CN103088046A - Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point - Google Patents
Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point Download PDFInfo
- Publication number
- CN103088046A CN103088046A CN2013100262584A CN201310026258A CN103088046A CN 103088046 A CN103088046 A CN 103088046A CN 2013100262584 A CN2013100262584 A CN 2013100262584A CN 201310026258 A CN201310026258 A CN 201310026258A CN 103088046 A CN103088046 A CN 103088046A
- Authority
- CN
- China
- Prior art keywords
- gene
- mstn
- zfns
- cell
- bovine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for knocking out a ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating an exogenous gene at the fixed point. The method comprises the following steps of: designing a specific locus expression vector of the ZFNs according to a bovine MSTN gene sequence; designing a target vector according to an acting site of the ZFNs, wherein the target vector contains the exogenous gene and can be integrated into a host genome; and transferring the expression vector and the target vector into a bovine fibroblast to obtain a cell for knocking out the bovine MSTN gene and integrating the exogenous gene at the fixed point. The DNA sequence acting on the designed specific ZFNs is located on the exon of the bovine MSTN gene. The constructed ZFNs-mediated target vector provides a way for easily and quickly knocking out the bovine MSTN gene and inserting the exogenous gene at the fixed point and has an important value to the genetic breeding of the new double-muscle bovine variety.
Description
Technical field
The present invention relates to biology field, specifically, relate to a kind of ox MSTN gene knockout of ZFNs mediation and the method for targeted exogenous gene integration.
Background technology
Myogenesis statin (MSTN) belongs to the TGF-beta superfamily, is the negative regulatory factor that Skeletal Muscle Growth is grown, and the forfeiture of its activity or reduction can cause the Overgrowth of animal muscle, and form " two flesh " (double muscle).Occurring in nature has many animals that this pair of kuhne's phenomenon arranged, and comprises pig, dog, ox, and even the people also has this proterties to occur.In the livestock of natural seed selection, Belgian Blue ox (Belgian Blue) and Piemonte ox (piedmontese) are typical two flesh animals.Both all undergone mutation by the MSTN gene and cause, the former has lacked 11bp Nucleotide in the 3rd exon of MSTN sequence, causes the MSTN reading frame to undergo mutation, and the MSTN albumen of generation can not be brought into play its biological activity; Sudden change has all occured in latter in first exon and the 3rd exon, its mutation type is Substitution, make that in the MSTN albumen that translates, a leucine sports phenylalanine, a cysteine mutation is tyrosine, finally caused MSTN albumen inactivation (Kambadur, Sharma etc., 1997).The Biology Breeding work that is found to be of MSTN gene provides new thinking.The people such as McPherron in 1997 have obtained the mouse model of MSTN gene knockout, and find that this mouse of the same age increases by 30% than wild-type mice on body weight, and in adult rats, this phenotype is not subjected to the impact (McPherron of age and sex, Lawler etc., 1997).At present, lack the kind of this " two flesh " in domestic beef breed, if can obtain the beef breed of this MSTN mutant, can improve the beef cattle quality of China, increase the income of beef cattle feeding.
Can obtain MSTN mutant beef cattle by the conventional breeding mode, but this technology seed selection speed is slow, character inheritance is unstable.Gene targeting is that a kind of that development in recent years is got up modifies, revises cytogenetics information, the transgenic technology that perhaps foreign gene is imported, after obtaining the cell of gene targeting, by somatic cell nuclear transfer technique and embryo transfer technology, can finally obtain the transgenic animal individuality again.This method can obtain individuality with genetic stability proterties in one to two generation, greatly improved the speed of animal improvement and seed selection.Traditional gene targeting efficient approximately 10
-7, efficient is lower, and needs through multimedia screening, and the cell generation that finally obtains is high, and cell state is poor.In recent years, the investigator combines the zinc fingers (Zinc finger) of specific recognition DNA sequence dna with the nuclease of Non-specific cleavage DNA chain, developed to refer to the zinc that genomic a certain specificity site is identified and cut ribozyme (Zinc finger nuclease).The gene-splicing that is referred to the ribozyme mediation by zinc has higher efficient, can reach 10
-2Level, and zinc refers to that the homologous recombination efficiency of ribozyme mediation is higher than traditional target practice technology.At present, this technology is widely used in plant, nematode, fish, birds, and in the genetic modification of mammalian cell and genetically modified experimental study.And for ox MSTN gene knock out and practice shooting on report is not yet arranged.
Long-chain unsaturated fatty acid ω-3 in fish oil has been proved the health that is beneficial to man.Include the ω-3 in a bit and a sup (cereal) source and a large amount of ω-6 in the animal meat product, the ω of high-content-6th, the one of the main reasons that causes coronary sclerosis, cancer, diabetes, sacroiliitis and dysthymia disorders to occur.ω-6 can not be changed into ω-3 owing to lacking the fatty acid desaturase gene in family's carcass, and have the fat-1 gene of exercising this transformation function in the lower animal nematode.With the hfat-1 gene of nematode fat-1 gene after humanization is modified, change mouse and pig over to, in the muscle of transgenic mice and pig, ω-3 can be increased to 5 times with the ratio of ω-6 as a result.Recently, report and successfully cultivated the fat-1 transgenic dairy, but have no report in the research of fat-1 transgenosis beef cattle.
Utilize zinc to refer to that ribozyme knocks out beef cattle MSTN gene, refer to that at zinc the research of ribozyme cleavage site site-directed integration hfat-1 gene has no report simultaneously.
Summary of the invention
The purpose of this invention is to provide a kind of ox MSTN gene knockout of ZFNs mediation and the method for targeted exogenous gene integration (as the hfat-1 gene).
In order to realize the object of the invention, the ox MSTN gene knockout of a kind of ZFNs mediation of the present invention and the method for targeted exogenous gene integration, it is according to ox myostatin gene sequence, design ZFNs specific site expression vector, and contain foreign gene according to ZFNs action site design and can be integrated into targeting vector in host genome, then above-mentioned expression vector and targeting vector are changed in the inoblast of ox jointly, obtain that the ox myostatin gene knocks out and the cell of targeted exogenous gene integration; Wherein, design special zinc finger protein nuclease ZFNs, the DNA sequence dna of its effect is positioned on the exon of ox MSTN gene.
Aforesaid method, the DNA sequence dna of ZFNs effect are preferably placed on the exon 2 and/or the 3rd exon of ox MSTN gene.
Aforesaid method, the DNA sequence dna of ZFNs effect is: CTCATCAAACCCATGAAAGACGGTACAAGGTATACTGG and/or TTCCCAGAACCAGGAGAAGATGGACTGGTA.
Aforesaid method, described targeting vector contain ox MSTN gene 5 ' homology arm and the 3 ' homology arm of with good grounds ZFNs action site design.
Aforesaid method, described foreign gene are fatty acid desaturase fat-1 gene, or the gene (hfat-1 gene) after the modification of fat-1 gene process humanization.
Preceding method comprises the steps:
Scheme I:
1) build bZFN-1 and bZFN-2 expression vector, their base sequence is respectively as shown in SEQ ID NO:1 and SEQ ID NO:2;
2) according to the ZFNs action site build contain foreign gene and can be integrated into targeting vector pflrk-1 in host genome, its base sequence is as shown in SEQ ID NO:5;
3) above-mentioned expression vector and targeting vector are changed in the inoblast of ox jointly, checking order by the PCR product, detection ox myostatin gene knocks out and the cell of targeted exogenous gene integration; And/or
Scheme II:
1) build bZFN-3 and bZFN-4 expression vector, their base sequence is respectively as shown in SEQ ID NO:3 and SEQ ID NO:4;
2) according to the ZFNs action site build contain foreign gene and can be integrated into targeting vector pflrk-2 in host genome, its base sequence is as shown in SEQ ID NO:6;
3) above-mentioned expression vector and targeting vector are changed in the inoblast of ox jointly, checking order by the PCR product, detection ox myostatin gene knocks out and the cell of targeted exogenous gene integration.
The present invention also provides the ox myostatin gene that obtains according to aforesaid method to knock out and the cell of targeted exogenous gene integration.
The present invention also provides the application of aforesaid method in the clened cows of producing ox MSTN gene knockout and targeted exogenous gene integration.
The present invention also provides a kind of method for preparing the ox clone embryos of ox MSTN gene knockout and targeted exogenous gene integration, its take above-mentioned ox myostatin gene knock out and the cell of targeted exogenous gene integration as the nuclear transplantation donorcells, the ovocyte that exsomatizes is the nuclear transplantation recipient cell, obtains the ox clone embryos by nuclear transfer technology.
The present invention also provides a kind of method for preparing transgenic cattle, and it is that the clone embryos that will prepare by aforesaid method moves into by Nonoperative method and carries out gestation in cattle uterus, obtains transgenic cattle.
particularly, the present invention obtains MSTN full length DNA sequence from GenBank, refer to the ribozyme carrier for Second Exon design two cover zinc, difference called after bMK-I and bMK-II, wherein bMK-I comprises bZFN-1, two plasmids of bZFN-2, bMK-II comprises bZFN-3 and two plasmids of bZFN-4 (being completed by Sigma-Aldrich company), method by the liposome cotransfection, two cover zinc are referred to that the ribozyme carrier imports respectively in different bovine fetal fibroblasts, picking is unicellular again sets up a plurality of unicellular strains, same cell strain is divided into two portions, go down to posterity respectively with frozen, the cell strain that goes down to posterity is extracted genome, use is increased across the PCR detection primer of action site, the amplified production evaluation of checking order, finally obtain referring to the ribozyme action site cell strain of undergoing mutation at zinc.
obtain genomic dna from bovine fibroblasts, according to the MSTN full length sequence of reporting in GenBank, design respectively the homology arm primer that refers to the ribozyme action site for zinc, go out homology arm by pcr amplification, by connecting cloning vector and carrying out that restriction enzyme cuts and after order-checking is accredited as correct sequence, adopt enzyme to cut and with the method that is connected, 5 ' homology arm and 3 ' homology arm are connected respectively to the desired location of carrier is carrier pCAGG-hfat-1-BGHpA, cut by restriction enzyme the exactness of identifying homology arm at last, final obtain for the targeting vector pflrk-1 of bMK-I action site and for the targeting vector pflrk-2(building process of bMK-II action site referring to Fig. 1 and Fig. 2).
The encoding sequence of MSTN gene is conservative at the evolution camber, and whole gene comprises 3 exons and 2 introns, wherein second main region that exon is coding MSTN albumen.The MSTN gene of ox is positioned at chromosomal nearly centromere distance TGLA44(microsatellite marker No. 2, and ms) 3.1cM position comprises 6628 bases, and 3 exons lay respectively at 1-506,2335-2708 and 4741-6628 position.Two cover zinc of design refer to that ribozyme carrier bMK-I and bMK-II comprise CMV promotor ZFN gene and the kalamycin resistance gene (Kan for ox MSTN Second Exon sequence
r).The action site of bMK-I is CTCATCAAACCCATGAaagacggTACAAGGTATACTGG, be positioned at the ox MSTN gene 2487-2524bp shown in SEQ ID NO:7, the action site of bMK-II is that TTCCCAGAACcaggaGAAGATGGACTGGTA is positioned at the ox MSTN gene 2682-2711bp shown in SEQ ID NO:7, lowercase partly refers to the cutting position of ribozyme for zinc, capitalization partly refers to recognition site for zinc.Two action sites all are positioned at the Second Exon of MSTN gene.
Carrier is carrier pCAGG-hfat-1-BGHpA comprises humanization fat-1 gene under the CAGG promotor and the neomycin resistance gene (Neo under the PGK promotor
r), and neomycin resistance is expressed the LoxP site of framework both sides.Its nucleotide sequence is as shown in SEQ ID NO:8.
Targeting vector pflrk-1 provided by the invention is the targeting vector for the bMK-I action site, comprises the 5 ' homology arm of long 885bp in CAGG promotor upstream, is positioned at the 1603-2487 shown in SEQ ID NO:7, at Neo
rExpression framework downstream comprises the 3 ' homology arm of long 823bp, is positioned at the ox MSTN gene 2520-3342bp shown in SEQ ID NO:7.The homology arm sequence is positioned at bMK-I action site both sides, and the zinc that does not comprise bZFN-1 and bZFN-2 refers to recognition site.Its complete sequence is as shown in SEQ ID NO:5.When pflrk-1 and bMK-I cotransfection cell, bMK-I shears at recognition site, and through the homologous recombination effect, genome is take pflrk-1 as template, and the foreign gene targeted integration is regional to purpose.
The homology arm primer of above-mentioned pflrk-1 carrier comprises two groups of the upstream primer of 5 ' homology arm and 3 ' homology arm and downstream primers.Concrete sequence following (5 '-3 '):
5 ' homology arm upstream primer: LH-1U:ACGCGTATCCTGGAATAGATTTGCCTTACT
5 ' homology arm downstream primer: LH-1D:ACGCGTGGATTTGCACAAACACTGTCGC
3 ' homology arm upstream primer: RH-1U:GCTAGCATCCGATCTCTGAAACTTGAC
3 ' homology arm downstream primer: RH-1D:GCTAGCTTTTAATTTTACCAGGGGTAATT
Targeting vector pflrk-2 provided by the invention is the targeting vector for the bMK-II action site, comprises the 5 ' homology arm of long 885bp in CAGG promotor upstream, is positioned at the ox MSTN gene 17 99-2682bp shown in SEQ ID NO:7, at Neo
rExpression framework downstream comprises the 3 ' homology arm of long 826bp, is positioned at the ox MSTN gene 2707-3532bp shown in SEQ ID NO:7.The homology arm sequence is positioned at bMK-II action site both sides, and the zinc that does not comprise bZFN-3 and bZFN-4 refers to recognition site.Its complete sequence is as shown in SEQ ID NO:6.When pflrk-2 and bMK-II cotransfection cell, bMK-II shears at recognition site, and through the homologous recombination effect, genome is take pflrk-2 as template, and the foreign gene targeted integration is regional to purpose.
The homology arm primer of above-mentioned pflrk-2 carrier comprises two groups of the upstream primer of 5 ' homology arm and 3 ' homology arm and downstream primers.Concrete sequence following (5 '-3 '):
5 ' homology arm upstream primer: LH-2U:ACGCGTTGTCCCAGCGTCCTAACATAACA
5 ' homology arm downstream primer: LH-2D:ACGCGTCAGCAAGATCATGGCCATTCTC
3 ' homology arm upstream primer: RH-2U:GCTAGCGTGATTACTGAAAATAACATGC
3 ' homology arm downstream primer: RH-2D:GCTAGCGAAGAGTGAGTAGCTCTAAAC
MSTN gene knockout method provided by the invention comprises the following steps:
1, the cultivation of bovine fibroblasts;
2, utilize the method for liposome transfection that bMK-I and bMK-II are transfected into respectively in the bovine fibroblasts of cultivating in step 1;
3, utilize the mouth suction pipe of diameter 10 μ m, genome is extracted in picking cell monoclonal and the cultivation of going down to posterity in the bovine fibroblasts of transfection from step 2;
4, utilize PCR method to carry out specific amplification to the genome in step 3, identify that by the method for order-checking obtaining the positive knocks out cell;
5, the positive of obtaining in step 4 is knocked out cell and carry out enlarged culturing, and further utilize primers designed to carry out pcr amplification, check order after connection carrier and compare of analysis, the final details that obtain sudden change.
Wherein, the PCR primer that uses in step 4 is (5 '-3 '):
Sudden change detects upstream primer: 61:GATTGATATGGAGGTGTTCGTT
Sudden change detects downstream primer: 62:ACTAGAATCCACTGTGAAGACT
The PCR reaction conditions is: 95 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations.
The main construction step of targeting vector pflrk-1 for the bMK-I action site provided by the invention is as follows:
A, extraction bovine fibroblasts genomic dna;
B, utilize primer LH-1U and LH-1D, the 5 ' homology arm of clone MSTN in the genomic dna from steps A utilizes the 3 ' homology arm of clone MSTN in primer RH-1U and the RH-1D genomic dna from steps A;
C, homology arm is connected in cloning vector, carries out restriction endonuclease analysis and sequencing analysis and identify;
D, will identify that correct homology arm is connected in carrier is carrier, build the targeting vector pflrk-1 that obtains for the bMK-I action site.
Wherein, adopt the reaction conditions of PCR method amplification 5 ' homology arm to be in step B: 95 ℃ of sex change 30s, 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations; The reaction conditions of 3 ' homology arm is: 5 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations.
Provided by the invention similar to pflrk-1 with the main construction step of the targeting vector pflrk-2 in site for bMK-II, wherein the primer in step B is the 5 ' homology arm of LH-2U and LH-2D clone MSTN, utilizes the 3 ' homology arm of primer RH-2U and RH-2D clone MSTN; After being connected into skeleton carrier, build the targeting vector pflrk-2 that obtains for the bMK-II action site, wherein the reaction conditions of 5 ' homology arm is: 95 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations; The reaction conditions of 3 ' homology arm is: 5 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations.
G418(Geneticin selective antibiotic418) be a kind of antibiotics, work as Neo
rAfter gene entered cell, cell obtained resistance, and can grow in the G418 substratum, and did not obtain cells death in the G418 substratum of resistance.This characteristic of G418 is in aspect widespread uses such as transgenic technology, gene knockouts.
Gene knockout method provided by the invention, utilize liposome-mediated transfection method, import to respectively bMK-I and bMK-II in bovine fetal fibroblast, entering carrier after cell expresses respectively zinc and refers to ribozyme, zinc refers to that ribozyme is made of the Zinc finger domain of specific recognition DNA sequence dna and nonspecific DNA shear constitution territory two portions, zinc refer to ribozyme can be in cell the specific recognition target site, and in this site, DNA is sheared, form double-strand break, and start the self-regeneration mechanism of DNA.DNA can pass through two kinds of different approach reparations, and the first is homologous recombination, and the DNA of damage can be take allelotrope as template, DNA plerosis damage, and the DNA that this repair mode produces and original as broad as long can not undergo mutation; Another kind of is the reparation of non-homology end, and the DNA of damage repairs the DNA that ruptures at random not take other allelotrope as template, and this repair mode can produce base deletion or the insertion mutation of DNA, finally causes the sudden change of gene.BMK-I and bMK-II for the different sequences of the Second Exon of MSTN gene, can produce the DNA double splitting of chain for the site at it respectively, cause the reparation of DNA, and produce sudden change.Unicellular with mouthful suction pipe picking to the cell after transfection, be seeded in respectively in 96 orifice plates, through going down to posterity and extracting genome, the performing PCR of going forward side by side amplification and sequencing analysis finally obtain the clone of undergoing mutation.
The present invention also provides a kind of method of gene targeting, utilize liposome-mediated transfection method, jointly import to bMK-I and pflrk-1, bMK-II and pflrk-2 in bovine fetal fibroblast respectively, zinc refers to that ribozyme cuts the generation double-strand break in target site to DNA, genome arrives target site take targeting vector as template with exogenous origin gene integrator when carrying out the homology reparation.Foreign gene is with Neo
r, cell is survived in containing the nutrient solution of G418, after the process screening of G418, the picking cell monoclonal is through the method that PCR detects and checks order, the clone that obtains practicing shooting.Integrated simultaneously the cell of foreign gene, its MSTN gene is because the insertion of foreign gene, can not correction MSTN albumen, reach simultaneously the purpose that knocks out the MSTN gene.
The present invention further provides zinc and refer to that the gene knockout of ribozyme mediation and gene targeting are in the application of cultivating the beef cattle kind.
The present invention has following advantages and beneficial effect at least:
(1) compare with conventional homologous recombination method, zinc of the present invention refers to that the gene knockout efficient of ribozyme mediation significantly improves.
(2) can realize that different foreign genes insert in the fixed point in same site.
(3) can be used for the MSTN gene knockout of different ox kinds.
(4) can not introduce resistant gene in the genetic breeding process, guarantee breeding safety.
Description of drawings
Fig. 1 is pflrk-1 vector construction schema in the embodiment of the present invention 1.
Fig. 2 is pflrk-2 vector construction schema in the embodiment of the present invention 1.
Fig. 3 is the gene targeting process schematic diagram of ZFN mediation in the embodiment of the present invention 1.
Fig. 4 is MSTN DNA homolog arm pMD19-T-LA-1 and pMD19T-LA-2 carrier cleavage map in the embodiment of the present invention 4; Wherein, M1 is DNA molecular amount standard 100bp ladder(Transgen company); M2 is DNA molecular amount standard 200bp ladder(Takara company); 1-3 cuts result from the enzyme of the pMD19-T-LA-2 plasmid of 3 different bacterium colonies, and wherein 1,2 swimming lanes generation sizes are the fragment of 213bp and 3363bp, and it is the fragment of 737bp and 2839bp that 3 swimming lanes produce sizes; 4-6 cuts result from the enzyme of the pMD19-T-LA-1 plasmid of 3 different bacterium colonies, and wherein 4,6 swimming lanes generation sizes are the fragment of 542pb and 3035bp, and it is the fragment of 409pb and 3168bp that 5 swimming lanes produce sizes; 7-9 cuts result from the enzyme of the pMD19-T-RA-2 plasmid of 3 different bacterium colonies, and wherein 7,9 swimming lanes generation sizes are 608bp and 2910bp fragment, and it is 297bp and 3221bp fragment that 8 swimming lanes produce sizes; 10-12 cuts result from the enzyme of the pMD19-T-RA-1 plasmid of 3 different bacterium colonies, wherein 10 swimming lanes generation sizes are 418bp and 3097bp fragment, it is 484bp and 3031bp fragment that 11 swimming lanes produce size, 12 swimming lanes have produced two fragments at the small segment place, and size is respectively 484bp and 418bp(may be by bacterium colony single causing not).
Fig. 5 is that intermediate carrier pfl-1 in the embodiment of the present invention 5, pfl-2 enzyme are cut evaluation figure; Wherein, M1 is DNA molecular amount standard λ-HindIII digest(Takara company); M2 is DNA molecular amount standard λ-EcoT14I digest(Takara company); M3 is DNA molecular amount standard 200bp ladder(Takara company); 1-2 is the pfl-1 plasmid enzyme restriction result from 2 different bacterium colonies, and producing size is the fragment of 4692bp, 2263bp, 1277bp and 682bp, is homology arm forward connection result; 3-5 is the pfl-2 plasmid enzyme restriction result from 3 different bacterium colonies, wherein 3 swimming lanes generation sizes are 5020bp, 1934bp, 1277bp and 682bp fragment, be homology arm Opposite direction connection result, it is 4496bp, 2458bp, 1277bp and 682bp fragment that 4 and 5 swimming lanes produce size
Fig. 6 is targeting vector pflrk-1 in the embodiment of the present invention 6, pflrk-2 cleavage map; Wherein, M1 is DNA molecular amount standard Trans5K DNA Marker(TransGen company); M2 is DNA molecular amount standard λ-HindIII digest(Takara company); 1-3 is the pflrk-1 plasmid enzyme restriction result from 3 different bacterium colonies, and wherein 1 is an enzyme slitting band, illustrates that plasmid is incorrect, and 2 and 3 generation sizes are the endonuclease bamhi of 1788bp and 7943bp; 4-6 is the pflrk-2 plasmid enzyme restriction result from 3 different bacterium colonies, all produces size and is the fragment of 3661bp, 2263bp, 1851bp, 1277bp, 628bp.
Fig. 7 is targeting vector pflrk-1 in the embodiment of the present invention 8, pflrk-2 cleavage map; Wherein, M is DNA molecular amount standard λ-HindIII digest(Takara company); 1 is the pflrk-1 plasmid; 2 is the pflrk-2 plasmid; 3 is linearizing pflrk-1 plasmid, and the product size is 9731bp; 4 is linearizing pflrk-2 plasmid, and the product size is 9734bp.
Embodiment
Following examples are used for explanation the present invention, but are not used for limiting the scope of the invention.If do not specialize, the conventional means that in embodiment, technique means used is well known to those skilled in the art, the raw materials used commercial goods that is.
The structure of embodiment 1 ZFN expression vector
obtain MSTN full length DNA sequence from GenBank, refer to the ribozyme carrier for Second Exon design two cover zinc, difference called after bMK-I and bMK-II, wherein bMK-I comprises bZFN-1, two plasmids of bZFN-2, bMK-II comprises bZFN-3 and two plasmids of bZFN-4 (being completed by Sigma-Aldrich company), method by the liposome cotransfection, two cover zinc are referred to that the ribozyme carrier imports respectively in different bovine fetal fibroblasts, picking is unicellular again sets up a plurality of unicellular strains, same cell strain is divided into two portions, go down to posterity respectively with frozen, the cell strain that goes down to posterity is extracted genome, use is increased across the PCR detection primer of action site, the amplified production evaluation of checking order, finally obtain referring to the ribozyme action site cell strain of undergoing mutation at zinc.
obtain genomic dna from bovine fibroblasts, according to the MSTN full length sequence of reporting in GenBank, design respectively the homology arm primer that refers to the ribozyme action site for zinc, go out homology arm by pcr amplification, by connecting cloning vector and carrying out that restriction enzyme cuts and after order-checking is accredited as correct sequence, adopt enzyme to cut and with the method that is connected, 5 ' homology arm and 3 ' homology arm are connected respectively to the desired location of carrier is carrier pCAGG-hfat-1-BGHpA, cut by restriction enzyme the exactness of identifying homology arm at last, finally obtain for the targeting vector pflrk-1 of bMK-I action site and see Fig. 1 and Fig. 2 for the targeting vector pflrk-2(building process of bMK-II action site).
The encoding sequence of MSTN gene is conservative at the evolution camber, and whole gene comprises 3 exons and 2 introns, wherein second main region that exon is coding MSTN albumen.The MSTN gene of ox is positioned at chromosomal nearly centromere distance TGLA44(microsatellite marker No. 2, and ms) 3.1cM position comprises 6628 bases, and 3 exons lay respectively at 1-506,2335-2708 and 4741-6628 position.Two cover zinc of design refer to that ribozyme carrier bMK-I and bMK-II comprise CMV promotor ZFN gene and the kalamycin resistance gene (Kan for ox MSTN Second Exon sequence
r).The action site of bMK-I is CTCATCAAACCCATGAaagacggTACAAGGTATACTGG, be positioned at the ox MSTN gene 2487-2524bp shown in SEQ ID NO:7, the action site of bMK-II is that TTCCCAGAACcaggaGAAGATGGACTGGTA is positioned at the ox MSTN gene 2682-2711bp shown in SEQ ID NO:7, lowercase partly refers to the cutting position of ribozyme for zinc, capitalization partly refers to recognition site for zinc.Two action sites all are positioned at the Second Exon of MSTN gene.
Carrier is carrier pCAGG-hfat-1-BGHpA comprises humanization fat-1 gene under the CAGG promotor and the neomycin resistance gene (Neo under the PGK promotor
r), and neomycin resistance is expressed the LoxP site of framework both sides.Its nucleotide sequence is as shown in SEQ ID NO:8.
Targeting vector pflrk-1 provided by the invention is the targeting vector for the bMK-I action site, comprises the 5 ' homology arm of long 885bp in CAGG promotor upstream, is positioned at the 1603-2487 shown in SEQ ID NO:7, at Neo
rExpression framework downstream comprises the 3 ' homology arm of long 823bp, is positioned at the ox MSTN gene 2520-3342bp shown in SEQ ID NO:7.The homology arm sequence is positioned at bMK-I action site both sides, and the zinc that does not comprise bZFN-1 and bZFN-2 refers to recognition site.Its complete sequence is as shown in SEQ ID NO:5.When pflrk-1 and bMK-I cotransfection cell, bMK-I shears at recognition site, and through the homologous recombination effect, genome is take pflrk-1 as template, and the foreign gene targeted integration is regional to purpose.
Targeting vector pflrk-2 provided by the invention is the targeting vector for the bMK-II action site, comprises the 5 ' homology arm of long 885bp in CAGG promotor upstream, is positioned at the ox MSTN gene 17 99-2682bp shown in SEQ ID NO:7, at Neo
rExpression framework downstream comprises the 3 ' homology arm of long 826bp, is positioned at the ox MSTN gene 2707-3532bp shown in SEQ ID NO:7.The homology arm sequence is positioned at bMK-II action site both sides, and the zinc that does not comprise bZFN-3 and bZFN-4 refers to recognition site.Its complete sequence is as shown in SEQ ID NO:6.When pflrk-2 and bMK-II cotransfection cell, bMK-II shears at recognition site, and through the homologous recombination effect, genome is take pflrk-2 as template, and the foreign gene targeted integration is regional to purpose.The gene targeting process schematic diagram of ZFN mediation as shown in Figure 3.
The embodiment 2 genomic extractions of bovine fetal fibroblast
After the cell dissociation that is incubated in the 100mm culture dish; Wizard Genomic DNA Purification Kit test kit (Promega company) is adopted in centrifugal collection, according to the method for extracting cellular genome; carry out cow genome group DNA extraction, use at last 100 μ L ultrapure water back dissolving DNA.Utilize UV spectrophotometer measuring to extract concentration and the purity of DNA, be used for follow-up work.
The structure of embodiment 3 MSTN DNA homolog arm pMD19-T-LA-1 and pMD19T-LA-2, pMD19-T-RA-1 and pMD19T-RA-2
According to Accession No.NC_007300.5 in template sequence GenBank, design respectively the upstream primer LH-1U(for the 5 ' homology arm (being positioned at the 1609-2481bp of SEQ ID NO:1) of bMK-I site targeting vector
ACGCGTATCCTGGAATAGATTTGCCTTACT) and downstream primer LH-1D(
ACGCGTGGATTTGCACAAACACTGTCGC); Upstream primer RH-1U(for the 3 ' homology arm (being positioned at the 2526-3336bp of SEQ ID NO:7) of bMK-I site targeting vector
GCTAGCATCCGATCTCTGAAACTTGAC) and downstream primer RH-1D(
GCTAGCTTTTAATTTTACCAGGGGTAATT); Upstream primer LH-2U(for the 5 ' homology arm (being positioned at the 1805-2676bp of SEQ ID NO:7) of bMK-II site targeting vector
ACGCGTTGTCCCAGCGTCCTAACATAACA) and downstream primer LH-2D(
ACGCGTCAGCAAGATCATGGCCATTCTC); Upstream primer RH-2U(for the 3 ' homology arm (being positioned at the 2713-3526bp of SEQ ID NO:7) of bMK-I site targeting vector
GCTAGCGTGATTACTGAAAATAACATGC) and downstream primer RH-2D(
GCTAGCGAAGAGTGAGTAGCTCTAAAC); Underscore is partly restriction enzyme site.Take above-mentioned cow genome group DNA as template, carry out respectively the synthetic homology arm of PCR.
PCR reaction system (20 μ L): each 1 μ L of upstream and downstream primer, template 1 μ L, 10 * reaction, 2 μ L, 2.5mMdNTPs 1.6 μ L, EX-Taq 0.2 μ L, ddH
2O 13.2 μ L.
5 ' homology arm PCR reaction conditions for bMK-I site targeting vector is: 95 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations; The reaction conditions of 3 ' homology arm is: 5 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations.
5 ' homology arm PCR reaction conditions for bMK-II site targeting vector is: 95 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations; The reaction conditions of 3 ' homology arm is: 5 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations.
The PCR product that obtains after amplification is connected respectively on pMD19-T carrier (Takara company), Transformed E .coli DH5 α, the positive bacterium colony that connects of picking spreads cultivation and plasmid extraction respectively, finally obtains pMD19-T-LA-1 and pMD19T-LA-2, pMD19-T-RA-1 and four kinds of homology arm plasmids of pMD19T-RA-2.
The enzyme of embodiment 4 homology arms is cut and is identified and sequencing analysis
Extract respectively each 1 μ L of four kinds of homology arm plasmids, utilize restriction enzyme EcoRI to carry out enzyme and cut evaluation, two EcoRI restriction enzyme sites are arranged in four kinds of homology arm plasmids, a multiple clone site that is arranged in the pMD19-T carrier, another one is positioned at homology arm inside, the exactness (Fig. 4) of the homology arm that can Preliminary detection PCR obtains.The enzyme system of cutting is 10 μ L: homology arm plasmid 1 μ L, 10 * Buffer1 μ L, restriction endonuclease 0.5 μ L, ddH
2O7.5 μ L.Enzyme is cut identified that correct plasmid carries out the DNA sequencing analysis, and compare with the ox MSTN gene order in GenBank, finally determine the exactness of homology arm sequence.
Embodiment 55 ' homology arm is connected into carrier is carrier
homology arm plasmid pMD19-T-LA-1 and pMD19-T-LA-2 that order-checking is correct, and carrier is carrier pCAGG-hfat-1-BGHpA carries out enzyme with restriction enzyme MluI respectively and cuts, enzyme is cut system such as front, reclaim respectively the 879bp fragment of pMD19-T-LA-1 and the 879bp fragment of pMD19-T-LA-2, and the linearizing fragment of skeleton carrier, then with pMD19-T-LA-1 and pMD19-T-LA-2 respectively with pCAGG-hfat-1-BGHpA according to the ratio of mol ratio 2:1 under 16 ℃ of conditions, through the connection of spending the night of T4DNA ligase enzyme, Transformed E .coli, extract plasmid called after pfl-1 and pfl-2 respectively.Utilize restriction enzyme EcoRI enzyme to cut and identify direction and the exactness (Fig. 5) that connects, and determine that finally 5 ' homology arm correctly is connected into carrier is carrier.
Embodiment 63 ' homology arm is connected into carrier is carrier
pMD19-T-RA-1 and pMD19T-RA-2 that order-checking is correct, and intermediate carrier pfl-1 and pfl-2 carry out enzyme with restriction enzyme NheI respectively and cut, enzyme is cut system such as front, reclaim respectively the 817bp fragment of pMD19-T-RA-1 and the 820bp fragment of pMD19-T-RA-2, and the linearizing fragment of intermediate carrier pfl-1 and pfl-2, then with pMD19-T-RA-1 and intermediate carrier pfl-1, pMD19-T-RA-2 and intermediate carrier pfl-2 respectively according to the ratio of mol ratio 2:1 under 16 ℃ of conditions, through the connection of spending the night of T4DNA ligase enzyme, Transformed E .coli, extract plasmid called after pflrk-1 and pflrk-2 respectively.Utilize respectively restriction enzyme HindIII to be connected with the EcoRI enzyme and identify direction and the exactness (Fig. 6) that connects, and determine that finally 3 ' homology arm correctly is connected into carrier.The final targeting vector that successfully obtains to be directed to respectively bMK-I and bMK-II action site.
The Luxi Yellow cattle fetal fibroblast is passaged to respectively in a plurality of holes of 24 orifice plates, density is 6 * 10
4Individual/hole, 38.5 ℃, 5%CO
2Cultivate in the cell culture incubator of condition and be used for liposome transfection after 24 hours.At first 800ng plasmid DNA (bZFN-1400ng+bZFN-2400ng or bZFN-3400ng+bZFN-4400ng) is used Opti-MEM substratum (Invitrogen, Cat.31985) be diluted to 100 μ L, the liposome LTX(Invitrogen that adds again 2 μ L, Cat.15338) gently after mixing, standing 30 minutes of room temperature.The nutrient solution for the treatment of the cell of transfection is changed to Opti-MEM, then liposome LTX-DNA mixture is evenly dripped in the cell cultures hole.In 38.5 ℃, 5%CO
2Hatch 4-6 hour under condition, then cell culture fluid is replaced by the DMEM+10%FBS nutrient solution.After cell cultures 24 hours, cell dissociation is resuspended in PBS, uses under stereoscopic microscope from the donsole suction pipe and draw individual cells, be inoculated in respectively in 96 orifice plates that contain 200 μ L nutrient solution/holes and cultivate, and in the 3rd day, the 5th day and the 8th day, culture plate is changed liquid.During the cell monoclonal of growing in culture plate in the time of the 10th day is passaged to 24 orifice plates, continue to cultivate after 3-5 days, a cell monoclonal part is frozen, and another part extracts genome and identifies.
Classify template as with ox MSTN genome sequence, the design gene knockout detects the PCR primer, utilizes PCR method and DNA sequencing to detect the cellular genome sudden change.The PCR primer is (5 '-3 '):
Sudden change detects upstream primer: 61:GATTGATATGGAGGTGTTCGTT
Sudden change detects downstream primer: 62:ACTAGAATCCACTGTGAAGACT
The PCR reaction conditions is: 95 ℃ of sex change 30s, and 54 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35 circulations.The PCR product that amplifies is directly checked order, if refer to two amplified signals of ribozyme action site place's generation at zinc, produce Double-peak Phenomenon in the order-checking collection of illustrative plates, can be defined as the producer sudden change.Further this primer amplification of use, and the PCR product that will increase is connected in the pMD19-T carrier, Transformed E .coli, 10 bacterial colonys of picking, and wealthy training checks order, and sequencing result and wild-type MSTN genome are compared, and finally can determine the mutation type of mutant.And then with the donor of mutant cells as body-cell neucleus transplanting, carry out bovine somatic cells clone and embryo transfer, obtain the MSTN Gene Knock-Out Animal Model.
Cut targeting vector pflrk-1 and pflrk-25 hour with restriction enzyme BstBI in 65 ℃ of enzymes, with its linearization process (Fig. 7), get bovine fetal fibroblast, respectively with combination 1(bMKI+pflrk-1) and combination 2(bMKII+pflrk-2) mixing, electric shock transfectional cell (transfection conditions: cell density 1.5 * 10
5Individual/mL, volume 150 μ L, plasmid content 2.5 μ g, wherein zinc refers to each 1 μ g of ribozyme plasmid, targeting vector 1 μ g in the 4mm pole cup, with the 500V voltage 4ms electric shock time, shocks by electricity 2 times), the cell after transfection is seeded in a hole of 6 orifice plates and cultivates.Added G418 to carry out drug screening in 48 hours after transfection, after screening the 7th day, cell dissociation is resuspended in PBS, uses under stereoscopic microscope from the donsole suction pipe and draw individual cells, be inoculated in respectively in 96 orifice plates that contain 200 μ L nutrient solution/holes and cultivate, and in the 3rd, 5 and 8 day, culture plate is changed liquid.During the cell monoclonal of growing in culture plate in the time of the 10th day is passaged to 24 orifice plates, continue to cultivate after 3-5 days, a cell monoclonal part is frozen, and another part extracts genome and identifies.
Take genome karyomit(e) site-directed integration sequence as template, the PCR primer of 5 ' homology arm sequence is crossed in design, utilizes PCR method and DNA sequencing to detect the homologous recombination event.The primer following (5 '-3 ') that pcr amplification uses:
RATKU：CGATGCCTGCTTGCCGAATA
RATKD：AGGAAGGTAGAGGGATGAAGATAGTGG
The PCR reaction conditions is: 95 ℃ of sex change 30s, and 60 ℃ of annealing 30s, 72 ℃ are extended 1.5min, totally 35 circulations.
When the sequence that detects comprises MSTN gene 5 ' homology arm upstream sequence, 5 ' homology arm sequence and hfat-1 gene simultaneously, can amplify the purpose band, after detecting correctly through order-checking, think that this cell is middle target cell, foreign gene hfat-1 successfully is incorporated into target site.With the donor of this cell as body-cell neucleus transplanting, carry out bovine somatic cells clone and embryo transfer, finally obtain the MSTN gene knockout, and the transgenic animal of integrative gene expression hfat-1 gene.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements, all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (10)
1.ZFNs the ox MSTN gene knockout of mediation and the method for targeted exogenous gene integration, it is characterized in that, it is according to ox myostatin gene sequence, design ZFNs specific site expression vector, and contain foreign gene according to ZFNs action site design and can be integrated into targeting vector in host genome, then above-mentioned expression vector and targeting vector are changed in the inoblast of ox jointly, obtain that the ox myostatin gene knocks out and the cell of targeted exogenous gene integration; Wherein, design special zinc finger protein nuclease ZFNs, the DNA sequence dna of its effect is positioned on the exon of ox MSTN gene.
2. method according to claim 1, is characterized in that, the DNA sequence dna of ZFNs effect is positioned on the exon 2 and/or the 3rd exon of ox MSTN gene.
3. method according to claim 2, is characterized in that, the DNA sequence dna of ZFNs effect is: CTCATCAAACCCATGAAAGACGGTACAAGGTATACTGG and/or TTCCCAGAACCAGGAGAAGATGGACTGGTA.
4. method according to claim 1, is characterized in that, described targeting vector contains ox MSTN gene 5 ' homology arm and the 3 ' homology arm of with good grounds ZFNs action site design.
5. according to claim 1-4 described methods of any one, is characterized in that, described foreign gene is fatty acid desaturase fat-1 gene, or the gene after the modification of fat-1 gene process humanization.
6. method according to claim 5, is characterized in that, comprises the steps:
Scheme I:
1) build bZFN-1 and bZFN-2 expression vector, their base sequence is respectively as shown in SEQ ID NO:1 and SEQ ID NO:2;
2) according to the ZFNs action site build contain foreign gene and can be integrated into targeting vector pflrk-1 in host genome, its base sequence is as shown in SEQ ID NO:5;
3) above-mentioned expression vector and targeting vector are changed in the inoblast of ox jointly, checking order by the PCR product, detection ox myostatin gene knocks out and the cell of targeted exogenous gene integration; And/or
Scheme II:
1) build bZFN-3 and bZFN-4 expression vector, their base sequence is respectively as shown in SEQ ID NO:3 and SEQ ID NO:4;
2) according to the ZFNs action site build contain foreign gene and can be integrated into targeting vector pflrk-2 in host genome, its base sequence is as shown in SEQ ID NO:6;
3) above-mentioned expression vector and targeting vector are changed in the inoblast of ox jointly, checking order by the PCR product, detection ox myostatin gene knocks out and the cell of targeted exogenous gene integration.
7. the ox myostatin gene that obtains of according to claim 1-6 described methods of any one knocks out and the cell of targeted exogenous gene integration.
8. the application of the described method of claim 1-6 any one in the clened cows of producing ox MSTN gene knockout and targeted exogenous gene integration.
9. method for preparing the ox clone embryos of ox MSTN gene knockout and targeted exogenous gene integration, its take the described ox myostatin gene of claim 7 knock out and the cell of targeted exogenous gene integration as the nuclear transplantation donorcells, the ovocyte that exsomatizes is the nuclear transplantation recipient cell, obtains the ox clone embryos by nuclear transfer technology.
10. method for preparing transgenic cattle, it is that clone embryos with the described method preparation of claim 9 moves into by Nonoperative method and carries out gestation in cattle uterus, the acquisition transgenic cattle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100262584A CN103088046A (en) | 2013-01-18 | 2013-01-18 | Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100262584A CN103088046A (en) | 2013-01-18 | 2013-01-18 | Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103088046A true CN103088046A (en) | 2013-05-08 |
Family
ID=48201175
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013100262584A Pending CN103088046A (en) | 2013-01-18 | 2013-01-18 | Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103088046A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671080A (en) * | 2016-03-04 | 2016-06-15 | 内蒙古大学 | CRISPER-Cas9-system-mediated sheep MSTN (myostatin) gene knock-out and exogenous gene site-specific integration method |
| CN106119203A (en) * | 2015-05-08 | 2016-11-16 | 内蒙古大学 | The milk goat fibroblast gene knockout of TALENs mediation and the method for gene site-directed insertion |
| CN106399361A (en) * | 2015-07-30 | 2017-02-15 | 聂凌云 | Method for screening mitochondria genome editing tool targeting target sequence |
| CN107034221A (en) * | 2017-06-02 | 2017-08-11 | 内蒙古大学 | A kind of number of base missing myostatin gene that can be expressed in Mice Body and application |
| CN107217074A (en) * | 2017-04-06 | 2017-09-29 | 中山大学 | A kind of method that utilization ZFN realizes multiple large fragment DNA site-directed integrations in mammalian cell |
| CN109321600A (en) * | 2018-10-19 | 2019-02-12 | 中国农业大学 | A kind of method and its application of ox that cultivating production low irritability milk |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6194167B1 (en) * | 1997-02-18 | 2001-02-27 | Washington State University Research Foundation | ω-3 fatty acid desaturase |
| CN102260711A (en) * | 2011-06-24 | 2011-11-30 | 北京济福霖生物技术有限公司 | Method for knocking out bovine myostatin gene by using zinc finger nuclease |
-
2013
- 2013-01-18 CN CN2013100262584A patent/CN103088046A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6194167B1 (en) * | 1997-02-18 | 2001-02-27 | Washington State University Research Foundation | ω-3 fatty acid desaturase |
| CN102260711A (en) * | 2011-06-24 | 2011-11-30 | 北京济福霖生物技术有限公司 | Method for knocking out bovine myostatin gene by using zinc finger nuclease |
Non-Patent Citations (2)
| Title |
|---|
| DONG ZHANGJI ET AL: "Heritable targeted inactivation of myostatin gene in yellow catfish(Pelteobagrus fulvidraco) using engineered zinc finger nucleases", 《PLOS ONE》 * |
| 赵丽华等: "牛肌肉生长抑制素基因敲除打靶载体的构建", 《中国农业科学》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119203A (en) * | 2015-05-08 | 2016-11-16 | 内蒙古大学 | The milk goat fibroblast gene knockout of TALENs mediation and the method for gene site-directed insertion |
| CN106399361A (en) * | 2015-07-30 | 2017-02-15 | 聂凌云 | Method for screening mitochondria genome editing tool targeting target sequence |
| CN105671080A (en) * | 2016-03-04 | 2016-06-15 | 内蒙古大学 | CRISPER-Cas9-system-mediated sheep MSTN (myostatin) gene knock-out and exogenous gene site-specific integration method |
| CN105671080B (en) * | 2016-03-04 | 2020-01-31 | 内蒙古大学 | Method for sheep MSTN gene knockout and site-specific integration exogenous gene mediated by CRISPR-Cas9 system |
| CN107217074A (en) * | 2017-04-06 | 2017-09-29 | 中山大学 | A kind of method that utilization ZFN realizes multiple large fragment DNA site-directed integrations in mammalian cell |
| CN107217074B (en) * | 2017-04-06 | 2021-07-02 | 中山大学 | Method for realizing site-specific integration of multiple large-fragment DNAs in mammalian cells by using ZFN (zero-forcing transcription) |
| CN107034221A (en) * | 2017-06-02 | 2017-08-11 | 内蒙古大学 | A kind of number of base missing myostatin gene that can be expressed in Mice Body and application |
| CN109321600A (en) * | 2018-10-19 | 2019-02-12 | 中国农业大学 | A kind of method and its application of ox that cultivating production low irritability milk |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106916820B (en) | SgRNA and its application of porcine ROSA 26 gene can effectively be edited | |
| CN104404036B (en) | Conditional gene knockout method based on CRISPR/Cas9 technologies | |
| CN105132427B (en) | A kind of dual-gene method for obtaining gene editing sheep of specific knockdown mediated with RNA and its dedicated sgRNA | |
| CN103088046A (en) | Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point | |
| CN105861554A (en) | Animal sex control method based on Rbmy gene editing and application | |
| CN104745626A (en) | Rapid construction method and applications of conditional gene knockout animal model | |
| CN105671080A (en) | CRISPER-Cas9-system-mediated sheep MSTN (myostatin) gene knock-out and exogenous gene site-specific integration method | |
| CN110643636B (en) | Megalobrama amblycephala MSTNa & b gene knockout method and application | |
| CN110317828A (en) | Modify the method that rice Os SWEET gene promoter cultivates wide spectrum bacterial blight-resisting rice | |
| CN101457233B (en) | Method for constructing chlorella expression vector, converting chlorella and breaking wall of chlorella | |
| CN104293833B (en) | A kind of special targeting vector of Sp110 macrophages and recombinant cell mediated based on TALEN | |
| CN105505879A (en) | Method and culture medium for culturing transgenic animal embryonic cells or transgenic animals | |
| CN106222204A (en) | A kind of method of Monopterus albus (Zuiew) gene editing | |
| CN110257435A (en) | A kind of construction method of PROM1-KO mouse model and its application | |
| CN108949832A (en) | A kind of targeting vector and its application for knock-out pig GHR gene | |
| CN106148406B (en) | Pig ApoE gene knockout carrier and its construction method and application | |
| CN104059877B (en) | Method for preparing 'imitated Belgian blue cattle' myostatin (MSTN) genetype gene editing pig | |
| CN103088044B (en) | Targeting vector for knockout of bovine MSTN gene and application thereof | |
| CN105950622B (en) | The crRNA of specific recognition GS gene and its application | |
| CN102212545B (en) | Method for knocking out cattle beta-lactoglobulin gene by using zinc finger nucleases (ZFNs) | |
| CN103947607A (en) | Construction method of grass carp anti-bacterial septicemia strain | |
| CN103923940A (en) | Site-specific integration method of exogenous genes | |
| CN101412999A (en) | A kind of gene targeting locus-specific transgenic method and application thereof | |
| CN103290045B (en) | Zinc finger nuclease is utilized to knock out the method for Sheep Muscle inhibin gene | |
| CN108949598A (en) | Recombinate the engineering bacteria of Fish leukocyte interleukin -2 and its preparation method of product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130508 |