CN101457233A

CN101457233A - Method for constructing chlorella expression vector, converting chlorella and breaking wall of chlorella

Info

Publication number: CN101457233A
Application number: CNA2007101793833A
Authority: CN
Inventors: 胡赞民; 安洋; 赵世民; 孙勇如; 尹维波; 陈宇红; 胡军; 张丽华
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Beijing Sino Paul Biological Technology Co Ltd
Priority date: 2007-12-12
Filing date: 2007-12-12
Publication date: 2009-06-17
Anticipated expiration: 2027-12-12
Also published as: CN101457233B

Abstract

The invention constructs an expression vector suitable for expressing an exogenous gene in a chlorella nitrate reductase deletion mutant by using a Ubiquitin promoter and an omega enhancer as starting elements and the nitrate reductase gene NR. An objective gene is converted to the mutant by using an economic and simple chlorella PEG conversion method and employing the Chlorella ellipsoidea nitrate reductase deletion mutant as a receptor. The transgene chlorella wall breaking technology is optimized, the expressed exogenous gene has normal biological activity and is stably inherited in a culture medium without antibiotics. The results of the invention can high efficiently and safely be used to express the exogenous gene which does not suit to be expressed by the normal genetic engineering expression system (such as the escherichia coli and yeast) by using the genetic engineering technology and the Chlorella ellipsoidea nitrate reductase deletion mutant as a vector.

Description

Make up the method for chlorella expression vector, conversion chlorella and broken wall chlorella

Technical field

The present invention relates to plant genetic engineering field.Particularly, the system that relates to the foreign protein that the gene engineering expression system (as intestinal bacteria and yeast) that utilizes efficient, the safe expression routine of chlorella ellipsoidea nitrate reductase deletion mutant is not suitable for expressing is set up and is used.

Background technology

Chlorella (Chlorella) belongs to the little algae of the unicellular eucaryon of a class of Chlorophyta Chlorella; have the advantages that eukaryotic gene is expressed; nutritive ingredients such as rich in proteins, amino acid, VITAMIN, iron, calcium; source (the Bricknell andDalmo that is considered to extremely valuable food and feed additive; 2005); and easily breeding is cultivated, and is suitable for large-scale production.

Based on the These characteristics that chlorella had, will have tangible advantage with chlorella as the bio-reactor expression alien gene, a plurality of research groups are explored to this.Dawson etal., (1997) utilize method that microparticle bombardment transforms that the nitrate reductase gene of C.vulgaris is imported in the C.sorokiniana nitrate reductase mutant, obtained the algae strain that can grow in containing nitrate culture-medium, this is the first report that transforms about external source stable gene in the chlorella.Richard et al. (1999) changes among C.vulgaris C-27 and the C.sorokiniana ATCC-22521 with the growth hormone gene of PEG conversion method with the people, has studied the influence to exogenous gene expression of random integration and homologous recombination.Kim et al., (2002) with the PEG conversion method flatfish growth hormone gene (fGH) is transferred among the C.ellipsoidea, the test-results of throwing something and feeding shows that transgenosis chlorella has promoter action to the growth of fry, shows that transgenosis chlorella has stronger practical value.The nitrate reductase gene and the promotor (Wanget al., 2003,2004) thereof of chlorella ellipsoidea (C.ellipsoidea) cloned by the Sun Yong of the Chinese Academy of Sciences such as research group.Nitrate reductase (NR) is an important enzyme in the nitrogen assimilation process, can be nitrite with nitrate reduction, thereby makes the wild-type chlorella can utilize nitrate to grow normally as nitrogenous source.The nitrate reductase afunction mutant of chlorella then can not utilize nitrate as nitrogenous source, but can utilize nitrite as nitrogenous source.When therefore foreign gene transformed chlorella nitrate reductase afunction mutant, available nitrate reductase gene was as selection markers (Wang et al., 2005; Zhang et al., 2006).

Alexin is extensively to be present in animals and plants and the intravital cationoid peptide of insect, and it is the natural cover for defense of the organism defence microorganism invasion of long-term evolution formation, has good application prospects clinically as potential a new generation antibiotic medicine.Rabbit alexin NP-1 obtains (Ganz, 1989) from the separation of rabbit neutrophil at first, is made up of 33 amino acid, belongs to the α alexin.As one of alexin of finding the earliest, people also study morely to its function, and NP-1 is the widest one of resistance spectrum from more than the 30 kind of alexin that organic sphere is separated at present.Antibacterial peptide as the alexin is owing to itself have very strong toxic action to the host, so be difficult to produce (Li et al., 2004) with the gene engineering expression system of routine such as intestinal bacteria and yeast.

Promotor is the important factor that influences expression of exogenous gene.The Ubiquiti promotor has higher efficient to the expression regulation of foreign gene in chlorella, and the Ω sequence has significant enhancement (Wang et al., 2001) to expression of exogenous gene.Wang et al., the nitrate reductase gene promotor of (2004) report chlorella has stronger effect than Ubiquitin promotor to the downstream gene of its control.Chenet al. (2001) is the selection markers gene with NPTII in chlorella ellipsoidea, with Ubiquitin promotor control NP-1 gene, expressed NP-1, but the transgenic alga strain that obtains detects the activity less than NP-1 after removing screening pressure, in chlorella Study on Transformation in the past, NPTII is often used as the selection markers gene, and screening reagent is G418.But the transgenosis chlorella that only utilizes G418 screening to obtain is stable inadequately, remove G418 after foreign gene easily lose (data are not delivered in this laboratory), and in containing the substratum of G418 large scale culturing transgenosis chlorella cost than higher.

Regular meeting foreign gene occurs and is difficult for being incorporated into the chromogene group in plant genetic engineering research, or integrates phenomenon such as back unstable expression.People infer that the generation of this phenomenon may be because identical promotor is competed limited transcription factor, thereby cause that transcriptional level reduces the translation skill (Park et al., 1996) that has influence on foreign gene.Usually this phenomenon is to be caused by one section homologous sequence in the promoter region.Existing report points out that the homologous sequence of 90bp just is enough to suppress two expression of gene levels (Vaucheret, 1993) in the promoter region.In the plant expression vector that we make up, the selection markers nitrate reductase gene is by the nitrate reductase gene promotor control of chlorella, if foreign gene NP-1 is also with the control of nitrate reductase gene promotor, add chlorella itself and also contain the nitrate reductase gene promotor, too much nitrate reductase gene promotor may cause the foreign gene starting efficiency not high, integrates problems such as instability in chlorella.This paper of delivering before us is not given enough concerns in (Zhang et al., 2006).We control NP-1 with the Ubiquitin promotor in this research, and perhaps this is to obtain to have one of important factor of the stronger transgenic alga strain of NP-1 activity.

The method for transformation of chlorella roughly is divided into four kinds at present: 1, PEG conversion method (Richard etal., 1999).2, electroporation quiding gene method (Ladygin and Boutanave, 2002; Maruyamaet al., 1994).3, particle bombardment (Boynton et al., 1988; Kindle et al., 1989).4, granulated glass sphere paddling process (Kindle et al., 1991,1990).Need expensive plant and instrument when utilizing electric-shocking method and gene gun conversion method to carry out genetic transformation, granulated glass sphere paddling process efficient is very low.The chlorella genetic transformation adopts the PEG method more, but the easy microbiological contamination because its operation steps is more of PEG method.This research has improved the PEG method for transformation, and with Richard et al., the PEG method of (1999) usefulness is compared, and has saved the consumption of enzyme, has saved the conversion cost, and has reduced operation steps, and then has reduced the probability of microbiological contamination.

Influencing one of active important factor that detects of NP-1 is the broken wall of transgenosis chlorella.The broken wall of Chlorella vulgaris adopts sonioation method more, if but change NP-1 chlorella ultrasonication overlong time then may cause the fracture of NP-1 disulfide linkage and influence the activity of NP-1.Can not complete broken transgenic alga cell if the ultrasonication time is too short, the unit's of making algae liquid NP-1 output is low excessively.Ultrasonic 9s when this test is 1:1 through repeatedly groping to draw the heavy mass ratio with granulated glass sphere of wet algae, 90 effects when broken that circulate are best.

This research is acceptor with chlorella ellipsoidea nitrate reductase gene deletion mutant, with NPTII and nitrate reductase gene is selection markers, with Ubiquitin promotor control NP-1, adopt economical and practical chlorella PEG method for transformation to transform, when primary dcreening operation, utilize NPTII and nitrate reductase gene as dual selection markers, carry out dual screening pressure screening (3 solid culture plate screenings and 3 liquid are cultivated screening) with G418 and nitrate, and then only utilize nitrate to screen, obtained on nitrate culture-medium, to cultivate and to have the strong active transgenosis chlorella of NP-1, had not yet to see and report that removing the G418 screening pressure can have the transgenic alga strain of the active NP-1 of NP-1 by force.

Summary of the invention

The present invention provides a kind of expression vector that is used for chlorella nitrate reductase gene deletion mutant expression alien gene in one aspect, it is by with NR expression cassette (SEQ ID NO:6), Ubiquitin promotor (SEQ ID NO:1) and Ω sequence (SEQ ID NO:5) head and the tail successively are connected in the multiple clone site that is cloned into vector plasmid and obtain, and wherein said vector plasmid is suitable for expression alien gene in chlorella nitrate reductase gene deletion mutant.

In a preferred embodiment of the invention, described vector plasmid is selected from by pBin19, pGreen0029, pCABIA1300, pBin121, the group that pbin221 and pBADW form.

In another embodiment preferred of the present invention, described vector plasmid is a pbin221 plasmid as shown in Figure 1.

In a specific embodiments of the present invention, described expression vector be as shown in Figure 4 pbin-NR-U Ω or pGreen-NR-U Ω as shown in Figure 8.

In a preferred embodiment of the invention, described foreign gene is the NP-1 gene, and its nucleotides sequence is classified the sequence shown in the SEQ ID NO:12 as.

In a preferred embodiment of the invention, described chlorella algae kind is common or chlorella ellipsoidea.

In another aspect of the present invention, provide the application in the expression alien gene in chlorella nitrate reductase gene deletion mutant of above-mentioned expression vector.Especially, wherein said vector plasmid, foreign gene and chlorella algae kind are as defined above.

In another aspect of the present invention, a kind of method that is structured in the expression vector of expression alien gene in the chlorella nitrate reductase gene deletion mutant is provided, comprise NR expression cassette (SEQ IDNO:6) Ubiquitin promotor (SEQ ID NO:1) and Ω sequence (SEQ ID NO:5) head and the tail successively are connected step in the multiple clone site that is cloned into vector plasmid, wherein said vector plasmid is suitable for expression alien gene in chlorella nitrate reductase gene deletion mutant.Especially, wherein said vector plasmid, foreign gene and chlorella algae kind are as defined above.

In another aspect of the present invention, a kind of chlorella PEG method for transformation is provided, it comprises chlorella cells enzymolysis solution (sorbyl alcohol 0.6M, CaCl ₂12H ₂O 50mM, R-10 cellulase (1U/mg) 3% 1 6%, R-10 polygalacturonase (1U/mg) 1%-4%, Y-23 polygalacturonase (1U/mg) 0.1 ‰-1.5 ‰) suspending is placed on 25 ℃, and shading is cultivated, and wherein said per-cent is mass/volume.

In a preferred embodiment of the invention, described R-10 cellulase (1U/mg) content is 4%, and R-10 polygalacturonase (1U/mg) content is 2%, and Y-23 polygalacturonase (1U/mg) content is 1 ‰.

In another aspect of the present invention, a kind of wall-breaking method of transgenosis chlorella efficiently is provided, it is characterized in that utilizing the method for ultrasonication, in chlorella weight in wet base (g): granulated glass sphere (g): the ratio of water (ml)=1:1:1 adds granulated glass sphere and water.

In a preferred embodiment of the invention, the condition of described ultrasonic disruption is ultrasonication 7-12s, interval 2-6s, broken number of times 70-90 time.

By content of the present invention as can be known, expression vector safety of the present invention, efficient, without antibiotic-screening, utilize algae strain that this expression vector transforms can be under the condition that antibiotic-free exists efficiently expressing exogenous gene.

Chlorella PEG method for transformation of the present invention has reduced PEG transforms in the prior art cost and step simultaneously, makes this transformation system help the application of chlorella and other unicellular algae cell transformations more.

The efficient wall breaking technology of transgenosis chlorella provided by the invention has improved the sporoderm-broken rate of transgenosis chlorella greatly, has improved the yield of expression product.

Description of drawings

Fig. 1 .pbin221 plasmid structure iron.

Fig. 2 .pbinUGUS plasmid structure iron.

Fig. 3 .pbinU Ω GUS plasmid structure iron.

Fig. 4 .pbin-NR-U Ω plasmid structure iron.

The structure iron of Fig. 5 .pGreen0029 plasmid.

Fig. 6 .pGreen0029nos plasmid structure iron.

Fig. 7 .pGreenU Ω Nos plasmid structure iron.

Fig. 8 .pGreen-NR-U Ω plasmid structure iron.

Fig. 9 .pbin-NR-U Ω-NP-1 plasmid structure iron.

The algae of the anti-G418 that Figure 10 .PEG fusion method conversion chlorella ellipsoidea nitrate reductase afunction mutant obtains falls.

Figure 11 .NPTII gene PCR detected result.1-7 transforms algae strain 1-7; 8, unconverted algae strain nrm-4; 9, positive plasmid.

Figure 12 .NP-1 gene PCR detected result.1, positive plasmid; 2, unconverted algae strain nrm-4; 3-9 transforms algae strain 1-7.

Figure 13. in the transgenosis chlorella crude protein extracting solution liquid medium within to colibacillary fungistatic effect.Last figure: Ck, the LB substratum; 1/2～1/64, be respectively the ratio (V/V) of transgenosis nrm-4 crude protein extracting solution with the dilution of LB substratum; Figure below: Ck, the LB substratum; 1/2～1/64, be respectively the ratio (V/V) of nrm-4 crude protein extracting solution with the dilution of LB substratum.

Figure 14. transgenosis chlorella crude protein extracting solution on solid medium to colibacillary fungistatic effect.1,3: be respectively nrm-4 soluble proteins extracting solution and sterilized water; 2,4: transgenic alga strain soluble proteins extracting solution.

Embodiment

Describe the present invention in detail below with reference to embodiment and accompanying drawing.What those having ordinary skill in the art will appreciate that is, following embodiment is illustrational purpose, and it should not be interpreted as limitation of the present invention by any way.Protection scope of the present invention is limited by accompanying Claim.

Various restriction enzymes, DNA sample-loading buffer (6 * Loading Buffer) is available from TaKaRa company; General T aq enzyme, plus 2000 Maker, the DNA purifying reclaims test kit, available from the Beijing Quanshijin Biotechnology Co., Ltd; The T4DNA ligase enzyme is available from NEB company; Glucose and other inorganic reagents all available from Beijing through Bioisystech Co., Ltd of HTC of section; Salmon sperm dna is available from Invitrogen company; RNA extracts test kit and purchases the company in Qiagen, and the reverse transcription test kit is purchased the company in TOYOBO; Cellulase (Onozuka R-10), polygalacturonase (Onozuka R-10), polygalacturonase Y-23 is available from ancient cooking vessel state company; Granulated glass sphere is purchased the company in Sigma.

The expression vector establishment method of embodiment 1. chlorella ellipsoidea nitrate reductase mutant

According to Ubiquitin promoter sequence (SEQ ID NO:1) design primer, upstream primer: 5 ' CCGGAAGCTTGTGCAGCGTGACCCG3 ' (SEQ ID NO:2); Downstream primer: 5 ' GCCCGGATCCCTGCAGAAGT3 ' (SEQ ID NO:3), wherein in upstream primer, add Hind III restriction enzyme site, add the BamHI restriction enzyme site in the downstream primer, from the corn gene group, obtain the Ubiquitin promotor with PCR method, sequencing result be shown as the Ubiquitin promoter sequence (SEQ IDNO:4, it is at SEQ ID NO; 15 ' end and 3 ' end have added Hind III restriction enzyme site and BamH I restriction enzyme site respectively).With PCR product HindIII and BamHI enzymes double zyme cutting, plasmid pBI221 (Clontech) (Fig. 1) also is connected for 16 ℃ with BamH I enzymes double zyme cutting through Hind III and spends the night, connect product transformed into escherichia coli DH5 α, on the LB substratum that contains 50mg/L ammonia benzyl mycin, be inverted overnight incubation for 37 ℃, the resistance bacterium colony extraction plasmid that grows is carried out enzyme cut evaluation, the plasmid that can access 1987bp size fragment (being the Ubiquitin promotor) is called after pbinUGUS (Fig. 2).

According to Ω sequence (SEQ ID NO:5), this gene of synthetic, and add the BamHI restriction enzyme site at its upstream, add the SmaI restriction enzyme site in the downstream.With synthetic gene Sma I and BamH I enzymes double zyme cutting, plasmid pbinUGUS also is connected for 16 ℃ with BamH I enzymes double zyme cutting through Sma I and spends the night, connect product transformed into escherichia coli DH5 α, on the LB substratum that contains 50mg/L ammonia benzyl mycin, be inverted overnight incubation for 37 ℃, the resistance bacterium colony order-checking that grows is accredited as the Ω sequence, then with above-mentioned connection product called after pbinU Ω GUS (Fig. 3).

With pbinU Ω GUS Hind III endonuclease digestion, cut the pSK-NR plasmid with same enzyme and (contain nitrate reductase expression cassette NR sequence, chlorella NR gene order has been submitted to GenBank, receive number is AY275834, NR expression cassette sequence is shown in SEQ ID NO:6, the patent publication No. that relates to pSK-NR plasmid and NR expression cassette: CN1676597), reclaim the NR expression cassette, be connected for 16 ℃ with pbinU Ω GUS plasmid vector that enzyme is cut then and spend the night, connect product transformed into escherichia coli DH5 α, on the LB substratum that contains 50mg/L ammonia benzyl mycin, be inverted overnight incubation for 37 ℃, the resistance bacterium colony upgrading granzyme that grows is cut evaluation, the plasmid that can access big or small fragment about 4kb (NR expression cassette) is the plant expression vector of two selective markers that will make up, called after pbin-NR-U Ω GUS (Fig. 4).

Embodiment 2. utilizes the pGreen0029 framework to come construction of expression vector.

According to Nos terminator sequence (SEQ ID NO:7) design primer, upstream primer: 5 ' ATAAGAATGCGGCCGCTCGAATTTCCCCGATCGTTCAAAC3 ' (SEQ ID NO:8) downstream primer: 5 ' CGAGCTCGCCCGATCTAGTAACATAGATGA3 ' (SEQ ID NO:9) wherein adds Not I restriction enzyme site in upstream primer, in downstream primer, add Sac I restriction enzyme site, method with PCR has obtained the Nos terminator with PCR product NotI and Sac I enzymes double zyme cutting from pBI221 (Clontech), plasmid pGreen0029 (BBSRC) (Fig. 5) also is connected for 16 ℃ with Sac I enzymes double zyme cutting through NotI and spends the night, connect product transformed into escherichia coli DH5 α, containing 37 ℃ of inversion overnight incubation on the LB substratum of 50mg/L kantlex, the resistance bacterium colony extraction plasmid that grows is carried out enzyme cut evaluation, the plasmid that can access big or small fragment about 200bp (being the Nos terminator) is called after pGreenNos (Fig. 6).

According to Ubiquitin promoter sequence (SEQ ID NO:1) and Ω sequence (SEQ ID NO:5) design primer, upstream primer: 5 ' GGCCGGATCCGTGCAGCGTGACCCGGTC3 ' (SEQ IDNO:10); Downstream primer: 5 ' GGCCGCGGCCGCTGTAATTGTAAATAGTAAT3 ' (SEQ IDNO:11), wherein in upstream primer, add the BamHI restriction enzyme site, add Not I restriction enzyme site in the downstream primer, from pbinU Ω GUS, obtain Ubiquitin promotor+Ω sequence with PCR method, with PCR product BamH I and Not I enzymes double zyme cutting, plasmid pGreenNos also is connected for 16 ℃ with Not I enzymes double zyme cutting through BamH I and spends the night, connect product transformed into escherichia coli DH5 α, containing 37 ℃ of inversion overnight incubation on the LB substratum of 50mg/L kantlex, the resistance bacterium colony extraction plasmid that grows is carried out enzyme cut evaluation, the plasmid that can access 2075bp size fragment (being Ubiquitin promotor+Ω sequence) is called after pGreenU Ω Nos (Fig. 7).

With pGreenU Ω Nos Hind III endonuclease digestion, cut pSK-NR plasmid (its sequence is shown in SEQ ID NO:6) with same enzyme, reclaim the NR expression cassette about 4kb, be connected for 16 ℃ with pGreenU Ω Nos plasmid vector that enzyme is cut then and spend the night, connect product transformed into escherichia coli DH5 α, containing 37 ℃ of inversion overnight incubation on the LB substratum of 50mg/L kantlex, the resistance bacterium colony upgrading granzyme that grows is cut evaluation, the plasmid that can access big or small fragment about 4kb (NR expression cassette) is the plant expression vector of two selective markers that will make up, called after pGreen-NR-U Ω (Fig. 8).

The structure of the expression vector pbin-NR-U Ω-NP1 of embodiment 3. chlorella ellipsoidea nitrate reductase mutant

According to routine techniques, the gus gene on the pbin-NR-U Ω GUS plasmid with BamH I and SacI part double digestion, is reclaimed carrier.Goal gene NP-1 (its sequence such as SEQ ID NO:12) two ends restriction enzyme site also is BamH I and Sac I, enzyme cuts back to close the NP-1 gene about 200bp, be connected for 16 ℃ with the carrier of above-mentioned recovery then and spend the night, connect product transformed into escherichia coli DH5 α, on the LB substratum that contains 50mg/L ammonia benzyl mycin, be inverted overnight incubation for 37 ℃, the resistance bacterium colony upgrading granzyme that grows is cut evaluation, can access NP-1 plant expression vector pbin-NR-U Ω-NP1 (Fig. 9) that big or small fragment about 200bp (NP-1 gene) then is built into chlorella ellipsoidea nitrate reductase mutant.

Embodiment 4. chlorella PEG transform

Chlorella E ₄Liquid nutrient medium: glucose 5g/L; KH ₂PO ₄0.075g/L; Na ₂NO ₂0.69g/L; MgSO ₄7H ₂O 0.175g/L; CaCl ₂25mg/L; FeCl ₃6H ₂O 5mg/L; NaCl 25mg/L; FeCl ₃6H ₂O 0.81mg/L; EDTA 20mg/L trace element mother liquor 1mL/L.

Trace element mother liquor prescription is: H ₃BO ₃1.43g, ZnSO ₄7H ₂O 0.11g, MnCl ₂4H ₂O 0.905g, Na ₂MoO ₄2H ₂O 0.0185g, CuSO ₄5H ₂O 0.0395g, water 1L.

Chlorella solid medium: liquid nutrient medium+7% agar PH5.4～6.0.

Chlorella screening culture medium: E ₄Na in the liquid nutrient medium ₂NO ₂0.69g/L replace with 10mmol/L NO ₃ ^-

Get the nitrate reductase mutant chlorella nrm-4 (publication number: CN1676597A) of 50ml logarithmic phase, 50g, and the centrifugal collection frustule of centrifugal 10min (Refrigerated CentrifugeCR 20B2, HIACHI), with 5ml enzymolysis solution (sorbyl alcohol 0.6M, CaCl ₂12H ₂O 50mM, R-10 cellulase 4%, R-10 polygalacturonase 2%, Y-23 polygalacturonase 1 ‰) suspending is placed on 25 ℃, the shading 16h that softly vibrates.The centrifugal 10min of 50g removes supernatant, and precipitation contains 0.6M N.F,USP MANNITOL with 1ml, 50mM CaCl ₂12H ₂Twice of the 1/2E4 substratum washing precipitation of O.(pbin-NR-U Ω-NP1) and the salmon sperm DNA room temperature incubation 15min of 25 μ g then add 200 μ l PNC (sorbyl alcohol 0.6M, CaCl to get the plasmid that 400 μ l suspension add 5 μ g ₂12H ₂O50mM, the E4 substratum of 1/2 no glucose and yeast extract, PEG400040%) softly mix 30min, after slowly splash into cell walls regeneration nutrient solution (the sorbyl alcohol 0.6M of 600 μ l, the E4 substratum 50ml of no glucose and yeast extract, glucose 1%, yeast extract 1%), 25 ℃ of temperature are bathed behind the 16h frustule is applied to and are contained 30mg/L G418 and 10mmol/L NO ₃ ^-Solid medium in cultivate, 25 ℃, illumination 2500lux cultivates, about 3-4 detects the algae that grows on the flat board fall (Figure 10) after week.

The screening of embodiment 5. transgenosis chlorellas and the Molecular Detection of transgenic alga strain

A. the extraction of the total DNA of transgenosis chlorella

Single algae on picking flat board cell inoculation that falls is cultivated in 15mg/L G418 liquid nutrient medium, (25 ℃, illumination 2500lux, 120rpm).(concentration reaches and is about 1 * 10 after 2 weeks ⁸Individual/mL), the centrifugal 10min of 1600g collects frustule, in liquid nitrogen, cell is ground, reference literature Chen et al., the method for (2001) is extracted the total DNA of chlorella, the DNA of extraction be stored in-20 ℃ standby.

B. the PCR of transgenosis chlorella detects

With the transgenic alga genomic dna is template, carries out the pcr amplification of NPTII gene (that resistant gene of the card among the vector plasmid pbin221, sequence are SEQ ID NO:13) and NP-1 gene respectively.The PCR primer that detects the NPTII gene is: forward primer NPTIIf, 5 ' GGCGATACCGTAAAGCACGA3 ' (SEQ ID NO:14); Reverse primer NPTIIr, 5 ' TCCGGTGCCCTGAATGAACT3 ' (SEQ ID NO:15).The PCR reaction conditions is: 94 ℃ of pre-sex change 3min, and 94 ℃ of sex change 30s, 57 ℃ of annealing 40s, 72 ℃ are extended 1min 30s, 30 circulations, last loop ends is extended 10min for 72 ℃.Can amplify the fragment of about 580bp.The PCR primer of NP-1 gene is: forward primer NPf, 5 ' AAGCTTATGGTGGTCTGTGCGTGCAGACG3 ' (SEQ ID NO:16); Reverse primer NPr, 5 ' GGGAGAGCTCAGTAGTCCAAACATGT3 ' (SEQ ID NO:17).The PCR reaction conditions is: 94 ℃ of pre-sex change 3s, and 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 40s, 30 circulations, last loop ends is extended 10min for 72 ℃.Can amplify the dna fragmentation of about 200bp, i.e. the NP-1 gene.

Altogether 7 algae strains are detected, detected result is seen Figure 11,12.In transforming

algae strain

3,4,5 and 6, can amplify external source NPTII gene, in transforming

algae strain

1,4,5 and 6, can amplify external source NP-1 gene, NPTII and NP-1 can both increase out in transforming

algae strain

4,5 and 6.It is the transgenic alga strain that preliminary proof NPTII and NP-1PCR are the strain of male algae, chooses these algae strain succeeding transfer culture and detects the NP-1 bacteriostatic activity.

C. the extraction of the total RNA of transgenosis chlorella

Get the centrifugal 10min of frustule 1200g of 2ml logarithmic growth, collect frustule and extract the total RNA of test kit (Qiagen) extraction chlorella with RNA afterwards.

The extraction of embodiment 6. transgenosis chlorella soluble proteinss

With E4 culture medium culturing transgenic alga, (concentration is about 1 * 10 to centrifugal collection logarithmic phase ⁸Individual/mL) cell, the wet algae of about 3g is heavy, and heavy by wet algae then: sterilized water: granulated glass sphere=1:1:1 mixes.Ultrasonication 9s, interval 4s, broken number of times 90 times (the ultrasonic cell pulverization machine of JY92-II, Ningbo), boiling water boil 10min and make macromolecular weight protein sex change precipitation.4 ℃ of centrifugal 10min of back 7500g that spend the night, the bacteriostatic activity of mensuration supernatant liquor.

The bacteriostatic activity of embodiment 7. transgenosis chlorella soluble proteinss detects

Liquid culture method: adopt test tube doubling dilution (Balous et al., 1991), add testing sample with liquid LB substratum and do isopyknic dilution, the testing sample dilution is 1/2, adds an amount of bacterium liquid OD after the 1/4-1/64 concentration ₆₀₀(intestinal bacteria ATCC 25922 is diluted to 10 to=0.02-0.04 behind 37 ℃ of cultivation 16h ^-4), the corresponding minimum inhibitory concentration of quantitative assay.37 ℃ of constant temperature shaking tables are cultivated 16h.

Plate method: with 10 μ l bacterium liquid (OD ₆₀₀=0.02-0.04) coat on the LB solid medium, the filter paper of 0.6cm is lain on the substratum, on filter paper, add chlorella protein extract 200 μ l, overnight incubation in 37 ℃ of incubators is observed and is had or not inhibition zone to generate.

The bacteriostatic activity of above-mentioned two kinds of mensuration transgenosis chlorella soluble proteinss is tested used contrast and is unconverted nrm-4 chlorella soluble proteins.Transgenosis chlorella soluble proteins extracting solution is after 1/2-1/16 times of dilution, behind intestinal bacteria ATCC 25922 mixed culture 16h, nutrient solution is still clarified, and contrast muddy (Figure 13), show that transgenosis chlorella soluble proteins extracting solution after 16 times of dilutions, still has bacteriostatic activity.Dull and stereotyped bacteriostatic test shows, adds transgenosis chlorella soluble proteins extracting solution and can form tangible inhibition zone (Figure 14).Above-mentioned result of study shows: the NP-1 gene not only stable integration given transgenosis chlorella to colibacillary restraining effect in the chlorella genome but also can correctly express.

Reference:

[1]Balous?A，Hausler?W?J，Herrmann?K?L，Isenberg?H?D，and?Shadomy?H?J，eds.Manual?of?Clinical?Microbiology.5th?ed(M).Washington?DC：American?Society?for?Microbiology，1991.1138～1152

[2]Boynton?J?E，Gillham?N?W，Harris?E?H，Hosler?J?P，Johnson?A?M，Jones?A?R，Randolph-Anderson?B?L，Robertson?D，Klein?T?M，Shark?K?B?and?Sanford?J?C.Chloroplast?transformation?in?Chlamydomonas?with?high?velocitymicroprojectiles(J)，Science，1988，240：1534～1538

[3]Bricknell?I，and?Dalmo?R?A.The?use?of?immunostimulants?in?fish?larvalaquaculture(J).Fish?Shellfish?Immunol，2005，19：457～472

[4]Chen?Y，Wang?Y?Q，Sun?Y?R，Zhang?L?M?and?Li?W?B.Highly?efficientexpression?of?rabbit?neutrophil?peptide-1gene?in?Chlorella?ellipsoidea?cells(J).Curr?Genet，2001，39：365～370

[5]Dawson?H，Burlingame?R?and?Cannons?A?C.Stable?transformation?ofChlorella：rescue?of?nitrate?reductase-deficient?mutants?with?the?nitratereductase?gene(J).Curr?Microbiol，1997，35：356～362

[6]Ganz?T，Rayner?J?R，Valore?E?V，Tumolo?A，Talmadge?K?and?Fuller?F.Thestructure?of?the?rabbit?macrophage?defensin?genes?and?their?organ-specificexpression(J).Immunl，1989，43：1358～1365

[7]Kindle?K?L，Schnell?R?A，Fernandez?E?and?Lefebvre?P?A.Stable?nucleartransformation?of?Chlamydomonas?using?the?Chlamydomonas?gene?for?nitratereductase(J).J.Cell?Biol.，1989，109：2589～2601

[8]Kindle?K?L，Rlchards?K?L?and?Stern?D?B.Engineering?the?chloroplastgenome：Techniques?and?capabilities?for?chloroplanst?transformation?inChlamydomonas?reinharchii(J).Proc?NatlAcad?Dci?USA，1991，88：1721～1725

[9]Kindle?K?L.High-frequency?nuclear?transformation?of?Chlamydomonasreinhardtii(J).Proc?Natl?Acad?Dci?USA，1990，87：1228～1232

[10]Kim?D?H，Kim?Y?T，Cho?J?J，Bae?J?H，Hur?S?B，Hwang?I?and?Choi?T?J.Stable?integration?and?functional?expression?of?flounder?growth?hormone?genein?transformed?microalga，Chlorella?ellipsoidea(J).Mar.Biotechno.l，2002，4：63～73

[11]Ladygin?V?G.An?efficient?way?for?obtaining?transformants?ofChlamydomonas?reinhardtii?by?electroporation(J).Biofizika，2004，49：700～704

[12]Li?X，Shen?X，Wang?Y?Q，Li?W?B，Sun?Y?R.High-level?expression?andone-step?purification?of?neutrophil?peptide?1?in?E.coli?with?self-cleavableIntein?Tag(J).High?Technology?Letters(English?Language?Edition)，2004，10(Suppl.)：264～268

[13]Maruyama?M，Horakova?I?and?Honda?H.Introduction?of?foreign?DNA?intoC.saccharophila?by?electroporation(J).Biotech?Tech.，1994，8：821～826

[14]Park?Y?D，Papp?I，Moscone?E?A，Iglesias?V?A，Vaucheret?H，Matzke?A?Jand?Matzke?M?A.，Gene?silencing?mediated?by?promoter?homology?occur?at?thelevel?of?transcription?and?result?in?meiotically?heritable?alterations?inmethylation?and?gene?activity(J).Plant?J.，1996，9(2)：183～194

[15]Piers?K?L，Brown?M?H?and?Hancock?R?E.Recombinant?DNA?proceduresfor?producing?small?antimicrobial?cationic?peptides?in?bacteria(J).Gene，1993，134：7～13

[16]Richard?L，Hawkins?R?I?and?Nakamura?M.Expression?of?human?growthhormone?by?the?eukaryotic?alga，Chlorella(J).Curr?Microbiol，1999，38：335～341

[17]Vaucheret?H.Identification?of?a?general?silencer?for?19S?and?35Spromoters?in?a?transgenic?tobacco?plant：90bp?of?homology?in?the?promotersequences?are?sufficient?for?trans-inactivation.CR?Acad?Sci?Paris，1993，316：1471～1483

[18]Wang?P，Wang?Y?Q，Geng?D?G，Li?W?B?and?Sun?Y?R.Molecular?cloningand?characterization?of?a?cDNA?encoding?nitrate?reductase?from?Chlorellaellipsoidea(Chlorophyta)(J).J.Appl.Phycol.，2003，15：457～463

[19]Wang?P，Sun?Y?R，Li?X，Zhang?L?M，Li?W?B，and?Wang?Y?Q.Rapidisolation?and?functional?analysis?of?promoter?sequences?of?the?nitrate?reductasegene?from?Chlorella?ellipsoidea(J).J.Appl.Phycol.，2004，16：11～16

[20]Wang?Y?Q，Chen?Y?and?Sun?Y?R.Isolation?and?characterization?of?anitrate?reductase?deficient?mutant?of?Chlorella?ellipsoidea(Chlorophyta)(J).J.Appl.Phycol.，2005，17：281～286

[21] Wang Y Q (Wang Yiqin), Chen Y (Chen Ying), Bai Q H (Bai Qinhua), Zhao S M (Zhao Shimin), Li W B (Li Wenbin) and Sun Y R (Sun Yongru) .Using transgenic Chlorellaellipsoidea as bio-reactor to produce rabbit defensin (J) .High TechnologyLetters (hi-tech communication), 2001,11:1～5

[22] Zhang X Y (Zhang Xiaoyu), Wang P (Wang Peng), Zhao S M (Zhao Shimin), Li X (Li Xia), Shen X (Shen Xin), Sun Y R (Sun Yongru), Chu C C (storage is become a useful person) and Wang Y Q (Wang Yiqin) .Expression of rabbit neutrophile peptide-1 in nitrate reductase deficientmutant of Chlorella ellipsoidea (J) .Yichuan (Beijing) (heredity), 2006,28:1580～1584

SEQUENCE?LISTING

＜110〉Inst. of Genetics and Development Biology, CAS

＜120〉a kind of method that makes up the chlorella expression vector transforms PEG method of chlorella and breaking of chlorella

Wall side

Method

<130>IB080055

<160>17

<170>PatentIn?version?3.1

<210>1

<211>1987

<212>DNA

＜213〉artificial sequence

<400>1

<210>2

<211>25

<212>DNA

＜213〉artificial sequence

<400>2

<210>3

<211>20

<212>DNA

＜213〉artificial sequence

<400>3

<210>4

<211>2007

<212>DNA

＜213〉artificial sequence

<400>4

<210>5

<211>88

<212>DNA

＜213〉artificial sequence

<400>5

<210>6

<211>4086

<212>DNA

＜213〉artificial sequence

<400>6

<210>7

<211>268

<212>DNA

＜213〉artificial sequence

<400>7

<210>8

<211>40

<212>DNA

＜213〉artificial sequence

<400>8

<210>9

<211>30

<212>DNA

＜213〉artificial sequence

<400>9

<210>10

<211>28

<212>DNA

＜213〉artificial sequence

<400>10

<210>11

<211>31

<212>DNA

＜213〉artificial sequence

<400>11

<210>12

<211>143

<212>DNA

＜213〉artificial sequence

<400>12

<210>13

<211>582

<212>DNA

＜213〉artificial sequence

<400>13

<210>14

<211>20

<212>DNA

＜213〉artificial sequence

<400>14

<210>15

<211>20

<212>DNA

＜213〉artificial sequence

<400>15

<210>16

<211>29

<212>DNA

＜213〉artificial sequence

<400>16

<210>17

<211>26

<212>DNA

＜213〉artificial sequence

<400>17

Claims

1. expression vector that is used for chlorella nitrate reductase gene deletion mutant expression alien gene, it is by the NR gene with SEQ ID NO:6, the Ω sequence of the Ubiquitin promotor of SEQ ID NO:1 and SEQ ID NO:5 head and the tail successively is connected in the multiple clone site that is cloned into vector plasmid and obtains, and wherein said vector plasmid is suitable for expression alien gene in chlorella nitrate reductase gene deletion mutant.

2. the expression vector of claim 1, wherein said vector plasmid is selected from by pBin19, pGreen0029, pCABIA1300, pBin121, the group that pbin221 and pBADW form.

3. the expression vector of claim 1, wherein said vector plasmid is a pbin221 plasmid as shown in Figure 1.

4. the expression vector of claim 1, wherein said expression vector be as shown in Figure 4 pbin-NR-U Ω or pGreen-NR-U Ω as shown in Figure 8.

5. the expression vector of claim 1, wherein said foreign gene is the NP-1 gene, its nucleotides sequence is classified the sequence shown in the SEQ ID NO:12 as.

6. each expression vector of claim 1-5, wherein said chlorella algae kind is common or chlorella ellipsoidea.

7. each expression vector application in the expression alien gene in chlorella nitrate reductase gene deletion mutant of claim 1-6.

8. method that is structured in the expression vector of expression alien gene in the chlorella nitrate reductase gene deletion mutant, comprise NR expression cassette (NRpro-NR-nosT) with SEQ ID NO:6, the Ω sequence of the Ubiquitin promotor of SEQ ID NO:1 and SEQ ID NO:5 is connected the step in the multiple clone site that is cloned into vector plasmid successively from beginning to end, and wherein said vector plasmid is suitable for expression alien gene in chlorella nitrate reductase gene deletion mutant.

9. chlorella PEG method for transformation, it comprises chlorella cells suspended with enzymolysis solution and is placed on 25 ℃, and shading is cultivated, and described enzymolysis solution comprises sorbyl alcohol 0.6M, CaCl ₂12H ₂O 50mM, R-10 cellulase (1U/mg) 3%-6%, R-10 polygalacturonase (1U/mg) 1%-4%, Y-23 polygalacturonase (1U/mg) 0.1 ‰-1.5 ‰, wherein said per-cent is mass/volume.

10. the method for claim 9, wherein said R-10 cellulase (1U/mg) content is 4%, and R-10 polygalacturonase (1U/mg) content is 2%, and Y-23 polygalacturonase (1U/mg) content is 1 ‰.

11. a transgenosis chlorella wall-breaking method efficiently is characterized in that utilizing the method for ultrasonication, in chlorella weight in wet base (g): granulated glass sphere (g): the ratio of water (ml)=1:1:1 adds granulated glass sphere and water.

12. the method for claim 11, the condition of wherein said ultrasonic disruption are ultrasonication 7-12s, interval 2-6s, broken number of times 70-90 time.