CA2439254A1 - Life attenuated strains of prrs virus - Google Patents

Abstract

The present invention realtes to live attenuated European PRRS viruses which are attenuated by nucleic acid mutations on specific sties of the viral protein coded by ORF 2, 3 and 5. The invention also pertains to nucleotide sequences coding said viruses, methods of generating such viruses and a pharmaceutical composition comprising said PRRS viruses and teh use of said PRRS virus in the manufacture of a vaccine for the prophylaxis and treatment of PRRSV infections.

Description

Life attenuated strains of PRRS virus Field of the invention The present invention relates to live attenuated European PRRS viruses which are attenuated by nucleic acid mutations on specific sites. The invention also pertains to nucleotide 'sequences coding said viruses, methods of generating such viruses and a pharmaceutical composition comprising said PRRS viruses and the use of said PRRS virus in the manufacture of a vaccine for the prophylaxis and treatment of PRRS
infections.
~o Background of the invention Porcine reproductive and respiratory syndrome (PRRS), is caused by an enveloped positive-stranded RNA virus of the family arteriviridae (Snijder E.J., Meulenberg J.J.M.
~s 199. "The molecular biology of arteriviruses". Journal~of General Virology 79(5):961-971). About 10 to 15 years ago, two different PRRS virus strains emerged apparently independently in the USA and Europe. The disease is now endemic in many swine producing countries in North America, Europe and Asia. It continues to be a major cause w of reproductive loss and respiratory disease in swine. In the USA the prevalence of 2o infection is estimated to be up to 70 %.
The virus is transmitted by inhalation, ingestion, coitus, bite wounds or needles. It replicates in mucosal, pulmonary or regional macrophages. Subclinically, the disease results in resolution or persistent infection. Persistently infected animals shed virus in 2s oral/pharyngeal fluids, blood, feces, urine and semen. Clinical symptoms in sows relate to abortion or premature farrowing with weak live-born pigs, stilborn pigs and autolyzed fetuses. Infected neonatal pigs have a high mortality or suffer from pneumonia. The subsequent nursery and growth of pigs is complicated by pneumonia, concurrent bacterial infections and increased mortality. Boars are prone to fever and morphological changes in so semen.
Like for all arteriviruses, the PRRS virus genome is a single positive-stranded RNA
molecule of about 15 kilobases. ORF's (open reading frame) la and 1b code replicases, ORF's 2 to 5 putative glycoproteins (gp 1 to 4), ORF 6 a membrane protein (M) and ORF
7 codes for a nucleocapsid protein (I~.
The original descriptions of PRRS infection in the USA (WO 93/03760, isolate ATCC VR-2332, deposited July 18, 1991 at the American Type Culture Collection in Rockville, Maryland, USA, NCBI GeneBank Accession No. U 87392 U00153) and Europe (WO
92121375, isolate Lelystad Agent (CDI-NL-2.91), Accession No. CNCM I-1102, deposited' June 5 1991 with the Institute Pasteur, Paris; NCBI GeneBank Accession Nos. M

[gi:11125727], NC 002533 [gi:11138120]) identified viruses that had genomic and ~o serological differences. Comparison demonstrated that both had a common ancestor which had diverged before the clinical disease was described in the late 1980's.
Full length genomic sequences have been reported for a number of PRRS viruses and complete structural protein-coding regions thereof (Snijder et al. 1998, supra;
Meulenberg J.J.M., Hulst, M.M. et al., 1993. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome ..., Virology 192, 62-72; Conzelmann K.K., Visser N., Van Woensel P., Thiel H.J., 1993. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group, Virology 103, 329-339;
Murtaugh M.P., Elam M.R., Kakach L.T., 1995. Comparison of the structural protein ,. coding sequences of the VR-2332 and Lelystad virus strains, of the PRRS
virus, Archives zo of Virology 140, 1451-1460; Kapur V., Elam M.R., Pawtovich T.M. Murtaugh M.P., 1996:
Genetic variation in porcine reproductive and respiratory sydrome virus isolates in the midwestern United States, Journal of General Virology 77, 1271-1276).
PRRS virus can be replicated ire vitro in pig lung macrophages, monocytes, glial cells and zs two MA-104 cell subpopulations (embryonic monkey kidney cell) known as CL-2621 and MARL-145 (K.D. Rossow, Porcine reproductive and respiratory syndrome, Vet Pathol 35:1-20, 1998). Recombinant means for generating infectious PRRS clones are also available (EP 0839912).
so For protecting pigs, live attenuated PRRS vaccines are commercially available (RespPRRS/Ingelvac~ PRRS MLV, Boehringer Ingelheim). Killed vaccines (inactivated whole virus) or subunit vaccines (conventionally purified or heterologously expressed purified viral proteins) are most often inferior to live vaccines in their efficacy to produce a full protective immune response even in the presence of adjuvants. For PRRS, it has been demonstrated that in comparison to the currently available killed vaccines, the attenuated vaccines induce an immunity against the disease which lasts longer and is more efficient (Snijder et al., referenced above). The present live PRRS vaccines are attenuated conventionally by serially passaging the virus in appropriate host cells until pathogenicity s is lost (American strain: EP 0529584; European strain: EP 0676467; EP
0835930).
Present live PRRS vaccines still. leave room for improvement. For one; they do not prevent reinfection. Secondly, they do not allow serological discrimination between vaccinated animals and animals infected with the field virus. Furthermore, a live vaccine in principle .
~o has a theoretical risk of reversion to the non-attenuated phenotype. In particular; RNA
viruses such as the PRRS virus,' are considered to have high rates of mutation due to imprecise replication of the RNA genome resulting from a lack of proofreading by the RNA replication enzyme. For conventionally derived attenuated viruses obtained by conventional multiple passaging, the molecular origin as well as the genetic stability ~s. remains unknown, and the features of revertants are unpredictable.
Thus, the problem underlying the invention was to provide improved PRRS virus strains ' which can be used for the manufacture of vaccines which overcome the disadvantages of the prior art.
20 .
Figure Legends Figure 1: Sequence comparison of wild type Lelystad Virus, published in GenBank, Attenuated virus A (abbreviated Vir.A) and attenuated Lelystad Virus B
2s Genomic area: ORF 2 Number of nucleotides: 750 In Bold and boxed are indicated the mutations (non-synonymous nucleotide exchanges) according to the invention (gee also claims 2 and 3) so Figure 2: Sequence comparison.of wild type Lelystad- Virus, published in GenBank, Attenuated virus A (abbreviated Vir.A) and attenuated Lelystad- Virus B
Genomic area: ORF 3 Number of nucleotides: 798 In Bold and boxed are indicated the mutations (non-synonymous nucleotide exchanges) according to the invention (see also claims 2 and 3) Figure~3: Sequence comparison of wild type Lelystad Virus, published in GenBank, Attenuated virus A (abbreviated Vir.A) .and attenuated Lelystad Virus B
Genomic area: ORF 4 Number of nucleotides: 552 Figure 4: Sequence comparison of wild type Lelystad Virus, published in GenBank, ~o . Attenuated virus.A (abbreviated Vir.A) and attenuated Lelystad- Virus B
..
Genomic area: ORF 5 Number of nucleotides: 606 ' ' In Bold.and boxed are indicated the mutations (non-synonymous nucleotide exchanges) according to the invention (see also claims 2 and 3) . " .
Disclosure of the invention Before the embodiments of the present.invention it must be noted that as used herein and in~
the appended claims, the singular forms "a", "an", and "the" include plural reference unless 2o the context clearly dictates otherwise. Thus, for example, reference to "a PRRS virus"
includes a plurality of such PRRS viruses, reference to the "cell" is a reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.
25 Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the cell lines, vectors, and methodologies which are reported in the publications which might be used in connection so with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure .by virtue of prior invention.

The present invention provides an attenuated European PRRS virus encoded by a nucleic acid comprising ORFl, ORF2, ORF3,.ORF4, ORES, ORF6 and ORF7 and subtypes thereof such as ORFla and ORFlb or ORF2a and ORF2b, characterized in that:
s a) ORF2 comprises at positions 11915 - 11935 at least one of the nucleotides as set out in table 1:
A T G A C C A G A A C G A A G A G T C T C

C C A C T T C A C C A A C C A C A C A C A

G G~ T G A A G T G G G T G G T G T G T G T
, and at positions 12037 -12057 at least one of the nucleotides as set out in table 2:
T G T T A A A C G T C A G T T C G T G G G

C A C C C C C T A C T C A C C T A C A A A

v G T ' G G G G A T G A G T G''G A T G T T T
G

and at positions 12058 -12078 at least one of the nucleotides as set out in table 3:
T A A C C C A T A~ C A A A A C~C G T G T A

C C C' T T T C C C T C C C C T T A C A C C

G G G A A A G G G A G G G G A A T G T G G

and/or a deletion at said'position(s) and/or ~o '~ b) ORF3 comprises at positions 12660 - 12680 at least one of the nucleotides as set '' out in table 4:
C A A C A A ~T T A C A G G T A G G G C A G

T C C T C C C C C T C A A C C A A A T C A

A G G A G G G G G A G T T G G T T T A G T

and/or a deletion at said positions) and/or c) ORFS comprises at positions 13684 - 13704 at least one of the nucleotides as set out in table 5:
C T G G A A A C A C G A A A T G G G C C A

T C A A C C C T C T A C C C C A A A T T C

A G T T G G G A G A T G G G G T T T A A G

~s and/or a deletion at said position(s).
It has surprisingly been found that PRRS viruses comprise specific sites on individual viral proteins which, if mutated, lead to an attenuated phenotype compared to the original virulent field strain. The evolutionary pressure on~these from now on called "virulence specific sites" or simply referred to as "sites of the invention" or just "sites" is immense. It is assumed that these sites have a general involvement in the process leading to the attenuation of European PRRSV like vaccine strains. These sites disclosed in tables 1 to 5 s . are specific for European strains (wild type Lelystad Agent CNCM I-1102 is regarded as reference type strain) and not shared with US strains of PRRS viruses.
In a further aspect, the present invention relates to an attenuated European PRRS virus wherein at least one of the sequence sections corresponding.to SEQ ID NOs: 25, 26, 27, ~o 28, or 29 is mutated at one, two, three, or more positions, up to a maximum of ten mutations: The sites SEQ ID NO's: 25, 26, and 27 are located in ORF2 (positions 130-150;
,, 252-272, and 273-293, respectively, in Fig 1), the site SEQ ID NO: 28 is located in ORF3' (position 267-287 in Fig. 3), and the site SEQ ID NO: 29 is located in ORFS
(position 201--.
221 in Fig. 4). Said sequence sections represent the virulence specific sites according to the ~s invention. As PRRS virus is a positive-stranded RNA virus,,it will comprise a respective RNA sequence instead of the DNA sequences given in the sequences listings, i.e. it will contain uracil (II) at positions indicated to be thymin (T) in the sequence listings, and ribose instead of deoxyribose.
2o It is to be understood that an attenuated European PRRS virus according to the invention comprises genomic RNA containing sequence sections corresponding to the DNA
sequences with SEQ ID NOs: 25, 26, 27, 28, or 29, wherein at least one of said sequences sections differs from the referred sequences by at least one mutation. In this context, "corresponding to" means that the virus of the invention contains sequence sections which 25 Can be aligned to the referred sequences by a standard alignment algorithm like BLAST
(Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search tool." J. Mol. Biol. 215:403-410; Gish, W. & States, D.J.
(1993) "Identification of protein coding regions by database similarity search."
Nature Genet.
3:266-272; Madden, T.L., Tatusov, R.L. & Zhang, J. (1996) "Applications of network 30' BLAST server" Meth. Enzymol. 266:131-141; Zhang, J. & Madden, T.L. (1997) "PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation." Genome Res. 7:649-656; Altschul, Stephen F., Thomas L.
Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). Sequence positions which are aligned pairwise by such an algorithm "correspond to" each other.
Upon such an alignment, a respective mutated sequence section of the virus then would s differ from the corresponding referencesequence ("site", i.e. either SEQ m NO: 25, 26, 27, 28, or 29) at one, two, three, or more positions, up to a maximum of ten positions.
Preferably, a virus of the invention is mutated at all five of the cited sequence sections (sites). Preferably, the mutations) is/are substitutions) and/or a deletion(s). In preferred embodiments, the mutations result in a change of the amino acid sequences) of the ~o protein(s) coded by the respective ORF(s).
In a further aspect, the present invention relates to an attenuated European PRRS virus having an ORF2 containing a sequence section corresponding to SEQ ID NO: 25, wherein the triplet corresponding to positions 10 to 12 of SEQ m NO: 25 is mutated.
Preferably, .
~5 said triplet does not code for phenylalanine. Preferably, said triplet codes for a different amino acid. In a preferred embodiment, said triplet codes for serine. More preferably, the nucleotide correponding to position 11 of SEQ m NO: 25 is a C. Hence in a preferred embodiment, the attenuated European PRRS virus has an ORF2 coding for a protein which has not phenylalanine at position 47 (or the corresponding position in a BLAST
Zo alignment). Preferably, said protein has a serine at this position instead.
In a further aspect, the present invention relates to an attenuated European PRRS virus having an ORF2 containing a sequence section corresponding to SEQ ID NO: 26, wherein the triplet corresponding to positions 10 to 12 of SEQ m NO: 26 is mutated.
Preferably, Zs . said triplet does not code for valine. Preferably, said triplet codes for a different amino acid. In a preferred embodiment, said triplet codes for phenylalanine. More preferably, the nucleotide correponding to position 10 of SEQ m NO: 26 is a T (or an U in the RNA, respectively). Hence in a preferred embodiment, the attenuated European PRRS
virus has an ORF2 coding for a protein which has not valine at position 88 (or the corresponding so position in a BLAST alignment). Preferably, said protein has a phenylalanine at this position instead.
In a further aspect, the present invention relates to an attenuated European PRRS virus having an ORF2 containing a sequence section corresponding to SEQ )D NO: 27, wherein the triplet corresponding to positions 11 to 13 of SEQ ID NO: 27 is mutated.
Preferably, said triplet does not code for phenylalanine. Preferably, said triplet codes for a different amino acid. In a preferred embodiment, said triplet codes for leucine. More preferably, the nucleotide correponding to position 11 of SEQ ID NO: 27 is a C. Hence in a preferred embodiment, the attenuated European PRRS virus has an ORF2 coding for a protein which has not phenylalanine at position 95 (or the corresponding position in a BLAST
alignment). Preferably, said protein has a leucine at this position instead.
In a further aspect, the present invention relates to an attenuated European PRRS virus ~o having an ORF3 containing a sequence section corresponding to SEQ ID NO:
28, wherein the triplet corresponding to positions 11 to 13 of SEQ ID NO: 28 is mutated.
Preferably, said triplet does not code for serine. Preferably, said triplet codes for a different amino acid. In a preferred embodiment, said triplet codes for proline. More preferably, the.
nucleotide correponding to position .11 ~of SEQ ID NO: 28 is a C. Hence in a preferred ~5 embodiment, the attenuated European PRRS virus has an ORF2 coding for a protein which . has not serine at position 93 (or the corresponding position in a BLAST
alignment):
Preferably, said protein has a proline at this position instead:
In a further aspect, the present invention relates to an attenuated European PRRS virus Zo . having an ORES containing a sequence section corresponding to SEQ m NO:
29, wherein .
the triplet corresponding to positions 11 to 13 of SEQ ID NO: 29 is mutated.
Preferably, said triplet does not code for leucine. Preferably, said triplet codes for a different amino acid. In a preferred embodiment, said triplet codes for phenylalanine. More preferably, the .
nucleotide correponding to position 11 of SEQ ID NO: 29 is a T (or an U in the RNA, 2s respectively). Hence in a preferred embodiment, the attenuated European PRRS virus has an ORF2 coding for a protein which has not leucine at position 71 (or the corresponding position in a BLAST alignment). Preferably, said protein has a phenylalanine at this position instead.
so' Live PRRS vaccines based on European strains attenuated by defined mutations and/or deletions allow to avoid the disadvantages of the present generation of attenuated vaccines:
If the attenuated strain carries defined and known mutations, it can be analysed conveniently for quality control and genetic stability. The possibility to introduce defined deletions andlor substitutions, in particular as double or multiple mutations decreases the probability of reversion to the non-attenuated or virulent phenotype. A
further advantage of said attenuating mutations lies in their known molecular uniqueness which allows for use as distinctive labels for attenuated PRRS viruses and to distinguish them from PRRS
viruses from the field. With the sites identified in the present invention, safe and site-s specifically attenuated viruses can be generated. Such viruses are useful for the preparation.
of a safe live vaccine for use in the prevention and/or treatment of PRRS
infections.
The present invention is directed to attenuated European PRRS strains and methods of production thereof. In this context, "attenuated" means that a virulent -strain is or has been ~o modified in a way that he is less virulent or pathogen than before the modification. In particular, "attenuated" means that the virus has a significantly reduced ability of causing ~ .
clinical, disease, while he is still able to replicate in the host.
Preferably, virulence or ~ ~ ~ . .
pathogenicity is reduced to an amount which makes the virus acceptable for administration as a vaccine: In a preferred embodiment, the virus is attenuated to an extent that is does not- .
15 , cause clinical diesease while still being able to replicate in the host.
Such an attenuated strain is an ideal agent for vaccination because replication,in the host ensures stimulation of a rapid and excellent immune response. In one~preferred embodiment, an attenuated . - .
European PRRS virus is less virulent than the Lelystad Agent. In another embodiment; the attenuated virus is less virulent than the.parent strain from which it s derived. The term 20 "less virulent than the PRRS virus Lelystad Agent" (or, likewise, the parent strain from which it is derived) is to be understood in terms of a comparison of clinical symptoms of the virus of interest with Lelystad Agent (CDI-NL-2.91/CNCM I-1102), or the parent strain. A preferred procedure for determining if a PRRS virus is less virulent than Lelystad' Agent, or likewise for determining if a virus modified according to the invention is less 25 virulent than its parent strain before the modification, is disclosed in example 1. It may be that not each and every possible nucleic acid mutation at the virulence specific site is implicated in reducing virulence. The procedure of example 1 provides a precise and straight forward experimental setup for determining whether a live PRRS virus according to the teaching of the invention is Iess virulent than its parent strain or a virulent field so isolate like Lelystad Agent.
The present invention is directed to European PRRSV strains which can be distinguished from American strains as follows. Soon after the virus was found, Wensvoort et al. (J. Vet.
Diagn. Invest 4: 134-138 (1992) observed differences in antigenic characteristics between American and European isolates. They raised sera against both the American type and the European type in several pigs, and compared the cross-reactivity of the anti-European (LV) and anti-American (VR-2332) sera with three American virus isolates and 4 European isolates. Sera against PRRS viruses of the European serotype are significantly less reactive 5 .~ with American isolates than with European isolates. Furthermore, sera raised against viruses of the American serotype are less reactive, or even not reactive at all, with European virus isolates. Wensvoort et al. also showed the reactivity of sera raised against European and American isolates with the two reference viruses CNCM I-1102 (European) and ATCC VR-2332 (American). In this experiment; sera raised against European strains ~o ~ were not reactive at all with the American strain. Thus, two fully different serotypes of the virus exist: the American and the European serotypes, which may be distinguished based . . ~ on their. serological properties. ' ,, ..,.
This can also be shown on the molecular level. Nelson et al: (74th Annual Meeting of the ~5 Conference of Research Workers in Animal Diseases, November 8-9, 1993) compared sequences of polymerase-encoding genes of vari~us isolates: They demonstrated that polymerase genes show a 87-95% homology within the American group. However, a ' homology as low as 64-67% based on~nucleic acids was found between European serotypes and American serotypes. Mardassi published comparable results at the ~ Conference mentioned above, showing that the 3'-terminal 530 nucleic acids of the Quebec PRRS Reference strain and European isolates only show a homology as low as 59%. The results from the papers mentioned above make it most likely that the American and European serotypes have diverged a long time ago, which would then easily explain their genetic differences and their serological unrelatedness.
American and European serotypes thus may be easily discriminated. Viruses of the European serotype are characterised in that they react to a higher titer in an Immunoperoxidase Monolayer Assay with a panel of antisera against the European PRRS
virus LV (CNCM I-1102) compared with a reaction with a panel of antisera against the so American PRRS virus (ATCC VR-2332). If a panel of sera is used, obtained about 40 days post infection, and from different animals, any virus can easily be classified as belonging either to the American or European serotype. Typically, the reactivity of a European strain with a panel of antisera against other European strains is about 400 times higher than with a panel of antisera against American strains. When a European strain is reacted with antisera against the deposited European strain I-1102 and the deposited American strain VR-2332, a typical difference in reactivity of about 55 times is found (Wensvoort et al., referenced above). ' "Mutation" means the substitution, deletion, or insertion of a nucleotide or amino acid at a given position of a nucleotide or amino acid sequence. A "substitution" is a replacement of a nucleotide or amino acid by another (e.g. C for a T). "Deletion" means the removal of a . nucleotide or amino acid. "Insertion" means that a nucleotide or amino acid is inserted at a' given position.
~o . . . In a further aspect, the present invention comprises a method or process of attenuation of a ' European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at least one of the positions of ORF2 corresponding to.positions 130 to 150 andlor 15 . positions .252 to 272 and/or positions 273 to 293 of SEQ ID NO: 22;
. b) it is tested whether the resulting PRRS virus is attenuated.
In a further aspect, the present invention comprises a method of attenuation of a European ;" , pRRS virus, characterised in that ~ ' a 20 a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at , least one of the positions of ORF3 corresponding to positions 267 to 287 of SEQ
ID N0: 23;
b) it is tested whether the resulting PRRS virus is attenuated.
2s In a further aspect, the present invention comprises a method of attenuation of a European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at least one of the positions corresponding to positions 201 to 221 of ORFS
according to SEQ ID NO: 24; ' so b) it is tested whether the resulting PRRS virus is attenuated.
In this context, the term "corresponding to" has a meaning as outlined above, i.e. that the two positions corresponding to each other would be aligned as a pair in a sequence alignment like BLAST. Preferably, the modification according to the invention results in a change of the amino acid sequence of the encoded protein. In preferred embodiments, the modifications are deletions and/or substitutions, preferably double or multiple mutations.
In a preferred embodiment, two or more of the aforementioned modifications are combined. In a further preferred embodiment, the sequence of each of ORF2, ORF3, and s ORES is modified. Preferably, the sequence of ORF2 is modified at least at two, preferably at least at three positions.
Preferably, the aforementioned method comprises (a) modifications) resulting in one or . ' more of the following features: an ORF2 encoding a protein having the amino acids) at ~o one or more of amino acid sequence positions corresponding to positions 47, 88 and/or 95 .
of SEQ ID N0: 22 substituted or deleted; an ORF3 encoding a protein having the amino acid at amino acid sequence position corresponding to position 93 of SEQ ID
NO: 23 substituted or deleted; andlor an ORFS~ encoding a protein having the amino acid at amino acid sequence position corresponding to position 71 of SEQ m NO: 24 substituted or ~s ~ deleted. Preferably, all of the aforementioned positions are mutated.
Preferably, the method according to the invention comprises (a) modification (s) resulting in one or more, preferably all of the following features: an ORF2 encoding a protein having not phenylalanine at amino acid sequence position corresponding to position 47 of Zo SEQ m NO: 22, an ORF2 encoding a protein having not valine at amino acid sequence _ position corresponding to position 88 of SEQ m NO: 22, an ORF2 having not phenylalanine at amino acid sequence position corresponding to position 95 of SEQ ID
NO: 22, an ORF3 having not serine at amino acid sequence position corresponding to position 93 of SEQ m NO: 23, and/or an ORFS having not leucine at amino acid sequence Zs position corresponding to position 71 of SEQ m NO: 24.
Preferably, the method according to the invention comprises (a) modification (s) resulting in one or more, preferably all of the following features: an ORF2 encoding a protein having serine at amino acid sequence position corresponding to position 47 of SEQ ID NO:
so 22, an ORF2 encoding a protein having phenylalanine at amino acid sequence position corresponding to position 88 of SEQ m NO: 22, an ORF2 having leucine at amino acid sequence position corresponding to position 95 of SEQ m NO: 22, an ORF3 having proline at amino acid sequence position corresponding to position 93 of SEQ m NO: 23, and/or an ORES having phenylalanine at amino acid sequence position corresponding to position 71 of SEQ m NO: 24.
Preferably, a method according to the invention comprises (a) modification (s) resulting in' one or more, preferably all of the following features: an ORF2 having a C at the position corresponding to position 140 if SEQ m NO: 22, an ORF2 having a T at the position .
corresponding to position 262 of SEQ m NO: 22, an ORF2 having a C at the position . corresponding to position 283 of SEQ m NO: 22; an ORF3 having a C at the position . ~ , .
corresponding to position 277 of SEQ m NO: 23, and/or an ORF5 having a T at the ~o position corresponding to position 211 of SEQ m NO: 24.
'. Furthermore, the present invention relates to an attenuated European PRRS
virus obtainable by any one of the aforementioned methods. ., , . In a further aspect, the present invention comprises a nucleic acid containing the coding information of an attenuated European PRRS virus as described above. As outlined above, this may be a ribonucleic acid (RNA). Such nucleic acid may furthermore be a , .
deoxyribonucleic acid which is complementary to':such a ribonucleic acid, i.e.
a cDNA, or~ : .
any other type of DNA. In a preferred embodiment; such a cDNA is infectious.
This means , that if such a cDNA is introduced into a suitable host cell, said cell will start generating , .
virus particles. The present invention furthermore relates to a RNA, cDNA, or other DNA
comprising any one; or a multitude of the mutations outlined above.
In a further aspect, the invention comprises a vaccine comprising an attenuated European 2s PRRS virus as described in combination with a pharmaceutically acceptable earner.
In a further aspect, the present invention comprises a method of vaccination of a pig against PRRS, characterised in that an efficient amount of the aforementioned vaccine is adminstered to said pig.
In a further aspect, the present invention relates to the use of an attenuated European PRRS
virus as described for the manufacture of a vaccine against PRRS.

According to the present invention, the numbering of nucleotides or amino acids is according to the publicly available Lelystad agent as disclosed above.
However, as disclosed in figures 1 to 4, the ORFs ("open reading frames = ORF") are numbered separately as some of them are overlapping.
The nucleotides of the specific sites at which the attenuated European virus is different from the virulent wild type are of ORF. 2 the nucleotides 11915 -11935 (table corresponding to numbers 130 to 150 in figure 1), 12037 -12057 (table 2 numbers 252-. 272 in figure 1), 12058 -12078 (table 3 numbers 273-293 in figure 1); of ORF

~0 12680 (table 4; numbers 267-287 in figure 3), andlor of ORES 13684 -13704 (table 5;
numbers 201-221 in figure 4). By mutating the Lelystad Agent at one or several of the ., before-mentioned positions to any one of the nucleotides indicated in said tables and/deleting said nucleotides at said positions, the artisan will obtain life attenuated European vaccine strains of PRRS virus. The mutations such as replacement or deletion at ~s said locations are only limited by the condition that the virus.must still be able to replicate, i.e. it must still be a live virus. This can be determined without undue experimentation. The skilled person can, on the basis of the publicly available~Lelystad Agent and the teachings ~ .
according to the invention; introduce e.g. one single mutation:into every site disclosed on,.:
the basis of the provided tables, e.g. at position 11915 he may introduce an A, C or (~ or he 20: may delete the nucleotide at that position (which is a T). A non-limited example',is shown in figures 1 to 3 (ORF2, ORF 3 and ORF 5 of Lelystad B and Attenuated Virus A) and in example 1.
The invention comprises such viruses wherein only one nucleotide is mutated, but also 2s several nucleotides, or even all nucleotides e.g. one or several triplets encoding one or several amino acids at said positions. However, the sequence shall not be mutated to the extend that the virus is not capable of replicating anymore, i.e. according to the invention, a live virus is encoded.
so Additional nucleic acids outside said regions may also be mutated, however, this is not essential to the invention (see figure 1, e.g. position 426 of ORF2 of Lelystad-B wich is a C instead of a T).

Said mutations may be carned out by standard genetic engineering methods known in the art, in particular by site-directed mutagenesis. In'the context of the invention, "site-directed mutagenesis" means a genetic engineering technique which allows directed mutation of preselected sites of a nucleic acid. In general, such a technique requires at least partial 5 knowledge of the sequence of such nucleic acid. The classical attenuation method by serial passaging dose not allow mutation of preselected sites. Such genetic engineering methods are well-known in the art (see e.g. Sambrook et a1.(1989) Molecular Cloning: A
Laboratory Manual; 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York;
Chapter 15; Wu (ed.) (1993), Methods in Enzymology Vol 217, p. 173-285).
~o As a starting material for introduction of mutations, a cDNA.clone of a virulent PRSSV
strain, e:g. Lelystad Agent (CNCM I-.1102), may be generated according to procedures . ~ known in the art (Buyer et Haenni. Infectious transcripts and cDNA clones of RNA
viruses. Virology (1994) 198: 415-426). For example, an infectious PRRSV copy may be .. ~5~ . prepared as described (W000/53787; ~Meulenberg: et al, Adv. Exp. Biol (1998) 440:199-. 206; Meulenberg et al., J. Virol: (1998) 72(1): 380-387) which then may be mutated according to the invention. The cited references provide detailed procedures how to obtain .. infectious cDNA clones of PRRSV and to create mutants thereof. The mutated clone or infectious tanscripts thereof.generated in vitro may then be transfected into appropriate - host cells which will then generate attenuated virus.
In particular, it was surprisingly found that sites 11925, 12047, and 12068 of ORF2 (see figure 1); 12670 of ORF 3 (see figure 2) and/or 13694 of ORFS (see figure 4) are consistently changed compared to the virulent field strain Lelystad Agent.
Therefore, Zs another preferred embodiment of the present invention is an attenuated European PRRS
virus according to the invention, characterized in that:
a) ORF2 comprises a C, A or G at position 11925 and/or a C, T or A at position and/or a A, C or G at position 12068 or a deletion at said positions) and/or b) ORF3 comprises a A, C or G at position 12670 or a deletion at said position and/or 3o c) ORFS comprises a G, A or T at position 13694 or a deletion at said position.
Even more particular, it was found that found that site 11925 of ORF 2 is consistently changed to a C, site 12047 of ORF 2 is consistently changed to T, and site 12068 of ORF2 is consistently changed to C (see figure 1); site 12670 of ORF 3 is consistently changed to C (see figure 2) and/or 13694 of ORES is consistently changed to T (see figure 4) compared to the virulent field strain Lelystad Agent. Thus, another more preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention, wherein said nucleic acid is further characterized in that:
s a) said ORF2 comprises a C at position 11925 and/or a T at position 12047 and/or a C
at position 12068 or a deletion at said positions) andlor b) said ORF3 comprises a C at position 12670 or a deletion at said position and/or c) said ORFS comprises a T at position 13694 or a deletion at said position.
~o Another more preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention designated attenuated Virus A in the figures, .. .. wherein said nucleic acid is further chaxacterized:in that: ' a) said ORF2 comprises the nucleic acid as defined in~SEQ ID No. 1 and/or b) said ORF3 comprises the nucleic acid as defined iwSEQ ID No. 2 andlor ~s . c) said ORF4'comprises the nucleic acid asvdefined in SEQ ID No. 3 and/or d) said ORFS comprises the nucleic acid as defined iri SEQ ID No. 4.
or a fragment, allelic variant, functional variant; variant based on the degenerative nucleic . ~ . .. acid code, fusion molecule or a~chemical derivative thereof.:
2o A "fragment" according to the invention is any immunogenic subunit of a PRRS virus or .;
ORF according to the invention, i.e. any polypeptide subset, characterized in that it is encoded by a shorter nucleic acid molecule than disclosed above, however still retains its activity.
25 A "functional variant" of the PRRS virus or ORF according to the invention is a PRRS
virus or ORF which possesses a biological activity (either functional or structural) that is substantially similar to the PRRS virus or ORF according to the invention. The term "functional variant" also includes "a fragment", "an allelic variant" "a functional variant", "variant based on the degenerative nucleic acid code" or "chemical derivatives". Such a so "functional variant" e.g. may carry one or several point mutations, one or several nucleic acid exchanges, deletions or insertions or one or several amino acid exchanges, deletions or insertions. Said functional variant is still retaining its biological activity, e.g. function as a vaccine strain, at least in part or even going along with an improvement said biological activity.

A "variant based on the degenerative of the genetic code" is a variant due to the fact that a~
certain amino acid may be encoded by. several different nucleotide tripletts.
Said variant is still retaining its biological activity, at least in part or even going along with an improvement said biological activity.
A "fusion molecule" may be the PRRS virus or ORF according to the invention fused to . . .
e.g. a reporter such as a radiolabel, a chemical molecule such as a fluorescent label or any other molecule known in the art. ' As used herein, a ,chemical derivative" according to the invention is a PRRS
virus or ORF.
according to the invention chemically modified or containing additional chemical moieties v, not normally being part of the molecule: Such moieties may.improve the molecule's solubility, absorption, biological half life etc.
- . ' .
A molecule is "substantially similar" to another molecule if both molecules have substantially.similar structures or biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if the structure of one of the molecules is not found in the other, or if the sequence of amino 2o acid residues is not identical.
Another most preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention (designated attenuated Virus A in the figures), wherein said nucleic acid is characterized in that:
z5 a) said ORF2 consists of the nucleic acid as defined in SEQ m No. 1 and/or b) said ORF3 consists of the nucleic acid as defined in SEQ m No. 2 and/or c) said ORF4 consists of the nucleic acid as defined in SEQ m No. 3 and/or d) said ORES consists of the nucleic acid as defined in SEQ m No. 4.
so Another preferred embodiment of the present invention is an attenuated European PRRS
virus according to the invention (designated attenuated virus A in the figures), wherein said.
nucleic acid is characterized in that it comprises the nucleic acid as defined in SEQ >D No.
5 or a fragment, allelic variant, functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof.

Another most preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention (designated attenuated virus A in the figures), wherein said nucleic acid is characterized in that it consists of the nucleic acid as defined in s SEQ m No. 5.
Another preferred embodiment of the present invention is an attenuated European PRRS:
virus according to the invention (LELYSTAD-B in the figures), wherein said nucleic acid.
is further characterized in that:
~o a) said ORF2 comprises the nucleic acid as defined in SEQ m No. 6 and/or b) ~ said ORF3 comprises the nucleic acid as defined in SEQ ID No. 7 and/or c) said ORF4 comprises the nucleic acid as defined in SEQ m No. 8 and/or d) . said ORES comprises the nucleic acid as defined in SEQ )D No. 9 and/or or a fragment, allelic variant, functional variant, variant based on the degenerative nucleic-acid code, fusion molecule or a chemical derivative thereof..
Another most preferred embodiment of the present invention is an attenuated European' PRRS virus according to the invention (LELYSTAD-B in the figures), wherein said nucleic acid is further characterized in that:
20 a) said ORF2 consists of the nucleic acid as defined in SEQ ID No. 6 and/or b) said ORF3 consists of the nucleic acid as defined in SEQ m No. 7 and/or c) said ORF4 consists of the nucleic acid as defined in SEQ m No. 8 and/or d) said ORFS consists of the nucleic acid as defined in SEQ JD No. 9.
2s Another important embodiment of the present invention is an attenuated European PRRS
virus (attenuated virus A in the figures), wherein said PRRS virus is characterized in that:
a) ORFla comprises the amino acid as defined in SEQ ID No. 10 and/or b) ORFlb comprises the amino acid as defined in SEQ ~II7 No. 11 and/or c) ORF2 comprises the amino acid as defined in SEQ )D No. 12 andlor so d) ORF3 comprises the amino acid as defined in SEQ m No. 13 and/or e) ORF4 comprises the amino acid as defined in SEQ ll~ No. 14 and/or f) ORFS comprises the amino acid as defined in SEQ m No. 15 and/or g) ORF6 comprises the amino acid as defined in SEQ ID No. 16 andlor h) ORF7 comprises the amino acid as defined in SEQ ID No. 17.

or a fragment, allelic variant, functional variant, glycosylation variant, fusion molecule or a chemical derivative thereof.
Another more preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention (attenuated virus A in the figures), wherein said PRRS virus is characterized in that:
a) .ORFl a consists of the .amino acid as defined in SEQ m No. 10 andlor b) ORFlb consists of the amino acid as defined in SEQ m No. 11 and/or c) ORF2 consists of the amino acid as defined in SEQ m No. 12 andlor ~o d) ORF3 consists of the amino acid as defined in SEQ m No. 13 and/or e) .ORF4 consists of the amino acid as defined in SEQ m No. 14 and/or f) ORFS consists of the amino acid as defined in SEQ ~m No. 15 andlor g) ORF6 consists of the amino acid as defined in SEQ m No. l6,andlor h) ORF7 consists of the amino acid as defined in SEQ ID No. 17.
Another very important embodiment of the present invention is an attenuated European PRRS virus (LELYSTAD-B in the figures), wherein said PRRS virus is characterized in that: , a) ORF2 comprises the amino acid as defined in SEQ m No. 18 andlor 2o b) ORF3 comprises the amino acid as defined in SEQ >D No. 19 and/or c) ORF4 comprises the amino acid as defined in SEQ m No. 20 and/or d) ORES comprises the amino acid as defined in SEQ ID No. 21.
or a fragment, allelic variant, functional variant, glycosylation variant, fusion molecule or a chemical derivative thereof.
Another more preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention (LELYSTAD-B in the figures), wherein said PRRS
virus is characterized in that:
a) ORF2 consists of the amino acid as defined in SEQ m No. 18 and/or so b) ORF3 consists of the amino acid as defined in SEQ ll~ No. 19 and/or c) ORF4 consists of the amino acid as defined in SEQ m No. 20 andlor d) ORES consists of the amino acid as defined in SEQ m No. 21.

Yet another important embodiment of the present 'invention is a nucleotide sequence coding for a virus according to the invention as described above. Such nucleotide sequences include sequences disclosed in the sequence listing (e.g. with the identification numbers 1 to 9 (given under <400> = SEQ m NO.). The invention further relates to the s. proteins disclosed in SEQ m No. 10 to ZI.
. Yet another preferred embodiment of the present invention is a nucleotide sequence according to the invention, wherein the nucleotide sequence has been modified to encode:~a virulence marker and/or a serological marker. As mentioned in the introductory pages it is.
~o important for the health management of pigs to be able to distinguish between the less virulent live vaccine strain of the pharmaceutical~composition and the virulent wild type virus infections. This is often difficult, especially wc~hen clinical symptoms of a field infection are not that specific or superimposed by other infections or the time period for observation and evaluation is short. Thenecombinant generation of the viruses of interest allows for the introduction of modifications in the genetic code that establishes a serological marker and/or a virulence marker. A serological. marker refers to an antigenically detectable .molecule such as a peptide, a protein, glycoprotein that can be . E
isolated from infected cells or body fluids such as but not limited to pharyngeal or nasal fluids or urine. A virulence marker is to be understood as a marker in the genetic code that 2o can be identified by recombinant analytical methods such as but not limited to PCR and conventional sequencing. Therefore, in a preferred embodiment, the present invention relates to a nucleotide sequence according to the invention; wherein the nucleotide sequence has been modified to encode a virulence marker and/or a serological marker.
Particularly, the mutations or deletions introduced for the purpose of attenuating the 2s virusare useful as virulence and serological markers. By monitoring these mutations in the disclosed virulence specific sites it is possible to predict the emergence of possibly virulent revenants at an early stage.
Yet another preferred embodiment of the present invention is a nucleotide sequence so according to the invention, wherein the nucleic acid encoding said marker is located within any of the open reading frames encoding structural viral proteins.
In another aspect, the invention relates to a method for the generation of an infectious live attenuated PRRS virus, said method comprising producing a recombinant nucleic acid comprising at least one full-length DNA copy or in vitro-transcribed RNA copy or a derivative of either said DNA or RNA whereby said nucleotide sequence is a nucleotide sequence according to the invention. Thus, according to the invention, the method leads to a PRRS virus as described above. The. artisan may employ site-directed mutagenesis s (Sambrook et a1.(1989) Molecular Cloning: A Laboratory Manual, 2"d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.; Chapter 15; Wu (ed.) (1993), Methods in Enzymology Vol 217, p. 173-285) or 'any other method to insert mutations) to specifically insert mutations) to obtain a PRRS virus as disclosed above.
~o The method disclosed in the following preferred aspect will lead (at the genomic level) to the PRRS virus according to the invention as described supra. Thus, in another preferred aspect, the invention relates to a method as described for the generation of an infectious ~ .
live attenuated PRRS virus; said method is characterized by the following steps:
a) a PRRS virus according to the invention is used to infect a suitable cell line 15 ~ b). said PRRS virus is further attenuated via cell culture passages.
. ~ In another preferred aspect, the invention relates to a methodwas described, wherein saidv . ..
cell line is an embryonic monkey kidney cell or preferred a Marc cell or a derivative therof (see below):
In another preferred aspect, the invention relates to a method as described, wherein said PRRS virus is or are the viruses) according to the invention as disclosed supra.
In a further aspect, the present invention relates to a cell line comprising a PRRS virus Zs according to the invention. Examples for such cell lines include permanent cell lines known to the artisan, preferably porcine, monkey or human cell lines such as human embryonic kidney (HEK) 293, BHK, GH3, H4, U373, NT2, PC12, COS, CHO, Ltk-, fibroblasts, myelomas, neuroblastomas, hybridomas, oocytes, embryonic stem cells), insect cell lines (e.g., using baculovirus vectors such as pPbac or pMbac (Stratagene, La Jolla, 3o USA)), yeast (e.g., Pichia pastoris or using yeast expression vectors such as pYESHIS
(Invitrogen, San Diego, USA)), and fungi.

In a further preferred aspect, the present invention relates to a cell line according to the invention, wherein said cell line is an embryonic monkey kidney cell or preferred a Marc cell or a derivative therof.
s In a further aspect, the present invention comprises a method or process of attenuation of a.
European PRRS virus, characterised in that . a) . the nucleotide sequence of said~virus is modified by site-directed mutagenesis at at ~.
least one of the positions of ORF2 corresponding to positions 130 to 150 and/or positions 252 to 272 and/or positions 273 to 293 of SEQ ID NO: 22;
~o b). it is tested~whether the resulting PRRS virus is attenuated.
In this context, a position within a nucleic acid or amino acid sequence "corresponding to".
a position of another sequence shall mean that, if the two sequences have sufficient structural similarity to be aligned with a standard.alignment algorithm like BLAST
(Altschul, S.F:, Gish, W., Miller; W.,'Myers, E.W: & Lipman, D.J. (1990) "Basic local alignment search tool." J. Mol. Biol. 215:403-410; Gish, W. & States, D.J.
(1993) "Identification of protein coding regions by database similarity search."
Nature Genet. . , 3:266-272; Madden, T.L., Tatusov, R.L. & Zhang; J. (1996) "Applications of network BLAST server" Meth. Enzymol. 266:131-141; Zhang, J. & Madden, T.L. (1997) ' 20 "PowerBLAST: A new network BLAST application for interactive or automated sequence ' ' analysis and annotation." Genome Res. 7:649-656; Altschul, Stephen F., Thomas L.
Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang; Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402), and such an alignment is done, the zs two positions would be aligned as a pair.
In a further embodiment, the present invention relates to a method of attenuation of a European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at .
so least one of the positions of ORF3 corresponding to positions 267 to 287 of SEQ
ID NO: 23_;
b) it is tested whether the resulting PRRS virus is attenuated.

In a further embodiment, the present invention relates to a method of attenuation of a European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at least one of the positions corresponding to positions 201 to 221 of ORES
according s to SEQ m NO: 24;
b) it is tested whether the resulting PRRS virus is attenuated.
Preferably, a modification as described above results in a change of the amino acid sequence of the encoded protein. Preferably, the modification is a deletion or a .. . ~o substitution. In a preferred embodiment, the sequence of each of ORF2, ORF3, .and ORFS
is modified. In asnother preferred embodiment, the sequence of ORF2 is modified at least at two,,preferably at least at three positions. Preferably, the modification results in one or.
more of the following features: an ORF2 encoding a protein having the amino acid at one or more of amino acid sequence positions corresponding to positions 47, 88 and/or 95 of .
15 - the amino acid sequence encoded by SEQ ID NO: 22 substituted or deleted;
an. ORF3 encoding a protein having the amino acid corresponding to position 93 of the amino acid sequence encoded by SEQ ID NO: 23 substituted or deleted; and/or an ORFS
encoding a protein;having the amino acid corresponding to position 71 of the amino acid sequence encoded by SEQ m NO: 24 substituted or deleted.
2p More preferably, the modification made by such method results in one or more, preferably all of the following features: an ORF2 encoding a protein having serine at the position corresponding to position 47 of the amino acid sequence encoded by SEQ ID NO:
22, an ORF2 encoding a protein having phenylalanine at the position corresponding to position 88 2s of the amino acid sequence encoded by SEQ m NO: 22, an ORF2 having leucine at the postion corresponding to position 95 of the amino acid sequence encoded by SEQ
m NO:
22, an ORF3 having proline at the position corresponding to position 93 of the amino acid sequence encoded by SEQ ID NO: 23, and/or an ORFS having phenylalanine at the position corresponding to position 71 of the amino acid sequence encoded by SEQ >D NO:
so 24.
In preferred embodiments, the modification results in one or more, preferably all of the following features: an ORF2 having a C at the position corresponding to position 140 if SEQ m NO: 22, an ORF2 having a T at the position corresponding to position 262 of SEQ

m NO: 22, an ORF2 having a C at the position corresponding to position 283 of SEQ ID
NO: 22, an ORF3 having a C at the position corresponding to position 277 of SEQ ID NO:
23, and/or an ORES having a T at the position corresponding to position 211 of SEQ m NO: 24.
In a further embodiment, the present invention relates to an attenuated European PRRS
virus obtainable by a method described above.
In a further embodiment, the present invention relates to an attenuated European PRRS
~o virus having an ORF2 which differs from SEQ )D NO: 22 at one or more of positions 130 to 150, and/or at one or more of positions 252 to ,272, and/or at one or more of positions -273 to 293. .. -In a further embodiment, the present invention relates to an attenuated European PRRS .
virus having an ORF3 which differs from SEQ IP NO: 23 at one or more of positions 267 -to 287.
In a~ further embodiment, the present invention relates to an attenuated European PRRS
virus having an ORFS which differs from SEQ ID NO: 24 at one or more of positions 201 2o to 221.
In a further embodiment, the present invention relates to a vaccine comprising an attenuated European PRRS virus as described above in combination with a pharmaceutically acceptable Garner. In a further embodiment, the present invention relates Zs to a method of vaccination of a pig against PRRS, characterised in that an efficient amount of such vaccine is adminstered to said pig. Alternatively, the present invention relates to the use of an attenuated European PRRS virus as disclosed for the manufacture of a vaccine against PRRS.
so Preferably, the live attenuated PRRS virus may be used for the treatment, prophylaxis or diagnosis of diseases caused by wild-type PRRS virus. Such diseases and uses are exemplified in example 1. A further aspect of the invention relates to the use of the viruses of the invention. Their defined molecular basis of attenuation makes them superior to viruses known in the art. Especially the use of viruses according to the invention that comprise deletions in the virulence specific sites is preferred since deletions are less prone to revert.
Another preferred embodiment of the present invention is a pharmaceutical composition s comprising one or several PRRS viruses) according to the invention and a pharmaceutically acceptable carrier. A preferred aspect is a pharmaceutical composition comprising not only said European PRRS virus according to the invention, but also an attenuated US PRRS virus such as the virus which is sold in a pharmaceutical composition under the trade name RespPRRS/Ingelvac~ PRRS MLV, Boehringer Ingelheim. A
~o pharmaceutically acceptable Garner can contain physiologically acceptable compounds that act, for example, to stabilize or to increase the absorption or form part of a slow release ~- .
formulation of the PRRS virus according to the invention. Such physiologically acceptable compounds include, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants, such as ascorbic acid o'r glutathione, chelating 'agents; low molecular weight ~s proteins or other stabilizers or excipients (see also e.g. Remington's Pharmaceutical Sciences (1990). l~8th ed. Mack Publ., Easton). One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on~the route of administration of the composition. Most preferably, the composition is formulated by obtaining the virus-containing supernatant ' .
20 (tissue culture fluid) of an infected cell culture and freeze drying said supernatant, optionally after addition of a stabilisator. The freeze-dried composition may be reconstituted with water prior to administration. In another example, ; a suitable carrier would be a physiological salt solution. Preferably; the pharmaceutical composition is injected intramuscularly or intradermally. The vaccine according to the invention can be 2s administered to pigs depending on the vaccination history of the sows at 1, 3, 6 or 10 weeks of age, to sows before mating and/or up to 6 weeks before farrowing (booster vaccination), or to boars each half a year (boosters).
Another preferred embodiment of the present invention is the use of a PRRS
virus so according to the invention in the manufacture of a vaccine for the prophylaxis and ' treatment of PRRS infections.
The following example serves to further illustrate the present invention; but the same should not be construed as limiting the scope of the invention disclosed herein.

Example 1 Establishment of attenuation This example provides a clear guidance for the comparison of the virulent character of two s different strains of PRRS viruses. As reference strain for a typical virulent European strain can serve a low cell culture passage (not more than 5) of the Lelystad Agent (CDI-NL-2.91).
At least 10 gilts per group are included in each trial, which are derived from a PRRS free ~o farm. Animals are tested free of PRRS virus specific serum antibodies and negative for PRRSV. All animals included in the trial are of the same source and breed and from a farm historically free of any PRRSV infection. The animals allocation to the groups is .. , randomized. Challenge is performed at day ~5-90 of pregnancy with intranasal application.
of 1 ml PRRSV .with 105 TDCIDso (third passage) per nostril. There are at least three ~s groups for each test setup:
One group for challenge Lelystad Agent (CDI-NL-2.91) ; one test group for challenge with the possibly attenuated virus; and one strict control group. .. .
20. . Validity of the study is given when the strict controls stay PRRS
negative over the time course of the study and at least 25% less life healthy piglets are born compared to the the strict controls in the Lelystad agent challenged group.
Attenuation, in other words less virulence, is defined as the statistical significant change of 25 one or more parameters determining reproductive performance:
Significant reduction in at least one of the following parameters for the test group is preferred:
' frequency of stillborns so ' abortion at or before day 112 of pregnancy ' number of mumified piglets ' number of life and weak piglets preweaning mortality or furthermore a significant increase in one of the following parameters for the test group is preferred:
' number of piglets weaned per sow ' number of life healthy piglets born per sow ' compared to the Lelystad agent infected group.
In an examplary manner the following results can be obtained in a clinical trial according to the given description with the 147th cell culture passage of the Lelystad agent:
Passagelive live/weakstillbornMummifie average of ' level /healthy' d born 'liters per sow , 305% 45,5% 17;9% 6,2% 11 147 71,9% 10,5% 17,54% 0 f1,4 Individual sow reproductive performance data from sows being inocculated as described .
'' above'with cell culture passage's Lelystad agent (group 1) and cell culture passage 147 of Lelystad agent (group 2)are' given. In addition group 3 animals served as strict controls and ~s ' were only inocculated with PRRSV free cell culture supernatant:

Group Passage DurationTotal Live Live/ StillbornMummi level of of No. /HealthyWeak fled inocculum gestationof born in days piglets Average 11 2,8 5,6 2,0 0,6 group 100 30,5 45,5 17,9 6,2 2 147 115 13 , 11 1 1 0 Average 11,4 8,2 1,2 2 0 group 100 71,93 10,53 17,54 0 Average 11,7 9,8 1,8 0 0 group a/o 100 86,1 13,9 0 0 SEQUENCE LISTING
<110> Boehringer Ingelheim Vetmedica GmbH
<120> Life attenuated PRRS virus <130> 1-1176 <160> 29 <170> PatentIn Ver. 2.1 <210> 1 .
<211> 750 ' <212> DNA
<213> Porcine reproductive and respiratory syndrome virus <400> 1 atgcaatggg gttactgtgg agtaaaatca gccagctgtt cgtggacgcc ttcactgagt 60,~:
tccttgttag tgtggttgat attgttattt tccttgccat actgtttggg ttcaccgtcg 120 caggatggtt actggtcttc cttctcagag tggtttgctc cgcgcttctc cgttcgcgct 180 ctgccattca ctctcccgaa ctatcgaagg tcctatgaag gcttgttgcc caactgcaga 240 ccggatgtcc cacaatttgc attcaagcac ccattgggta tgctttggca catgcgagtt 300.
tcccaattaa ttgatgagat ggtctctcgt cgcatttacc agaccatgga acattcaggt 360 caagcggcct ggaagcaggc ggttggtgag gccactctca cgaagctgtc aaggctcgat 420 atagttactc atttccaaca cctggccgca gtagaggcgg attcttgccg ctttctcagc 480 tcacgactcg tgatgctaaa aaatcttgcc gttggcaatg tgagcctaca gtacaacacc 540 acgttggacc gcgttgagct catcttcccc acgccaggta cgaggcccaa gttgaccgac 600 ttcagacaat ggctcatcag tgtgcacgct tccatttttt cctctgtggc ttcatctgtt 660 accttgttca tagtgctttg gcttcgaatt ccag'ctctac gctatgtttt tggtttccat 720 tggcccacgg caacacatca ttcgagctga ~ 750 <210> 2 <211> 798 <212> DNA
<213> Porcine reproductive and respiratory.syndrome virus <400> 2 atggctcatc agtgtgcacg cttccatttt ttcctctgtg gcttcatctg ttaccttgtt 60 catagtgctt tggcttcgaa ttCCagCtCt acgctatgtt tttggtttcc attggcccac 120 ggcaacacat cattcgagct gaccatcaac tacaccatat gcatgccctg ttctaccagt 180 caagcggctc gccaaaggct cgagcccggt cgtaacatgt ggtgcaaaat agggtatgac 240 aggtgtgagg agcgtgacca tgatgagttg ttaatgccca tcccgtccgg gtacgacaac 300 ctcaaacttg agggttatta tgcttggctg gcttttttgt ccttttccta cgcggcccaa 360 ttccatccgg agttgttcgg gatagggaat gtgtcgcgcg tcttcgtgga caagcgacac 420 cagttcattt gtgccgagca tgatggacag aattcaaccg tatctaccgg acacaacatc 480 tccgcattat atgcggcata ttaccaccac caaatagacg ggggcaattg gttccatttg 540 gaatggctgc ggccactctt ttcctcctgg ctggtgctca atatatcatg gtttctgagg 600 cgttcgcctg taagccctgt ttctcgacgc atctatcaga tattgagacc aacacgaccg 660 cggctgccgg tttcatggtc cttcaggaca tcaattgtct ccgacctcac ggggtctcag 720 cagcgcaaga ggaaattccc ttcggaaagt cgtcccaatg tcgtgaagcc gtcggtactc 780 cccagtacat cacgataa 798 <210> 3 <211> 552 <212> DNA

<213> Porcine reproductive and respiratory syndrome virus <400> 3 atggctgcgg ccactctttt cctcctggct ggtgctcaat atatcatggt ttctgaggcg 60 ttcgcctgta agccctgttt ctcgacgcat ctatcagata ttgagaccaa cacgaccgcg 120 gctgccggtt tcatggtcct tcaggacatc aattgtctcc gacctcacgg ggtctcagca 180 gcgcaagagg aaattccctt cggaaagtcg tcccaatgtc gtgaagccgt cggtactccc 240 cagtacatca cgataacggc taacgtgacc gacgaatcat acttgtacaa cgcggacttg 300 ctgatgcttt CtgCgtgCCt tttCCa.CgCC tcagaaatga gcgagaaagg cttcaaagtt 360 atctttggga atgtctctgg cgttgtttcc gcttgtgtca atttcacaga ttatgtggcc 420 catgtgaccc aacataccca gcagcatcat ttggtaattg atcacattcg gttgctgcat 480 ttcctgacac catctgcaat gaggtgggct acaaccattg cttgtttgtt cgccattctc 540 ttggcgatat ga 552.
<210> 4 <211> 606 . .
<212> DNA , , <213> Porcine reproductive and respiratory syndrome virus <400> 4 atgagatgtt ctcacaaatt ggggcgtttc ttgactccgc actcttgctt ctggtggttt 60..' tttttgctgt gtaccggctt gtcctggtcc tttgccgatg gcaacggcaa cagctcgaca 120:
taccaataca,tatataactt gacgatatgc gagctgaatg ggaccgactg gttgtccagc 180.
cattttggtt gggcagtcga gacctttgtg ttttacccgg ttgccactca tatcctctca 240.:
ctgggttttc tcacaacaag ccattttttt gacgcgetcg,,gtctcggcgc.tgtatccact.300 gcaggatttg ttggcgggcg gtatgtactc tgcagCgtct acggcgcttg tgctttcgca 360 gcgttcgtat gttttgtcat ccgtgctgct aaaaattgca tggcctgccg ctatgcccgt 420:
acccggttta ccaacttcat tgtagacaac cgggggagag ttcatcgatg gaagtctcca 480 atagtggtag aaaaattggg caaagccgaa gtcgacggca acctcgtcac catcaaacat 540 gtcgtccteg aaggggttaa agctcaaccc ttgacgagga cttcggctga gcaatgggag 600 gcctag 606 <210> 5 <211> 14815 <212> DNA
<213> Porcine reproductive and respiratory syndrome virus <400> 5 gganacatac acgacacttc tagtgtttgt gtaccttgga ggcgtgggta cagccccgcc 60 CCaCCCCttg gCCCCtgttC tagCCCaaCa ggtatccttc tctctcgggg cgagtgcgcc 120 gcctgctgct cccttgcagc gggaaggacc tcccgagtat ttccggagag cacctgcttt 180 acgggatctc caccctttaa ccatgtctgg gacgttctcc cggtgcatgt gcaccccggc 240 tgcccgggta ttttggaacg ccggccaagt cttttgcaca cggtgtctca gtgcgcggtc 300 tcttctctct ccagagcttc aggacactga cctcggtgca gttggcttgt tttacaagcc 360 tagggacaag cttcactgga aagtccctat cggcatccct caggtggaat gtactccatc 420 cgggtgctgt tggctctcag ctgttttccc tttggcgcgt atgacctccg gcaatcacaa 480 cttcctccaa cgacttgtga aggttgctga tgttttgtac cgtgacggtt gcttggcacc 540 tcgacacctt cgtgaactcc aagtttacga gcgcggctgc aactggtacc cgatcacggg 600 gcccgtgccc gggatgggtt tgtttgcgaa ctccatgcac gtatccgacc agccgttccc 660 tggtgccacc catgtgttga ctaactcgcc tttgcctcaa caggcttgtc ggcagccgtt 720 ctgtccattt gaggaggctc attctagcgt gtacaggtgg aagaaatttg tggttttcac 780 ggactcctcc ctcaacggtc gatctcgcat gatgtggacg ccggaatccg atgattcagc 840 cgccctggag gtactaccgc ctgagttaga acgtcaggtt gaaatcctca ttcggagttt 900 tcctgctcat caccctgtcg acctggccga ctgggagctc actgagtccc ctgagaacgg 960 tttttccttc aacacgtctc attcttgcgg tcaccttgtc caaaaccccg acgtgtttga 1020 tggcaagtgc tggctctcct gctttttggg ccagtcggcc gaagtgcgct gccatgagga 1080 acatctagct gacgccttcg gttaccaaac caagtggggc gtgcatggta agtacctcca 1140 gcgcaggctt caagttcacg gcattcgtgc tgtagtcgat cctgacggtc ccattcacgt 1200 tgaagcgctg tcttgccccc agtcttggat caggcacctg actctgaatg atgatgtcac 1260 cccaggattc gttcgcctga catcccttcg cattgtgccg aacacagagc ctaccacttc 1320 ccggatcttt cggtttggag cgcataagtg gtatggcgct gccggcaaac gggctcgtgc 1380 taagcgtgcc gctaaaagtg agaaggattc ggctcccacc cccaaggttg ccctgcctgt 1440 ccccacctgt ggaattacca cctactctcc accgacagac gggtcttgtg gttggcatgt 1500 ccttgccgcc ataatgaacc ggatgataaa tggtgacttc acgtcccctc tgactcagta 1560 caacagacca gaggatgatt gggcttctga ttatgatctt gttcaggcga ttcaatgtct 1620 acaactgcct gctaccgtgg ttcggaatcg cgcctgtcct aacgccaagt accttataaa 1680 acttaacgga gttcactggg aggtagaggt gaggtctgga atggctcctc gctcccttcc 1740 tcgtgaatgt gtggttggcg tttgctctga aggctgtgtc gcaccgcctt atccagcaga 1800 CgggCtaCCt aaacgtgcac tcgaggcctt ggcgtctgct tacagactac cctccgattg 1860 tgttagctct ggtattgctg actttcttgc taatccacct cctcaggaat tctggaccct 1920 cgacaaaatg ttgacctccc cgtcaccaga gcggtccggc ttctctagtt tgtataaatt 1980 actattagag gttgttccgc aaaaatgcgg tgccacggaa ggggctttca tctatgctgt 2040 tgagaggatg ttgaaggatt gtccgagctc caaacaggcc atggcccttc tggcaaaaat 2100 taaagttcca tcctcaaagg ccccgtctgt gtccctggac gggtgtttcc ctacggatgt 2160 tccagccgac ttcgagccag catctccgga aaggccagct ggtctaatta acctggtagg 2220 cgggaatttg tccccctcag actccatgaa agaaaacatg ctcaatagcc gggaagacga 2280 accactggat ttgtcccaac cagcaccagc tgccacaacg acccttgtga gagagcaaac 2340 acccgacaac ccaggttctg atgccggtgc cctccccgtc accgttcgag.aatttgtccc 2400 gacggggcct atactccgtc atgttgagca ctgcggcacg gagtcgggcg;acagcagttc 2460-gcctttggac cagtctgatg cgcaaaccct ggaccagcct ttaaatctat ccctggccgc 2520 ttggccagtg agggccaccg cgtctgaccc tggctgggtc cacggtaggc gcgagcctgt 2580:
ttttgtaaag cctcgaaatg ctttctctga tggcgattca gcccttcagt tcggggagct 2640, ttctgaatcc agccctgtca tcgagtttga ccggacaaaa gatgctccgg tggttgacgc 2700 .ccctgtcgac ttgacgactt cgaacgaggc cctctctgta gtcgaccctt tcgaatttgc 2760 cgaactcaag cgcccgcgtt tctccgcaca agccttaatt gaccgaggcg gtccacttgc 2820 cgatgtccat gcgaaaataa agaaccgggt atatgaacag tgcctccaag cttgtgagcc 2880 cggtagtcgt gcaaccccag ccaccaggga gtggctcgac aaaatgtggg atagggtgga 2940 catgaaaact tggcgctgca cctcgcagtt ccaagctggt cgcattcttg cgtccctcaa 3000 attcctccct gacatgattc aagacacacc gcctcctgtt cccaggaaga accgagctag 3060 tgacaatgcc ggcctgaagc aaccggtggc acagtgggat aggaaattga gtgtgacccc 3120 ccccccaaaa ccggttgggc cagtgcttga ccagaccgtc cctccgccta cggatatcca 3180 gcaagaagat gtcaccccct ccgatgggcc accccatgcg ccggattttc ctagtcgagt 3240 gagcacgggc gggagttgga aaggccttat gctttccggc acccgtctcg cggggtctat 3300 cagtcagcgc ctcatgacat gggtttttga agttttctcc cacctcccag cttttatgct 3360 cacacttttc tcgccacggg gctetatggc tccaggtgat tggttgtttg caggtgtcgt 3420 -.tttactcgct ctcttgctct gtcgttctta cccgatactc ggatgccttc ccctattggg 3480 tgtcttttct ggttctttgc ggcgtgttcg tctgggtgtt tttggttctt ggatggcttt 3540 tgctgtattt ttattctcga ctccatccaa cccagtcggt tcttcttgtg accacgattc 3600 gccggagtgt catgctgagc ttttggctct tgagcagcgc caactttggg aacctgtgcg 3660 CggCCttgtg gtCggCCCCt-CgggCCtCtt atgtgtcatt cttggcaagt tactcggtgg 3720 gtcacgttat ctctggcatg ttttcctacg tttatgcatg cttgcggatt tggccctttc 3780 tcttgtttat gtggtgtccc aggggcgttg tcacaagtgt tggggaaagt gtataaggac 3840 agctcctgcg gaggtggctc ttaatgtatt tcctttcttg cgcgccaccc gtgcctctct 3900 tgtatccttg tgtgatcgat tccaaacgcc aaaaggggtt gatcctgtgc acttggcaac 3960 gggttggcgc gggtgctggc gtggtgagag tcccattcat caaccacacc aaaagcccat 4020 agcttatgcc aatttggatg aaaagaaaat atctgctcaa acggtggttg ctgtcccata 4080 cgatcccagt caggctgtca aatgcctgaa agttctgcag gcgggagggg ctatcgtgga 4140 ccagcctaca cctgaggtcg ttcgcgtgtc cgagatcccc ttctcagccc catttttCCC 4200 aaaagttcca gtcaacccag attgcagggt tgtggtagat tcggacactt ttgtggctgc 4260 ggtccgctgc ggttactcga cagcacaact ggtcctgggc cggggcaact ttgccaagtt 4320 aaatcagacc ccccccagga actctatctc caccaaaacg actggtgggg cctcttacac 4380 ccttgctgtg gctcaagtgt ctgcgtggac tcttgttcat ttcatcctcg gtctttggtt 4440 cacatcacct caagtgtgtg gccgaggaac cgctgaccca tggtgttcaa atcctttttc 4500 atatcctacc tatggccccg gagttgtgtg ctcctctcga ctttgtgtgt ctgccgacgg 4560 ggtcaccctg ccattgttct cagccgtggc acaactctcc ggtagagagg tggggatttt 4620 tattttggtg ctcgtctcct tgactgcttt ggcccaccgc atggctctta aggcagacat 4680 gttagtgatc ttttcggctt tctgtgctta cgcctggccc atgagctcct ggttaatctg 4740 cttctttcct atactcttga agtgggttac ccttcaccct ctcactatgc tttgggtgca 4800 ctcattcttg gtgttttgtc tgccagcagc cggcatcctc tcactaggga taactggcct 4860 tctctgggca attggccgct ttacccaggt tgccggaatt attacacctt atgacatcca 4920 ccagtacacc tctgggccac gtggtgcagc tgctgtggcc acagccccag aaggca~tta 4980 ;tatggccgcc gtccggagag ctgctttaac tgggcgaact ttaatcttca ccccgtctgc 5040 agttggatcc cttctcgaag gtgctttcag gactcataaa ccctgcctta acaccgtgaa 5100 tgttgtaggc tcttcccttg gttccggagg ggttttcacc attgatggca gaagaactgt 5160 cgtcactgct gcccatgtgt tgaacggcga cacagctaga gtcaccggcg actcctacaa 5220 ccgcatgcac actttcaaga ccaatggtga ttatgcctgg tcccatgctg atgactggca 5280 gggcgttgcc cctgtggtca.aggttgcgaa ggggtaccgc ggtcgtgcct actggcaaac 5340 atcaactggt gtcgaacccg gtatcattgg ggaagggttc gccttctgtt ttactaactg 5400 tggcgattcg gggtcacccg tcatctcaga atctggtgat cttattggaa tccacaccgg 5460 ~ttcaaacaaa cttggttctg gtcttgtgac aacccctgaa ggggagacct gcaccatcaa 5520 agaaaccaag ctctctgacc tttccagaca ttttgcaggc ccaagcgttc ctcttgggga 5580 cattaaatag agtccggcca tcatccctga tgtaacatcc attccgagtg acttggcatc 5640 gctcctagcc tCCgtCCCtg tagtggaagg cggcctctcg accgttcaac ttttgtgtgt 5700 ;.ctttttcctt ctctggcgca tgatgggcca tgcctggaca cccattgttg ccgtgggctt 5760 ctttttgctg aatgaaattc.ttccagcag't tttggtccga gccgtgtttt cttttgcact 5820 ctttgtgctt gcatgggcca ccccctggtc tgcacaggtg tt.gatgatta gactectcac 5880 .ggcatctctc aaccgcaaca agctttctct ggcgttctac gcactcgggg gtgtcgtcgg~5940 ~,tttggccgct gaa-atcggga cttttgctgg cagattgtct gaattgtctc aagctc.tttc 6000, gacatactgc ttcttaccta gggtccttgc tatgaccagt tgtgttccca ccatcatcat 6060, cggtggactc cataccctcg gtgtgattct gtggttattc aaataccggt gcctccacaa 6120 catgctggtt ggtgatggga gtttctcaag cgccttcttc ctacggtatt ttgcagaggg 6180, taatctcaga aaaggtgttt cacagtcctg tggcatgaat aacgagtccc taacggctgc 6240 tttagcttgc aagttgtcac aggctgacct tgattttttg tccagcttaa cgaacttcaa 6300 gtgctttgta tctgcttcaa acatgaaaaa tgctgccggc cagtacattg aagcagcgta 6360 tgccaaggcc ctgcgccaag agttggcctc tctagttcag attgacaaaa tgaaaggagt 6420 tttgtccaag ctcgaggcct ttgctgaaac agccaccccg tcccttgaca taggtgacgt '6480 gattgttctg cttgggcaac atcctcacgg atccatcctc gatattaatg tggggactga 6540 aaggaaaact gtgtccgtgc aagagacccg gagcctaggc ggctccaaat tcagtgtttg 6600 tactgtcgtg tccaacacac ccgtggacgc cttaaccggc atcccactcc agacaccaac 6660 ccctcttttt gagaatggtc cgcgtcatcg cagcgaggaa gacgatctta aagtcgagag 6720 gatgaagaaa cactgtgtat ccctcggctt ccacaacatc aatggcaaag tttactgcaa 6780 aatttgggac aagtctaccg gtgacacctt ttacacggat gattcccggt acacccaaga 6840 ccatgctttt caggacaggt cagccgacta cagagacagg gactatgagg gtgtgcaaac 6900 cgccccccaa cagggatttg atccaaagtc tgaaaccccg gttggcaccg ttgtgatcgg 6960 cggtattacg tataacaggt atctgatcaa aggtaaagag gttctggttc ccaagcctga 7020 caactgcctt gaagctgcca agctgtccct tgagcaagct ctcgctggga tgggccaaac 7080 ttgcgacctt acagctgccg aggtggaaaa gctaaagcgc atcattagtc aactccaagg 7140 cttgaccact gaacaggctt taaactgtta gccgccagcg gcttgacccg ctgtggccgc 7200 ggcggcctag ttgtaactga aacggcggta aaaattataa aataccacag cagaactttc 7260 accttaggcc ctttagacct aaaagtcact tccgaggtgg aggtaaagaa atcaactgag 7320 cagggccacg ctgttgtggc aaacttatgt tccggtgtca tcttgatgag acctcaccca 7380 ccgtcccttg ttgacgttct tctgaaaccc ggacttgata caacacccgg cattcaacca 7440 gggcatgggg ccgggaatat gggcgtggac ggttctattt gggattttga aaccgcaccc 7500 acaaaggcag aactcgagtt atccaagcaa ataatccaag catgtgaagt taggcgcggg 7560 gacgccccga acctccaact cccttacaag ctctatcctg ttagggggga tcctgagcgg 7620 cataaaggcc gccttatcaa caccaggttt ggagatttac cttacaaaac tcctcaagac 7680 accaagtccg caatccacgc ggcttgttgc ctgcacccca acggggcccc agtgtctgat 7740 ggtaaatcca cactaggtac cactcttcaa catggtttcg agctttatgt ccctactgtg 7800 ccctatagtg tcatggagta ccttgattca cgccctgaca ccccttttat gtgtactaaa 7860 catggcactt ccaaggctgc tgcagaggac ctccaaaaat acgacctatc cacccaagga 792.0 tttgtcctgc ctggggtcct acgcctagta cgcagattca tctttggcca tattggtaag 7980 gcgccgccat tgttcctccc atcaacttat cccgccaaga actctatggc agggatcaat 8040 ggccagaggt tcccaacaaa ggacgttcag agcatacctg aaattgatga aatgtgtgcc 8100 cgcgccgtca aggagaattg gcaaactgtg acaccttgta ccctcaagaa acagtactgt 81'60 tccaagccca aaaccaggac catcctgggc accaacaact ttattgcctt ggctcacaga 8220 tcggcgctca gtggtgtcac ccaggcattc atgaagaagg cttggaagtc cccaattgcc 8280 ttggggaaaa acaaattcaa ggagctgcat tgcactgtcg ccggcagatg tcttgaggcc 8340 gacttggcct cctgtgaccg cagcaccccc gccattgtaa gatggtttgt tgccaacctc 8400 ctgtatgaac ttgcaggatg tgaagagtac ttgcctagct atgtgcttaa ttgctgccat 8460 gacctcgtgg caacacagga tggtgccttc acaaaacgcg gtggcctgtc gtccggggac 8520 cccgtcacca gtgtgtccaa caccgtatat tcactggtaa tttatgccca gcacatggta 8580 ttgtcggcct tgaaaatggg tcatgaaatt ggtcttaagt tcctcgagga acagctcaaa 8640 ttcgaggacc tccttgaaat tcagcctatg ttggtatact ctgatgacct tgtcttgtac 8700 gctgaaagac ccacctttcc caattaccac tggtgggtcg agcaccttga cctgatgctg 8760 ggtttcagaa cggacccaaa gaaaaccgtc ataactgata aacccagctt cctcggctgc 8820.
agaattgagg cagggcgaca gctagtcccc aatcgcgacc gcatcctggc tgctcttgca 8880.
tatcacatga aggcgcagaa cgcctcagag tattatgcgt ctgctgccgc aatcctgatg-894~0 gattcatgtg cttgcattga ccatgaccct gagtggtatg aggacctcat ctgcggtatt 9.000 gcccggtgcg cccgccagga tggttatagc ttcccaggtc cggcattttt catgtccatg 9060 tgggagaagc tgagaagtca taatgaaggg aagaagttcc gc.cactgcgg catctgcgac 9120.
gccaaagc.cg actatgcgtc cgcctgtggg cttgatttgt gtttgttcca ttcgcacttt 9180' catcaacact gccctgtcac tctgagctgcggtcaccatg ccggttcaaa ggaatgttcg 924~0~
cagtgtcagt cacctgttgg ggctggcaga tcccctcttg atgccgtgct aaaacaaatt 9300' -ccatacaaac ctcctcgcac tgtcatcatg aaggtgggta ataaaacaac ggccctcgat 9360°
ccggggaggt accagtcccg tcgaggtctc gttgcagtca agaggggtat tgcaggcaat.942-0' gaagttgatc tttctgatgg agactaccaa gtggtgcctc ttttgccgac ttgcaaagac 9480.
ataaacatgg,tgaaggtggc ttgcaatgta ctactcagca agttcatagt agggccacca 9540v . ggttccggaa agaccacctg gctactgagt caagtccagg acgatgatgt catttacaca 9600 cccacccatc..agactatgtt tgatatagtc agtgctctca aagtttgcag gtattccgtt 9660v ccaggagcct caggactccc tttcccacca cctgccaggt cegggccgtg ggttaggctt 9720 attgccagcg ggcacgtccc tggccgagta tcatacctcg atgaggctgg atattgtaat 9780 catctggaca ttcttagact gctttccaaa acaccccttg tgtgtttggg tgaccttcag 9840 caacttCacC ctgtcggctt tgattcctrc tgttatgtgt tcgatcagat gcctcagaag 9900 cagctgacca ctatttacag atttggccct aacatttgcg cagccatcca gccttgttac 9960 agggaaaaac ttgaatctaa ggctaggaac accagggtgg tttttaccac ccggcctgtg ioo2o gcctttggtc aggtgctgac accataccat aaagatcgca tcggctctgc gataaccata looso gattcatccc agggggccac ctttgatatt gtgacattgc atctaccatc gccaaagtcc 10140 ctaaataaat cccgagcact tgtagccatc actcgggcaa gacacgggtt gttcatttat 10200 gaccctcata accagctcca ggagtttttc aatctaaccc ctgagcgcac tgattgtaac 10260 cttgtgttca gctgtgggga tgagctggta gttctgaatg cggataatgc agtcacaact 10320 gtagcgaagg ccctagagac aggtccatct cgatttcgag tatcagaccc gaggtgcaag lo3so tctctcttag ccgcttgttc ggccagtctg gaagggagct gtatgccact accgcaagtg 10440 gcacataacc tggggtttta cttttccccg gacagtccag tatttgcacc tctgccaaaa 10500 gagttggcgc cacattggcc agtggttacc caccagaaca atcgggcgtg gcctgatcga 10560 cttgtcgcta gtatgcgccc aattgatgcc cgctacagca agccaatggt cggtgcaggg 10620 ~tatgtggtcg ggccgtccac ctttcttggt actcctggcg tggtgtcata ctatctcaca lo6so ctatacatca ggggtgaacc tcaggccttg ccagaaacac tcgtttcaac aggacgtata 10'740 gccacagatt gtcgggagta tctcgacgcg gctgaggaag aggcagcaaa agaactcccc los0o cacgcattca ttggcgatgt caaaggtacc acggtggggg ggtgtcatca cattacatca los6o aaatacctac etaggtcect gcctaaggac tctgttgceg tagttggagt aagttcgccc 10920 ggcagggctg ctaaagccgt gtgcactctc accgatgtgt acctccccga actccggcca lo9so tatctgcaac ctgagacggc atcaaaatgc tggaaactca aattagactt cagggacgtc 11040 cgactaatgg tctggaaagg agccaccgcc tatttccagt tggaagggct tacatggtcg 11100 gcgctgcccg actatgccag gtttattcag ctgcccaagg atgccgttgt atacattgat 11160 ccgtgtatag gaccggcaac agccaaccgt aaggtcgtgc gaaccacaga ctggcgggcc 11220 gacctagcag tgacaccgta tgattacggc gcccagaaca ttttgacaac agcctggttc 112s0 gaggacctcg ggccgcagtg gaagattttg gggttacagc cctttaggcg agcatttggc 11340 tttgaaaaca ctgaggattg ggcaatcctt gcacgccgta tgaatgacgg caaggactac 11400 actgactata actggaactg tgttcgagaa cgcccacacg ccatctacgg gcgtgctcgt 11450 gaccatacgt atcattttgc ccctggcaca gaattgcagg tagagctagg taaaccccgg 11520 ctgccgcctg ggcaagtgcc gtgaattcgg agtgatgcaa tggggttact gtggagtaaa 11580 atcagccagc tgttcgtgga cgccttcact gagttccttg t agtgtggt tgatat-tgtt 11640 ~attttccttg ccatactgtt tgggttcacc gtcgcaggat ggttactggt cttccttctc 1100 agagtggttt gctccgcgct tctccgttcg cgctctgcca ttcactctcc cgaactatcg 1150 aaggtcctat gaaggcttgt tgcccaactg cagaccggat gtcccacaat ttgcatacaa 11s20 gcacccattg ggtatgcttt ggcacatgcg agtttcccaa ttaattgatg agatggtctc ll,sso tcgtcgcatt taccagacca tggaacattc aggtcaagcg gcctggaagc aggcggttgg 11.940 tgaggccact ctcacgaagc tgtCaaggct cgatatagtt actcatttcc aacacetggc 12000 -cgcagtagag gcggattctt'gccgctttct cagctcacga ctcgtgatgc taaaaaatct 12060 ,tgccgttggc aatgtgagcc tacagtacaa caccacgttg gaccgcgttg agctcatctt 12120 - ~ccccacgcca ggtacgaggc ccaagttgac cgacttcaga caatggctca tcagtgtgca 121s0 CgCttCCatt ttttCCtCtg tggcttcatc tgttaccttg ttcatagtgc tttggcttCg 12240 ~~aattccagct ctacgctatg ttttggttt ccattggccc acggcaacac atcattcgag 12300 ctgaccatcaactacaccat .atgcatgccc tgttctacca gtcaagcggc tcgccaaagg 12360 ctcgagcccg gtcgtaacat gtggtgcaaa atagggtatg acaggtgtga ggagcgtgac 12420 ~catgatgagt tgttaatgcc.catcccgtcc gggtacgaca,acctcaaact tgagggttat.12480.
.tatgcttggc tggctttttt gtccttttcc tacgcggccc aattccatcc ggagttgttc 12540 gggataggga atgtgtcgcg cgtcttcgtg gacaagcgac accagttcat ttgtgccgag 12500 catgatggac agaattcaac cgtatctacc ggacacaaca.tctccgCatt atatgcggca 12660 attaccacc-,accaaataga cgggggcaa,t tggttccatt~tggaatggct gcggccactc 1220 wttttcctcct ggCtggtgct caatatatca tggtttctga ggcgttcgcc tgtaagccct l2~so ,gtttctcgac:gcatc.tatca gatattgaga ccaacacgac cgCggctgcc ggtttcatgg 12s40 tccttcagga cat.caattgt.ctccgacctc acggggtctc agcagcgcaa gaggaaattc 12900 ccttcggaaa gtcgtcccaa tgtcgtgaag ccgtcggtac tccccagtac atcacgataa 12960 cggctaacgt gaccgacgaa tcatacttgt acaacgcgga cttgctgatg ctttctgcgt 13020 gccttttcca cgcctcagaa atgagcgaga aaggcttcaa agttatcttt gggaatgtct l3oso ;c,tggcgttgt ttCCgcttgt gtcaatttca cagattatgt ggcccatgtg acccaacata 13140 ,cccagcagca tcatttggta~attgatcaca ttcggttgct gcatttcctg acaccatctg 13200 caatgaggtg ggCtacaacc~attgcttgtt tgttcgccat tctcttggcg atatgagatg 13260 ttctcacaaa ttggggcgtt tcttgactcc gcactcttgc ttctggtggt tttttttgct 13320 gtgtaccggc ttgtcctggt cctttgccga tggcaacggc aacagctcga cataccaata 13380 catatataaC ttgacgatat gcgagctgaa tgggaccgac tggttgtcca gccattttgg 13440 ttgggcagtc gagacctttg tgttttaccc ggttgccact catatcctct cactgggttt 13500 tctcacaaca agccattttt ttgacgcgct cggtctcggc gctgtatcca ctgcaggatt 13550 tgttggcggg cggtatgtac tctgcagcgt ctacggcgct tgtgctttcg cagcgttcgt 13620 atgttttgtc atccgtgctg ctaaaaattg catggcctgc cgctatgccc gtacccggtt 1380 taccaacttc attgtagaca accgggggag agttcatcga tggaagtctc caatagtggt 13740 agaaaaattg ggcaaagccg aagtcgacgg caacctcgtc accatcaaac atgtcgtcct 13800 cgaaggggtt aaagctcaac ccttgacgag gacttcggct gagcaatggg aggcctagac 13860 gatttttgca acgatcctat cgccgcacaa aagctcgtgc tagcctttag catcacatac 13920 acacctataa tgatatacgc ccttaaggtg tcacgcggcc gactcctggg gctgttgcac 139s0 ~atcctaatat ttctgaactg ttcctttaca ttcggataca tgacatatgt gcattttcaa 14040 ~tccaccaacc gtgtcgcact taccctgggg gctgttgtcg cccttctgtg gggtgtttac 14100 agcttcacag aatcatggaa gtttatcact tCCagatgca gattgtgttg ccttggccgg 14160 cgatacattc tggcccctgc ccatcacgta gaaagtgctg caggtctcca ttcaatctca 14220 gcgtctggta accgagcata cgctgtgaga aagcccggac taacatcagt gaacggcact 142s0 ctagtaccag gacttcggag cctcgtgctg ggcggcaaac gagctgttaa acgaggagtg 14340 gttaacctcg tcaagtatgg ccggtaaaaa ccagagccag aagaaaaaga aaagtacagc 14400 tccgatgggg aatggccagc cagtcaatca actgtgccag ttgctgggtg caatgataaa 14460 gtcccagcgc cagcaaccta ggggaggaca ggccaaaaag aaaaagcctg agaagccaca 14520 w.ttttcccctg gctgctgaag atgacatccg gcaccacctc acccagactg aacgct~cect 14580 ctgcttgcaa tcgatccaga cggctttcaa tcaaggcgca ggaactgcgt cgctttcatc 14640 cagcgggaag gtcagttttc aggttgagtt tatgctgccg gttgctcata cagtgcgcct 14700 gattcgcgtg acttctacat ccgccagtca gggtgcaagt taatttgaca gtcaggtgaa 14760 ~tggccgcgat tggcgtgtgg cctctgagtc acctattcaa ttagggcggt catag 14815 <210> 6 .. ~211> 75.0 . ..
< 212 > ,DNA ~ , <213> Porcine reproductive and respiratory syndrome virus <400> 6 , ~~.atgcaatggg gtcactgtgg agtaaaatca gccagctgtt cgtggacgcc ttcactgagt 60 t:ccttgttag tgtggttgat.attgccattt tccttgccat actgtttggg ttcaccgtcg 12.0 c-aggatggtt actggtcttt cttctcagag tggtttgctc cgcgcttctc cgttcgcgct~180' ctgccatt.ca ctctcccgaa ctatcgaagg tcctatgaag gc.ttgttgcc caactgcaga 240 ... ccggatgtcc cacaatttgc agtcaagcac ccattgggya tgttttggca catgcgagtt 300~
~tcccac.ttga ttgatgagat ggtctctcgt cgcatttacc agaccatgga acattcaggt.360 ~caagcggcct ggaagcaggt ggttggtgag gccactctca cgaagctgtc agggctcgat 42.0 atagttactc~atttccaaca cctggccgca gtggaggcgg attcttgccg ctttctcagc-480 tcacgactcg tgatgctaaa aaatcttgcc gttggcaatg tgagcctaca gtacaacacc,540 eacgttggacc gcgttgagct catcttcccc acgccaggta cgaggcccaa gttgaccgat .600.
. ;,ttaagacaat ggctcatcag tgtgcacgct tccatttttt~cctctgtggc ttcatctgtt 660 ;
accttgttca tagtgctttg gcatcgaatt ccagctctac gctatgtttt,tggtttccat.720 .tggcccacgg caaca.catca t~tcgagctga , . 750v . r :.<210>: 7e. ~. . , <,.211 > 7°9"8 ~ ' a .
<212> DNA
<213> Porcine reproductive and~respiratory syndrome virus <400> 7.: , atggctcatc agtgtgcacg cttccatttt ttcctctgtg gcttcatctg ttaccttgtt catagtgctt tggcttcgaa ttccagctct acgctatgtt tttggtttcc attggcccac 120 ggcaacacat cattcgagct gaccatcaac tacaccatat gcatgccctg ttctaccagt 180 caagcggctc gccaaaggct cgagcccggt catagcatgt ggtgcaaaat agggcatgac 240 aggtgtgagg agcgtgacca tgatgagttg ttaatgccca tcccgtccgg gtacgacaac 300 ctcaaacttg agggttatta tgcttggctg gcttttttgt ccttttccta cgcggcccaa 360 ttccatccgg agttgttcgg gatagggaat gtgtcgcgcg tcttcgtgga caagcgacac 420 cagttcattt gtgccgagca tgatggacac aattcaaccg tgtctaccgg acacaacatc 480 tccgcattat atgcggcata ttaccaccac caaatagacg ggggcaattg gttccatttg 540 gaatggctgc ggccactctt ttcttcctgg ctggtgctca acatatcatg gtttctgagg 600 cgttcgcctg taagccctgt ttctcgacgc atctatcaga tattaagacc aacacgaccg 660 cggctgccgg tttcatggtc cttcaggaca tcaattgttt ccgacctcac ggggtctcag 720 cagcgcaaga gaaaatttcc ttcggaaagt cgtcccaatg tcgtgaagcc gtcggtactc 780 cccagtacat cacgataa , 798 <210> 8 <211> 552 <212> DNA
<213> Porcine reproductive and respiratory syndrome virus <400> 8 atggctgcgg ccactctttt cttcctggct ggtgctcaac atatcatggt ttctgaggcg 60 ttcgcctgta agccctgttt ctcgacgcat ctatcagata ttaagaccaa cacgaccgcg 120 gctgccggtt tcatggtcct tcaggacatc aattgtttcc gacctcacgg ggtctcagca 180 gcgcaagaga aaatttcctt cggaaagtcg tcccaatgtc gtgaagccgt cggtactccc 240 cagtacatca cgataacggc taacgtgacc gacgaatcat acttgtacaa cgcggacctg 300 ctgatgcttt ctgcgtgcct tttctacgcc tcagaaatga gcgagaaagg cttcaaagtc 360 atctttggga atgtctctgg cgttgtttct gcttgtgtca atttcacaga ttatgtggcc 420 catgtgaccc aacataccca gcagcatcat ctggtagttg atcacattcg gttgctgcat 480 ttcctgacac catctgcaat gaggtgggct acaaccattg cttgtttgct cgccat'tctc 540 ttggcnatat ga ~ 552 <210> 9 ,.<211> 606 <212> DNA
.<213> Porcine reproductive and respiratory syndrome virus :<400> 9 ~ . , atgagatgtt ctcacaaatt ggggcg tcc ttgactccgc actcttgctt ctggtggctt 60..
ttt.ttgctgt gtaccggctt gtcctggtcc tttgccgatg gcaacggcga cagctcgaca 120 ,.taccaataca tatatgactt gacgatatgc gagctgaatg ggaccgactg gttgtccagc 180 .,cattttggtt gggcagtcga gacctttgtg ttttacccgg ttgccactca tatcctctca 240 ,.ctgggttttc,,tcacaacaag ccattttt.tt gacgcgctcg gtctcggcgc tgtatccact 300.
gcaggatttg ttggcgggcg gtacgtactc tgcagcgtct acggcgcttg tgctttcgca;360 gcgttcgtat gttttgtcat ccgtgctgct aaaaattgca tggcctgccg ctatgcccgt 420 acccggttta ccaacttcat tgtggacgac~:cgggggagag ttcatcgatg,gaagtctcca 480 atagtggtag aaaaattggg caaagccgaa gtcgatggca acctcgtcac catcaaacat 540 gtcgtcctcg aaggggttaa agctcaaccc ttgacgagga cttcggctga gcaatgggag 600 gcctag 606 <210> 10 <211> 2396 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 10 Met Ser Gly Thr Phe Ser Arg Cys Met Cys Thr Pro Ala Ala Arg Val Phe Trp Asn A1a Gly Gln Val Phe,Cys Thr Arg Cys Leu Ser Ala Arg Ser Leu Leu Ser Pro Glu Leu Gln Asp Thr Asp Leu Gly Ala Val Gly Leu Phe Tyr Lys Pro Arg Asp Lys Leu His Trp Lys Val Pro Ile Gly Ile Pro Gln Val Glu Cys Thr Pro Ser Gly Cys Cys Trp Leu Ser Ala 65 70 ~ 75 80 Val Phe Pro Leu Ala Arg Met Thr Ser Gly Asn His Asn Phe Leu Gln Arg Leu Val Lys Val Ala Asp Val Leu Tyr Arg Asp Gly Cys Leu Ala Pro Arg His Leu Arg Glu Leu Gln Val Tyr Glu Arg Gly Cys Asn Trp Tyr Pro Ile Thr Gly Pro Val Pro Gly Met Gly Leu Phe Ala Asn Ser Met His Val Ser Asp Gln Pro Phe Pro Gly Ala Thr His Val Leu Thr Asn Ser Pro Leu Pro Gln Gln Ala Cys Arg Gln Pro Phe Cys Pro Phe Glu Glu Ala His Ser Ser Val Tyr Arg Trp Lys Lys Phe Val Val Phe Thr Asp Ser Ser Leu Asn Gly Arg Ser Arg Met Met Trp Thr Pro Glu 195 200: 205 Ser Asp Asp Ser Ala Ala Leu Glu Val Leu Pro Pro Glu Leu Glu Arg 210 ~ 215 220 Gln Val Glu Ile Leu Ile Arg Ser Phe Pro Ala His His Pro Val Asp 225 ~ 230 235 240 Leu Ala Asp Trp Glu Leu Thr Glu.Ser.Pro Glu Asn Gly Phe Ser Phe Asn Thr Ser His Ser Cys Gly His Leu Val Gln Asn Pro Asp Val Phe Asp Gly Lys Cys Trp Leu Ser Cys Phe Leu Gly Gln Ser Ala Glu Val Arg Cys His Glu Glu His Leu Ala Asp Ala Phe Gly Tyr Gln Thr Lys Trp Gly Val His Gly Lys Tyr Leu Gln Arg Arg Leu Gln Val His Gly Ile Arg Ala Val Val Asp Pro Asp Gly Pro Ile His Val Glu Ala Leu Ser Cys Pro Gln Ser Trp Ile Arg His Leu Thr Leu Asn Asp Asp Val Thr Pro Gly Phe Val Arg Leu Thr Ser Leu Arg Ile Val Pro Asn Thr Glu Pro Thr Thr Ser Arg Ile Phe Arg Phe Gly Ala His Lys Trp Tyr Gly Ala Ala Gly Lys Arg Ala Arg Ala Lys Arg Ala Ala Lys Ser Glu Lys Asp Ser Ala Pro Thr Pro Lys Val Ala Leu Pro Val Pro Thr Cys Gly Ile Thr Thr Tyr Ser Pro Pro Thr Asp Gly Ser Cys Gly Trp His Val Leu Ala Ala Ile Met Asn Arg Met Ile Asn Gly Asp Phe Thr Ser Pro Leu Thr Gln Tyr Asn Arg Pro Glu Asp Asp Trp Ala Ser Asp Tyr Asp Leu Val Gln Ala Ile Gln Cys Leu Gln Leu Pro Ala Thr Val Val Arg Asn Arg Ala Cys Pro Asn Ala Lys Tyr Leu Ile Lys Leu Asn Gly Val His Trp Glu Val Glu Val Arg Ser Gly Met Ala Pro.Arg Ser Leu Pro Arg Glu Cys Val Val Gly Val Cys Ser Glu Gly Cys Val Ala Pro Pro Tyr Pro Ala Asp Gly Leu Pro Lys Arg Ala Leu Glu Ala Leu Ala Ser Ala Tyr Arg Leu Pro Ser Asp Cys Val Ser Sew Gly Ile Ala Asp Phe Leu Ala Asn Pro Pro Pro Gln Glu Phe Trp Thr Leu Asp Lys Met Leu Thr Ser Pro Ser Pro Glu Arg Ser Gly Phe Ser Ser Leu Tyr Lys Leu Leu Leu Glu Val Val Pro Gln Lys Cys Gly Ala Thr Glu Gly Ala Phe Ile Tyr Ala Val Glu Arg Met Leu Lys Asp Cys Pro Ser Ser Lys Gln Ala Met Ala Leu Leu Ala Lys Ile Lys Val Pro Ser Ser Lys Ala Pro Ser Val Ser Leu Asp Gly Cys Phe Pro Thr Asp Val Pro Ala Asp Phe Glu Pro Ala Ser Pro Glu Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ala Gly Leu Ile Asn Leu Val Gly Gly Asn Leu Ser Pro Ser Asp Ser Met Lys G1u Asn Met Leu Asn Ser Arg Glu Asp Glu Pro Leu Asp Leu Ser Gln Pro Ala Pro Ala Ala Thr Thr Thr Leu Val Arg Glu Gln Thr Pro Asp Asn Pro Gly Ser Asp Ala Gly Ala Leu Pro Val Thr Val Arg Glu Phe Val Pro Thr Gly Pro Ile Leu Arg His Val Glu His Cys Gly Thr Glu Ser Gly Asp Ser Ser Ser Pro Leu Asp Gln Ser Asp Ala Gln Thr Leu Asp Gln Pro Leu Asn Leu Ser Leu Ala Ala Trp Pro Val Arg Ala Thr Ala Ser Asp Pro Gly Trp Val His Gly Arg Arg Glu Pro Val Phe Val Lys Pro Arg Asn Ala Phe Ser Asp Gly Asp Ser Ala Leu Gln Phe Gly Glu Leu Ser Glu Ser Ser Pro Val Ile Glu Phe Asp Arg Thr Lys Asp Ala Pro Val Val Asp Ala Pro Val Asp Leu Thr Thr Ser Asn G1u Ala Leu Ser Val Val Asp Pro Phe Glu Phe Ala Glu Leu Lys Arg Pro Arg Phe Ser A1a Gln Ala Leu Ile Asp Arg Gly Gly Pro Leu Ala Asp Val His Ala Lys Ile Lys Asn Arg Val Tyr Glu Gln Cys Leu Gln Ala Cys Glu Pro Gly Ser Arg Ala Thr Pro Ala Thr Arg Glu Trp Leu Asp Lys Met Trp Asp Arg Val Asp Met Lys Thr Trp Arg Cys Thr Ser Gln Phe Gln Ala Gly Arg Ile Leu Ala Ser Leu Lys Phe Leu Pro Asp Met Ile Gln Asp Thr Pro Pro Pro Val Pro Arg Lys Asn Arg Ala Ser Asp Asn Ala Gly Leu Lys Gln Pro Val Ala Gln Trp Asp Arg Lys Leu Ser Val Thr Pro Pro Pro Lys Pro Val Gly Pro Val Leu Asp G1n Thr Val Pro Pro Pro Thr Asp Ile Gln Gln Glu Asp Val Thr Pro Ser Asp Gly Pro Pro His Ala Pro Asp Phe Pro Ser Arg Val Ser Thr Gly Gly Ser Trp Lys Gly Leu Met Leu Ser Gly Thr Arg Leu A1'a Gly Ser Ile Ser Gln Arg Leu Met Thr Trp Val Phe Glu Val Phe Ser 1105 1110 1115 11'20 His Leu Pro Ala Phe Met Leu Thr Leu Phe Ser Pro Arg Gly Ser Met Ala Pro Gly Asp Trp Leu Phe Ala Gly Val Val Leu Leu Ala Leu Leu Leu Cys Arg Ser Tyr Pro Ile Leu Gly Cys Leu Pro Leu Leu Gly Val Phe Ser Gly Ser Leu Arg Arg Val Arg Leu Gly Val Phe Gly Ser Trp Met Ala Phe Ala Val Phe Leu Phe Ser Thr Pro Ser Asn Pro Val Gly Ser Ser Cys Asp His Asp Ser Pro Glu Cys His Ala Glu Leu Leu Ala Leu Glu Gln Arg Gln Leu Trp Glu Pro Val Arg Gly Leu Val Val Gly Pro Ser Gly Leu Leu Cys Val Ile Leu Gly Lys Leu Leu Gly Gly Ser Arg Tyr Leu Trp His Val Phe Leu Arg Leu Cys Met Leu Ala Asp Leu Ala Leu Ser Leu Val Tyr Val Val Ser Gln G1y Arg Cys His Lys Cys Trp Gly Lys Cys Ile Arg Thr Ala Pro Ala Glu Val Ala Leu Asn Val Fhe Pro Phe Leu Arg Ala Thr Arg Ala Ser Leu Val Ser Leu Cys Asp Arg Phe Gln Thr Pro Lys Gly Val~Asp Pro Val His Leu Ala Thr Gly Trp Arg Gly Cys Trp Arg Gly Glu Ser Pro Ile His Gln Pro His Gln Lys Pro Ile Ala Tyr Ala Asn Leu Asp Glu Lys Lys Tle Ser Ala Gln Thr Val Val Ala Val Pro Tyr Asp Pro Ser Gln Ala Val Lys Cys Leu Lys Val Leu Gln Ala Gly Gly Ala Ile Val Asp Gln Pro Thr Pro Glu Val Val Arg Val Ser Glu Ile Pro Phe Ser Ala Pro Phe Phe Pro Lys Val Pro.Val Asn Pro Asp Cys Arg Val Val Val Asp Ser Asp Thr Phe Val Ala Ala Val Arg Cys Gly Tyr Ser Thr Ala Gln Leu Va1 Leu Gly ~. . , Arg Gly Asn Phe Ala Lys Leu Asn Gln Thr Pro Pro Arg Asn Ser Ile 1445 1'450 1455 Ser Thr Lys Thr Thr Gly Gly Ala Ser Tyr Thr Leu Ala Val Ala Gln Val Ser Ala Trp Thr Leu Val His Phe Ile Leu Gly Leu Trp Phe Thr Ser Pro Gln Val Cys Gly Arg Gly Thr Ala Asp Pro Trp Cys Ser Asn Pro Phe Ser Tyr Pro Thr Tyr Gly Pro Gly Val Val Cys Ser Ser Arg Leu Cys Val Ser Ala Asp Gly Val Thr Leu Pro Leu Phe Ser Ala Val Ala Gln Leu Ser Gly Arg Glu Val Gly Ile Phe Ile Leu Val Leu Val Ser Leu Thr A1a Leu Ala His Arg Met Ala Leu Lys Ala Asp Met Leu Val Ile Phe Ser Ala Phe Cys Ala Tyr Ala Trp Pro Met Ser Ser Trp Leu Ile Cys Phe Phe Pro Ile Leu Leu Lys Trp Val Thr Leu His Pro Leu Thr Met Leu Trp Val His Ser Phe Leu VaI Phe Cys Leu Pro Ala Ala Gly Ile Leu Ser Leu Gly Ile Thr Gly Leu Leu Trp Ala Ile Gly Arg Phe Thr Gln Val Ala Gly Ile Ile Thr Pro Tyr Asp Ile His Gln Tyr Thr Ser Gly Pro Arg Gly Ala Ala Ala Val Ala Thr Ala Pro Glu Gly Thr Tyr Met Ala Ala Val Arg Arg Ala Ala Leu Thr Gly Arg Thr Leu Ile Phe Thr Pro Ser Ala Val Gly Ser Leu Leu Glu Gly Ala Phe Arg Thr His Lys Pro Cys Leu Asn Thr Val Asn Val Val Gly Ser Ser Leu Gly Ser Gly Gly Val Phe Thr Ile Asp Gly Arg Arg Thr Val Val Thr Ala Ala His Val Leu Asn Gly Asp Thr Ala Arg Val Thr Gly Asp Ser Tyr Asn Arg Met His Thr Phe Lys Thr Asn Gly Asp Tyr Ala Trp Ser His Ala Asp Asp Trp Gln Gly Val Ala Pro Val Val Lys Val Ala Lys Gly Tyr Arg Gly Arg Ala Tyr Trp Gln Thr Ser Thr Gly Val Glu Pro Gly Ile Ile Gly Glu Gly Phe Ala Phe Cys Phe Thr Asn Cys Gly Asp Ser Gly Ser Pro Val Ile Ser Glu Ser Gly Asp Leu Ile Gly Ile His Thr Gly Ser Asn Lys Leu Gly Ser Gly Leu Val Thr Thr Pro Glu Gly Glu Thr Cys Thr Ile Lys Glu Thr Lys Leu Ser Asp Leu Ser Arg His Phe Ala Gly Pro Ser Val Pro Leu Gly Asp Ile Lys Leu Ser Pro Ala Ile Ile Pro Asp Val Thr Ser Ile Pro Ser Asp Leu Ala Ser Leu Leu Ala Ser Val Pro Val Val Glu Gly Gly Leu Ser Thr Val Gln Leu Leu Cys Val Phe Phe Leu Leu Trp Arg Met Met Gly His Ala Trp Thr Pro Ile Val Ala Val Gly Phe Phe Leu Leu Asn Glu Ile Leu Pro Ala Val Leu Val Arg Ala Val Phe Ser Phe Ala Leu Phe Val Leu Ala Trp Ala Thr Pro Trp Ser A1a Gln Val Leu Met Ile Arg Leu Leu Thr Ala Ser Leu Asn Arg Asn Lys Leu Ser Leu Ala Phe Tyr Ala Leu Gly Gly Val Val Gly Leu Ala AIa Glu Ile Gly Thr Phe Ala Gly Arg Leu Ser Glu Leu Ser Gln Ala Leu Ser Thr Tyr Cys Phe Leu Pro Arg Val Leu Ala Met Thr Ser Cys Val Pro Thr Ile Ile Ile Gly Gly Leu His Thr Leu Gly Val Ile Leu Trp Leu Phe Lys Tyr Arg Cys Leu His Asn Met Leu .GlyAsp Gly Ser PheSer Ser Ala PhePhe Leu ArgTyr Phe Val Ala GlyAsn Leu Arg LysGly Val Ser GlnSer Cys GlyMet Asn Glu Asn SerLeu Thr Ala AlaLeu Ala Cys LysLeu Ser GlnAla Asp Glu Leu PheLeu Ser Ser LeuThr Asn Phe LysCys Phe ValSer Ala Asp Ser MetLys Asn Ala AlaGly Gln Tyr IleGlu Ala AlaTyr Ala Asn 2115 2120 . 2125 Lys LeuArg G1n Glu LeuAla Ser Leu ValGln Ile AspLys Met Ala Lys ValLeu Ser Lys LeuGlu Ala Phe AlaGlu Thr AlaThr Pro Gly Ser AspIle G1y Asp ValIle Val Leu LeuGly Gln HisPro His Leu Gly IleLeu Asp Ile AsnVal Gly Thr GluArg Lys ThrVal Ser Ser Val Gln Glu Thr Arg Ser Leu Gly Gly Ser Lys Phe Ser Val Cys Thr Val Val Ser Asn Thr Pro Val Asp Ala Leu Thr Gly Ile Pro Leu Gln Thr Pro Thr Pro Leu Phe Glu Asn Gly Pro Arg His Arg Ser Glu Glu Asp Asp Leu Lys Val Glu Arg Met Lys Lys His Cys Val Ser Leu Gly Phe His Asn Ile Asn Gly Lys Val Tyr Cys Lys Ile Trp Asp Lys Ser Thr Gly Asp Thr Phe Tyr Thr Asp Asp Ser Arg Tyr Thr Gln Asp H'i's Ala Phe Gln Asp Arg Ser Ala Asp Tyr Arg Asp Arg Asp Tyr Glu Gly Val Gln Thr Ala Pro Gln Gln Gly Phe Asp Pro Lys Ser Glu Thr Pro .Val Gly Thr Val Val Ile Gly Gly Ile Thr Tyr Asn Arg Tyr Leu I-le Lys Gly Lys Glu Val Leu Val Pro Lys Pro Asp Asn Cys Leu Glu Ala Ala Lys Leu Ser Leu Glu Gln Ala Leu Ala Gly Met Gly Gln Thr Cys Asp Leu Thr Ala Ala Glu Val Glu Lys Leu Lys Arg Ile Ile Ser Gln Leu Gln Gly Leu Thr Thr Glu Gln Ala Leu Asn Cys <210> 11 <211> 1463 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 11 Thr Gly Phe Lys Leu Leu Ala Ala Ser Gly Leu Thr Arg Cys Gly Arg Gly Gly Leu Va1 Val Thr Glu Thr Ala Val Lys Ile Ile Lys Tyr His Ser Arg Thr Phe Thr Leu Gly Pro Leu Asp Leu Lys Val Thr Ser Glu Val Glu Val Lys Lys Ser Thr G1u Gln Gly His Ala Val Val Ala Asn Leu Cys Ser G1y Val Ile Leu.Met Arg Pro His Pro Pro Ser Leu Val 65 70 75 ~ 80 Asp Val Leu Leu Lys Pro Gly Leu Asp Thr Thr Pro Gly Ile Gln Pro Gly His Gly Ala Gly Asn Met Gly Val Asp Gly Ser Ile Trp Asp Phe Glu Thr Ala Pro Thr Lys Ala Glu Leu Glu Leu Ser Lys Gln Ile I1e Gln Ala Cys Glu Val Arg Arg Gly Asp Ala Pro Asn Leu Gln Leu Pro 130: 135 140 Tyr Lys Leu Tyr Pro Val Arg Gly Asp Pro Glu Arg His Lys Gly Arg 145 150 155 1.60 Leu Ile Asn Thr Arg Phe Gly Asp Leu Pro Tyr Lys Thr Pro Gln Asp Thr Lys Ser Ala Ile His Ala Ala Cys Cys Leu His Pro Asn Gly Ala Pro Val Ser Asp G1y Lys Ser Thr Leu Gly Thr Thr Leu Gln His Gly Phe Glu Leu Tyr Val Pro Thr Val Pro Tyr Ser Val Met Glu Tyr Leu Asp Ser Arg Pro Asp Thr Pro Phe Met Cys Thr Lys His Gly Thr Ser 225 230 235 ~ 240 Lys Ala Ala Ala Glu Asp Leu Gln Lys Tyr Asp Leu Ser Thr Gln Gly Phe Val Leu Pro Gly Val Leu Arg Leu Va1 Arg Arg Phe Ile Phe Gly His Ile Gly Lys Ala Pro Pro Leu Phe Leu Pro Ser Thr Tyr Pro Ala Lys Asn Ser Met Ala Gly Ile Asn Gly Gln Arg Phe Pro Thr Lys Asp Val Gln Ser Ile Pro Glu Ile Asp Glu Met Cys Ala Arg Ala Val Lys Glu Asn Trp Gln Thr Val Thr Pro Cys Thr Leu Lys Lys Gln Tyr Cys Ser Lys Pro Lys Thr Arg Thr Ile Leu Gly Thr Asn Asn Phe Ile Ala Leu Ala His Arg Ser Ala Leu Ser Gly Val Thr Gln Ala Phe Met Lys Lys Ala Trp Lys Ser Pro Ile Ala Leu Gly Lys Asn Lys Phe Lys Glu Leu His Cys Thr Val Ala Gly Arg Cys Leu Glu Ala Asp Leu Ala Ser Cys Asp Arg Ser Thr Pro Ala Ile Val Arg Trp Phe Val Ala Asn Leu Leu Tyr Glu Leu Ala Gly Cys Glu Glu Tyr Leu Pro Ser Tyr Val Leu Asn Cys Cys His Asp Leu Val Ala Thr Gln Asp Gly Ala Phe Thr Lys Arg Gly Gly Leu Ser Ser Gly Asp Pro Val Thr Ser Val Ser Asn Thr Val Tyr Ser Leu Val Ile Tyr Ala Gln His Met Val Leu Ser Ala Leu Lys Met Gly His Glu Ile Gly Leu Lys Phe Leu Glu Glu Gln Leu Lys Phe Glu Asp Leu Leu Glu Ile Gln Pro Met Leu Val Tyr Ser Asp Asp Leu Val Leu Tyr Ala Glu Arg Pro Thr Phe Pro Asn Tyr His Trp Trp 515 . 520 525 Val Glu His Leu Asp Leu Met Leu Gly Phe Arg Thr Asp Pro Lys Lys Thr Val Ile Thr Asp Lys Pro Ser Phe Leu Gly Cys Arg Ile Glu Ala Gly Arg Gln Leu Val Pro Asn Arg Asp Arg Ile Leu Ala Ala Leu Ala Tyr His Met Lys Ala Gln Asn Ala Ser Glu Tyr Tyr Ala Ser Ala Ala Ala Ile Leu Met Asp Ser Cys Ala Cys Ile Asp His Asp Pro Glu Trp Tyr Glu Asp Leu Ile Cys Gly Ile Ala Arg Cys Ala Arg Gln Asp Gly Tyr Ser Phe Pro Gly Pro Ala Phe Phe Met Ser Met Trp Glu Lys Leu Arg Ser His Asn Glu Gly Lys Lys Phe Arg His Cys Gly Ile Cys Asp Ala Lys Ala Asp Tyr Ala Ser Ala Cys Gly Leu Asp Leu Cys Leu Phe His Ser His Phe His Gln His Cys Pro Val Thr Leu Ser Cys Gly His His Ala Gly Ser Lys Glu Cys Ser Gln Cys Gln Ser Pro Val Gly Ala Gly Arg Ser Pro Leu Asp Ala Val Leu Lys Gln Ile Pro Tyr Lys Pro Pro Arg Thr Val Ile Met Lys Va1 Gly Asn Lys Thr Thr Ala Leu Asp Pro Gly Arg Tyr Gln Ser Arg Arg Gly Leu Val Ala Val Lys Arg Gly Ile Ala G1y Asn Glu Val Asp Leu Ser Asp Gly Asp Tyr Gln Val Val Pro Leu Leu Pro Thr Cys Lys Asp Ile Asn Met Val Lys Val Ala Cys Asn Va1 Leu Leu Ser Lys Phe Ile Val Gly Pro Pro Gly Ser Gly Lys Thr Thr Trp Leu Leu Ser Gln Val Gln Asp Asp Asp Val Ile Tyr Thr Pro Thr His Gln Thr Met Phe Asp Ile Val Ser Ala Leu Lys Va1 Cys 820 . 825 830 Arg Tyr Ser'Val Pro Gly Ala Ser Gly Leu Pro Phe Pro Pro Pro Ala Arg Ser Gly Pro Trp Val Arg Leu Ile Ala Ser Gly His Val Pro G1y Arg Val Ser Tyr Leu Asp Glu Ala Gly Tyr Cys Asn His Leu Asp Ile Leu Arg Leu Leu Ser Lys Thr Pro Leu Val Cys Leu Gly Asp Leu Gln Gln Leu His Pro Val Gly Phe Asp Ser Xaa Cys Tyr Val Phe Asp Gln Met Pro Gln Lys Gln Leu Thr Thr Ile Tyr Arg Phe Gly Pro Asn Ile Cys Ala Ala Ile Gln Pro Cys Tyr Arg Glu Lys Leu Glu Ser Lys Ala Arg Asn Thr Arg Val Val Phe Thr Thr Arg Pro Val Ala Phe Gly Gln Val Leu Thr Pro Tyr His Lys Asp Arg Ile Gly Ser Ala Ile Thr Ile Asp Ser Ser Gln Gly Ala Thr Phe Asp Ile Val Thr Leu His Leu Pro Ser Pro Lys Ser Leu Asn Lys Ser Arg Ala Leu Val Ala Ile Thr Arg Ala Arg His Gly Leu Phe Ile Tyr Asp Pro His Asn Gln Leu Gln Glu Phe Phe Asn Leu Thr Pro Glu Arg Thr Asp Cys Asn Leu Val Phe Ser Cys Gly Asp Glu Leu Val Val Leu Asn Ala Asp Asn Ala Val Thr Thr Val Ala Lys Ala Leu Glu Thr Gly Pro Ser Arg Phe Arg Val Ser Asp Pro Arg Cys Lys Ser Leu Leu Ala Ala Cys Ser Ala Ser Leu Glu Gly Ser Cys Met Pro Leu Pro Gln Val Ala His Asn Leu Gly Phe Tyr Phe Ser Pro Asp Ser Pro Val Phe Ala Pro Leu Pro Lys Glu Leu Ala Pro His Trp Pro Val Val Thr His Gln Asn Asn Arg Ala Trp Pro Asp Arg Leu Val Ala Ser Met Arg Pro Ile Asp Ala Arg Tyr Ser Lys Pro Met Val Gly Ala Gly Tyr Va1 Val Gly Pro Ser Thr Phe Leu Gly Thr Pro Gly Val Val Ser Tyr Tyr Leu Thr Leu Tyr Ile Arg Gly Glu Pro Gln Ala Leu Pro Glu Thr Leu Val Ser Thr Gly Arg Ile Ala Thr Asp Cys Arg Glu Tyr Leu Asp Ala Ala Glu Glu Glu Ala Ala Lys Glu Leu Pro His Ala Phe Ile Gly Asp Val Lys Gly Thr Thr Val Gly Gly Cys His His Ile Thr Ser Lys Tyr Leu Pro Arg Ser Leu Pro Lys Asp Ser Val Ala Val Val Gly Val Ser Ser Pro Gly Arg Ala Ala Lys Ala Val Cys Thr Leu Thr Asp Val Tyr Leu Pro Glu Leu Arg Pro Tyr Leu Gln Pro Glu Thr Ala Ser Lys Cys Trp Lys Leu Lys Leu Asp Phe Arg Asp Val Arg Leu Met Val Trp Lys Gly Ala Thr Ala Tyr Phe Gln Leu Glu Gly Leu Thr Trp Ser Ala Leu Pro Asp Tyr Ala Arg Phe Ile G1n Leu Pro Lys Asp Ala Val Val Tyr Ile Asp Pro Cys Ile Gly Pro Ala Thr Ala Asn Arg Lys Val Val Arg Thr Thr Asp Trp Arg Ala Asp Leu Ala Val Thr Pro Tyr Asp Tyr Gly Ala Gln Asn Ile,Leu Thr Thr Ala Trp Phe Glu Asp Leu Gly Pro Gln Trp Lys Ile Leu Gly Leu Gln Pro Phe Arg Arg Ala Phe Gly Phe Glu Asn Thr Glu Asp Trp Ala Ile Leu Ala Arg Arg Met~Asn Asp Gly Lys Asp Tyr Thr Asp Tyr Asn Trp Asn Cys Val Arg G1u Arg Pro His Ala Ile Tyr Gly Arg Ala Arg Asp His Thr Tyr His Phe Ala Pro Gly Thr Glu Leu Gln Val Glu Leu Gly Lys Pro Arg Leu Pro Pro Gly Gln Val Pro <210> 12 <211> 249 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 12 Met Gln Trp Gly Tyr Cys Gly Val Lys Ser Ala Ser Cys Ser Trp Thr Pro Ser Leu Ser Ser Leu Leu Val Trp Leu Ile Leu Leu Phe Ser Leu Pro Tyr Cys Leu Gly Ser Pro Ser Gln Asp Gly Tyr Trp Ser Ser Phe Ser Glu Trp Phe Ala Pro Arg Phe Ser Val Arg Ala Leu Pro Phe Thr Leu Pro Asn Tyr Arg Arg Ser Tyr Glu Gly Leu Leu Pro Asn Cys Arg Pro Asp Val Pro Gln Phe Ala Phe Lys His Pro Leu Gly Met Leu Trp His Met Arg Val Ser Gln Leu Ile Asp Glu Met Val Ser Arg Arg Ile Tyr Gln Thr Met Glu His Ser Gly Gln Ala Ala Trp Lys Gln Ala Val Gly Glu Ala Thr Leu Thr Lys Leu Ser Arg Leu Asp Ile Val Thr His '.

Phe Gln His Leu Ala Ala Val Glu Ala Asp Ser Cys Arg Phe Leu Ser 145 150 155 . 160 Ser Arg Leu Val Met Leu Lys Asn Leu A1a Val Gly Asn Val Ser Leu . 165 170 175 Gln Tyr Asn Thr Thr Leu Asp Arg Val G1u Leu Ile Phe Pro Thr Pro Gly Thr Arg Pro Lys Leu Thr Asp Phe Arg Gln Trp Leu Ile Ser Val r 195 200 205 His Ala Ser Ile Phe Ser Ser Val Ala Ser Ser Val Thr Leu Phe Ile Val Leu Trp Leu Arg Ile Pro Ala Leu Arg Tyr Val Phe Gly Phe His Trp Pro Thr Ala Thr His His Ser Ser <210> 13 <211> 265 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 13 Met Ala His Gln Cys Ala Arg Phe His Phe Phe Leu Cys Gly Phe Ile 1 ' 5 10 15 Cys Tyr Leu Val His Ser Ala Leu Ala Ser Asn Ser Ser Ser Thr Leu Cys Phe Trp Phe Pro Leu Ala His Gly Asn Thr Ser Phe Glu Leu Thr Ile Asn Tyr Thr Ile Cys Met Pro Cys Ser Thr Ser Gln Ala Ala Arg Gln Arg Leu Glu Pro Gly Arg Asn Met Trp Cys Lys Ile Gly Tyr Asp Arg Cys Glu Glu Arg Asp His Asp Glu Leu Leu Met Pro Ile Pro Ser Gly Tyr Asp Asn Leu Lys Leu Glu Gly Tyr Tyr Ala Trp Leu Ala Phe Leu Ser Phe Ser Tyr Ala Ala Gln Phe His Pro Glu Leu Phe Gly Ile '115 120 125 .
Gly Asn Val Ser Arg Val Phe Val Asp Lys Arg His Gln Phe Ile Cys 130 ' . 135 140 Ala Glu His Asp Gly Gln Asn Ser Thr Val Ser Thr Gly His Asn Ile Ser Ala Leu Tyr Ala Ala Tyr Tyr His His Gln Ile Asp Gly G1y Asn Trp Phe His Leu Glu Trp Leu Arg Pro Leu Phe Ser Ser Trp Leu Val Leu Asn Ile Ser Trp Phe Leu Arg Arg Ser Pro Val Ser Pro Val Ser Arg Arg Ile Tyr Gln Ile Leu Arg Pro Thr Arg Pro Arg Leu Pro Val Ser Trp Ser Phe Arg Thr Ser Ile Val Ser Asp Leu Thr Gly Ser Gln Gln Arg Lys Arg Lys Phe Pro Ser Glu Ser Arg Pro Asn Val Val Lys Pro Ser Val Leu Pro Ser Thr Ser Arg <210> 14 <211> 183 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 14 Met Ala Ala Ala Thr Leu Phe Leu Leu Ala Gly Ala Gln Tyr Ile Met Val Ser Glu Ala Phe Ala Cys Lys Pro Cys Phe Ser Thr His Leu Ser Asp Ile Glu Thr Asn Thr Thr Ala Ala Ala Gly Phe Met Val Leu Gln Asp Ile Asn Cys Leu Arg Pro His Gly Val Ser Ala Ala Gln Glu Glu Ile Pro Phe Gly Lys Ser Ser Gln Cys Arg Glu Ala Val Gly Thr Pro Gln Tyr Ile Thr Ile Thr Ala Asn Val Thr Asp Glu Ser Tyr Leu Tyr Asn Ala Asp Leu Leu Met Leu Ser Ala Cys Leu Phe His Ala Ser Glu 100 ~ 105 110 Met Ser Glu Lys Gly Phe Lys Val Ile Phe Gly Asn Val Ser Gly Val T15 120 ~ 125 Val Ser Ala Cys Val Asn Phe Thr Asp Tyr Val Ala His Val Thr Gln 130 135 , 140 His Thr Gln Gln His His Leu Val Ile Asp His Ile Arg Leu Leu His Phe Leu Thr Pro Ser Ala Met Arg Trp Ala Thr Thr Ile Ala Cys Leu 165 170 ~ 175 Phe Ala Ile Leu Leu Ala Ile ,. 18 0 , <210> 15 <211> 201 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 15 Met Arg Cys Ser His Lys Leu Gly Arg Phe Leu Thr Pro His Ser Cys Phe Trp Trp Phe Phe Leu Leu Cys Thr Gly Leu Ser Trp Ser Phe Ala Asp Gly Asn Gly Asn Ser Ser Thr Tyr Gln Tyr Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Ser Ser His Phe Gly Trp Ala Val Glu Thr Phe Val Phe Tyr Pro Val Ala Thr His Ile Leu Ser Leu Gly Phe Leu Thr Thr Ser His Phe Phe Asp Ala Leu Gly Leu Gly Ala Val Ser Thr Ala Gly Phe Val Gly Gly Arg Tyr Val Leu Cys Ser Val Tyr Gly Ala Cys Ala Phe Ala Ala Phe Val Cys Phe Val Ile Arg Ala Ala Lys Asn Cys Met Ala Cys Arg Tyr Ala Arg Thr Arg Phe Thr Asn Phe Ile Val Asp Asn Arg Gly Arg Val His Arg Trp Lys Ser Pro 145 150 155 1'60 Ile Val Val Glu Lys Leu Gly Lys Ala Glu Val Asp Gly Asn Leu Val Thr Ile Lys His Val Val Leu Glu Gly Val Lys Ala Gln Pro Leu Thr Arg Thr Ser Ala Glu Gln Trp Glu Ala <210> 16 <211> 173 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 16 Met Gly Gly Leu Asp Asp Phe Cys Asn Asp Pro Ile Ala Ala Gln Lys Leu Val Leu Ala Phe Ser Ile Thr Tyr Thr Pro Ile Met Ile Tyr Ala Leu Lys Val Ser Arg Gly Arg Leu Leu Gly Leu Leu His Ile Leu Ile Phe Leu Asn Cys Ser Phe Thr Phe Gly Tyr Met Thr Tyr Val His Phe Gln Ser Thr Asn Arg Val Ala Leu Thr Leu Gly Ala Val Val Ala Leu Leu Trp Gly Val Tyr Ser Phe Thr Glu Ser Trp Lys Phe Ile Thr Ser Arg Cys Arg Leu Cys Cys Leu Gly Arg Arg Tyr Ile Leu Ala Pro Ala His His Val Glu Ser Ala Ala Gly Leu His Ser Ile Ser Ala Ser Gly Asn Arg Ala Tyr Ala Val Arg Lys Pro Gly Leu Thr Ser Val Asn Gly Thr Leu Val Pro Gly Leu Arg Ser Leu Val Leu Gly Gly Lys Arg Ala Val Lys Arg Gly Val Val Asn Leu Val Lys Tyr Gly Arg <210> 17 <211> 128 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 17 Met Ala Gly Lys Asn Gln Ser Gln Lys Lys Lys Lys Ser Thr Ala Pro Met Gly Asn Gly Gln Pro Val Asn Gln Leu Cys Gln Leu Leu Gly Ala 20 25 3d Met Ile Lys Ser Gln Arg Gln Gln Pro Arg Gly Gly Gln Ala Lys Lys Lys Lys Pro Glu Lys Pro His Phe Pro Leu Ala Ala Glu Asp Asp Ile Arg His His Leu Thr Gln Thr Glu Arg Ser Leu Cys Leu Gln Ser Ile 65 70 ; . 75 80 Gln Thr Ala Phe Asn Gln Gly Ala Gly Thr Ala Ser Leu Ser Ser Ser Gly Lys Val Ser Phe Gln Val Glu Phe Met Leu Pro Val Ala His Thr Val Arg Leu Ile Arg Val Thr Ser Thr Ser Ala Ser Gln Gly Ala Ser <210> 18 <211> 249 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 18 Met Gln Trp Gly His Cys Gly Val Lys Ser Ala Ser Cys Ser Trp Thr Pro Ser Leu Ser Ser Leu Leu Val Trp Leu Ile Leu Ser Phe Ser Leu Pro Tyr Cys Leu Gly Ser Pro Ser Gln Asp Gly Tyr Trp Ser Ser Phe Ser Glu Trp Phe Ala Pro Arg Phe Ser Val Arg Ala Leu Pro Phe Thr Leu Pro Asn Tyr Arg Arg Ser Tyr Glu Gly Leu Leu Pro Asn Cys A.rg Pro Asp Val Pro Gln Phe Ala Phe Lys His Pro Leu Gly Met Leu Trp His Met Arg Val Ser His Leu Ile Asp Glu Met Val Ser Arg Arg Ile Tyr Gln Thr Met Glu His Ser Gly Gln Ala Ala Trp Lys Gln Val Val Gly Glu Ala Thr Leu Thr Lys Leu Ser Gly Leu Asp Ile Val Thr His Phe Gln Xaa Leu Ala Ala Val Glu Ala Asp Ser Cys Arg Phe Leu Ser Ser Arg Leu Val Met Leu Lys Asn Leu Ala Val Gly Asn Va.l Ser Leu Gln Tyr Asn Thr Thr Leu Asp Arg Val Glu Leu Ile Phe Pro Thr Pro Gly Thr Arg Pro Lys Leu Thr Asp Phe Arg Gln Trp Leu Ile Ser Val 195 20.0 205 His Ala Ser Ile Phe Ser Ser Val Ala Ser Ser Val Thr Leu Phe Ile Val Leu Trp Leu Arg Ile Pro Ala Leu Arg Tyr Val Phe Gly Phe His Trp Pro Thr Ala Thr His His Ser Ser <210> 19 <211> 265 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 19 Met Ala His Gln Cys Ala Arg Phe His Phe Phe Leu Cys Gly Phe Ile Cys Tyr Leu Val His Ser Ala Leu Ala Ser Asn Ser Ser Ser Thr Leu Cys Phe Trp Phe Pro Leu Ala His Gly Asn Thr Ser Phe Glu Leu Thr Ile Asn Tyr Thr Ile Cys Met Pro Cys Ser Thr Ser Gln Ala Ala Arg Gln Arg Leu Glu Pro Gly His Ser Met Trp Cys Lys Ile Gly His Asp Arg Cys Glu Glu Arg Asp His Asp Glu Leu Leu Met Pro Ile Pro Ser Gly Tyr Asp Asn Leu Lys Leu Glu Gly Tyr Tyr Ala Trp Leu Ala Phe Leu Ser Phe Ser Tyr Ala Ala Gln Phe His Pro Glu Leu Phe Gly Ile Gly Asn Val Ser Arg Val Phe Val Asp Lys Arg His Gln Phe Ile Cys Ala Glu His Asp Gly His Asn Ser Thr Val Ser Thr Gly His Asn I~le '145 150 155 160 Ser Ala Leu Tyr Ala Ala Tyr Tyr His His Gln Ile Asp Gly Gly Asn 165 170 . 175 Trp Phe His Leu Glu Trp Leu Arg Pro Leu Phe Ser Ser Trp Leu Val Leu Asn Ile Ser Trp Phe Leu Arg Arg Ser Pro Val Ser Pro Val Ser Arg Arg Ile Tyr Gln Ile Leu Arg Pro Thr Arg Pro Arg Leu Pro Val 210 . 215 ~ 220 Ser Trp Ser Phe Arg Thr Ser Ile Val Ser Asp Leu Thr Gly Ser Gln 225 230 . 235 240 Gln Arg Lys Arg Lys Phe Pro Ser Glu Ser Arg Pro Asn Val Val Lys Pro Ser Val Leu Pro Ser Thr Ser Arg , <210> 20 <211> 183 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 20 Met Ala Ala Ala Thr Leu Phe Phe Leu Ala Gly Ala Gln His Ile Met 1 5 10 . 15 Val Ser Glu Ala Phe Ala Cys Lys Pro Cys Phe Ser Thr His Leu Ser Asp Ile Lys Thr Asn Thr Thr Ala Ala Ala Gly Phe Met Val Leu Gln Asp Ile Asn Cys Phe Arg Pro His Gly Val Ser Ala Ala Gln Glu Lys Ile Ser Phe Gly Lys Ser Ser Gln Cys Arg Glu Ala Val Gly Thr Pro 65 70 75 ~ 80 Gln Tyr Ile Thr Ile Thr Ala Asn Val Thr Asp Glu Ser Tyr Leu Tyr 85 ~ 90 95 Asn Ala Asp Leu Leu Met Leu Ser Ala Cys Leu Phe Tyr Ala Ser Glu Met Ser G1u Lys Gly Phe Lys Val Ile Phe Gly Asn Val Ser Gly Val .. 115 120 125 Val Ser Ala Cys Val Asn Phe Thr Asp Tyr Val Ala His Val Thr Gln His Thr Gln Gln His His Leu Val Val Asp His Ile Arg Leu Leu His 1:45 , 150 155 . . 160 Phe Leu Thr Pro Ser Ala Met Arg Trp Ala Thr Thr Ile Ala Cys Leu Leu Ala Ile Leu Leu Ala Ile <210> 21 <211> 201 <212> PRT
<213> Porcine reproductive and respiratory syndrome virus <400> 21 Met Arg Cys Ser His Lys Leu Gly Arg Ser Leu Thr Pro His Ser Cys Phe Trp Trp Leu Phe Leu Leu Cys Thr Gly Leu Ser Trp Ser Phe Ala Asp Gly Asn Gly Asp Ser Ser Thr Tyr Gln Tyr Ile Tyr Asp Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Ser Ser His Phe Gly Trp Ala Val Glu Thr Phe Val Phe Tyr Pro Val Ala Thr His Ile Leu Ser Leu Gly Phe Leu Thr Thr Ser His Phe Phe Asp Ala Leu Gly Leu Gly Ala Val Ser Thr Ala Gly Phe Val Gly Gly Arg Tyr Val Leu Cys Ser Val Tyr Gly Ala Cys Ala Phe Ala Ala Phe Val Cys Phe Val Ile Arg Ala Ala Lys Asn Cys Met Ala Cys Arg Tyr Ala Arg Thr Arg Phe Thr Asn Phe Ile Val Asp Asp Arg Gly Arg Val His Arg Trp Lys Ser Pro Ile Val Val Glu Lys Leu Gly Lys Ala Glu Val Asp Gly Asn Leu Val Thr Ile Lys His Val Val Leu Glu Gly Val Lys Ala Gln Pro Leu Thr Arg Thr Ser Ala Glu Gln Trp Glu Ala 195 . 200 <210> 22 <211> 750 <212> DNA
<213> PRRSV Lelystad Agent ORF2 <400> 22 CAGGATGGTT ACTGGTCTTT CTTCTCAGAG TGGTTTGCTC CGCGCTTCTC CGTTCGCGCT 180' CCGGATGTCC CACAATTTGC AGTCAAGCAC CCATTGGGyA TGTTTTGGCA CATGCGAGTT 300 TCCCACTTGA TTGATGAGAT GGTCTCTCGT CGCATTTACC AGACCATGGA ACATTCAGGT 360' ATAGTTACTC ATTTCCAACA CCTGGCCGCA GTGGAGGCGG ATTCTTGCCG CTTTCTCAGC 480' <210> 23 <211> 798 <212> DNA
<213> PRRSV Lelystad Agent ORF3 <400> 23 GGCAACACAT CATTCGAGCT GACCATCAAC TACACCATAT GCATGCCCTG TTCTACCAGT 180' CCCAGTACAT CACGATAA 79g <210> 24 <211> 606 <212> DNA
<213> PRRSV Lelystad Agent ORFS
<400> 24 GCAGGATTTG TTGGCGGGCG GTACGTACTC TGCAGCGTCT ACGGCGCTTG TGCTTTCGCA 3.60 <210> 25 <211> 21 .
<212> DNA
<213> PRRSV Attenuation Site I ORF2 <400> 25 <210> 26 <211> 21 <212> DNA
<213> PRRSV Attenuation Site II ORF2 <400> 26 <210> 27 <211> 21 <212> DNA
<213> PRRSV Attenuation Site III ORF2 <400> 27 ATTGGGyATG TTTTGGCACA T 21 <210> 28 <211> 21 <212> DNA
<213> PRRSV Attenuation Site ORF3 <400> 28 <210> 29 <211> 21 <212> DNA
<213> PRRSV Attenuation Site ORFS
<400> 29 GACCTTTGTG CTTTACCCGG T ~ 21

Claims (42)

Claims

1. Attenuated European PRRS virus encoded by a nucleic acid comprising ORF1, ORF2, ORF3, ORF4, ORF5, ORF6 and ORF7, characterized in that:
a) ORF2 comprises at positions 11915 - 11935 at least one of the nucleotides as set out in table 1:

A T G A C C A G A A C G A A G A G T C T C
C C A C T T C A C C A A C C A C A C A C A
G G T G A A G T G G G T G G T G T G T G T

and at positions 12037 - 12057 at least one of the nucleotides as set out in table 2:

T G T T A A A C G T C A G T T C G T G G G
C A C C C C C T A C T C A C C T A C A A A
G T G G G G G A T G A G T G G A T G T T T

and at positions 12058 - 12078 at least one of the nucleotides as set out in table 3:

T A A C C C A T A C A A A A C C G T G T A
C C C T T T C C C T C C C C T T A C A C C
G G G A A A G G G A G G G G A A T G T G G

and/or a deletion at said position(s) and/or b) ORF3 comprises at positions 12660 - 12680 at least one of the nucleotides as set out in table 4:

C A A C A A T T A C A G G T A G G G C A G
T C C T C C C C C T C A A C C A A A T C A
A G G A G G G G G A G T T G G T T T A G T

and/or a deletion at said position(s) and/or c) ORE5 comprises at positions 13684 - 13704 at least one of the nucleotides as set out in table 5:

C T G G A A A C A C G A A A T G G G C C A
T C A A C C C T C T A C C C C A A A T T C
A G T T G G G A G A T G G G G T T T A A G

and/or a deletion at said position(s).

2. Attenuated European PRRS virus according to claim 1, characterized in that:

a) ORF2 comprises a C, A or G at position 11925 and/or a C, T or A at position and/or a A, C or G at position 12068 or a deletion at said position(s) and/or b) ORF3 comprises a A, C or G at position 12670 or a deletion at said position and/or c) ORE5 comprises a G, A or T at position 13694 or a deletion at said position.

3. Attenuated European PRRS virus according to claim 1 or 2, wherein said nucleic acid is further characterized in that:
a) said ORF2 comprises a C at position 11925 and/or a T at position 12047 and/or a C
at position 12068 or a deletion at said position(s) and/or b) said ORF3 comprises a C at position 12670 or a deletion at said position and/or c) said ORE5 comprises a T at position 13694 or a deletion at said position.

4. Attenuated European PRRS virus according to any of claims 1 to 3, wherein said nucleic acid is further characterized in that:
a) said ORF2 comprises the nucleic acid as defined in SEQ ID No. 1 and/or b) said ORF3 comprises the nucleic acid as defined in SEQ ID No. 2 and/or c) said ORF4 comprises the nucleic acid as defined in SEQ ID No. 3 and/or d) said ORF5 comprises the nucleic acid as defined in SEQ ID No. 4.
or a fragment, allelic variant, functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof.

5. Attenuated European PRRS virus according to any of claims 1 to 4, wherein said nucleic acid is characterized in that:
a) said ORF2 consists of the nucleic acid as defined in SEQ ID No. 1 and/or b) said ORF3 consists of the nucleic acid as defined in SEQ ID No. 2 and/or c) said ORF4 consists of the nucleic acid as defined in SEQ ID No. 3 and/or d) said ORF5 consists of the nucleic acid as defined in SEQ ID No. 4.

6. Attenuated European PRRS virus according to any of claims 1 to 5, wherein said nucleic acid is characterized in that it comprises the nucleic acid as defined in SEQ ID
No. 5 or a fragment, allelic variant, functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof.

7. Attenuated European PRRS virus according to. any of claims 1 to 6, wherein said nucleic acid is characterized in that it consists of the nucleic acid as defined in SEQ ID
No. 5.

8. Attenuated European PRRS virus according to any of claims 1 to 3, wherein said nucleic acid is further characterized in that:
a) said ORF2 comprises the nucleic acid as defined in SEQ ID No. 6 and/or b) said ORF3 comprises the nucleic acid as defined in SEQ ID No. 7 and/or c) said ORF4 comprises the nucleic acid as defined in SEQ ID No. 8 and/or d) said ORE5 comprises the nucleic acid as defined in SEQ ID No. 9 and/or or a fragment, allelic variant, functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof.

9. Attenuated European PRRS virus according to any of claims 1 to 3 or 8, wherein said nucleic acid is further characterized in that:
a) said ORF2 consists of the nucleic acid as defined in SEQ ID No. 6 and/or b) said ORF3 consists of the nucleic acid as defined in SEQ ID No. 7 and/or a) said ORF4 consists of the nucleic acid as defined in SEQ ID No. 8 and/or b) said ORE5 consists of the nucleic acid as defined in SEQ ID No. 9.

10. Attenuated European PRRS virus, wherein said PRRS virus is characterized in that:
a) ORF1a comprises the amino acid as defined in SEQ ID No. 10 and/or b) ORF1b comprises the amino acid as defined in SEQ ID No. 11 and/or c) ORF2 comprises the amino acid as defined in SEQ ID No. 12 and/or d) ORF3 comprises the amino acid as defined in SEQ ID No. 13 and/or e) ORF4 comprises the amino acid as defined in SEQ ID No. 14 and/or f) ORF5 comprises the amino acid as defined in SEQ ID No. 15 and/or g) ORF6 comprises the amino acid as defined in SEQ ID No. 16 and/or h) ORF7 comprises the amino acid as defined in SEQ ID No. 17.
or a fragment, allelic variant, functional variant, glycosylation variant, fusion molecule or a chemical derivative thereof.

11. Attenuated European PRRS virus according to claim 10, wherein said PRRS
virus is characterized in that:

a) ORF1a consists of the amino acid as defined in SEQ ID No. 10 and/or b) ORF1b consists of the amino acid as defined in SEQ ID No. 11 and/or c) ORF2 consists of the amino acid as defined in SEQ ID No. 12 and/or d) ORF3 consists of the amino acid as defined in SEQ ID No. 13 and/or e) ORF4 consists of the amino acid as defined in SEQ ID No. 14 and/or f) ORE5 consists of the amino acid as defined in SEQ ID No. 15 and/or g) ORF6 consists of the amino acid as defined in SEQ ID No. 16 and/or h) ORF7 consists of the amino acid as defined in SEQ ID No. 17.

12. Attenuated European PRRS virus, wherein said PRRS virus is characterized in that:
a) ORF2 comprises the amino acid as defined in SEQ ID No. 18 and/or b) ORF3 comprises the amino acid as defined in SEQ ID No. 19 and/or c) ORF4 comprises the amino acid as defined in SEQ ID No. 20 and/or d) ORE5 comprises the amino acid as defined in SEQ ID No. 21.
or a fragment, allelic variant, functional variant, glycosylation variant, fusion molecule or a chemical derivative thereof.

13. Attenuated European PRRS virus according to claim 14, wherein said PRRS
virus is characterized in that:
a) said ORF2 consists of the amino acid as defined in SEQ No. 18 and/or b) said ORF3 consists of the amino acid as defined in SEQ No. 19 and/or c) said ORF4 consists of the amino acid as defined in SEQ No. 20 and/or d) said ORF5 consists of the amino acid as defined in SEQ No. 21.

14. A nucleotide sequence coding for a virus according to any one of claims 1 to 13.

15. A nucleotide sequence according to claim 14, wherein the nucleotide sequence has been modified to encode a virulence marker and/or a serological marker.

16. A nucleotide sequence according to claim 14 or 15, wherein the nucleic acid encoding said marker is located within any of the open reading frames encoding structural viral proteins.

17. Method for the generation of an infectious live attenuated PRRS virus, said method comprising producing a recombinant nucleic acid comprising at least one full-length DNA copy or in vitro-transcribed RNA copy or a derivative of either whereby said nucleotide sequence is a nucleotide sequence according to any one of claims 14 to 16.

18. Method for the generation of-an-infectious live attenuated PRRS virus, said method is characterized by the following steps:
a) a PRRS virus according to any of claims 1 to 13 is used to infect a suitable cell line b) said PRRS virus is attenuated via cell culture passages.

19. Method according to claim 18, wherein said cell line is a Marc cell or a derivative therof.

20. Method according to any one of claims 18 or 19, wherein said PRRS virus is the virus according to any one of claims 1 to 13.

21. Method according to any one of claims 18 to 20, wherein said PRRS virus is the virus according to claim 5, 9, 11 or 13.

22. Cell line comprising a PRRS virus according to any one of claims 1 to 13.

23. Cell line according to claim 22, wherein said cell line is a Marc cell or a derivative therof.

24. Pharmaceutical composition comprising a PRRS virus according to any one of claims 1 to 13 and a pharmaceutically acceptable carrier.

25. Use of a PRRS virus according to any one of claims 1 to 13 in the manufacture of a vaccine for the prophylaxis and treatment of PRRS infections.

26. Method of attenuation of a European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at least one of the positions of ORF2 corresponding to positions 130 to 150 and/or positions 252 to 272 and/or positions 273 to 293 of SEQ ID NO: 22;

b) it is tested whether the resulting PRRS virus is attenuated.

27. Method of attenuation of a European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at least one of the positions of ORF3 corresponding to positions 267 to 287 of SEQ
ID NO: 23;
b) it is tested whether the resulting PRRS virus is attenuated.

28. Method of attenuation of a European PRRS virus, characterised in that a) the nucleotide sequence of said virus is modified by site-directed mutagenesis at at least one of the positions corresponding to positions 201 to 221 of ORE5 according to SEQ ID NO: 24;
b) it is tested whether the resulting PRRS virus is attenuated.

29. Method of any one of claims 26 to 28, wherein the modification results in a change of the amino acid sequence of the encoded protein.

30. Method of any one of claims 26 to 29, wherein the modification is a deletion or a substitution.

31. Method of any one of claims 26 to 30, wherein the sequence of each of ORF2, ORF3, and ORE5 is modified.

32. Method of claim 31, wherein the sequence of ORF2 is modified at least at two, preferably at least at three positions.

33. Method of any one of claims 26 to 32, wherein the modification results in one or more of the following features: an ORF2 encoding a protein having the amino acid at one or more of amino acid sequence positions corresponding to positions 47, 88 and/or 95 of the amino acid sequence encoded by SEQ ID NO: 22 substituted or deleted; an encoding a protein having the amino acid corresponding to position 93 of the amino acid sequence encoded by SEQ ID NO: 23 substituted or deleted; and/or an ORF5 encoding a protein having the amino acid corresponding to position 71 of the amino acid sequence encoded by SEQ ID NO: 24 substituted or deleted.

34. Method of claim 33, wherein the modification results in one or more, preferably all of the following features: an ORF2 encoding a protein having serine at the position corresponding to position 47 of the amino acid sequence encoded by SEQ ID NO:
22, an ORF2 encoding a protein having phenylalanine at the position corresponding to position 88 of the amino acid sequence encoded by SEQ ID NO: 22, an ORF2 having leucine at the postion corresponding to position 95 of the amino acid sequence encoded by SEQ ID NO: 22, an ORF3 having proline at the position corresponding to position 93 of the amino acid sequence encoded by SEQ ID NO: 23, and/or an ORE5 having phenylalanine at the position corresponding to position 71 of the amino acid sequence encoded by SEQ ID NO: 24.

35. Method of claim 34, wherein the modification results in one or more, preferably all of the following features: an ORF2 having a C at the position corresponding to position 140 if SEQ ID NO: 22, an ORF2 having a T at the position corresponding to position 262 of SEQ ID NO: 22, an ORF2 having a C at the position corresponding to position 283 of SEQ ID NO: 22, an ORF3 having a C at the position corresponding to position 277 of SEQ ID NO: 23; and/or an ORF5 having a T at the position corresponding to position 211 of SEQ ID NO: 24.

36. Attenuated European PRRS virus obtainable by the method of any one of claims 26 to 35.

37. Attenuated European PRRS virus having an ORF2 which differs from SEQ ID
NO: 22 at one or more of positions 130 to 150, and/or at one or more of positions 252 to 272, and/or at one or more of positions 273 to 293.

38. Attenuated European PRRS virus having an ORF3 which differs from SEQ ID
NO: 23 at one or more of positions 267 to 287.

39. Attenuated European PRRS virus having an ORF5 which differs from SEQ ID
NO: 24 at one or more of positions 201 to 221.

40. Vaccine comprising an attenuated European PRRS virus according to according to any one of claims 36 to 39 in combination with a pharmaceutically acceptable carrier.

41. Method of vaccination of a pig against PRRS, characterised in that an efficient amount of the vaccine of claim 40 is adminstered to said pig.

42. Use of an attenuated European PRRS virus according to any one of claims for the manufacture of a vaccine against PRRS.