CN1156467C - 3-deoxy-3-carbonyl-erycin lactone B and its engineeirng strain and application - Google Patents

Abstract

The present invention relates to 3-deoxy-3-carbonyl-erycin lactone B and engineering strains and application thereof, particularly to a macrolide compound, engineering strains for producing the compound and the application of the compound. The compound of the present invention is a compound with a general formula (I). The engineering bacteria of the present invention is saccharopolyspora erythraea CGMCC No0604. The present invention is widely applied to the preparation of ketolide antibiotics.

Description

3-deoxy-3-carbonyl-erycin lactone B, its engineering strain and application

Technical field

The present invention relates to a kind of macrolides compound, the engineering strain of production compound and this application of compound.

Background technology

Erythromycin and derivative thereof are class microbiotic of widespread use clinically.First-generation erythromycin easily for acid degradation and generation resistance, seldom uses.S-generation erythromycin by the chemically modified transformation, can overcome first-generation erythromycin easily by the deficiency of acid degradation as Roxithromycin, clarithromycin, Azythromycin, dirithromycin etc., just be widely used clinically, but still can't overcome this shortcoming of resistance.The third generation erythromycin telithromycin that is now introducing to the market is typical case's representative of ketolide antibiotics, also is to use chemically modified that the erythromycin structure is transformed.The structural maximum characteristics of ketolide antibiotics are at the C-3 position of erythromycin macrolide carbonyl substituted glycosyl.Studies show that ketolide antibiotics is Stability Analysis of Structures not only, and many resistant organisms are had activity.

Summary of the invention

The purpose of this invention is to provide a kind of ketolide antibiotics that can be used as---the compound 3-deoxy-3-carbonyl-erycin lactone B of third generation erythromycin precursor substance, it is the compound of structural formula (I).

This compound can also can be synthesized with chemical process by biosynthesizing.

Second purpose of the present invention provides a kind of red mould of sugared many spores (Saccharopolyspora erythraea) M1 CGMCC № 0604 that can produce said structure formula (I) compound.This bacterial strain is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center August 13 calendar year 2001, and it abbreviates CGMCC as, and deposit number is CGMCC № 0604.

After compound 3-deoxy-3-carbonyl-erycin lactone B process biology and the chemically modified, can become ketolide antibiotics, third generation erythromycin just, so this compound will play an important role in the preparation ketolide antibiotics.

The biosynthetic pathway of erythromycin more clear (Zhang Buchang, Zhao Zhihu, Ma Qingjun.The biosynthetic molecular biology of erythromycin.The biotechnology communication, 2001,12 (2) 151-160), can infer that according to the erythromycin biosynthetic pathway 3-deoxy-3-carbonyl-erycin lactone B biosynthetic pathway of the present invention is as follows:

Existing before this report (Xue Q, Ashley G, Hutchinson CR, et al.A multiplasmidapproach to preparing large libraries of polyketides.Proc Natl Acad Sci US A.1999,96 (21): 11740-5; McDaniel R, Thamchaipenet A, Gustafsson C, et al.Multiple genetic modifications of the erythromycin polyketide synthase toproduce a library of novel " unnatural " natural products.Proc Natl Acad SciUSA.1999,96:1846-51) utilize gene engineering method to synthesize 3-deoxidation-3-carbonyl-6-deoxidation-erythronolide B, but all be to utilize the streptomycete heterologous expression system, the host bacterium is not further modified lactonic ring.The present invention produces in the bacterium at erythromycin erythromycin gene is transformed, not only synthesized 3-deoxidation-3-carbonyl-6-deoxidation-erythronolide B, and endobacillary hydroxylase has synthesized occurring in nature from undiscovered new macrolides compound 3-deoxy-3-carbonyl-erycin lactone B to its further oxidative modification in C-6 position.

With the red mould M1 of the mass spectrometric detection many spores of sugar fermented liquid the time, do not detect 3-deoxidation-3-carbonyl-6-deoxidation-erythronolide B, but 3-deoxy-3-carbonyl-erycin lactone B, illustrate that C-6 position hydroxylase is not strict to the substrate requirement in the red mould of sugared many spores, 3-deoxidation-3-carbonyl-6-deoxidation-erythronolide B almost all can be oxidized to 3-deoxy-3-carbonyl-erycin lactone B.

Below in conjunction with accompanying drawing embodiments of the invention are described further.

Description of drawings

Fig. 1 is that the PCR of intasome identifies.

Fig. 2 is the inhibition test of the red mould Z1 of sugared many spores fermented liquid to Bacillus subtilus.

Fig. 3 is that the PCR of recombinant chou identifies.

Fig. 4 is a Serythraea M1 extracting solution mass spectrum

Embodiment

Substratum, damping fluid and reagent used in the embodiment of the invention are as follows:

The LB substratum is pressed Sambrook method (Sambrook J, Frisch EF and Maniatis T. molecular cloning experiment guide (second edition) (Jin Dongyan, Li Mengfeng etc. translate). Beijing: Science Press, 1992), the TSB substratum is pressed Hopwood method (Hopwood DA, Bibb MJ, Chater KF et al.Genetic manipulation ofstretomyces:a laboratory manual.The John Innes Foundation, England, 1985), the SGGP substratum, PEG3350-T damping fluid and improvement P damping fluid are pressed Yamamoto method (Yamamoto H, MaurerKH and Hutchinson CR.Transformation of streptomyces erythraeus.J Antibiotics, 1986,39 (9), 1304-13), the R3M substratum is pressed Summers method (Summers RG, Donadio S, Staver MJ, et al.Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene clusterof Saccharopolyspora erythraea that are involved in L-mycarose and D-desosamineproduction.Microbiology, 1997,143 (10): 3251-62).

The sugar red mould A226 of many spores (S erythraea A226) bacterial strain is provided by Inst. of Medicinal Biological Technology, Chinese Academy of Medical Sciences bacterial classification chamber, thiostrepton (thiostrepton, Tsr), PEG3350 is a Sigma company product, N,O-Diacetylmuramidase is a Fluka company product, Proteinase K is an AMRESCO company product, PEG1000 is a MERCK-Schuchardt company product, TSB is a DIFCO company product, restriction enzyme, the T4 dna ligase is a Biolab company product, the pfu archaeal dna polymerase is that worker company product is given birth in Shanghai, the Taq archaeal dna polymerase is a MBI company product, and long segment archaeal dna polymerase (Expand Long Template PCR System) is a Roche company product, DNA MarkerDL2,000 is the precious biotech firm in Dalian product, and plasmid purification test kit and PCR purification kit are Promega company product.

Experimental technique used in the embodiment of the invention is:

Sambrook method (Sambrook J is pressed in colibacillary cultivation, plasmid enzyme restriction, connection, conversion etc., FrischEF and Maniatis T. molecular cloning experiment guide (second edition) (Jin Dongyan, Li Mengfeng etc. translate). Beijing: Science Press, 1992), plasmid extraction, PCR product purification are undertaken by the Promega product description.

Hopwood method (Hopwood DA is pressed in the cultivation of the red mould A226 of the many spores of sugar and the extraction of total DNA, BibbMJ, Chater KF et al.Genetic manipulation of stretomyces:a laboratory manual.The JohnInnes Foundation, England, 1985) carry out.

Yamamoto method (Yamamoto H is pressed in the red mould A226 of the many spores of sugar protoplastis preparation and conversion, MaurerKH and Hutchinson CR.Transformation of streptomyces erythraeus.J Antibiotics, 1986,39 (9), 1304-13) with Summers method (Summers RG, Donadio S, Staver MJ, et al.Sequencingand mutagenesis of genes from the erythromycin biosynthetic gene cluster of Saccharopolyspora erythraea that are irvolved in L-mycarose and D-desosamine production.Microbiology, 1997,143 (10): 3251-62) carry out.

The biological activity determination of fermented liquid: the Bacillus subtilus of incubated overnight (B subtilis) PUB110 coating LB plate, put the sterilization filter paper, on filter paper, add the fermented liquid that 10 μ l cultivate 72hrs, put 37 ℃ of thermostat containers and cultivate more than the 7hrs.

The extraction of erythromycin and derivative thereof in the fermented liquid: the centrifuged supernatant of 50mlTSB fermented liquid is transferred pH to 9.0-9.5 with ammoniacal liquor, ethyl acetate extraction, and water-bath concentrates.

The mass spectrum of 3-deoxy-3-carbonyl-erycin lactone is identified in the fermented liquid: the red mould M1 of the sugared many spores fermented liquid that extracts detects with the ZabsPec mass spectrograph as stated above.

The structure of embodiment 1, pWHM2201 plasmid

1, PCR primer design: for knocking out KR6 enzyme territory in the erythromycin synthesis gene, according to document Cortes J, Haydock SF, Roberts GA, et al.An unusually large multifunctional polypeptide in theerythromycin-producing polyketide synthase of Saccharopolyspora erythraea.Nature, 1990,348 (6297): the 176-8 sequence, the fragment that respectively increases in its both sides, sheet is intersegmental to have 20bp overlapping.Its primer is:

Fragment 1:

Forward: 5 '-TACGAATTCAGATCTCATGCGGCTCCTGGAGTCCGCAGTGGACG;

Oppositely: 5 '-CTCGAGGTCGCCGGTGGCCGGGCCCGCCGGCTCCCAGCTCGACTCG;

Fragment 2:

Forward: 5 '-CGAGTCGAGCTGGGAGCCGGCGGGCCCGGCCACCGGCGACCTCGAG;

Oppositely: 5 '-TTCAAGCTTCTGCAGTCATGAGTTCCCTCCGCCCAGCCAG.

Be template with fragment 1 and fragment 2 again, fragment 1 forward primer and fragment 2 reverse primers are primer, the gene fragment of synthetic no KR6, and the whole DNA fragment is about 3.2kb.

2, pcr amplification condition

1) the amplification A application of sample of fragment 1 and fragment 2: total dna profiling 5 μ l, DMSO 5 μ l, 4 * 2.5mMdNTP, 5 μ l, 10 * pfu dna polymerase buffer liquid, 5 μ l, water 10 μ l, 2.5 μ M primer 2s * 10 μ l, pfu archaeal dna polymerase 1 μ l; B amplification condition: 95 ℃ of 5min, (94 ℃ of 1min, 65 ℃ of 1min, 72 ℃ of 2min) * 30,72 ℃ of 7min;

2) overlapping pcr amplification A application of sample: each 2.5 μ l of fragment 1 and 2 templates, 4 * 2.5mM dNTP, 5 μ l, lengthy motion picture segment DNA synthetic enzyme damping fluid 5 μ l, water 10 μ l, 2.5 μ M primer (fragment 1 forward and fragment 2 are reverse) 2 * 10 μ l, lengthy motion picture segment DNA synthetic enzyme 0.75 μ l; B amplification condition: 95 ℃ of 5min, (94 ℃ of 1min, 65 ℃ of 1min, 68 ℃ of 5min) * 30,68 ℃ of 7min;

3, pUC2201 clone: after overlapping pcr amplification goes out required dna fragmentation, link to each other transformed into escherichia coli DH5 α with the pUC-T carrier by vast company product description.After overlapping PCR product cloning arrives the pUC-T carrier, sequence to the pUC2201 foreign gene has been carried out the partial sequence Analysis and Identification, the result shows more than 500 base that a sequencing reaction is finished and reports that sequence is in full accord, shows that the pWHM2201 plasmid with this sequence construct can be used as homologous recombination vector.

4, the structure of pWHM2201: be connected in pWHM3 EcoRI and Hind III restriction enzyme site after exogenous dna fragment among the pUC2201 cut with EcoRI and Hind III enzyme, and transformed into escherichia coli DH5 α.The pWHM2201 plasmid that will extract from bacillus coli DH 5 alpha, transformed into escherichia coli ET12567 bacterial strain does not have the modification plasmid that methylates with preparation, is used for the protoplast transformation of the red mould of sugared many spores.

The PCR of embodiment 2, chromosomal integration and the reorganization of karyomit(e) secondary identifies

1) according to tsr gene order (Hopwood DA, Bibb MJ, Chater KF et al.Genetic manipulationof stretomyces:a laboratory manual.The John Innes Foundation, England, 1985) the design primers designed is:

Forward: 5 '-CCTGAATTCATGACTGAGTTGGACACCATCGCA;

Oppositely: 5 '-TCTAAGCTTGGAAACGTTGAGAACTCGGTCTG.

The dna fragmentation length 774bp that amplification is come out.

2), select the PCR primer to be in both sides, KR6 enzyme territory according to the erythromycin synthesis gene sequence:

Forward: 5 ' AACGTCTTCCCGGCGGCACC;

Oppositely: 5 ' GTCGAGGTAGGACCGGACCC.

The expanding fragment length that KR6 does not remove is 1,770bp, and the DNA cloning fragment length that KR6 removes is 1,239bp.

3) pWHM2201 plasmid and homology of chromosome are recombinated: after the red mould A226 of the many spores of sugar is made protoplastis, transform with the pWHM2201 plasmid, the R3M substratum that contains 30 μ g/ml Tsr screens.From transformant, choose 130 bacterium colonies and be coated with the R3M inclined-plane that contains Tsr, have 18 bacterium colonies can be on the Tsr inclined-plane normal growth.Inoculation wherein 4 inclined-planes is carried out liquid culture and is extracted total DNA, carries out pcr amplification with the Tsr primer, the result as shown in Figure 1, gel electrophoresis all has tangible band, shows that the pWHM2201 plasmid is incorporated on the karyomit(e).

For the template that proves the PCR product is a genome DNA, rather than the free plasmid in the thalline, extract plasmid, do not see the plasmid band during gel electrophoresis, be that template is carried out pcr amplification with the extracting solution, do not see the PCR band yet.Illustrate that plasmid is incorporated on the karyomit(e), rather than free existence in thalline.

In order to confirm that further the pWHM2201 plasmid has been incorporated into the erythromycin synthesis gene site on the karyomit(e), be chosen at a growth normal strain bacterial strain (S erythraea Z1) on the R3M inclined-plane that contains Tsr, the 5ml TSB that inoculation contains 30 μ g/ml Tsr shakes pipe, inoculate the red mould A226 of sugared many spores simultaneously and shake pipe, cultivate 72hrs for 30 ℃ in the TSB of no Tsr.Add 10 μ l fermented liquids on the LB plate of Bacillus subtilus PUB110 scribbling.If the pWHM2201 plasmid integration has arrived on the karyomit(e) and will destroy erythromycin synthesis gene, make it can not synthesis of erythromycin.As shown in Figure 2, the result is to Bacillus subtilus PUB110 inhibition test: the Z1 transformant no longer suppresses the growth of Bacillus subtilus, illustrates that the pWHM2201 plasmid really has been incorporated into erythromycin biosynthesis gene site.

The screening of embodiment 3, the red mould of sugared many spores (Saccharopolyspora erythraea) M

After passing for two generations continuously on the non-resistant R3M inclined-plane, the system protoplastis is coated with non-resistant R3M plate with the red mould Z1 of the many spores of intasome sugar, therefrom 40 bacterium colonies of picking each be coated with the R3M inclined-plane that contains Tsr and the R3M inclined-plane of no Tsr continuously.There are 8 bacterium colonies (S erythraea M1-M8) only on nonresistant R3M inclined-plane, to grow.Inoculate 4 bacterium colonies (M1-M4) and carry out liquid culture and extract total DNA, carry out pcr amplification to remove the KR6 primers designed.The about 1.2kb of PCR product (as shown in Figure 3) shows that KR6 enzyme territory is knocked out on the karyomit(e).Obtain the red mould of sugared many spores (Saccharopolyspora erythraea) M1 CGMCC № 0604.

The evaluation of embodiment 4, the red mould M of sugared many spores tunning

With the 50ml fermented liquid ethyl acetate extraction of the red mould M1 of the many spores of sugar, water-bath concentrates the back and detects with the ZabsPec mass spectrograph.As shown in Figure 4, (3-deoxy-3-oxo-erythronolide B, each proton peak DOEB) is high-visible: 383.0m/z is [DOEB-H2O] H to 3-deoxy-3-carbonyl-erycin lactone B ⁺, 401.0m/z is [DOEB] H ⁺, 423.0m/z is [DOEB] Na ⁺, 439.0m/z is [DOEB] K ⁺Therefore conclude that the tunning of the red mould M1 of sugared many spores contains 3-deoxidation-3-carbonyl-erythronolide B.

Claims (3)

1, structural formula (I) compound

2, the red mould of sugared many spores (Saccharopolyspora erythraea) M1 CGMCC № 0604.

3, the application of structural formula (I) compound in the preparation ketolide antibiotics.

Images