CN101054557A - Construction of geldanamycin gene engineering high yield strain - Google Patents

Abstract

The present invention relates to geldanamycin high yield engineered bacteria strain construction, It is specificly described as follows: two groups of AHBA synthase gene cluster AHBA-shn gene discovered in water-absorbing streptomyces are destroyed by gene blocking technology due to likely participation in naphthoquinone type ansamycin compound biosynthesis. The present invention increases benzenquinone type GDM precursor (B-AHBA) supply and metabolic flow to promote GDM ferment yield by blocking or reduceing content of naphthoquinone type ansamycin compound precursor (N-AHBA). It proves that block mutant strain promote near 186% in yield to original strain.

Description

The structure of geldanamycin gene engineering high yield strain

Technical field:

The present invention relates to the application of genetic engineering technique in making up the microbiotic superior strain.

Background technology:

Geldanamycin (geldanamycin, GDM) produce bacterium-streptomyces hygroscopicus 17997 (Streptomyces hygrocopicus 17997), be that Inst. of Medicinal Biological Technology, Chinese Academy of Medical Sciences separates [the Chinese microbiotic magazine such as Tao Peizhen that obtains from Chinese soil, 1997,22 (5): 368].Geldanamycin has antitumor and the broad-spectrum disease resistance toxic action.In recent years studies show that GDM can specificity suppresses the function of heat shock protein 90 (Hsp90).Hsp90 is the mate molecule of many signal proteins.GDM is by to the inhibition of Hsp90, can the remote effect cell in the function of signal protein, therefore, GDM is expected to become a kind of very potential antitumor and antiviral.The novel mechanism of action of GDM has determined potential science and the economic worth to its further investigation.The acquisition of low toxicity, efficient GDM derivative also just becomes an important goal of current new drug research naturally.At present, existing two derivative 17-AAG and 17-DMAG that replace in GDM C17 position, carry out II phase and I clinical trial phase [Goetz MP et al J Clin Oncol.2005 in the U.S. in succession, 23 (6): 1078-1087, Glaze ER et al Cancer Chemother Pharmacol.2005,56 (6): 637-647].Therefore, improve the fermentation yield of GDM, have important society and economic benefit for the industrialization of GDM and derivative thereof.At present, Wal, China Jiangsu moral Industrial Co., Ltd. has also entered the GDM industrialization stage.

GDM belongs to benzene AMSA microbiotic.The AMSA microbiotic belongs to a kind of Macrocyclic lactams, all contains an aromatic nucleus (benzoquinones or naphthoquinones) in their structure, and its aliphatic chain is to be attached between two non-conterminous atoms of aromatic nucleus.The aliphatic chain of aromatic nucleus is connected to become macrocyclic structure by amido linkage.All (3-amino-5-hydroxybenzoic acid is AHBA) as start element with 3-amino-5-hydroxy-benzoic acid in the biosynthesizing of AMSA microbiotic aromatic nucleus.

Utilize biotechnology to realize to producing the chromosomal transformation of bacterium, significant for improving the GDM fermentation yield with the derivative that the development chemical process is difficult to obtain.This laboratory once utilized and participated in the biosynthetic initial AHBA of the unit synthase gene of GDM [number of patent application: ZL 02125509.1], produced from it and found and obtain two groups of AHBA biological synthesis gene clusters and chain with it part PKS gene fragment bacterium gene library.By the gene disruption experiment, identified the biosynthetic gene cluster of participation GDM [HE WQ et al.CurrMicrobiol.2006,52 (3): 197-203].The dna homolog analysis revealed, another group AHBA biological synthesis gene cluster (AHBA-shn) is higher than benzoquinones type gene cluster with the homology of naphthoquinones type, points out to contain the antibiotic biological synthesis gene cluster of coding naphthoquinones type AMSA in this generation bacterium.Precursor supply in the microbiotic biosynthesizing often becomes the restrictive factor of fermentation yield.In view of benzoquinones and two kinds of AMSA compounds of naphthoquinones type sharing A HBA as its biosynthetic start element, increase the supply of leading to one of them start element precursor, be expected to improve the output of associated antibiotic.

The objective of the invention is, adopt the gene disruption technology, destruction may participate in the biosynthetic AHBA-shn gene of naphthoquinones type AMSA compound, lead to the amount of synthesizing naphthoquinones type AMSA compound precursor (N-AHBA) by blocking-up or minimizing, strengthen GDM precursor (B-AHBA) supply metabolism stream, to improve the fermentation yield of GDM.

The method of the said employing gene disruption of the present invention technique construction geldanamycin superior strain, not seeing as yet so far has relevant report.

Summary of the invention:

The structure of geldanamycin gene engineering high yield strain provided by the present invention, be according to two groups of AHBA synthase genes in streptomyces hygroscopicus 17997, finding bunch, adopt the gene disruption technology, destruction may participate in the biosynthetic AHBA-shn gene of naphthoquinones type AMSA compound, so that lead to the amount of synthesizing naphthoquinones type AMSA compound precursor (N-AHBA) by blocking-up or minimizing, strengthen benzoquinones type GDM precursor (B-AHBA) supply metabolism stream, to improve the fermentation yield of GDM.For this reason, SOP gene order (the shnS-NCBI AY077756 of the AHBA-shn gene cluster of measuring according to this laboratory, shnO-NCBI AF506521, ShnP-NCBI AF506520) design primer, with streptomyces hygroscopicus 17997 (China Microbial Culture Preservation Commission pharmacy microbial strains preservation center, preserving number CPHCC200178) genome is that template is carried out PCR, obtain fragment respectively with the SOP dna homolog, insert the selectivity resistant gene with corresponding restriction enzyme site therebetween, and be connected with carrier in changing streptomyces hygroscopicus 17997 bacterium over to, transformed into escherichia coli DH5 α, the recombinant vectors of gene disruption is carried out in acquisition.The gene disruption recombinant vectors that makes up is imported in the streptomyces hygroscopicus 17997, and the back of going down to posterity, mono-clonal separate, and according to resistant phenotype, screening obtains homologous gene double exchange blocked mutant.Blocked mutant is verified at dna double exchange the carrying out PCR that gene level takes place.Become the strain fermented liquid and directly carry out the HPLC analysis, the result shows that after the AHBA synthase gene synthetic relevant with naphthoquinones type AMSA compound precursor was blocked in the streptomyces hygroscopicus 17997, the former strain of the rate ratio of geldanamycin GDM had improved 186%.The synthetic of AHBA may be a restrictive factor in streptomyces hygroscopicus 17997, blocks in this bacterium and naphthoquinones type AMSA microbiotic synthesis related gene bunch shn SOP gene, can make AHBA metabolism stream promote the supply of B-AHBA, finally helps the synthetic of GDM.

The invention effect:

The present invention is by homologous gene double exchange interrupter technique; destroy in the streptomyces hygroscopicus 17997 and synthesize relevant AHBA synthase gene with naphthoquinones type AMSA compound precursor; obtained the GDM fermentation yield and improved 186% superior strain, had significant social and an economic benefit for the large-scale production of GDM and derivative thereof.

Description of drawings:

The composition of Figure 1A HBA-shn gene cluster

Wherein: the amino dehydroquinic acid synthase of shnQ-; The shnS-AHBA synthase; The shnO-oxydo-reductase; The shnP-Phosphoric acid esterase; The shnK-kinases; The amino dehydroquinate dehydratase of shnJ-.

Annotate: two open reading frames do not belong to the AHBA gene cluster in the middle of shnK and the shnJ, so do not indicate.

The structure of Fig. 2 naphthoquinones type AHBA gene disruption recombinant vectors

Fig. 3 gene disruption becomes strain PCR product electrophorogram

Wherein: 1-S.hygroscopicus 17997 former strains; 2-Δ SOP blocked mutant;

M1-λ DNA/HindIII molecular weight standard; M2-DNA molecular weight standard III.

Fig. 4 HPLC detects Δ SOP and becomes tiring of strain fermented liquid

Wherein: the former strain of A-;

B-Δ SOP blocked mutant;

Retention time (min) during X-coordinate: HPLC analyzes; Response value during ordinate zou: HPLC analyzes.

Embodiment:

Below listed embodiment be for helping those skilled in the art to understand the present invention better, but do not limit the present invention in any way.

＜embodiment 1〉structure of naphthoquinones type AHBA gene disruption recombinant vectors

Design primer arbitrarily according to shn SOP gene order, extract streptomyces hygroscopicus 17997 genomic dnas, carry out conventional PCR as template with this.Adopt the restriction enzyme site of following primer and design in this experiment, but be not limited to said primer sequence.

Upstream primer: P1 5 '-CCG GAATTCACACTCGCACGTCCAGCC-3 ' has the EcoRI restriction enzyme site;

Downstream primer: P2 5 '-GCG GGTACCGCAGCCAGATGCAGTCGG-3 ' has the KpnI restriction enzyme site; Amplification 1257bp fragment S1.

Upstream primer: P3 5 '-AAAA CTGCAGCTGTGGCTCAGACTGCTGC-3 ' has the PstI restriction enzyme site;

Downstream primer: P4 5 '-CTAG TCTAGATGATGTCGGAAAGTAGCG-3 ' has the XbaI enzyme cutting site; Amplification 1265bp fragment S2.

Designed PCR primer among the present invention is seen Fig. 1 at the corresponding site of naphthoquinones type AHBA gene cluster.

Reclaim PCR product fragment S1 and S2, insert the Am resistant gene with the PstI-KpnI restriction enzyme site therebetween, [derive from plasmid vector pKC1139 (Britain John Innes Centre, Norwich ResearchPark, Colney Norwich R4 7UH)], and with the EcoRI-XbaI restriction enzyme site with can connect at carrier such as the corresponding restriction enzyme site of pGH112 carrier (Institute of Microorganism, Academia Sinica provides, and can provide to the public by normal channel) that streptomyces hygroscopicus transforms.The pGH112 carrier carries thiostrepton, the Tsr resistance).Connect product transformed into escherichia coli DH5 α, extract transformant DNA, cut proof through enzyme and obtain gene disruption carrier pGHEX-shn.Gene disruption vector construction flow process is seen Fig. 2.

＜embodiment 2〉acquisition and the evaluation of gene disruption strain

The screening of gene disruption strain is carried out according to document [Chinese microbiotic magazine such as He Weiqing, 2006,31 (3): 168-171].With the gene disruption carrier pGEX-shn that makes up by carrying out the intestinal bacteria of conjugal transfer with streptomyces hygroscopicus, as intestinal bacteria ET12567/pUZ8002[Britain John InnesCentre, Norwich Research Park, Colney Norwich R4 7UH] import in the streptomyces hygroscopicus 17997, and after in the MY substratum, passing for 3～4 generations, carrying out mono-clonal again separates, according to Tsr and Am resistant phenotype, screen the blocked mutant Δ SOP that obtains through homologous gene double exchange Am resistance, Tsr sensitivity.Δ SOP blocked mutant is carried out the PCR checking in the gene integration level.The genome that becomes strain with former strain and Δ SOP is a template, chooses the check order P5 and the P6 (see figure 1) of the designed primer of row of the S1 that makes up the gene disruption carrier and S2 fragment both wings outward and carries out PCR, the results are shown in Figure 3.The result shows, uses about the about 4kb of primer P5 and the former pnca gene group of P6 PCR product size, and amplify 6kb's nearly in Δ SOP change strain

P5 upstream primer: 5 ' GGCC TCTAGAAGCGCATAGGTTACGA3 ' (XbaI)

P6 downstream primer: 5 ' CTAG TCTAGATGATGTCGGGAAAGTAGCG3 ' (XbaI)

Specific band.PCR result is disclosed between the homologous gene fragment, has inserted the Am resistant gene about 1.5kb, meets expected results.It is very stable that Δ SOP becomes strain Am resistant phenotype in not dosing continuous passage, illustrates that the dna homology reorganization Am resistant gene that double exchange caused has taken place in this change strain really to be inserted, and make shn SOP gene owing to blocking-up is damaged.

＜embodiment 3〉geldanamycin becomes the raising of fermentation yield in the strain at Δ SOP

Δ SOP becomes strain according to document [Chinese microbiotic magazine 2002 such as high group outstanding person, 27 (1): 13～17] described method was carried out fermentation culture 5 days, fermented liquid is centrifugal, directly get 5 μ l fermentation broth samples and use the ShimadzuLC-10Avp high pressure liquid chromatograph, SPD-M10AvP diode-array detector, CLASS-VP workstation carry out HPLC and detect, and adopt methyl alcohol: water=40～100% gradient elution 30min, select wavelength 304nm to detect, the results are shown in Figure 4 and table one.

Table one HPLC detects the fermentation yield of GDM

Bacterial strain	Retention time (min)	Peak area (response area)
			17997 Δ SOP become strain	24.470 24.480	285489 529614

According to the peak area measuring and calculating, the content that Δ SOP becomes Gdm in the strain fermented liquid improves about 186% than 17997 former strains.Explanation is in streptomyces hygroscopicus 17997 former strains, and blocking-up shn SOP gene can obviously improve the Gdm output of bacterial strain.

Claims (2)

1. the structure of geldanamycin gene engineering high yield strain, it is characterized in that by homologous gene double exchange interrupter technique, destroy in the streptomyces hygroscopicus 17997 and synthesize relevant AHBA synthase gene, to obtain the geldanamycin superior strain with naphthoquinones type AMSA compound precursor.

2. construction process as claimed in claim 1, it is characterized in that designing primer arbitrarily according to the SOP gene order of AHBA-shn gene cluster, with streptomyces hygroscopicus 17997 genomes is that template is carried out PCR, obtain fragment respectively with the SOP dna homolog, insert the selectivity resistant gene with corresponding restriction enzyme site therebetween, and be connected with carrier in changing streptomyces hygroscopicus 17997 bacterium over to, transformed into escherichia coli DH5 α obtains to carry out the recombinant vectors of gene disruption; The gene disruption recombinant vectors that makes up is imported in the streptomyces hygroscopicus 17997, and the back of going down to posterity, mono-clonal separate, and according to resistant phenotype, screening obtains homologous gene double exchange blocked mutant; To dna double exchange the carrying out PCR checking that blocked mutant takes place at gene level, the fermented liquid that becomes strain and former strain directly carries out HPLC to be analyzed relatively, proves that the GDM fermentation yield of this blocked mutant is improved significantly.

Images