CN102229940A - Method for knocking out target gene of Chlamydomonas reinhardtii - Google Patents
Method for knocking out target gene of Chlamydomonas reinhardtii Download PDFInfo
- Publication number
- CN102229940A CN102229940A CN 201010620522 CN201010620522A CN102229940A CN 102229940 A CN102229940 A CN 102229940A CN 201010620522 CN201010620522 CN 201010620522 CN 201010620522 A CN201010620522 A CN 201010620522A CN 102229940 A CN102229940 A CN 102229940A
- Authority
- CN
- China
- Prior art keywords
- carrier
- pmd
- gene
- chlamydomonas reinhardtii
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of bioengineering and in particular relates to a method for knocking out a target gene of Chlamydomonas reinhardtii. The method comprises the following step of constructing a vector pMCS-SPA-MCS and a vector pTSBIR-XIR. According to the invention, the purpose of silencing the target gene of Chlamydomonas reinhardtii is achieved by screening a transformant which exerts a silencing effect on the candidate gene, utilizing the restriction enzyme cutting sites of the vector pMCS-SPA-MCS and constructing a vector pXF-SPA-XR to construct the vector pTSBIR-XIR for the target gene RNAi. The method has the characteristics of increasing the efficiency of knocking out the target gene and being convenient to operate and rapid.
Description
Technical field
The invention belongs to technical field of bioengineering, be specifically related to a kind of utilize intermediate carrier can be fast, precise and high efficiency carries out reticent knockout technique at the Chlamydomonas reinhardtii target gene.
Background technology
Chlamydomonas reinhardtii belongs to Chlorophyta, volvocales, chlamydomonas section, it is a kind of unicellular eucaryon Flagellatae, it is the model animals of the multiple vital movement of research (as photosynthesis, flagellum assembling, phototaxis, the regulation and control of cell cycle and cell recognition etc.), with yeast cell many common features are arranged, simple as growth cycle, growth is fast, generation time is short, can on flat board, form mono-clonal, also can carry out liquid culture, with monoploid and two kinds of form growths of diploid, can carry out tetrads analysis etc. to the growth course of its gamete.The title that " photosynthetic yeast " therefore arranged.Its genetic background is clear, is at present unique biomaterial of setting up nucleus, chloroplast(id) and plastosome three cover genetic transformation systems.
Chlamydomonas reinhardtii is as the common ancestor of plant and animal, and its genome can provide important information for the evolution of multicellular organism.Nearly 15000 genes of Chlamydomonas reinhardtii, by the Chlamydomonas reinhardtii genome plan, scientists has obtained the sequence of Chlamydomonas reinhardtii genomic 95%.Chlamydomonas reinhardtii genome and other known genome are relatively found Chlamydomonas reinhardtii and human have 45% gene and flowering plant and have 62% gene.This explanation has general significance to the research of Chlamydomonas reinhardtii.
Chlamydomonas reinhardtii structural genomics and expressed sequence tag plan finish that research for the reverse genetics of Chlamydomonas reinhardtii provides may.RNA disturbs the strong instrument as functional genomics research, extensive application and obtained remarkable effect in fungi, plant, fruit bat, vertebrates such as low and mammiferous research.(RNA interference, RNAi) phenomenon is meant that (double strand RNA, dsRNA) the specificity degraded takes place mRNA in Jie Dao the cell, finally causes corresponding PTGS for endogenous or exogenous double-stranded RNA in the RNA interference.Characteristics such as it is fast and convenient, highly versatile, target height have demonstrated very strong superiority in the research that gene function is identified.It is a kind of gene silencing phenomenon that is caused by double-stranded RNA of finding in nematode the earliest that RNA disturbs, no matter studies confirm that afterwards is long double-stranded RNA (dsRNA) or bobby pin RNA (small hairpin RNA, shRNA), all to be processed into the little RNA of functional two strands---the siRNA (small interfering RNA) of 21 base length at last by Dicer.SiRNA combines with the associated protein prime factor that comprises Argonaute in tenuigenin and forms the RISC complex body, by base pairing identification target RNA, in the presence of magnesium ion and ATP, Argonaute albumen utilizes its endonuclease activity cutting target RNA of complete complementary pairing with it, generation has the mRNA fragment of 5 ' phosphate and 3 ' C-terminal, makes it to be more vulnerable to the attack of 5 ' or 3 ' exonuclease and degraded fast.This mechanism promptly is that usually said RNA disturbs.Yet, knocking out of candidate gene also just is in the starting stage by the RNAi technology with regard to Chlamydomonas reinhardtii.Exist the unstable that gene is pounded out.Promptly in the transgenosis colony that changes the RNAi carrier, a part is pounded out target gene by the RNAi effect, and another part is not then pounded out target gene for various reasons.This is very unfavorable for research work.
Summary of the invention
The purpose of this invention is to provide a kind of Chlamydomonas reinhardtii target gene knockout technique, the transformant that candidate gene is had reticent effect by screening, utilize the restriction enzyme site of intermediate carrier pMD285 self, inverted repeats by the establishing target gene comes establishing target gene RNAi carrier pTSBIR-XIR, thereby realize the Chlamydomonas reinhardtii target gene is carried out silence, have target gene is knocked out efficient height, characteristics such as easy and simple to handle, quick.
The technology used in the present invention principle:
Selection has the reporter gene of lethal effect: tryptophane enzyme beta subunit (Tryptophan synthase β-subunit, TSB) gene.Its activity in vivo and principle of work are as follows:
Tryptophane synthetic enzyme a subunit (TSA) activity:
Tryptophane enzyme beta (TSB) subunit activity:
After adding 5-Fluoroindole in the substratum:
On the basis of clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit (TSB) gene, the inverted repeats of TSB (tryptophane enzyme beta subunit) and the inverted repeats of candidate gene are cascaded, place Ble gene 3 ' the non-coding region zone of RbcS-Ble expression cassette then, simultaneously, introduce the HSP70/RbcS-aphIII expression cassette of paramaciny resistance, as the transgenosis selective marker.Like this, in transgenic progeny colony, by detecting tryptophane enzyme beta subunit inverted repeats (TSB-IR) the reticent effect (positive transformant can be grown) of target gene is screened the transformant (Fig. 1, target gene knock out efficient and reach more than 90%) that candidate gene is had reticent effect on the substratum that contains tryptophane and 5-fluoro indole.
The inverted repeats that makes up goal gene by intermediate carrier pMD285 has the advantage of the following aspects:
1, easy, quick.The structure of target gene inverted repeats carrier can utilize the restriction enzyme site of intermediate carrier pMD285 self, cut and be connected the inverted repeats that just can build target gene by twice enzyme, cut with once being connected by an EcoRI enzyme again and just can build target gene RNAi carrier pTSBIR-XIR.Connection with respect to flush end has simple, fast characteristics.
2, need not order-checking.The target gene fragment is inserted on the pMD of the TAKARA company serial carrier (Fig. 2) by TA clone's mode, because the structure of this carrier is just cut, is connected such directed cloning by enzyme and do not relate to and be easy to generate sudden change round pcr etc., therefore need not order-checking in the vector construction process subsequently, this has also just solved inverted repeats this difficult problem that can not check order.
3, economy.What the enzyme that utilizes intermediate carrier pMD285 to make up the whole process of RNAi carrier pTSBIR-XIR carrier was cut usefulness all is the restriction endonuclease of using always, has enzyme and cuts efficient height, cheap.The ligase enzyme that whole process is used is T4 ligase enzyme, good economy performance.
The technical solution adopted in the present invention:
A kind of Chlamydomonas reinhardtii target gene knockout technique method comprises the structure of intermediate carrier pMD285 and RNAi carrier pTSBIR-XIR.
1, the structure of intermediate carrier pMD285
Based on the pMD-18T Simple of TAKARA company carrier, by designing synthetic multiple clone site and transcribed spacer sequence, insert pMD-18T Simple carrier at last, (MD represents that this plasmid comes from the pMD of TAKARA company series to obtain intermediate carrier pMD285; 285 meanings are that to add the transcribed spacer sequence be 285bp to artificial synthetic multiple clone site; P represents plasmid).
The design of A, multiple clone site
The restriction enzyme site commonly used at the pMD serial carrier T cloning site two ends that the TAKARA company of selecting the laboratory to use always produces is as the restriction enzyme site at intervening sequence two ends.
Choosing of B, intervening sequence
With inertia in the strain of transgene receptor algae is principle, and a fragment choosing the one section 180bp no homology in the Chlamydomonas reinhardtii genome on the pCAMBIA1302 is as intervening sequence.
C, two ends have the synthetic of multiple clone site intervening sequence
The intervening sequence that the two ends that design is had multiple clone site entrusts Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to synthesize, and institute's calling sequence is seen Fig. 3.Simultaneously, the intervening sequence that has a multiple clone site for two ends designs a pair of primer:
MCSF：5’-CGCAGAATTCTGCAGATATC-3’
MCSR：5’-GGTCGAATTCCAGCACACTG-3’
Purpose be method by PCR with this sequence clone to pMD-18T Simple carrier.
Choosing of D, cloning vector
Choose pMD-18T Simple as cloning vector.
The intervening sequence that E, two ends have multiple clone site inserts pMD-18T Simple
Utilize primer (MCSF:5 '-CGCAGAATTCTGCAGATATC-3 ', MCSR:5 '-GGTCGAATTCCAGCACACTG-3 ') carries out pcr amplification, reclaim the PCR product and connect pMD-18T Simple carrier, connect product and transform DH5 α cell, extract plasmid and then obtain the pMD285 intermediate carrier.
2, the structure of RNAi carrier pTSBIR-XIR
The fragment of A, clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit (TSB) gene 3 ' end non-coding region 450bp.Pass through primer
(TBSF:GCACTGTGCTTTGACAGACAAG; TBSR:CGATTGGTAGCAACAAAGTGAGT), pcr amplification obtains TBS gene inverted repeats, inserts carrier S P124S Ble gene 3 ' end non-coding region zone respectively, obtains containing the intermediate carrier of TBS inverted repeats.
B, aphVIII gene expression cassette is downcut from the pSI103 carrier with SacI/KpnI, mend flatly, be connected into the intermediate carrier that step 1 obtains, (TSB is the english abbreviation of tryptophane enzyme beta subunit to obtain RNAi carrier pTSBIR-XIR (Fig. 1); IR is the abbreviation of English inverted repeats; X represents target gene, and P represents plasmid).
Beneficial effect of the present invention:
1, on the basis of clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit (TSB) gene, the inverted repeats of TSB and the inverted repeats of candidate gene are cascaded, place Ble gene 3 ' the non-coding region zone of RbcS-Ble expression cassette then, simultaneously, introduce the HSP70/RbcS-aphIII expression cassette of paramaciny resistance, as the transgenosis selective marker.Like this, in transgenic progeny colony, by detecting tryptophane enzyme beta subunit inverted repeats (TSB-IR) the reticent effect (positive transformant can be grown) of target gene is screened the transformant that candidate gene is had reticent effect on the substratum that contains tryptophane and 5-fluoro indole, make target gene knock out efficient and reach more than 90%.
2, utilize the restriction enzyme site of intermediate carrier pMD285 self, cut with just being connected by twice enzyme and can build the target gene inverted repeats, cut with once being connected by an EcoRI enzyme again and just can build target gene RNAi carrier pTSBIR-XIR.The connection that relates in the whole process all is sticking terminal connection, has easy and simple to handle, characteristics efficiently with respect to the connection of flush end.
Description of drawings
The synoptic diagram of Fig. 1, RNAi carrier pTSBIR-XIR (a) and intermediate carrier pMD285 (b).Wherein, B, BamHI; E, EcoRI; H, HindIII; K, KpnI; S, SalI; Xb, XbaI; Xh, XhoI.
Fig. 2 pMD18-T Vector synoptic diagram shows multiple clone site.
Fig. 3, intermediate carrier pMD285 multiple clone site and interval region sequence.
Fig. 4, plasmid pRSEP1F-SPA-MCS HindIII and XbaI double digestion are identified figure.
Fig. 5, RNAi carrier pTSBIR-RSEP1 IR EcoRI enzyme are cut evaluation figure.
Fig. 6 .pTSBIR-RSEP1IR transforms the detection case of Chlamydomonas reinhardtii and reporter gene ARS.
The horizontal Real time of the mRNA pcr analysis result of Fig. 7 transgenic alga strain Rsep1 gene.1:C.reinhardtii CC124; 2～6: change pTSBIR-RSEP1IR carrier algae strain RSEP1RNAi7, RSEP1RNAi36, RSEP1RNAi71, RSEP1RNAi103, RSEP1RNAi138.
Embodiment
The present invention is described in further detail below in conjunction with example.
Embodiment
To pounding out of Chlamydomonas reinhardtii rsep1 (Protein ID:206032) gene.
1, design forward and reverse primer:
RSEP1-347BP-3UCS-F：GTCGCGGCTTGTTTTACAAT
RSEP1-347BP-3UCS-R：CCTCCTGTTATTTCCCAGCA
With Chlamydomonas reinhardtii CC124 cDNA is template, the nucleotide fragments of its 3 ' end non-coding region 347bp length that increases.Fragment is inserted the pMD-18T carrier of Takara company through reclaiming.Recombinant vectors carries out sequence relatively with the sequence comparison software that NCBI provides after order-checking, the dna fragmentation of determining the clone is the nucleotide fragments of rsep1 gene 3 ' end non-coding region 347bp length.Obtain this segmental cloning vector pMD-RSEP1.
2, with HindIII and XbaI double digestion pMD-RSEP1, rsep1 gene 3 ' end non-coding region 347bp fragment is inserted the intermediate carrier pMD285 through HindIII and XbaI double digestion after reclaiming; After the two connects, transformed into escherichia coli, recon obtains carrier pRSEP1F-SPA-MCS (Fig. 4) after HindIII and the evaluation of XbaI double digestion.
3, with KpnI and SalI double digestion pMD-RSEP1,347bp rsep1 gene 3 ' end non-coding region fragment is inserted the carrier pRSEP1-SPA-MCS through KpnI and SalI double digestion after reclaiming; After the two connected, transformed into escherichia coli, recon obtained carrier pRSEP1F-SPA-RSEP1R after enzyme is cut evaluation.
4, the pRSEP1F-SPA-RSEP1R carrier is cut with the EcoRI enzyme, is connected with the RNAi carrier pTSBIR-XIR that cuts through same EcoRI enzyme.Transformed into escherichia coli obtains RSEP1 RNAi carrier pTSBIR-RSEP1IR.Cut evaluation (Fig. 5) with the EcoRI enzyme.
5, the RNAi carrier transforms and screening
Adopt glass beads method to transform Chlamydomonas reinhardtii CC-124.Get and be cultured to cell log algae in vegetative period liquid 50ml, the centrifugal 5min of 4000r/min abandons supernatant.With the resuspended precipitation of 600 μ lTAP liquid nutrient mediums, make cell concn reach 2 * 10
8Cell/ml.Cell transfer adds granulated glass sphere in another centrifuge tube, 20%PEG8000 and pTSBIR-RSEP1IR are provided with pTSBIR-XIR in addition as the negative contrast of transgenosis.Upright vibration is 20 seconds on the vortex vibrator.Cell transfer places shaking table to the TAP liquid nutrient medium, at 25 ℃, and 120r/min, the 24h full exposure, shaking culture is spent the night under the culture condition of intensity of illumination 1000-1500lux.Centrifugal, collecting cell, evenly be applied to contain 1.2% agar the TAP solid medium on (containing 1.5mM L-tryptophane, 5ug/ml paromycin, 5uM 5-FI), put incubator, at 25 ℃, 24h full exposure, the culture condition of intensity of illumination 2000-2500lux are inverted down and are cultivated 7-8d, picking mono-clonal (Fig. 6).
6, the reticent effect of Real-time pcr analysis target gene RSEP1
Get C.reinhardtii CC-124 wild-type, the total RNA of frustule is extracted in strain of pTSBIR-XIR transgenic alga and the strain of picked at random pTSBIR-RSEP1IR transgenic alga.Dnase I handles above-mentioned extracting RNA, pollutes to remove DNA, and the RNA after the processing detects and electrophoresis detection with spectrophotometer.SuperScript by Invitrogen
TMIII Reverse Transcriptase synthesizes cDNA first chain.Template as Real-time PCR.18SrDNA is with reference to primer: QRT-18s-F:CGAACTTCTGCGAAAGCAT; QRT-18s-R:TCAGCCTTGCGACCATACT.Real-time PCR response procedures: 95 ℃ of pre-sex change 10s; The PCR reaction: 5s/95 ℃, 25s/55 ℃, 40Cycles; Melt curve analysis is analyzed: 10s/55 ℃, and 5 ℃/s, 95 ℃ of end.Quantitative fluorescent PCR The data 2
-Δ Δ ctMethod is analyzed.The result as shown in Figure 7.The rna level of target gene rsep1 descends greatly.
Claims (1)
1. a Chlamydomonas reinhardtii target gene knockout technique method is characterized in that: the structure that comprises pMCS-SPA-MCS carrier and pTSBIR-XIR carrier;
1), the structure of intermediate carrier pMD285
Based on the pMD-18T Simple of TAKARA company carrier, by designing synthetic multiple clone site and transcribed spacer sequence, insert pMD-18T Simple carrier at last, obtain intermediate carrier pMD285;
The design of A, multiple clone site
The restriction enzyme site commonly used at the pMD serial carrier T cloning site two ends that the TAKARA company of selecting the laboratory to use always produces is as the restriction enzyme site at intervening sequence two ends;
Choosing of B, intervening sequence
With inertia in the strain of transgene receptor algae is principle, and a fragment choosing the one section 180bp no homology in the Chlamydomonas reinhardtii genome on the pCAMBIA1302 is as intervening sequence;
C, two ends have the synthetic of multiple clone site intervening sequence
The intervening sequence that the two ends that design is had multiple clone site entrusts Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to synthesize institute's calling sequence such as sequence table＜400〉1; Simultaneously, the intervening sequence that has a multiple clone site for two ends designs a pair of primer:
MCSF：5’-CGCAGAATTCTGCAGATATC-3’
MCSR：5’-GGTCGAATTCCAGCACACTG-3’
Method by PCR with this sequence clone to pMD-18T Simple carrier;
Choosing of D, cloning vector
Choose pMD-18T Simple as cloning vector;
The intervening sequence that E, two ends have multiple clone site inserts pMD-18T Simple
Utilize primer
MCSF：5’-CGCAGAATTCTGCAGATATC-3’
MCSR：5’-GGTCGAATTCCAGCACACTG-3’
Carry out pcr amplification, reclaim the PCR product and connect pMD-18T Simple carrier, connect product and transform DH5 α cell, extract plasmid and then obtain the pMD285 intermediate carrier;
2), the structure of RNAi carrier pTSBIR-XIR
The fragment of A, clone's look Chlamydomonas reinhardtii tryptophane enzyme beta subunit gene 3 ' end non-coding region 450bp; Pass through primer
TBSF：GCACTGTGCTTTGACAGACAAG；TBSR：CGATTGGTAGCAACAAAGTGAGT
Pcr amplification obtains TBS gene inverted repeats, inserts carrier S P124S Ble gene 3 ' end non-coding region zone respectively, obtains containing the intermediate carrier of TBS inverted repeats;
B, aphVIII gene expression cassette is downcut from the pSI103 carrier, mend flatly, be connected into the intermediate carrier that step 1 obtains, obtain RNAi carrier pTSBIR-XIR with SacI/KpnI.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010620522 CN102229940B (en) | 2010-12-20 | 2010-12-20 | Method for knocking out target gene of Chlamydomonas reinhardtii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010620522 CN102229940B (en) | 2010-12-20 | 2010-12-20 | Method for knocking out target gene of Chlamydomonas reinhardtii |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102229940A true CN102229940A (en) | 2011-11-02 |
| CN102229940B CN102229940B (en) | 2013-05-08 |
Family
ID=44842545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010620522 Expired - Fee Related CN102229940B (en) | 2010-12-20 | 2010-12-20 | Method for knocking out target gene of Chlamydomonas reinhardtii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102229940B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105296516A (en) * | 2014-07-15 | 2016-02-03 | 中国农业科学院棉花研究所 | DsRNA expression vector and application |
| CN106978432A (en) * | 2017-03-09 | 2017-07-25 | 中国科学院水生生物研究所 | Knock out carrier construction method and the application of chlamydomonas endogenous gene and expression alien gene |
| CN110689923A (en) * | 2018-07-04 | 2020-01-14 | 赛业（广州）生物科技有限公司 | Automatic parallelization knockout strategy sequence repeatability analysis method and system thereof |
-
2010
- 2010-12-20 CN CN 201010620522 patent/CN102229940B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 《The Plant Journal》 20041130 Jennifer Rohr，Heriberto Cerutti et al., "Tandem inverted repeat system for selection of effective transgenic RNAi strains in Chlamydomonas" pages 611-621 1 第40卷, 第4期 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105296516A (en) * | 2014-07-15 | 2016-02-03 | 中国农业科学院棉花研究所 | DsRNA expression vector and application |
| CN106978432A (en) * | 2017-03-09 | 2017-07-25 | 中国科学院水生生物研究所 | Knock out carrier construction method and the application of chlamydomonas endogenous gene and expression alien gene |
| CN106978432B (en) * | 2017-03-09 | 2019-11-15 | 中国科学院水生生物研究所 | Knock out carrier construction method and the application of chlamydomonas endogenous gene and expression alien gene |
| CN110689923A (en) * | 2018-07-04 | 2020-01-14 | 赛业（广州）生物科技有限公司 | Automatic parallelization knockout strategy sequence repeatability analysis method and system thereof |
| CN110689923B (en) * | 2018-07-04 | 2022-05-17 | 广州赛业百沐生物科技有限公司 | Automatic parallelization knockout strategy sequence repeatability analysis method and system thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102229940B (en) | 2013-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wei et al. | RNA i‐based targeted gene knockdown in the model oleaginous microalgae Nannochloropsis oceanica | |
| CN106480036B (en) | A kind of DNA fragmentation and its application with promoter function | |
| WO2019120310A1 (en) | Base editing system and method based on cpf1 protein | |
| CN106086062A (en) | A kind of tomato dna group that obtains pinpoints the method knocking out mutant | |
| Lebrigand et al. | Comparative genomic analysis of Drechmeria coniospora reveals core and specific genetic requirements for fungal endoparasitism of nematodes | |
| CN103842511A (en) | Methods for producing a complex transgenic trait locus | |
| CN109161480B (en) | Preparation method and gene knockout method of protoplast of phomopsis | |
| CN109694872A (en) | The method of controlling gene expression | |
| Bhadauria et al. | Reverse genetics for functional genomics of phytopathogenic fungi and oomycetes | |
| US20190169653A1 (en) | Method for preparing gene knock-in cells | |
| US20230357788A1 (en) | Enhanced disease resistance of crops by downregulation of repressor genes | |
| US20210198670A1 (en) | Method for knocking out n-myristoyltransferase (nmt) gene from eimeria tenella | |
| CN101457233B (en) | Method for constructing chlorella expression vector, converting chlorella and breaking wall of chlorella | |
| CN102229940B (en) | Method for knocking out target gene of Chlamydomonas reinhardtii | |
| WO2022268135A1 (en) | Screening and use of new type crispr-cas13 proteins | |
| Bucknell et al. | That's no moon, it's a Starship: Giant transposons driving fungal horizontal gene transfer | |
| Zaman et al. | Engineering plants using diverse CRISPR-associated proteins and deregulation of genome-edited crops | |
| CN113862226B (en) | Dicer gene knockout BHK-21 cell line | |
| WO2019014917A1 (en) | Gene editing system and method for editing plant genome by using same | |
| CN103224950B (en) | Construction method of aspergillus flavus genetic transformation expression carrier | |
| Liu et al. | Safe-Harbor-Targeted CRISPR/Cas9 System and Cmhyd1 Overexpression Enhances Disease Resistance in Cordyceps militaris | |
| Wei et al. | Commercialization and supervision policies of gene edited crops in china and other main countries | |
| Li et al. | Common strategies in silkworm disease resistance breeding research | |
| CN113151354B (en) | Vector for conditional knockout of target gene and method for conditional knockout of target gene | |
| Lopez et al. | Modulating pathway performance by perturbing local genetic context |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130508 Termination date: 20151220 |
|
| EXPY | Termination of patent right or utility model |