CN102229940B - Method for knocking out target gene of Chlamydomonas reinhardtii - Google Patents
Method for knocking out target gene of Chlamydomonas reinhardtii Download PDFInfo
- Publication number
- CN102229940B CN102229940B CN 201010620522 CN201010620522A CN102229940B CN 102229940 B CN102229940 B CN 102229940B CN 201010620522 CN201010620522 CN 201010620522 CN 201010620522 A CN201010620522 A CN 201010620522A CN 102229940 B CN102229940 B CN 102229940B
- Authority
- CN
- China
- Prior art keywords
- carrier
- gene
- ptsbir
- pmd
- target gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of bioengineering and in particular relates to a method for knocking out a target gene of Chlamydomonas reinhardtii. The method comprises the following step of constructing a vector pMCS-SPA-MCS and a vector pTSBIR-XIR. According to the invention, the purpose of silencing the target gene of Chlamydomonas reinhardtii is achieved by screening a transformant which exerts a silencing effect on the candidate gene, utilizing the restriction enzyme cutting sites of the vector pMCS-SPA-MCS and constructing a vector pXF-SPA-XR to construct the vector pTSBIR-XIR for the target gene RNAi. The method has the characteristics of increasing the efficiency of knocking out the target gene and being convenient to operate and rapid.
Description
Technical field
The invention belongs to technical field of bioengineering, be specifically related to a kind of utilize intermediate carrier can be fast, precise and high efficiency carries out reticent knockout technique for the Chlamydomonas reinhardtii target gene.
Background technology
Chlamydomonas reinhardtii belongs to Chlorophyta, volvocales, chlamydomonas section, it is a kind of unicellular eucaryon Flagellatae, it is the model animals of the multiple vital movement of research (as photosynthesis, flagellum assembling, phototaxis, Control of cellcycle and cell recognition etc.), with yeast cell, many common features are arranged, as simple in growth cycle, growth is fast, generation time is short, can form mono-clonal on flat board, also can carry out liquid culture, with monoploid and two kinds of form growths of diploid, can carry out tetrads analysis etc. to the growth course of its gamete.The title of " photosynthetic yeast " is therefore arranged.Its genetic background is clear, is at present unique biomaterial of setting up nucleus, chloroplast(id) and plastosome three cover genetic transformation systems.
Chlamydomonas reinhardtii is as the common ancestor of plant and animal, and its genome can provide for the evolution of multicellular organism important information.Nearly 15000 genes of Chlamydomonas reinhardtii, by the Chlamydomonas reinhardtii genome plan, scientists has obtained the sequence of Chlamydomonas reinhardtii genomic 95%.Chlamydomonas reinhardtii genome and other known genome are relatively found, Chlamydomonas reinhardtii and the mankind have 45% gene, and flowering plant has 62% gene.This explanation has general meaning to the research of Chlamydomonas reinhardtii.
Chlamydomonas reinhardtii structural genomics and expressed sequence tag plan complete that research for the reverse genetics of Chlamydomonas reinhardtii provides may.RNA disturbs the powerful as functional genomics research, widely applies and obtained remarkable effect in fungi, plant, fruit bat, the vertebrates such as low and mammiferous research.RNA disturbs (RNA interference, RNAi) phenomenon to refer to that the specificity degraded occurs the interior mRNA of cell of endogenous or exogenous double-stranded RNA (double strand RNA, dsRNA) mediation, finally causes corresponding PTGS.It is fast and convenient, highly versatile, targeting high have demonstrated very strong superiority in the research of Functional identification of genes.It is a kind of gene silencing phenomenon that is caused by double-stranded RNA of finding in nematode the earliest that RNA disturbs, no matter studies confirm that afterwards is long double-stranded RNA (dsRNA) or bobby pin RNA (small hairpin RNA, shRNA), all to be processed into by Dicer the little RNA of functional two strands of 21 base length---siRNA (small interfering RNA) at last.SiRNA is combined with the associated protein prime factor that comprises Argonaute in tenuigenin and is formed the RISC complex body, identify target RNA by base pairing, in the presence of magnesium ion and ATP, Argonaute albumen utilizes its endonuclease activity to cut the target RNA of complete complementary pairing with it, generation has the mRNA fragment of 5 ' phosphate and 3 ' C-terminal, makes it to be more vulnerable to the attack of 5 ' or 3 ' exonuclease and fast degradation.This mechanism is namely that usually said RNA disturbs.Yet with regard to Chlamydomonas reinhardtii, by the RNAi technology, knocking out of candidate gene also just is in the starting stage.Exist the unstable that gene is pounded out.Namely in turning the transgenosis colony of RNAi carrier, a part is pounded out target gene by the RNAi effect, and another part is not pounded out target gene for various reasons.This is very unfavorable for research work.
Summary of the invention
The purpose of this invention is to provide a kind of method for knocking out target gene of Chlamydomonas reinhardtii, by screening, candidate gene there is the transformant of reticent effect, utilize the restriction enzyme site of intermediate carrier pMD285 self, inverted repeats by the establishing target gene comes establishing target gene RNAi carrier pTSBIR-XIR, thereby realization is carried out silence to the Chlamydomonas reinhardtii target gene, has target gene is knocked out the characteristics such as efficient is high, easy and simple to handle, quick.
The technology used in the present invention principle:
Selection has the reporter gene of lethal effect: tryptophane enzyme beta subunit (Tryptophan synthase β-subunit, TSB) gene.Its activity in vivo and principle of work are as follows:
Tryptophane synthetic enzyme a subunit (TSA) activity:
Tryptophane enzyme beta (TSB) subunit is active:
After adding 5-Fluoroindole in substratum:
On the basis of clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit (TSB) gene, the inverted repeats of TSB (tryptophane enzyme beta subunit) and the inverted repeats of candidate gene are cascaded, then the Ble gene 3 ' non-coding region that is placed in the RbcS-Ble expression cassette is regional, simultaneously, introduce the HSP70/RbcS-aphIII expression cassette of paramaciny resistance, as the transgenosis selective marker.Like this, in transgenic progeny colony, by detecting tryptophane enzyme beta subunit inverted repeats (TSB-IR), the reticent effect (positive transformant can be grown) of target gene is screened the transformant (Fig. 1, target gene knock out efficient and reach more than 90%) that candidate gene is had reticent effect on the substratum that contains tryptophane and 5-fluoro indole.
The inverted repeats that builds goal gene by intermediate carrier pMD285 has the advantage of the following aspects:
1, easy, quick.The structure of target gene inverted repeat sequence vector can utilize the restriction enzyme site of intermediate carrier pMD285 self, cut and be connected the inverted repeats that just can build target gene by twice enzyme, then cutting with being connected to connect by EcoRI enzyme and just can build target gene RNAi carrier pTSBIR-XIR.Connection with respect to flush end has simple, fast characteristics.
2, need not order-checking.The mode that the target gene fragment is cloned by TA is inserted on the TAKARA pMD of company serial carrier (Fig. 2), because this Vector construction is just cut, connected such directed cloning by enzyme and do not relate to easy generation sudden change round pcr etc., therefore need not order-checking in the vector construction process subsequently, this has also just solved inverted repeats this difficult problem that can not check order.
3, economy.What the enzyme that utilizes intermediate carrier pMD285 to build the whole process of RNAi carrier pTSBIR-XIR carrier was cut use is all the restriction endonuclease of commonly using, and having enzyme, to cut efficient high, cheap.The ligase enzyme that whole process is used is T4 ligase enzyme, good economy performance.
The technical solution adopted in the present invention:
A kind of method for knocking out target gene of Chlamydomonas reinhardtii method comprises the structure of intermediate carrier pMD285 and RNAi carrier pTSBIR-XIR.
1, the structure of intermediate carrier pMD285
Take the TAKARA pMD-18T Simple of company carrier as the basis, by designing synthetic multiple clone site and transcribed spacer sequence, insert at last pMD-18T Simple carrier, (MD represents that this plasmid comes from the TAKARA pMD of company series to obtain intermediate carrier pMD285; 285 meanings are that to add the transcribed spacer sequence be 285bp to the multiple clone site of synthetic; P represents plasmid).
The design of A, multiple clone site
The restriction enzyme site commonly used at choice experiment chamber TAKARA company commonly used produces pMD serial carrier T cloning site two ends is as the restriction enzyme site at intervening sequence two ends.
Choosing of B, intervening sequence
Take inertia in the strain of transgene receptor algae as principle, choose one section 180bp on pCAMBIA1302 in the Chlamydomonas reinhardtii genome without a fragment of homology as intervening sequence.
Synthesize with the multiple clone site intervening sequence at C, two ends
Entrust Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to synthesize with the intervening sequence of multiple clone site at the two ends that design, institute's calling sequence is seen Fig. 3.Simultaneously, be the intervening sequence design pair of primers of two ends with multiple clone site:
MCSF：5’-CGCAGAATTCTGCAGATATC-3’
MCSR：5’-GGTCGAATTCCAGCACACTG-3’
Purpose be method by PCR with this sequence clone to pMD-18T Simple carrier.
Choosing of D, cloning vector
Choose pMD-18T Simple as cloning vector.
PMD-18T Simple is inserted with the intervening sequence of multiple clone site in E, two ends
Utilize primer (MCSF:5 '-CGCAGAATTCTGCAGATATC-3 ', MCSR:5 '-GGTCGAATTCCAGCACACTG-3 ') carry out pcr amplification, reclaim the PCR product and connect pMD-18T Simple carrier, connect product and transform DH5 α cell, extract plasmid and obtain the pMD285 intermediate carrier.
2, the structure of RNAi carrier pTSBIR-XIR
The fragment of A, clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit (TSB) gene 3 ' end non-coding region 450bp.Pass through primer
(TBSF:GCACTGTGCTTTGACAGACAAG; TBSR:CGATTGGTAGCAACAAAGTGAGT), pcr amplification obtains TBS gene inverted repeats, and insertion vector SP124S Ble gene 3 ' end non-coding region is regional respectively, obtains containing the intermediate carrier of TBS inverted repeats.
B, aphVIII gene expression cassette is downcut from the pSI103 carrier with SacI/KpnI, fill, be connected into the intermediate carrier that step 1 obtains, (TSB is the english abbreviation of tryptophane enzyme beta subunit to obtain RNAi carrier pTSBIR-XIR (Fig. 1); IR is the abbreviation of English inverted repeats; X represents target gene, and P represents plasmid).
Beneficial effect of the present invention:
1, on the basis of clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit (TSB) gene, the inverted repeats of TSB and the inverted repeats of candidate gene are cascaded, then the Ble gene 3 ' non-coding region that is placed in the RbcS-Ble expression cassette is regional, simultaneously, introduce the HSP70/RbcS-aphIII expression cassette of paramaciny resistance, as the transgenosis selective marker.Like this, in transgenic progeny colony, by detecting tryptophane enzyme beta subunit inverted repeats (TSB-IR), the reticent effect (positive transformant can be grown) of target gene is screened the transformant that candidate gene is had reticent effect on the substratum that contains tryptophane and 5-fluoro indole, make target gene knock out efficient and reach more than 90%.
2, utilize the restriction enzyme site of intermediate carrier pMD285 self, cut with just being connected by twice enzyme and can build the target gene inverted repeats, then cut with being connected to connect by EcoRI enzyme and just can build target gene RNAi carrier pTSBIR-XIR.The connection that relates in whole process is all the connection of sticking end, has easy and simple to handle, characteristics efficiently with respect to the connection of flush end.
Description of drawings
The schematic diagram of Fig. 1, RNAi carrier pTSBIR-XIR (a) and intermediate carrier pMD285 (b).Wherein, B, BamHI; E, EcoRI; H, HindIII; K, KpnI; S, SalI; Xb, XbaI; Xh, XhoI.
Fig. 2 pMD18-T Vector schematic diagram shows multiple clone site.
Fig. 3, intermediate carrier pMD285 multiple clone site and interval region sequence.
Fig. 4, plasmid pRSEP1F-SPA-MCS HindIII and XbaI double digestion are identified figure.
Fig. 5, RNAi carrier pTSBIR-RSEP1 IR EcoRI enzyme are cut evaluation figure.
Fig. 6 .pTSBIR-RSEP1IR transforms the detection case of Chlamydomonas reinhardtii and reporter gene ARS.
The horizontal Real time of the mRNA pcr analysis result of Fig. 7 transgenic alga strain Rsep1 gene.1:C.reinhardtii CC124; 2～6: turn pTSBIR-RSEP1IR carrier algae strain RSEP1RNAi7, RSEP1RNAi36, RSEP1RNAi71, RSEP1RNAi103, RSEP1RNAi138.
Embodiment
The present invention is described in further detail below in conjunction with example.
Embodiment
To pounding out of Chlamydomonas reinhardtii rsep1 (Protein ID:206032) gene.
1, design forward and reverse primer:
RSEP1-347BP-3UCS-F：GTCGCGGCTTGTTTTACAAT
RSEP1-347BP-3UCS-R：CCTCCTGTTATTTCCCAGCA
Take Chlamydomonas reinhardtii CC124 cDNA as template, the nucleotide fragments of its 3 ' end non-coding region 347bp length that increases.Fragment is inserted the pMD-18T carrier of Takara company through reclaiming.Recombinant vectors carries out sequence relatively with the sequence comparison software that NCBI provides after order-checking, the DNA fragmentation of determining the clone is the nucleotide fragments of rsep1 gene 3 ' end non-coding region 347bp length.Obtain the cloning vector pMD-RSEP1 of this fragment.
2, with HindIII and XbaI double digestion pMD-RSEP1, rsep1 gene 3 ' end non-coding region 347bp fragment is inserted the intermediate carrier pMD285 through HindIII and XbaI double digestion after reclaiming; After both connecting, transform intestinal bacteria, recon obtains carrier pRSEP1F-SPA-MCS (Fig. 4) after HindIII and the evaluation of XbaI double digestion.
3, with KpnI and SalI double digestion pMD-RSEP1,347bp rsep1 gene 3 ' end non-coding region fragment is inserted the carrier pRSEP1-SPA-MCS through KpnI and SalI double digestion after reclaiming; After both connecting, transform intestinal bacteria, recon obtains carrier pRSEP1F-SPA-RSEP1R after enzyme is cut evaluation.
4, the pRSEP1F-SPA-RSEP1R carrier is cut with the EcoRI enzyme, is connected with the RNAi carrier pTSBIR-XIR that cuts through same EcoRI enzyme.Transform intestinal bacteria, obtain RSEP1 RNAi carrier pTSBIR-RSEP1IR.Cut evaluation (Fig. 5) with the EcoRI enzyme.
5, the RNAi carrier transforms and screening
Adopt glass beads method to transform Chlamydomonas reinhardtii CC-124.Get and be cultured to cell log algae in vegetative period liquid 50ml, the centrifugal 5min of 4000r/min abandons supernatant.With the 600 resuspended precipitations of μ lTAP liquid nutrient medium, make cell concn reach 2 * 10
8Cell/ml.Cell transfer adds granulated glass sphere in another centrifuge tube, 20%PEG8000 and pTSBIR-RSEP1IR arrange pTSBIR-XIR in addition as the negative contrast of transgenosis.On the vortex vibrator, upright vibration is 20 seconds.Cell transfer is placed in shaking table to the TAP liquid nutrient medium, at 25 ℃, and 120r/min, the 24h full exposure, under the culture condition of intensity of illumination 1000-1500lux, shaking culture is spent the night.Centrifugal, collecting cell, evenly be applied to contain 1.2% agar the TAP solid medium on (containing 1.5mM L-Trp, 5ug/ml paromycin, 5uM 5-FI), put incubator, at 25 ℃, the 24h full exposure is inverted under the culture condition of intensity of illumination 2000-2500lux and is cultivated 7-8d, picking mono-clonal (Fig. 6).
6, the reticent effect of Real-time pcr analysis target gene RSEP1
Get C.reinhardtii CC-124 wild-type, the total RNA of frustule is extracted in pTSBIR-XIR transgenic alga strain and choose at random the strain of pTSBIR-RSEP1IR transgenic alga.Dnase I processes above-mentioned extracting RNA, pollutes to remove DNA, and the RNA after processing detects and electrophoresis detection with spectrophotometer.SuperScript by Invitrogen
TMIII Reverse Transcriptase synthesizes cDNA the first chain.Template as Real-time PCR.18SrDNA is with reference to primer: QRT-18s-F:CGAACTTCTGCGAAAGCAT; QRT-18s-R:TCAGCCTTGCGACCATACT.Real-time PCR response procedures: 95 ℃ of denaturation 10s; The PCR reaction: 5s/95 ℃, 25s/55 ℃, 40Cycles; Melt curve analysis is analyzed: 10s/55 ℃, and 5 ℃/s, 95 ℃ of end.Quantitative fluorescent PCR the data 2
-Δ Δ ctMethod is analyzed.Result as shown in Figure 7.The rna level of target gene rsep1 descends greatly.
Claims (1)
1. method for knocking out target gene of Chlamydomonas reinhardtii, it is characterized in that: comprise that intermediate carrier pMD285 builds, rsepl gene inverted repeat sequence vector pRSEP1F-SPA-RSEP1R builds, rsepl gene inverted repeats inserts RNAi carrier pTSBIR, rsepl gene RNAi carrier pTSBIR-RSEP1IR transforms and screening, the reticent effect of Real-time pcr analysis target gene;
1) structure of intermediate carrier pMD285
Take the TAKARA pMD-18T Simple of company carrier as the basis, by designing synthetic multiple clone site and transcribed spacer sequence, insert at last pMD-18T Simple carrier, obtain intermediate carrier pMD285;
The design of A, multiple clone site
The restriction enzyme site commonly used at choice experiment chamber TAKARA company commonly used produces pMD serial carrier T cloning site two ends is as the restriction enzyme site at intervening sequence two ends;
Choosing of B, intervening sequence
Take inertia in the strain of transgene receptor algae as principle, choose one section 180bp on pCAMBIA1302 in the Chlamydomonas reinhardtii genome without a fragment of homology as intervening sequence; The described intervening sequence base sequence that 240 bases of the 61st base to the consist of as shown in SEQ ID NO:1;
Synthesize with the multiple clone site intervening sequence at C, two ends
Entrust Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to synthesize with the intervening sequence of multiple clone site at the two ends that design, institute's calling sequence is as shown in SEQ ID NO:1; Simultaneously, be the intervening sequence design pair of primers of two ends with multiple clone site:
MCSF：5’-CGCAGAATTCTGCAGATATC-3’
MCSR：5’-GGTCGAATTCCAGCACACTG-3’
Method by PCR with this sequence clone to pMD-18T Simple carrier;
Choosing of D, cloning vector
Choose pMD-18T Simple as cloning vector;
PMD-18T Simple is inserted with the intervening sequence of multiple clone site in E, two ends
Utilize primer
MCSF：5’-CGCAGAATTCTGCAGATATC-3’，MCSR：5’-GGTCGAATTCCAGCACACTG-3’
Carry out pcr amplification, reclaim the PCR product and connect pMD-18T Simple carrier, connect product and transform DH5 α cell, extract plasmid and obtain the pMD285 intermediate carrier;
2), rsepl gene inverted repeat sequence vector pRSEP1F-SPA-RSEP1R builds
A, synthetic primer
RSEP1-347BP-3UCS-F：GTCGCGGCTTGTTTTACAAT
RSEP1-347BP-3UCS-R：CCTCCTGTTATTTCCCAGCA
Take Chlamydomonas reinhardtii CC124cDNA as template, the nucleotide fragments of its 3 ' end non-coding region 347bp length that increases; Fragment reclaims, and inserts the pMD-18T carrier of Takara company; Recombinant vectors determines that clone's DNA fragmentation is the target gene fragment after order-checking; Obtain the cloning vector pMD-RSEP1 of this fragment;
B, with HindIII and XbaI double digestion pMD-RSEP1, the target gene endonuclease bamhi inserts the intermediate carrier pMD285 through HindIII and XbaI double digestion after reclaiming; After both connecting, transform intestinal bacteria, recon obtains carrier pRSEP1F-SPA-MCS after HindIII and the evaluation of XbaI double digestion;
C, with KpnI and SalI double digestion pMD-RSEP1, the target gene endonuclease bamhi inserts the carrier pRSEP1F-SPA-MCS through KpnI and SalI double digestion after reclaiming; After both connecting, transform intestinal bacteria, recon obtains inverted repeats pRSEP1F-SPA-RSEP1R after enzyme is cut evaluation;
3), RNAi carrier pTSBIR Vector construction
The fragment of A, clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit gene 3 ' end non-coding region 450bp, by the design primer, pcr amplification obtains TBS gene inverted repeats, insertion vector SP124S Ble gene 3 ' end non-coding region is regional respectively, obtains containing the intermediate carrier of TSB inverted repeats;
B, the aphVIIIgene expression cassette is downcut from the pSI103 carrier with SacI/KpnI, fills, be connected into steps A) intermediate carrier that obtains, obtain RNAi carrier pTSBIR;
4), rsepl gene inverted repeats inserts RNAi carrier pTSBIR
Inverted repeats pRSEP1F-SPA-RSEP1R carrier is cut with the EcoRI enzyme, is connected with the RNAi carrier pTSBIR that contains TSB gene inverted repeats that cuts through same EcoRI enzyme; Transform intestinal bacteria, obtain rsepl gene RNAi carrier pTSBIR-RSEP1IR; Cut evaluation with the EcoRI enzyme;
5), rsepl gene RNAi carrier pTSBIR-RSEP1IR transforms and screening
Adopt glass beads method to transform Chlamydomonas reinhardtii CC-124; Cell evenly is applied on the TAP solid medium that contains 1.5mML-tryptophane, 5ug/ml paromycin, 5uM5-FI, 7-8 days picking mono-clonals;
6), the reticent effect of Real-time pcr analysis target gene
Get C.reinhardtii CC-124 wild-type, the total RNA of frustule is extracted in the strain of pTSBIR transgenic alga; Synthesize cDNA the first chain by reverse transcription, as the template of Real-time PCR; Take 18SrDNA as with reference to primer: QRT-18s-F:CGAACTTCTGCGAAAGCAT; QRT-18s-R:TCAGCCTTGCGACCATACT; Real-time PCR response procedures: 95 ℃ of denaturation 10s; The PCR reaction: 5s/95 ℃, 25s/55 ℃, 40Cycles; Melt curve analysis is analyzed: 10s/55 ℃, and 5 ℃/s, 95 ℃ of end; Quantitative fluorescent PCR the data 2
-Δ ΔThe Ct method is analyzed; Detect the mRNA level of pTSBIR-RSEP1IR transgenic alga strain target gene, to determine the reticent effect of target gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010620522 CN102229940B (en) | 2010-12-20 | 2010-12-20 | Method for knocking out target gene of Chlamydomonas reinhardtii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010620522 CN102229940B (en) | 2010-12-20 | 2010-12-20 | Method for knocking out target gene of Chlamydomonas reinhardtii |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102229940A CN102229940A (en) | 2011-11-02 |
| CN102229940B true CN102229940B (en) | 2013-05-08 |
Family
ID=44842545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010620522 Expired - Fee Related CN102229940B (en) | 2010-12-20 | 2010-12-20 | Method for knocking out target gene of Chlamydomonas reinhardtii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102229940B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105296516A (en) * | 2014-07-15 | 2016-02-03 | 中国农业科学院棉花研究所 | DsRNA expression vector and application |
| CN106978432B (en) * | 2017-03-09 | 2019-11-15 | 中国科学院水生生物研究所 | Knock out carrier construction method and the application of chlamydomonas endogenous gene and expression alien gene |
| CN110751982B (en) * | 2018-07-04 | 2023-11-10 | 广州赛业百沐生物科技有限公司 | Intelligent parallelization knockout strategy screening method and system |
-
2010
- 2010-12-20 CN CN 201010620522 patent/CN102229940B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| Jennifer Rohr，Heriberto Cerutti et al.,."Tandem inverted repeat system for selection of effective transgenic RNAi strains in Chlamydomonas".《The Plant Journal》.2004,第40卷(第4期),pages 611-621. |
| Jennifer Rohr,Heriberto Cerutti et al.,."Tandem inverted repeat system for selection of effective transgenic RNAi strains in Chlamydomonas".《The Plant Journal》.2004,第40卷(第4期),pages 611-621. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102229940A (en) | 2011-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wei et al. | RNA i‐based targeted gene knockdown in the model oleaginous microalgae Nannochloropsis oceanica | |
| Catalanotto et al. | Redundancy of the two dicer genes in transgene-induced posttranscriptional gene silencing in Neurospora crassa | |
| CN106086062A (en) | A kind of tomato dna group that obtains pinpoints the method knocking out mutant | |
| Hou et al. | Comparative genomics of pathogens causing brown spot disease of tobacco: Alternaria longipes and Alternaria alternata | |
| CN101384721A (en) | Selecting and stabilizing dsrna constructs | |
| CN109161480B (en) | Preparation method and gene knockout method of protoplast of phomopsis | |
| CN105505879B (en) | Method and culture medium for culturing transgenic animal embryonic cells or transgenic animals | |
| US20190169653A1 (en) | Method for preparing gene knock-in cells | |
| Bhadauria et al. | Reverse genetics for functional genomics of phytopathogenic fungi and oomycetes | |
| Chang et al. | Identification and characterization of microRNAs in the white‐backed planthopper, Sogatella furcifera | |
| CN101851622B (en) | Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof | |
| US20210198670A1 (en) | Method for knocking out n-myristoyltransferase (nmt) gene from eimeria tenella | |
| CN101457233B (en) | Method for constructing chlorella expression vector, converting chlorella and breaking wall of chlorella | |
| WO2023174305A1 (en) | Development of rna-targeted gene editing tool | |
| CN102229940B (en) | Method for knocking out target gene of Chlamydomonas reinhardtii | |
| Xie et al. | Characterization of VdASP F2 secretory factor from Verticillium dahliae by a fast and easy gene knockout system | |
| CN113862226B (en) | Dicer gene knockout BHK-21 cell line | |
| Khan et al. | Genetically modified sugarcane for biofuels production: Status and perspectives of conventional transgenic approaches, RNA interference, and genome editing for improving sugarcane for biofuels | |
| WO2019014917A1 (en) | Gene editing system and method for editing plant genome by using same | |
| Zhang et al. | CRISPR/dCas9-mediated gene silencing in two plant fungal pathogens | |
| Liu et al. | Safe-Harbor-Targeted CRISPR/Cas9 System and Cmhyd1 Overexpression Enhances Disease Resistance in Cordyceps militaris | |
| CN103224950A (en) | Construction method of aspergillus flavus genetic transformation expression carrier | |
| Cheng et al. | Genomics insights into different cellobiose hydrolysis activities in two Trichoderma hamatum strains | |
| CN112351680A (en) | Plants with improved digestibility and marker haplotype | |
| JP7428459B2 (en) | Euglena genome modification method and Euglena breeding method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130508 Termination date: 20151220 |
|
| EXPY | Termination of patent right or utility model |