants, and molecular biological studies of these mutants have revealed to a large extent the molecular mechanisms of chlorophyll metabolism.

Since the normal metabolism of chlorophyll is destroyed, many leaf color mutants have been considered to be unfavorable for the growth and development of plants and are not useful in agricultural production. However, with the advancement of science and technology and the intensive excavation of related research, some mutants increasingly show greater application potential. For example, the yellow shoot mutant of cotton and the white-to-green mutant of rice, which have no significant effect on the yield and quality of crops, can be used as effective morphological markers for indicating the purity of hybrids (Duncan and Pate 1967; Wu et al 2003); the stay green mutant of durum wheat prolongs the photosynthesis time by delaying the degradation of chlorophyll, thus increasing the yield of grains (Spano et al 2003); the white tea mutant becomes an ideal raw material for preparing high-grade tea due to the improvement of the amino acid content of the leaves and the change of components in the stage whitening return period (plum et al 1996); due to the reduction of chlorophyll content relative to carotenoid and anthocyanin content caused by mutation, a large number of plants in nature show extensive leaf color variation and can be used for cultivating ornamental plants (Keskitalo et al 2005; Matile 2000).

However, although a large number of genes related to chlorophyll metabolism have been identified through studies on leaf color mutants, and primary pathways related to chlorophyll metabolism are described, there is still a large gap in the understanding of molecular mechanisms of chlorophyll metabolism. For example, due to the lack of mutant material, chlorophyll degradation is currently poorly understood; currently, although the genes encoding all 15 enzymes involved in chlorophyll synthesis have been cloned, studies on the transcriptional regulation thereof have just begun (Tang et al.2012). In view of the above situation, the creation of important experimental materials is a main approach for further and intensive research on molecular mechanisms of chlorophyll metabolism.

Disclosure of Invention

An object of the present invention is to provide a novel use of the WS1B protein.

The invention provides an application of WS1B protein in regulation and control of plant chloroplast metabolism and/or development.

The invention also provides application of the WS1B protein in regulation and control of plant chloroplast thylakoid membrane formation.

In the above application, the WS1B protein is a protein of a) or b) or c) or d) as follows:

a) the amino acid sequence is a protein shown in a sequence 6;

b) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 6;

c) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 6;

d) and (b) a protein having a homology of 75% or more than 75% with the amino acid sequence shown in sequence No.6 and having the same function.

WS1B protein of above c), wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The WS1B protein in c) above may be artificially synthesized, or may be obtained by synthesizing its coding gene and then performing biological expression.

The gene encoding WS1B protein of c) above can be obtained by deleting one or several amino acid residues from the DNA sequence shown in SEQ ID No. 4 and/or by carrying out missense mutation of one or several base pairs.

Another objective of the invention is to provide a new use of the biological material related to WS1B protein.

The invention provides application of biological materials related to WS1B protein in regulation and control of plant chloroplast metabolism and/or development.

The invention also provides application of the biological material related to the WS1B protein in regulation and control of the formation of a plant chloroplast thylakoid membrane.

In the above application, the biomaterial is any one of the following a1) to a 12):

A1) a nucleic acid molecule encoding WS1B protein;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising a4) said recombinant vector;

A9) a transgenic plant cell line comprising the nucleic acid molecule of a 1);

A10) a transgenic plant cell line comprising the expression cassette of a 2);

A11) a transgenic plant cell line comprising the recombinant vector of a 3);

A12) a transgenic plant cell line comprising the recombinant vector of a 4).

In the above application, the nucleic acid molecule of A1) is a gene as shown in 1) or 2) or 3) below:

1) the coding sequence is a cDNA molecule or a DNA molecule shown in a sequence 4;

2) a cDNA molecule or a genome DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes WS1B protein;

3) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and codes WS1B protein.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 6 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above applications, the expression cassette containing a nucleic acid molecule encoding WS1B (WS1B gene expression cassette) described in a2) refers to a DNA capable of expressing WS1B in a host cell, which may include not only a promoter for promoting transcription of WS1B but also a terminator for terminating transcription of WS 1B. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: a constitutive promoter; tissue, organ and development specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to: the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV35S terminator, the tml terminator, the pea rbcS E9 terminator and the nopaline and octopine synthase terminators.

The recombinant vector containing the WS1B gene expression cassette can be constructed by using the existing expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Corp.) and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), marker genes for antibiotics (e.g., nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to phosphinothricin as an herbicide, hph gene conferring resistance to hygromycin as an antibiotic, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or marker genes for chemical resistance (e.g., herbicide resistant gene), etc., which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above application, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

In the above application, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

In the above applications, none of the transgenic plant cell lines comprises propagation material.

It is a final object of the present invention to provide a method for breeding transgenic plants with increased levels of chloroplast metabolism and/or development.

The method for culturing the transgenic plant with the improved chloroplast metabolism and/or development level comprises the steps of improving the expression quantity and/or activity of WS1B protein in a receptor plant to obtain the transgenic plant; the transgenic plant has a higher level of chloroplast metabolism and/or development than the recipient plant.

In the above method, the transgenic plant has a higher level of chloroplast metabolism and/or development than the recipient plant occurs when the stem of the transgenic plant turns green.

In the above method, the method for increasing the expression level and/or activity of WS1B protein in the recipient plant is to overexpress WS1B protein in the recipient plant.

In the above method, the overexpression is carried out by introducing a gene encoding WS1B protein into a recipient plant.

In the invention, the encoding gene of the WS1B protein is introduced into a receptor plant through a recombinant vector, and the recombinant vector is an expression vector pWS1B: WS1B or an expression vector p35S: WS 1B.

In the above method, the nucleotide sequence of the gene encoding WS1B protein is a DNA molecule represented by sequence 4.

In the above method, the recipient plant is burley tobacco; the burley tobacco may specifically be the burley tobacco variety TN 90.

Experiments prove that: the WS1B protein provided by the invention participates in the chlorophyll metabolism pathway, and provides a new idea for the deep research of the molecular mechanism of chlorophyll metabolism.

Drawings

FIG. 1 compares the initial position and the fine position of ws1a and ws1 b.

FIG. 2 shows the phenotypes of Honghuadajinyuan (HD) and TN90(TN) at the seedling stage and the adult stage.

FIG. 3 shows the amplification of markers S5 and S7 in a partial BC1F1 recessive individual (white stem) (recombinant individual).

FIG. 4 is a fine mapping and map cloning of ws1a and ws1 b.

FIG. 5 is a comparison of the phenotype of the genetic complementation plants of WS1A and WS1B with that of the control.

FIG. 6 shows transmission electron microscope observation of chloroplast of Honghuadajinyuan (HD) and TN90 (TN).

FIG. 7 shows the amplification of primers specific for WS1A, WS1a, WS1B and WS1b in 22 Burley tobacco varieties and 24 green-stem tobacco varieties.

FIG. 8 shows the amplification of primers specific to WS1A, WS1a, WS1B and WS1b in a portion of the BC1F1 strain and the genotyping of the green stem strain.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

Example 1 localization and mapping of genes ws1a and ws1b

First, initial localization of genes ws1a and ws1b

1. A chlorophyll-deficient white stem mutant white stem1(ws1) was selected from EMS-mutagenized Nicotiana tabacum 100 (ZY). Genetic analysis was carried out by the method of allelic testing (see, for example, Mapping of two white stem genes in transgenic common tobacaco (Nicotiana tabacum L.)), in the following manner: hybridizing the white-stem mutant ws1 with a burley tobacco variety to obtain F1 generation, wherein the F1 generation is the same as the parent and the female parent; and then selfing the F1 generation to obtain selfed progeny, wherein the selfed progeny has no separation of characters. Genetic analysis shows that the white stem character is controlled by 2 recessive cell nuclear genes ws1a and ws1b, and is allelic with the white stem gene of burley tobacco, an important type of cultivation in nicotiana tabacum.

2. A tobacco SSR marker is used for primary localization of two genes ws1a and ws1b (see the following documents: Mapping of two white stem genes in a branched common tobacam L.) by crossing a white stem mutant (ws1) with a red-flower large gold element (HD) of a green-stem tobacco variety to obtain a hybrid F1 generation, then backcrossing the hybrid F1 generation with TN90 to obtain a BC1F1 segregating population, then selfing a green stem single strain in the BC1F1 segregating population to obtain a BC1F2 segregating population, obtaining a population with a green: white segregation ratio of 3:1 by phenotypic identification (in a particular population, only the ws1a or the ws1b gene is segregated separately, FIG. 1), one of the populations is selected for screening SSR markers linked to the white stem mutant phenotype, the genes linked to the marker is selected for the SSR marker linked to the marker a, and the population is selected for the remaining populations where the white stem marker is linked to the SSR marker b, finally positioning ws1a in a12 cM interval bounded by SSR markers PT54006 and PT51778 in the 5 th linkage group and positioning ws1b in a 17.12cM interval bounded by SSR markers PT53716 and TM11187 in the 24 th linkage group; and based on several evidences such as genetics and molecular marker maps, it is presumed that ws1a and ws1b are homologous genes.

Second, fine mapping and map-based cloning of genes ws1a and ws1b

1. Because the experimental materials for genetic analysis and gene localization in the step one belong to the same type of common tobacco, and the polymorphism of the SSR marker is lower in the same type of common tobacco and higher in different types of common tobacco, in order to improve the polymorphism of the SSR marker and facilitate the following gene fine localization and map-based cloning, the invention selects a common tobacco burley tobacco variety TN90(TN) to replace a white stem mutant to carry out the following tests: firstly, a burley tobacco variety TN90(TN) is hybridized with a green stem tobacco variety safflower Hongda (HD) to obtain a hybrid F1. The hybrid F1 generation was then backcrossed with TN90, resulting in a BC1F1 segregating population (FIGS. 1 and 2). The BC1F1 population had a total of 8500 strains, of which 2151 was identified as white stems (recessive) with a segregation ratio of 3:1(χ)² _0.050.424, less than critical value 3.841).

2. Since ws1a is located within a12 cM interval bounded by SSR markers PT54006 and PT51778 in the 5 th linkage group, ws1b is located within a 17.12cM interval bounded by SSR markers PT53716 and TM11187 in the 24 th linkage group. By aligning the SSR primer sequences provided in the document "A high specificity genetic map of tobaco (Nicotiana tabacum L.) amplified from large scale chromosome marker expression" with the genome sequence of safflower large gold (HD), it was shown that ws1b is located between chromosome 19, 64.73Mb and 70.45Mb, whereas the two SSR markers of ws1a, being located on different scalafolds respectively, temporarily failed to confirm the specific chromosomal location of ws1 a.

3. Fine positioning of ws1b is performed. The method comprises the following specific steps: (1) simple repeats of SSR primers can be designed by Searching for the region between chromosome 64.73Mb and 70.45Mb of Honghuadajinyuan 19 using the SSRH Software (described in the following documents: Development of a Local Searching Software for SSR Sites); (2) the obtained SSR simple repetitive sequence and the upstream and downstream 150bp sequences thereof are used for designing SSR primers and detecting the polymorphism between TN90 and safflower large gold; (3) polymorphic markers were used to detect white stem individuals (recessive) in the BC1F1 population. All experimental techniques used in fine Mapping, including genomic DNA preparation, PCR amplification, polyacrylamide gel electrophoresis and silver staining, were performed as described in the literature "Mapping of two white step genes in biochemical common to tobaco (Nicotiana tabacum L.)".

The SSR markers designed by the invention are 88 in total, 10 (S1-S10) have polymorphism between TN90 and safflower large gold, and the electrophoresis bands of the amplification products are clear. First, a small population of 282 individuals (here, the small population is a small part of 2151 white stalk individuals in the BC1F1 population in step 1 and contains 282 white stalk individuals) was tested by using the 10 polymorphic markers, and the markers were found to be closely linked to the white stalk mutant phenotype (fig. 3). Preliminarily locating ws1b within a 910kb interval based on genetic recombination between the SSR marker and ws1 b; subsequently, 6 polymorphic SSR markers (S11-S16) were developed in this interval and further localized in a 220kb interval using the remaining population (the remaining population refers to the remaining white stalk individuals of the 2151 white stalk individuals in step 1 except the small population consisting of 282 white stalk individuals as described above) (FIG. 4). The interval has 5 prediction genes, and a gene coding for metalloprotease (zinc metalloprotease) is preliminarily determined as a candidate gene of ws1b by sequence difference alignment between TN90 and safflower large gold. The ws1b gene has 10 exons and 9 introns, and a single base T insertion located in exon 9 results in a frame shift mutation of the gene (FIG. 4). The nucleotide sequence of the ws1b gene is shown in sequence 1.

4. Since ws1a and ws1b are presumed to be homologous genes, and the ws1b sequence was subsequently searched as query sequence in the safflower macrogold genomic sequence, it was found that another gene highly homologous to the ws1b candidate gene and encoding the same metalloprotease has a sequence difference between TN90 and safflower macrogold. The gene is located on chromosome 18 of safflower large gold, and also has 10 exons and 9 introns, and the deletion of 8 bases located on exon 2 results in frame shift mutation of the gene (figure 4), which is a candidate gene of ws1a, and the nucleotide sequence of the gene is shown as sequence 2.

5. The 8-base deletion described in step 4 was designed as a co-dominant marker M-a, and 470 white stalk individuals (recessive) were detected (here, 470 white stalk individuals (recessive) are part of the 2151 white stalk individuals in the BC1F1 segregating population described above), and the results show that: this marker was fully linked to the white stem mutant phenotype, indicating that ws1a was indeed located in the region where its candidate gene was located (FIG. 4). All the marker information used in fine positioning is shown in table 1.

TABLE 1 molecular markers for the fine mapping and map-based cloning of ws1a and ws1b

Marking	Chromosome	Physical location (Mb)	Forward primer sequence	Reverse primer sequence
					S1	Chr.19	66.34	TATGATTCTCCTTTTATTCCTA	TGCGGTCCACTCCACTGA
S2	Chr.19	66.91	GTGGCAACTAAATGAAAAAAGA	TTAGATATTCAACATCCTCCTT
					S3	Chr.19	67.49	GTTCTATATTTTCAAACAGTGTG	TGACAACCTCAATAAGCCAC
S4	Chr.19	67.92	TCTTATTCTCTTACAACACTCTG	GTAGACAAGCGTAATGAGGA
					S5	Chr.19	68.10	GATGTGTTTCTTTTGCTCTTTAT	AGTCTGAGATTATACTGGGTTG
S6	Chr.19	68.48	AGTTGAATATGAACCTATACAAAT	GATAGTGAAGAAAAATGTGAAAAT
					S7	Chr.19	69.01	GGTACAGCGGGGAAAGATA	AAACCTGCAATTACAAGTCAAA
S8	Chr.19	69.38	TTTTTCCCTACCGATTCTCTAC	TGTTGCTTCTTCACACACATTA
					S9	Chr.19	69.80	CCACTGTTTAAGCAACTTTAGATA	ACACCATATAAAATGATTGTGAAG
S10	Chr.19	69.92	AAACAAAACCGAACCAAACC	GAACGGACGCTAATTCTCAA
					S11	Chr.19	68.20	GTAAAAGATTGATTAAGATTTAGAC	GAGAATTGAAATTATGAGATTATC
S12	Chr.19	68.62	AAAGGGCACTCCCGAATAT	ATGCTTGTAAATCAAATGATGATG
					S13	Chr.19	68.66	TCGTGTAGGTTTAATAAAGGAG	ACAAAAGGAAAGAGGGAAAC
S14	Chr.19	68.79	CGGACATTGATAAGTTGTAGAT	TCCATACGACTGAATAATAGGT
					S15	Chr.19	68.83	AAACGAAATAAATAAAGGAAAGAA	GGGCATAAAAGTCGATCAATAT
S16	Chr.19	68.88	TCTTACCACCATTGTGTAGGA	CAAGTGAGCGTCAGTATTTTC
					M-a	Chr.18	13.25	ACCTGTTCATGGTGGAAGAG	CTGCGTGGTTGACGAGTTC

Example 2 application of metalloprotease WS1A or WS1B in regulating and controlling plant chloroplast metabolism

First, obtaining transgenic WS1A tobacco and transgenic WS1B tobacco

1. Construction of recombinant vectors

(1) Cloning of genes WS1A and WS1B

(1-1) extracting RNA of the leaves of the Honghuadajinyuan, and carrying out reverse transcription to obtain cDNA. RNA Extraction and reverse transcription were performed using the MiniBEST plant RNA Extraction Kit (Code No.9769) and the PrimeScript II 1st Strand cDNA Synthesis Kit (Code No.6210), from TaKaRa, respectively. And (3) taking the cDNA as a template, and adopting a primer CW-1F/CW-1R for amplification to obtain a PCR product.

(1-2) PCR products were subjected to TA cloning (Mighty TA-cloning Kit (TaKaRa Co., Code No.6028)) and sequencing to identify WS1A and WS1B, respectively. The WS1A gene sequence is shown as sequence 3, and the WS1B gene sequence is shown as sequence 4.

(2) Construction of expression vectors

(2-1) double cleavage of pCAMBIA1300-35S (pCAMBIA1300-35S described in "Loose Plant Architecture1, an INDETERMINATE DOMAIN Protein Involuted in Shoot G promoter, Regulates Plant Architecture in Rice") with restriction endonucleases PstI and EcoRI to obtain a 310bp fragment containing the NOS transcription terminator and ligating it into pCAMBIA1300 vector to form an intermediate vector pCAMBIA 1300-NOS;

(2-2) amplifying the WS1A gene using a primer ST-3F/ST-1R using the WS1A plasmid containing the correct sequence as a template, and inserting the amplified gene into an intermediate vector pCAMBIA1300-NOS using an In-Fusion HD Cloning Kit (TaKaRa Co.) to obtain pCAMBIA1300-WS 1A-NOS;

using WS1B plasmid with correct sequencing as a template, adopting a primer ST-3F/ST-1R to amplify WS1B gene, and inserting the amplified gene into an intermediate vector pCAMBIA1300-NOS by using an In-Fusion HD Cloning Kit of TaKaRa company to obtain pCAMBIA1300-WS 1B-NOS;

(2-3) taking safflower large-gold genomic DNA as a template, and respectively amplifying by using two pairs of primers SP-2F/SP-2R and TP-2F/TP-2R to respectively obtain promoters of WS1A and WS 1B;

(2-4) inserting the promoter of WS1A into pCAMBIA1300-WS1A-NOS using In-Fusion HD Cloning Kit of TaKaRa to obtain expression vector pWS1A: WS 1A;

the promoter of WS1B was inserted into pCAMBIA1300-WS1B-NOS using In-Fusion HD Cloning Kit (TaKaRa Co.) to obtain expression vector pWS1B: WS 1B;

(2-5) amplifying the WS1A gene by using a WS1A plasmid containing correct sequencing as a template and adopting a primer ST-1F/ST-1R; the WS1A gene was inserted into pCAMBIA1300-35S expression vector using In-Fusion HD Cloning Kit (Code No.639648) of TaKaRa Co., Ltd to obtain expression vector p35S: WS 1A;

amplifying the WS1B gene by using a primer ST-1F/ST-1R by taking the WS1B plasmid containing correct sequencing as a template; the WS1B gene was inserted into pCAMBIA1300-35S expression vector using In-Fusion HD Cloning Kit (Code No.639648) of TaKaRa to obtain expression vector p35S: WS 1B.

The expression vector pWS1A: WS1A and the expression vector pWS1B: WS1B are both expression vectors of which own promoters drive WS1A and WS 1B; the expression vector p35S: WS1A and the expression vector p35S: WS1B are both expression vectors of which CaMV35S strong promoter drives WS1A and WS 1B. The expression vector pWS1A: WS1A and the expression vector p35S: WS1A both express WS1A protein shown in a sequence 5; the expression vector pWS1B: WS1B and the expression vector p35S: WS1B both express the WS1B protein shown in the sequence 6.

All the primer information used for constructing the vectors described above is shown in Table 2.

TABLE 2 primers for WS1A and WS1B genetic complementary vector construction and cDNA amplification

2. Acquisition of transgenic tobacco plants

(1) The four vectors p35S: WS1A, p35S: WS1B, pWS1A: WS1A and pWS1B: WS1B are transferred into an agrobacterium strain LBA4404 (Bai ao Bai Si special chemical reagent, Inc. in Qingdao, the code number BC301-01) by electric shock, and white rib tobacco variety TN90 is transformed according to the method in the document "High-throughput generation of an activation-tagged mutant library for functional genetic analysis in tobaca", so as to obtain a transferred p35S: WS1A tobacco strain, a transferred p35S: WS1B tobacco strain, a transferred pWS1A: WS1A tobacco strain and a transferred pWS1B: 1B tobacco strain respectively.

(2) PCR identification

PCR identification was carried out using the primers in Table 3 for the p35S: WS1A, p35S: WS1B, pWS1A: WS1A and pWS1B: WS1B tobacco respectively.

TABLE 3 primer pairs for the identification of genetically complementary transgenic plants WS1A and WS1B

Note: a: p35S: WS 1A; b: p35S: WS 1B; c: pWS1A: WS 1A; d: pWS1B WS1B

Through PCR detection and sequencing analysis, more than 20 transgenic tobacco plants are obtained from each vector.

Second, the phenotype of transgenic WS1A tobacco and transgenic WS1B tobacco

The phenotype of the tobacco plant of the p35S: WS1A, the tobacco plant of the p35S: WS1B, the tobacco plant of the pWS1A: WS1A, the tobacco plant of the pWS1B: WS1B and the white rib tobacco variety TN90 is observed.

The results show that: compared with white stalks of TN90, the p35S: WS1A tobacco strain, the p35S: WS1B tobacco strain, the pWS1A: WS1A tobacco strain and the pWS1B: WS1B tobacco strain are recovered to green stalks which are the same as the wild type safflower large golden dollars. The above results indicate that WS1A and WS1B indeed control the white stalk trait of TN90, and either of them can restore it to wild type green stalk (FIG. 5).

Subcellular localization of tris, WS1A and WS1B

1. On-line analysis of the subcellular localization of WS1A and WS1B was performed using Predotar server (https:// urgi. versales. inra. fr/Predotar /).

The results show that: both WS1A and WS1B are localized in the plastids (chloroplasts).

2. To further analyze the effects of WS1A and WS1B in chloroplasts, mid-leaf samples of TN90 and safflower macrogol at the initial flowering stage were prepared and the ultrastructure of chloroplasts was observed by transmission electron microscopy of Hitachi H-7650, according to the methods described in "alternative chloroplastic Development and Delayed Fruit wetting used by Mutations in a Zinc Metalloprotease at the flowering 2 of Tomato".

The results show that: the thylakoid membrane of TN90 chloroplast was severely damaged, with few basal lamina layers and only a few basal lamina layers, in sharp contrast to intact thylakoid membranes of Honghuadajinyuan (FIG. 6). The results show that WS1A and WS1B influence the development of chloroplast by controlling the formation of chloroplast thylakoid membrane, thereby regulating the metabolism of chlorophyll.

Example 3 molecular markers Co-segregating with the Burley tobacco control Gene

Primer design for WS1A, WS1a, WS1B and WS1b genotype identification

1. Downloading WS1A and WS1B whole gene sequences from a safflower large gold genome database, performing sequence comparison by using an online analysis tool MUSCLE (https:// www.ebi.ac.uk/Tools/msa/MUSCLE /) to obtain the sequence difference between WS1A and WS1B, and intercepting the 200-bp and 400-bp genome sequences upstream and downstream of the mutation sites of WS1a and WS1b for later use;

2. due to the high homology of sequences of WS1A and WS1B, specific PCR primers containing gene mutation sites are respectively designed by utilizing the sequence difference between the sequences:

(1) for WS1A and WS1a, a pair of specific primers 1325-2F/1325-1R (i.e. M-a) are designed based on the 8-base length difference between the two, PCR products are separated by polyacrylamide gel electrophoresis, the ones with the fragment size similar to safflower large gold element are considered to contain WS1A, the ones with the fragment size similar to TN90 are considered to contain WS1a, and the ones with the fragment size similar to safflower large gold element and the fragment size similar to TN90 are considered to be WS1A/WS1a hybrid,

in practical application, whether the tobacco to be tested contains the WS1A gene, the WS1a gene, the WS1A gene and the WS1a gene can be determined according to the following method:

if the amplification product size of the 1325-2F/1325-1R primer is 209bp, the tobacco to be detected contains the WS1A gene;

if the amplification product size of the 1325-2F/1325-1R primer is 201bp, the tobacco to be detected contains the ws1a gene;

if the amplification product size of the 1325-2F/1325-1R primer is 209bp and 201bp, the tobacco to be detected contains the WS1A gene and the WS1a gene.

To verify that WS1A and WS1a were identified as correct, PCR sequencing was performed using another pair of specific primers 1325-1F/1325-1R for further confirmation.

(2) For WS1B and WS1B, the difference in single gene length between them could not be clearly shown by polyacrylamide gel electrophoresis, as in ACT-PCR in the references "A simple and effective method for CRISPR/Cas9-induced mutant screening", a reverse primer BW-N4R was designed to pair with the forward specific primer B-N1F for specific amplification of WS1B, and a reverse primer BM-N3R was designed to pair with the forward specific primer B-N1F for specific amplification of WS 1B. The optimal amplification conditions of the WS1B and WS1b specific primers are both obtained by searching the large gold elements of the safflower and the TN90 by a temperature gradient PCR method, and the conditions are determined according to the fact that the specifically amplified gene bands are clear, and the corresponding alleles have no bands or very weak bands.

In practical application, whether the tobacco to be tested contains the WS1B gene, the WS1b gene, the WS1B gene and the WS1b gene can be determined according to the following method:

if the BW-N4R/B-N1F primer has no amplified band or weak amplified band and the amplification product size of the BM-N3R/B-N1F primer is 251bp, the tobacco to be detected contains the ws1B gene;

if the amplification product size of the BW-N4R/B-N1F primer is 250bp, and the BM-N3R/B-N1F primer has no amplification band or weak amplification band, the tobacco to be detected contains the WS1B gene;

if the amplification product size of the BW-N4R/B-N1F primer is 250bp, and the amplification product size of the BM-N3R/B-N1F primer is 251bp, the tobacco to be detected contains a WS1B gene and a WS1B gene;

to verify that WS1B and WS1b were identified as correct, PCR sequencing was performed using another pair of specific primers 6877-1F/6877-2R for further confirmation.

The sequences of the relevant primers and the PCR amplification conditions are shown in Table 4.

TABLE 4 primers for the genotyping of WS1A, WS1a, WS1B and WS1b

Application of primers for identifying WS1A, WS1a, WS1B and WS1b genotypes

1. And (3) carrying out genotype identification on 22 burley tobacco varieties and 24 green-stem tobacco varieties (tables 5 and 6) provided by a national tobacco germplasm resource library (http:// www.ycsjk.com.cn /) by using the specific primers in the step one.

The results show that: all burley tobacco varieties contained homozygous WS1a gene and WS1b gene, while all green-stem tobacco varieties contained homozygous WS1A gene and WS1B gene (fig. 7).

Table 5, 22 burley tobacco germplasm resources for the genotyping of WS1A, WS1a, WS1B and WS1b

Table 6, 24 Nicotiana tabacum germplasm resources for the genotyping of WS1A, WS1a, WS1B and WS1b

Variety of (IV) C	Color of stem
		Adcock	Green colour
Cekpka	Green colour
		Connecticat-S98	Green colour
Greece Basma	Green colour
		Havana No. 1	Green colour
K326	Green colour
		KARABAGLAR izmir	Green colour
Katerini A	Green colour
		Kutsaga
110	Green colour
		Maden	Green colour
Samsun	Green colour
		Saribaglar	Green colour
Wisconsin 38	Green colour
		Xanthi NN	Green colour
An 88-2	Green colour
		Baila cigarette	Green colour
Hainan
	10	Green colour
Leaf apex of Salix cheilophila			Green colour
	Construct Heheng one number	Green colour
Reclamation of agricultural crops			Green colour
	Shao Huang I Hao	Green colour
Iron blue 3			Green colour
	Medium cigarette 100	Green colour
Build ripples No. 2			Green colour

2. To further verify the effectiveness of these specific primers, the genotypes of 376 individuals in the BC1F1 population, generated by the hybridization and backcross of TN90 with safflower macrogol, were identified.

As a result, 114 white stem individuals all contained the homozygous WS1a gene and WS1b gene, while 262 green stem individuals had three genotypes in total, respectively WS1Aws1a WS1Bws1b, WS1Aws1aWS1Bws1b and WS1aWS1a WS1Bws1b, the number of the individual plants was 76, 88 and 98 (FIG. 8), and the separation ratio was 1:1:1(χ 1: 1) (FIG. 8)² _0.052.779, less than critical value 5.991).

The results show that the molecular marker co-separated from the burley tobacco control gene and designed in the step one can quickly and accurately identify the tobacco genotype and the stalk character in molecular breeding.

Sequence listing

<110> tobacco institute of Chinese academy of agricultural sciences

Application of <120> metalloprotease WS1B in regulation and control of plant chloroplast metabolism

<160>12

<170>PatentIn version 3.5

<210>1

<211>1645

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgggaacgc taacgagctg cagtttcagc tcaatgaata taaggttccg tttgaatcct 60

ccagttaatt acactttcag tcgaagaatc caattgaaga gaatgtccaa acggaatttc 120

ggtcgattga ttattaggtg tagtagcggt agtagtggca atggcagtag caatgacagt 180

ggtagcagta gcgatgggaa attggaaaag gattcttcaa atttggctac agttactgaa 240

gaaaccactg aagaaaggaa cggcggcggt ggcgccagcg gtgtggaaaa tgattcggat 300

gattctccgg tgtcaatttc ttccagacca acaatatcca ctgttggatc aacttataat 360

aatttccaag tagattcttt taagttgatg gaacttcttg gaccagaaaa ggttgatccc 420

agtgatgtga agttcattaa ggaaaagtta tttggctact ctactttttg ggtgactaaa 480

gaagaaccat ttggagatct tggagagggc attcttttcc ttgggaatct tagaggaaag 540

agggaggatg tttttgccaa acttcagagt cagttatcag aaattatggg tgataagtac 600

aacctgttca tggtggagga acctaattca gaggggccag acccgcgtgg tgggcccaga 660

gtcagctttg gtatgctgcg gaaagaagtt tctgaaccag gtccaacaac tctctggcaa 720

tatgtaattg cttttctgtt gttccttctc actattggtt cctctgtgga gctaggaatt 780

gcatctcaga taactcgcct tcctcctgag gtagttaagt actttactga tccaaatgca 840

attgaaccac cagatatgca gcttttatta ccgtttgtgg attctgcttt accgttggca 900

tatggtgtgc tgggtgtgca gttatttcat gaaattgggc attttctggc tgcatttcca 960

aggaatgtga aattaagcat tcctttcttt attccaaaca tcactcttgg aagctttgga 1020

gcaatcactc agttcaaatc tattcttccc gatcgcaaag caaaggtaga catttctctt 1080

gcgggtcctt ttgctggtgc tgcattgtct tcttccatgt ttgcggttgg cctgttactc 1140

tcatccaatc ctgctgctgc tggagagttg gttcaggttc ctagcacact tttccagggc 1200

tctttgcttc tcgggcttat tagcagagcc actcttggtt atggagcaat gcatggtgca 1260

atggtttcaa tccatcctct tgtgatagct ggctggtgtg gcttgactac atcggctttt 1320

aatatgctgc cagttggatg tcttgatggt gggagagctg tgcagggagc ctttgggaaa 1380

ggatcactta ttggttttgg tttggcgaca tacacacttc tgggcttggg cgtgcttggt 1440

ggacctcttg tcacttcctt ggggattgta tgtgcttata tgtcagagga caccggagaa 1500

accatgcttg aatgatgtaa cagaggtcgg aaattggaga aaagcagctc ttggtgtggc 1560

tatattcctt gttgtattga ctcttcttcc tgtatgggat gaacttgcag aagaactagg 1620

tataggtctt gtaaccagct tttga 1645

<210>2

<211>1627

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgggaacgc taacgagctg cagtttcagc acaatgaata taaggttccg tttgaatcct 60

ccagttaatc acagtttcag tcgaagaatc caattgaaga gaatgtccaa acggaatttc 120

ggtagattga ttattaggtg tagtagtgga aatggcagta gcaataacaa tggcagcagt 180

agcgatggga aattggaaaa ggattcttca aatttagcta cagttactga agaaaccact 240

gaagaaagga acggcggcgg tggcgccagc ggtgtggaaa atgattccga ggattctccg 300

gtgtcaattt cttccagacc aacaatatcc acggttggat caacttataa taatttccaa 360

gtagattctt ttaagttgat ggaacttctt ggaccagaaa aggttgatcc cagtgatgtg 420

aagataatta aggaaaagtt atttggctac tctacttttt gggtgactaa agaagaacca 480

tttggagatc ttggagaggg cattcttttc cttgggaatc ttagaggaaa gagggaggat 540

gtttttgcca aacttcagag tcagttatca gaaattatgg gtgataagta caacctgttc 600

atggtggaag agcctaactc tggacccacg tggtgggccc agagttagct ttggtatgct 660

gcggaaagaa gtttctgaac caggtccaac aactctctgg caatatgtaa ttgcttttct 720

gttgttcctt ctcacaattg gttcctctgt ggagctagga attgcatctc agataactcg 780

ccttcctcct gaggtagtta agtactttac ggatccaaat gcaattgaac caccagatat 840

gcagctttta ctaccgtttg tggattctgc tataccactg gcatatggtg tgttgggcgt 900

gcagttattt catgaaattg ggcattttct ggctgcgttt ccaaggaatg tgaaattaag 960

cattcctttc tttattccaa acatcactct tggaagcttt ggagcaatca ctcagttcaa 1020

atctattctt cctgatcgaa aagcaaaggt agatatttcg cttgtgggtc cttttgctgg 1080

tgctgcattg tcttcttcaa tgtttgcggt tggcctgtta ctctcatcca atcctgctgc 1140

ttctggagag ttggttcagg ttcctagcac acttttccag ggatctttgc ttcttgggct 1200

tattagcaga gccactcttg gttatggagc aatgcatgga gcaatggttt caatccatcc 1260

tcttgtgatt gctggctggt gtggtttgac tacgtcggct tttaatatgc taccagttgg 1320

atgtcttgat ggtgggagag ctgtgcaggg agcctttggg aaaggatcac ttattggttt 1380

tggtttggcg acatacacac ttctgggctt gggcgtgctt ggtggacctc tgtcacttcc 1440

ttggggatta tatgtgctta tatgtcagag gacaccagag aaaccatgct tgaacgatgt 1500

aacagaggtc ggaacttgga gaaaagcagc tcttggtgtg gctatattcc ttgtagtatt 1560

gactcttctt cctgtatggg atgaacttgc agaagaacta ggtataggtc ttgtaaccag 1620

cttttga 1627

<210>3

<211>1635

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgggaacgc taacgagctg cagtttcagc acaatgaata taaggttccg tttgaatcct 60

ccagttaatc acagtttcag tcgaagaatc caattgaaga gaatgtccaa acggaatttc 120

ggtagattga ttattaggtg tagtagtgga aatggcagta gcaataacaa tggcagcagt 180

agcgatggga aattggaaaa ggattcttca aatttagcta cagttactga agaaaccact 240

gaagaaagga acggcggcgg tggcgccagc ggtgtggaaa atgattccga ggattctccg 300

gtgtcaattt cttccagacc aacaatatcc acggttggat caacttataa taatttccaa 360

gtagattctt ttaagttgat ggaacttctt ggaccagaaa aggttgatcc cagtgatgtg 420

aagataatta aggaaaagtt atttggctac tctacttttt gggtgactaa agaagaacca 480

tttggagatc ttggagaggg cattcttttc cttgggaatc ttagaggaaa gagggaggat 540

gtttttgcca aacttcagag tcagttatca gaaattatgg gtgataagta caacctgttc 600

atggtggaag agcctaattc agaggggcca gacccacgtg gtgggcccag agttagcttt 660

ggtatgctgc ggaaagaagt ttctgaacca ggtccaacaa ctctctggca atatgtaatt 720

gcttttctgt tgttccttct cacaattggt tcctctgtgg agctaggaat tgcatctcag 780

ataactcgcc ttcctcctga ggtagttaag tactttacgg atccaaatgc aattgaacca 840

ccagatatgc agcttttact accgtttgtg gattctgcta taccactggc atatggtgtg 900

ttgggcgtgc agttatttca tgaaattggg cattttctgg ctgcgtttcc aaggaatgtg 960

aaattaagca ttcctttctt tattccaaac atcactcttg gaagctttgg agcaatcact 1020

cagttcaaat ctattcttcc tgatcgaaaa gcaaaggtag atatttcgct tgtgggtcct 1080

tttgctggtg ctgcattgtc ttcttcaatg tttgcggttg gcctgttact ctcatccaat 1140

cctgctgctt ctggagagtt ggttcaggtt cctagcacac ttttccaggg atctttgctt 1200

cttgggctta ttagcagagc cactcttggt tatggagcaa tgcatggagc aatggtttca 1260

atccatcctc ttgtgattgc tggctggtgt ggtttgacta cgtcggcttt taatatgcta 1320

ccagttggat gtcttgatgg tgggagagct gtgcagggag cctttgggaa aggatcactt 1380

attggttttg gtttggcgac atacacactt ctgggcttgg gcgtgcttgg tggacctctg 1440

tcacttcctt ggggattata tgtgcttata tgtcagagga caccagagaa accatgcttg 1500

aacgatgtaa cagaggtcgg aacttggaga aaagcagctc ttggtgtggc tatattcctt 1560

gtagtattga ctcttcttcc tgtatgggat gaacttgcag aagaactagg tataggtctt 1620

gtaaccagct tttga 1635

<210>4

<211>1644

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgggaacgc taacgagctg cagtttcagc tcaatgaata taaggttccg tttgaatcct 60

ccagttaatt acactttcag tcgaagaatc caattgaaga gaatgtccaa acggaatttc 120

ggtcgattga ttattaggtg tagtagcggt agtagtggca atggcagtag caatgacagt 180

ggtagcagta gcgatgggaa attggaaaag gattcttcaa atttggctac agttactgaa 240

gaaaccactg aagaaaggaa cggcggcggt ggcgccagcg gtgtggaaaa tgattcggat 300

gattctccgg tgtcaatttc ttccagacca acaatatcca ctgttggatc aacttataat 360

aatttccaag tagattcttt taagttgatg gaacttcttg gaccagaaaa ggttgatccc 420

agtgatgtga agttcattaa ggaaaagtta tttggctact ctactttttg ggtgactaaa 480

gaagaaccat ttggagatct tggagagggc attcttttcc ttgggaatct tagaggaaag 540

agggaggatg tttttgccaa acttcagagt cagttatcag aaattatggg tgataagtac 600

aacctgttca tggtggagga acctaattca gaggggccag acccgcgtgg tgggcccaga 660

gtcagctttg gtatgctgcg gaaagaagtt tctgaaccag gtccaacaac tctctggcaa 720

tatgtaattg cttttctgtt gttccttctc actattggtt cctctgtgga gctaggaatt 780

gcatctcaga taactcgcct tcctcctgag gtagttaagt actttactga tccaaatgca 840

attgaaccac cagatatgca gcttttatta ccgtttgtgg attctgcttt accgttggca 900

tatggtgtgc tgggtgtgca gttatttcat gaaattgggc attttctggc tgcatttcca 960

aggaatgtga aattaagcat tcctttcttt attccaaaca tcactcttgg aagctttgga 1020

gcaatcactc agttcaaatc tattcttccc gatcgcaaag caaaggtaga catttctctt 1080

gcgggtcctt ttgctggtgc tgcattgtct tcttccatgt ttgcggttgg cctgttactc 1140

tcatccaatc ctgctgctgc tggagagttg gttcaggttc ctagcacact tttccagggc 1200

tctttgcttc tcgggcttat tagcagagcc actcttggtt atggagcaat gcatggtgca 1260

atggtttcaa tccatcctct tgtgatagct ggctggtgtg gcttgactac atcggctttt 1320

aatatgctgc cagttggatg tcttgatggt gggagagctg tgcagggagc ctttgggaaa 1380

ggatcactta ttggttttgg tttggcgaca tacacacttc tgggcttggg cgtgcttggt 1440

ggacctctgt cacttccttg gggattgtat gtgcttatat gtcagaggac accggagaaa 1500

ccatgcttga atgatgtaac agaggtcgga aattggagaa aagcagctct tggtgtggct 1560

atattccttg ttgtattgac tcttcttcct gtatgggatg aacttgcaga agaactaggt 1620

ataggtcttg taaccagctt ttga 1644

<210>5

<211>544

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Met Gly Thr Leu Thr Ser Cys Ser Phe Ser Thr Met Asn Ile Arg Phe

1 5 10 15

Arg Leu Asn Pro Pro Val Asn His Ser Phe Ser Arg Arg Ile Gln Leu

20 25 30

Lys Arg Met Ser Lys Arg Asn Phe Gly Arg Leu Ile Ile Arg Cys Ser

35 40 45

Ser Gly Asn Gly Ser Ser Asn Asn Asn Gly Ser Ser Ser Asp Gly Lys

50 55 60

Leu Glu Lys Asp Ser Ser Asn Leu Ala Thr Val Thr Glu Glu Thr Thr

65 70 75 80

Glu Glu Arg Asn Gly Gly Gly Gly Ala Ser Gly Val Glu Asn Asp Ser

85 90 95

Glu Asp Ser Pro Val Ser Ile Ser Ser Arg Pro Thr Ile Ser Thr Val

100 105 110

Gly Ser Thr Tyr Asn Asn Phe Gln Val Asp Ser Phe Lys Leu Met Glu

115 120 125

Leu Leu Gly Pro Glu Lys Val Asp Pro Ser Asp Val Lys Ile Ile Lys

130 135 140

Glu Lys Leu Phe Gly Tyr Ser Thr Phe Trp Val Thr Lys Glu Glu Pro

145 150 155 160

Phe Gly Asp Leu Gly Glu Gly Ile Leu Phe Leu Gly Asn Leu Arg Gly

165 170 175

Lys Arg Glu Asp Val Phe Ala Lys Leu Gln Ser Gln Leu Ser Glu Ile

180 185 190

Met Gly Asp Lys Tyr Asn Leu Phe Met Val Glu Glu Pro Asn Ser Glu

195 200 205

Gly Pro Asp Pro Arg Gly Gly Pro Arg Val Ser Phe Gly Met Leu Arg

210 215 220

Lys Glu Val Ser Glu Pro Gly Pro Thr Thr Leu Trp Gln Tyr Val Ile

225 230 235 240

Ala Phe Leu Leu Phe Leu Leu Thr Ile Gly Ser Ser Val Glu Leu Gly

245 250 255

Ile Ala Ser Gln Ile Thr Arg Leu Pro Pro Glu Val Val Lys Tyr Phe

260 265 270

Thr Asp Pro Asn Ala Ile Glu Pro Pro Asp Met Gln Leu Leu Leu Pro

275 280 285

Phe Val Asp Ser Ala Ile Pro Leu Ala Tyr Gly Val Leu Gly Val Gln

290 295 300

Leu Phe His Glu Ile Gly His Phe Leu Ala Ala Phe Pro Arg Asn Val

305 310 315 320

Lys Leu Ser Ile Pro Phe Phe Ile Pro Asn Ile Thr Leu Gly Ser Phe

325 330 335

Gly Ala Ile Thr Gln Phe Lys Ser Ile Leu Pro Asp Arg Lys Ala Lys

340 345 350

Val Asp Ile Ser Leu Val Gly Pro Phe Ala Gly Ala Ala Leu Ser Ser

355 360 365

Ser Met Phe Ala Val Gly Leu Leu Leu Ser Ser Asn Pro Ala Ala Ser

370 375 380

Gly Glu Leu Val Gln Val Pro Ser Thr Leu Phe Gln Gly Ser Leu Leu

385 390 395 400

Leu Gly Leu Ile Ser Arg Ala Thr Leu Gly Tyr Gly Ala Met His Gly

405 410 415

Ala Met Val Ser Ile His Pro Leu Val Ile Ala Gly Trp Cys Gly Leu

420 425 430

Thr Thr Ser Ala Phe Asn Met Leu Pro Val Gly Cys Leu Asp Gly Gly

435 440 445

Arg Ala Val Gln Gly Ala Phe Gly Lys Gly Ser Leu Ile Gly Phe Gly

450 455 460

Leu Ala Thr Tyr Thr Leu Leu Gly Leu Gly Val Leu Gly Gly Pro Leu

465 470 475 480

Ser Leu Pro Trp Gly Leu Tyr Val Leu Ile Cys Gln Arg Thr Pro Glu

485 490 495

Lys Pro Cys Leu Asn Asp Val Thr Glu Val Gly Thr Trp Arg Lys Ala

500 505 510

Ala Leu Gly Val Ala Ile Phe Leu Val Val Leu Thr Leu Leu Pro Val

515 520 525

Trp Asp Glu Leu Ala Glu Glu Leu Gly Ile Gly Leu Val Thr Ser Phe

530 535 540

<210>6

<211>547

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Met Gly Thr Leu Thr Ser Cys Ser Phe Ser Ser Met Asn Ile Arg Phe

1 5 10 15

Arg Leu Asn Pro Pro Val Asn Tyr Thr Phe Ser Arg Arg Ile Gln Leu

20 25 30

Lys Arg Met Ser Lys Arg Asn Phe Gly Arg Leu Ile Ile Arg Cys Ser

35 40 45

Ser Gly Ser Ser Gly Asn Gly Ser Ser Asn Asp Ser Gly Ser Ser Ser

50 55 60

Asp Gly Lys Leu Glu Lys Asp Ser Ser Asn Leu Ala Thr Val Thr Glu

65 70 75 80

Glu Thr Thr Glu Glu Arg Asn Gly Gly Gly Gly Ala Ser Gly Val Glu

85 90 95

Asn Asp Ser Asp Asp Ser Pro Val Ser Ile Ser Ser Arg Pro Thr Ile

100 105 110

Ser Thr Val Gly Ser Thr Tyr Asn Asn Phe Gln Val Asp Ser Phe Lys

115 120 125

Leu Met Glu Leu Leu Gly Pro Glu Lys Val Asp Pro Ser Asp Val Lys

130 135 140

Phe Ile Lys Glu Lys Leu Phe Gly Tyr Ser Thr Phe Trp Val Thr Lys

145 150 155 160

Glu Glu Pro Phe Gly Asp Leu Gly Glu Gly Ile Leu Phe Leu Gly Asn

165 170 175

Leu Arg Gly Lys Arg Glu Asp Val Phe Ala Lys Leu Gln Ser Gln Leu

180 185 190

Ser Glu Ile Met Gly Asp Lys Tyr Asn Leu Phe Met Val Glu Glu Pro

195 200 205

Asn Ser Glu Gly Pro Asp Pro Arg Gly Gly Pro Arg Val Ser Phe Gly

210 215 220

Met Leu Arg Lys Glu Val Ser Glu Pro Gly Pro Thr Thr Leu Trp Gln

225 230 235 240

Tyr Val Ile Ala Phe Leu Leu Phe Leu Leu Thr Ile Gly Ser Ser Val

245 250 255

Glu Leu Gly Ile Ala Ser Gln Ile Thr Arg Leu Pro Pro Glu Val Val

260 265 270

Lys Tyr Phe Thr Asp Pro Asn Ala Ile Glu Pro Pro Asp Met Gln Leu

275 280 285

Leu Leu Pro Phe Val Asp Ser Ala Leu Pro Leu Ala Tyr Gly Val Leu

290 295 300

Gly Val Gln Leu Phe His Glu Ile Gly His Phe Leu Ala Ala Phe Pro

305 310 315 320

Arg Asn Val Lys Leu Ser Ile Pro Phe Phe Ile Pro Asn Ile Thr Leu

325 330 335

Gly Ser Phe Gly Ala Ile Thr Gln Phe Lys Ser Ile Leu Pro Asp Arg

340 345 350

Lys Ala Lys Val Asp Ile Ser Leu Ala Gly Pro Phe Ala Gly Ala Ala

355 360 365

Leu Ser Ser Ser Met Phe Ala Val Gly Leu Leu Leu Ser Ser Asn Pro

370 375 380

Ala Ala Ala Gly Glu Leu Val Gln Val Pro Ser Thr Leu Phe Gln Gly

385 390 395 400

Ser Leu Leu Leu Gly Leu Ile Ser Arg Ala Thr Leu Gly Tyr Gly Ala

405 410 415

Met His Gly Ala Met Val Ser Ile His Pro Leu Val Ile Ala Gly Trp

420 425 430

Cys Gly Leu Thr Thr Ser Ala Phe Asn Met Leu Pro Val Gly Cys Leu

435 440 445

Asp Gly Gly Arg Ala Val Gln Gly Ala Phe Gly Lys Gly Ser Leu Ile

450 455 460

Gly Phe Gly Leu Ala Thr Tyr Thr Leu Leu Gly Leu Gly Val Leu Gly

465 470 475 480

Gly Pro Leu Ser Leu Pro Trp Gly Leu Tyr Val Leu Ile Cys Gln Arg

485 490 495

Thr Pro Glu Lys Pro Cys Leu Asn Asp Val Thr Glu Val Gly Asn Trp

500 505 510

Arg Lys Ala Ala Leu Gly Val Ala Ile Phe Leu Val Val Leu Thr Leu

515 520 525

Leu Pro Val Trp Asp Glu Leu Ala Glu Glu Leu Gly Ile Gly Leu Val

530 535 540

Thr Ser Phe

545

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

acctgttcat ggtggaagag 20

<210>8

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ctgcgtggtt gacgagttc 19

<210>9

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

caatcgttgt ccagtgtcta tttg 24

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccccaaggaa gtgacagagg 20

<210>11

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

caatcgttgt ccagtgtcta tttg 24

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ccccaaggaa gtgacaagag 20

Claims (4)

1. A method for cultivating a transgenic plant with an increased chloroplast metabolism level, comprising the step of increasing the expression level of WS1B protein in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher level of chloroplast metabolism than the recipient plant;

the transgenic plant has a higher level of chloroplast metabolism than the recipient plant occurs when the stem of the transgenic plant turns green;

the WS1B protein is a protein with an amino acid sequence shown as a sequence 6;

the recipient plant is burley tobacco TN 90.

2. The method of claim 1, wherein:

the method for improving the expression level of the WS1B protein in a receptor plant is to over-express the WS1B protein in the receptor plant.

3. The method of claim 2, wherein: the overexpression method is to introduce a gene coding for WS1B protein into a recipient plant.

4. The method of claim 3, wherein: the nucleotide sequence of the WS1B protein coding gene is a DNA molecule shown in a sequence 4.

Images