SK11282003A3 - Life attenuated European PRRS virus, nucleotide sequence coding said virus, method of generating such virus, cell line, and a pharmaceutical composition comprising said PRRS viruses and the use thereof - Google Patents

Abstract

The present invention realtes to live attenuated European PRRS viruses which are attenuated by nucleic acid mutations on specific sties of the viral protein coded by ORF 2, 3 and 5. The invention also pertains to nucleotide sequences coding said viruses, methods of generating such viruses and a pharmaceutical composition comprising said PRRS viruses and teh use of said PRRS virus in the manufacture of a vaccine for the prophylaxis and treatment of PRRSV infections.

Description

Technical field

The present invention relates to live attenuated European PRRS viruses that are attenuated by nucleic acid mutations at specific sites. The invention also relates to nucleotide sequences encoding said viruses, to methods for generating such viruses and to a pharmaceutical composition comprising said PRRS viruses and to the use of the PRRS virus for the production of a vaccine for the prophylaxis and treatment of PRRS infections.

BACKGROUND OF THE INVENTION

Porcine reproductive and respiratory syndrome (PRRS) is caused by enveloped positive-stranded RNA virus of the family Arteriviridae (Snijder E.J., Meuleberg J.J.M. 1998. "The molecular biology of arteriviruses". Journal of General Virology 79 (5): 961-971). Approximately 10 to 15 years ago, two different PRRS virus strains apparently appeared independently in the US and Europe. The disease is now endemic in many pig producing countries in North America, Europe and Asia. It is still a major cause of reproductive loss and respiratory disease in pigs. In the US, the prevalence of infection is estimated to be up to 70%.

The virus is transmitted by inhalation, swallowing, coitus, bite wounds or needles. It replicates in mucosal, pulmonary or regional macrophages. Subclinically, the disease leads to deficiency or persistent infection. Permanently infected animals secrete the virus into oral / pharynx fluids, blood, faeces, urine and semen. Clinical symptoms in sows are related to abortion or premature litters with mild newborn pigs, stillborn pigs and autolysed fetuses. Infected newborn pigs have high mortality and suffer from pneumonia. The subsequent treatment and breeding of piglets is complicated

W-W

-2 pneumonia, parallel bacterial infections and increased mortality. Boars are susceptible to fever and morphological changes in semen.

As with all arteriviruses, the PRRS viral genome is a single stranded positive RNA molecule of approximately 15 kilobases in length. ORF's (open reading frame) 1a and 1b encode replicases, ORF's 2-5 alleged glycoproteins (gp 1-4), ORF 6 encodes membrane protein (M) and ORF 7 encodes nucleocapsid protein (N).

Original descriptions of PRRS infection in the US (WO 93/03760, isolate ATCC VR-2332, deposited July 18, 1991 at the American Type Culture Collection in Rockville, Maryland, USA, NCBI GeneBank accession number U 87392 U00153) and in Europe (WO 92/21375 , isolate Lelystad agent (CDI-NL-2.91), accession number CNCM 1-1102, deposited on June 5, 1991 at the Paster Institute in Paris; NCBI GeneBank accession numbers M 96262 [gi: 11125727, C 002533 [gi: 11138120]) identified viruses that have genomic and serological differences. The comparison demonstrated that they both share a common ancestor, who split up before the clinical disease was described in the late 1980s. Complete genomic sequences for a number of PRRS viruses and their complete regions encoding structural proteins have been published (Snijder et al., Supra; Meulenberg JJM, Hulst, MM et al., 1993. Lelystad virs, the causative agent of porcine epidemic abortion and respiratory syndrome ... Virology 1992, 62-72, Conzelmann KK, Visser N., Van Woensel P., Thiel HJ, 1993. , Elam MR, Kakach LT, 1995. A comparison of the sequences encoding the structural proteins of VR-2332 and Lelystad virus strains of PRRS virus is given in Archives of Virology 140, 1451-1460, Kapur V., Elam MR, Pawtovich TM Murtaugh MP, 1996 in porcine reproductive ad respiratory syndrome virus isolates in the midwestern United States, Journal of General Virology 77, 1271-1276).

PRRS virus can replicate in vitro in porcine lung macrophages, monocytes, glial cells and two MA-104 cell subpopulations (embryonic monkey kidney cells) known as CL-2621 and MARC-145 (KD Rossow, Porcine reproductive ad respirators syndrome, Vet Pathol) 35: 1-20 (1998).

-3Recombinants for generating infectious PRRS clones are available (EP 0839912).

Live attenuated PRRS vaccines (RespPRRS / Ingelvac® PRRS MLV, Boehringer Ingelheim) are commercially available for the protection of pigs. Killed vaccines (completely inactivated virus) or subunit vaccines (commonly purified and heterologously expressed purified viral proteins) are often of lower quality than live vaccines in terms of their efficacy in producing a complete protective immune response even in the presence of an adjuvant. It has been demonstrated for PRRS that, compared to the currently available killed vaccines, attenuated vaccines induce immunity to disease that lasts longer and is more effective (Snijder et al., Cited above). Current live PRRS vaccines are usually attenuated by serial passage of the virus on suitable host cells until the pathogenicity is lost (American strain: EP 0529584; European strain: EP0676467; EP 0835930).

Current live PRRS vaccines still leave room for improvement. First, do not prevent reinfection. Secondly, they do not allow a serological distinction between vaccinated animals and animals infected with natural virus. In addition, the live vaccine entails a theoretical risk of reversion to an undiluted phenotype. In particular, RNA viruses, such as the PRRS virus, are considered to have high rates of mutation due to inaccurate replication of the RNA genome, which is due to a lack of control reading of the RNA replication enzyme. In the normal isolation of attenuated viruses obtained by routine multiple passages, the unknown molecular origin as well as genetic stability remains unknown, and the features of the revertants cannot be assumed.

Thus, the problem solved by the invention is to provide improved PRRS virus strains that can be used to produce vaccines that overcome the disadvantages of the prior art.

SUMMARY OF THE INVENTION

Before describing the embodiments of the present invention, it should be noted that the singular used in the specification and the appended claims includes the plural,

-4and the context clearly does not indicate otherwise. Thus, for example, the term "PRRS virus" includes a plurality of such PRRS viruses, the term "cell" includes one or more cells and their equivalents known to one of ordinary skill in the art and so on. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to the methods and materials described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials will now be described. All publications mentioned herein are incorporated by reference herein for the purpose of describing and illustrating cell lines, vectors, and methodologies that are disclosed in documents that could be used in connection with the invention. Nothing herein is to be construed as an admission that the invention has no right to be considered novel in view of the prior art description.

The present invention provides an attenuated European PRRS virus encoded by a nucleic acid comprising ORF1, ORF2, ORF3, ORF4, ORF5, ORF6 and ORF7 and their subtypes, such as ORF1a and ORFIb or ORF2a and ORF2b, characterized in that:

(a) ORF2 contains at positions 11915-11935 at least one of the nucleotides as shown in Table 1:

A T G A C C A G A A C G A A G A G T C T C C C A C T T C A C C A A C C A C A C A C A G G T G A A G T G G G T G G T G T G T G T and at positions 12037-12C At least one of the nucleotides as set forth in U.S. Pat Table 2: T G T T A A A C G T C A G T T C G T G G G C A C C C C C T A C T C A C C T A C A A A G T G G G G G A T G A G T G G A T G T T T

and at positions 12058-12078 at least one of the nucleotides as set forth in Table 3:

T A A C C C A T A C A A A A C C G T G T A C C C T T T C C C T C C C C T T A C A C C G G G A A A G G G A G G G G A A T G T G G a / a or a deletion in said semi he (polo and / or

-5b) ORF3 contains at positions 12660-12680 at least one of the nucleotides as shown in Table 4:

C A A C A A T T A C A G G T A G G G C A G T C C T C C C C C T C A A C C A A A T C A A G G A G G G G G A G T T G G T T T A G T a / a or a deletion in said semi j φ T? o o or)

(c) ORF5 contains at positions 13684-13704 at least one of the nucleotides shown in Table 5:

C T G G A A A C A C G A A A T G G G C C A T C A A C C C T C T A C C C C A A A T T C A G T T G G G A G A T G G G G T T T A A G a / a or a deletion in said semi ie (semi Hach).

Surprisingly, it has been found that PRRS viruses contain specific sites in individual viral proteins which, when mutated, lead to an attenuated phenotype as compared to the original virulet natural field strain. The evolutionary pressure on these sites, now called "virulence specific sites" or simply referred to as "sites of the invention" or "sites" only, is enormous. It is believed that these sites were generally involved in the process leading to the weakening of European PRRSV-like vaccine strains. These sites, listed in Tables 1 to 5, are specific to European strains (the standard Lelystad Agens CNCM 1-1102 is taken as a reference type strain) and are not shared with US PRRS virus strains.

Furthermore, the invention relates to an attenuated European PRRS virus, wherein at least one of the sequence portions of the corresponding sequences is SEQ. no. 25, 26, 27, 28 or 29 mutated at one, two, three or more positions, up to a maximum of ten mutations. Places in Seq. no. 25, 26, and 27 are located in vORF2 (positions 130150, 252-272 and 273-293, respectively, in Figure 1), instead of SEQ ID NOs. no. 28 is located in ORF3 (position 267-287 in Figure 3) and the site in SEQ. no. 29 is located in ORF5 (position 201-221 in Figure 4). Said sequence portions represent virulent specific sites of the invention. Since the PRRS virus is a positive strand RNA virus, it will contain the corresponding RNA sequence instead of the DNA sequences listed in the sequence listing, i. will contain

-6-uracil (U) at positions designated as thymine (T) in the sequence lists, and ribose instead of deoxyribose.

It will be appreciated that the attenuated European PRRS virus of the invention comprises genomic RNA comprising the sequence portions corresponding to the DNA sequences of SEQ. no. 25, 26, 27, 28 or 29, wherein at least one of said sequence portions differs from said sequences by at least one mutation. In this context, the term "corresponding" means that the virus of the invention comprises sequence parts that can be aligned with reference sequences by a standard matching algorithm such as BLAST (Altschul, SF, Gish, W., Miller, W., Myers, EV & Lipman, DJ (1990) "Basic local alignment search toll." J. Mol. Biol. 215: 403-41; Gish, W. & States, DJ (1993) "Identification of protein coding regions by database similarity search." "Nature Genet. 3: 266-272; Madden, TL, Tatusov, RL & Zhang, J. (1996)" Applications of the BLAST server network "Meth. Enzymol. 266: 131-141; Zhang, J. & Madden, TL (1997) "PowerBLAST: A New Network of BLAST Applications for Interactive or Automated Sequence Analysis and Annotation." Genome Res. 7: 649-656; Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLST: A New Generation of protein databasesearch programs', Nucleic Acids Res. 25: 3389-3402). Sequence positions that are paired with such an algorithm are "matching" to each other.

In such alignment, the respective mutated sequence parts of the virus should then differ from the corresponding reference sequence ("sites", i.e. either SEQ IDs 25, 26, 27, 28, or 29) at one, two, three or more positions, up to ten positions. Preferably, the virus of the invention is mutated at all five cited sequence positions (sites). Preferably, the mutation (s) is / are a substitution (s) and / or a deletion (s). In preferred embodiments, the mutations result in a change in at least the acid sequence (s) of the protein (s) encoded by the respective ORF (s).

Furthermore, the present invention relates to an attenuated European PRRS virus having ORF2 comprising a sequence portion corresponding to SEQ. no. 25, wherein the triplet corresponding to positions 10 to 12 of SEQ. no. 25 is mutated. Preferably said

The triplet does not code phenylalanine. Preferably said triplet encodes another amino acid. In a preferred embodiment, said triplet encodes serine. More preferably, the nucleotide corresponding to position 11 in SEQ. no. Thus, in a preferred embodiment, the attenuated European PRRS virus has ORF2 encoding a protein that does not have phenylalanine at position 47 (or the corresponding position in the BLAST alignment). Instead, said protein preferably has serine at this position.

Furthermore, the present invention relates to an attenuated European PRRS virus having ORF2 comprising a sequence portion corresponding to SEQ. no. 25, wherein the triplet corresponding to positions 10 to 12 of SEQ. no. 26 is mutated. Preferably said triplet does not encode valine. Preferably said triplet encodes another amino acid. In a preferred embodiment, said triplet encodes phenylalanine. More preferably, the nucleotide corresponding to position 10 in SEQ. no. 26 is T (respectively U in RNA). Thus, in a preferred embodiment, the attenuated European PRRS virus has ORF2 encoding a protein that has no valine at position 88 (or the corresponding position in the BLAST alignment). Instead, said protein preferably has phenylalanine at this position.

Furthermore, the present invention relates to an attenuated European PRRS virus having ORF2 which comprises a sequence portion corresponding to SEQ. no. 27, wherein the triplet corresponding to positions 11-13 of SEQ. no. 27 is mutated. Preferably said triplet does not encode phenylalanine. Preferably said triplet encodes another amino acid. In a preferred embodiment, said triplet encodes leucine. More preferably, the nucleotide corresponding to position 11 in SEQ. no. Thus, in a preferred embodiment, the attenuated European PRRS virus has ORF2 encoding a protein that does not have phenylalanine at position 95 (or the corresponding position in the BLAST alignment). Instead, said protein preferably has leucine at this position.

Furthermore, the present invention relates to an attenuated European PRRS virus having ORF3, which comprises a sequence portion corresponding to SEQ. no. 28, wherein the triplet corresponding to positions 11-13 of SEQ. no. 28 is mutated. Preferably said triplet does not encode serine. Preferably said triplet encodes another amino acid. In a preferred embodiment, said triplet encodes a proline. More preferably, the nucleotide corresponding to position 11 in SEQ. no. Thus, in a preferred embodiment, the attenuated European PRRS virus has an ORF3 encoding a protein that does not have a serine in position.

-893 (or the corresponding position for BLAST alignment). Instead, said protein preferably has proline at this position.

Another object of the present invention relates to an attenuated European PRRS virus having ORF5, which comprises a sequence portion corresponding to SEQ. no. 29, wherein the triplet corresponding to positions 11-13 of SEQ. no. 29 is mutated. Preferably said triplet does not encode leucine. Preferably said triplet encodes another amino acid. In a preferred embodiment, said triplet encodes phenylalanine. More preferably, the nucleotide corresponding to position 11 in SEQ. no. 29 is T (or U in RNA). Thus, in a preferred embodiment, the attenuated European PRRS virus has ORF5 encoding a protein that does not have a leucine at position 71 (or the corresponding position in the BLAST alignment). Instead, said protein preferably has phenylalanine at this position.

Live PRRS vaccines based on European strains attenuated by defined mutations and / or deletions make it possible to avoid the disadvantages of the current generation of attenuated vaccines. If the attenuated strain carries defined and known mutations, it can be easily analyzed for quality and genetic stability. The possibility of introducing defined deletions and / or substitutions, in particular as double or multiple mutations, reduces the likelihood of reversion to an un-attenuated or virulent phenotype. A further advantage of the attenuating mutations lies in their known molecular uniqueness which allows them to be used as distinguishing labels for attenuated PRRS viruses to distinguish them from field PRRS viruses. With the sites identified in the present invention, safe and site-specific attenuated viruses can be generated. Such viruses are useful for preparing a safe live vaccine for use in preventing and / or treating PRRS infections.

The present invention relates to attenuated European PRRS strains and methods for their production. In this context, the term "attenuated" means that the virulent strain is or has been modified in such a way that it is less virulent or pathogenic than before it was modified. In particular, "attenuated" means that the virus has a significantly reduced ability to cause clinical disease, although it is still able to replicate in the host. Preferably, virulence or pathogenicity is reduced to a level that makes the virus acceptable for administration as a vaccine. In a preferred embodiment, the virus is attenuated in a bird that is

It does not cause clinical disease, although it is still able to replicate in the host. The attenuated strain is an ideal vaccine agent because replication in the host guarantees the stimulation of a rapid and excellent immunological response. In a preferred embodiment, the attenuated European PRRS virus is less virulent than the Lelystad agent. In another embodiment, the attenuated virus is less virulent than the parent strain from which it is derived. The term "less virulent than PRRS virus Lelystad agent" (or, similarly to the parent strain from which it is derived) is to be understood in the context of comparing the clinical symptoms of a given virus with Lelystad agent (CDI-NL-2.91 / CNCM 1-1102) or parental tribe. Example 1 describes a preferred method for determining whether a PRRS virus is less virulent than Lelystad agents or the like, to determine whether a virus modified according to the invention is less virulent than its parent strain prior to modification. It may be that not every and every possible nucleic acid mutation at a virulent specific site is involved in reduced virulence. The method of Example 1 provides an accurate and direct experimental set-up to determine whether a live PRRS virus according to the instruction of the invention is less virulent than its parent strain or virulent field isolate than Lelystad agents.

The present invention relates to European PRRS strains which can be distinguished from American strains as follows. Very soon after the detection of the virus, Wensvoort et al. (J. Vet. Diagn. Invest 4: 134-138 (1992)) discovered differences in antigenic characteristics between American and European isolates. They developed sera against both American and European type in several pigs and compared the cross-reactivity of anti-European (LV) and anti-American (VR-2332) sera with three American virus isolates and 4 European isolates. Sera against PRRS viruses of the European serotype are significantly less reactive with American isolates than with European isolates. In addition, sera developed against American serotype viruses are less reactive or even completely unreactive with European virus isolates. Wensvoort et al. Also showed reactivity of serum developed against European and American isolates with two reference viruses CNCM 1-1102 (European) and ATCC VR-2332 American). In this experiment, the sera developed against European strains were not at all reactive with the American strain. So they exist

- 10 completely different virus serotypes: American and European serotypes, which can be distinguished by their serological characteristics.

This can also be demonstrated at the molecular level. Nelson et al. (74th Annual Meeting of Researchers in Animal Diseases, November 8-9, 1993) comparing the sequences of genes encoding polymerase from various isolates. They have demonstrated that polymerase genes exhibit 87-95% homology within the American group. However, only 64-67% homology at the nucleic acid level was found between European and American serotypes. Mardassi published comparable results at the aforementioned conference, which showed that 530 3'-terminal Quebec PRRS nucleic acids of the reference strain and European isolates showed only 59% homology. The results of the aforementioned publications show that the American and European serotypes have been bifurcated a long time ago, which would then simply explain their genetic differences and their serological unrelatedness.

Thus, the American and European serotypes can be easily distinguished. European serotype viruses are characterized by reacting with a higher titer in an immunoperoxidase monolayer panel with an antisera panel against the European PRRS virus LV (CNCM 1-1102) compared to a response with an antisera panel against the American PRRS virus (ATCC VR-2332). When a panel of sera, obtained approximately 40 days after infection, and from different animals is used, any virus can easily be classified as belonging to either the American or European serotype. Typically, the reactivity of a European strain with a panel of antisera against other European strains is approximately 400 times higher than the reactivity with a panel of antisera against American strains. When a European strain reacts with an antisera against a deposited European strain 1-1102 and a deposited American strain VR-2332, a difference in reactivity is typically found to be approximately 55-fold (Wensvoort et al., Cited above).

"Mutation" means the substitution, deletion or insertion of a nucleotide or amino acid at a given position in a nucleotide or amino acid sequence. "Substitution" means the replacement of a nucleotide or amino acid by another nucleotide or amino acid (e.g., C for T). "Deletion means nucleotide removal or

-11 amino acids. "Insertion" means that a nucleotide or amino acid is inserted at a given position.

Further, the present invention includes a method or process of weakening the European

PRRS virus in which:

(a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the ORF2 positions corresponding to positions 130 to 150 and / or positions 252 to 272 and / or positions 273 to 293 of SEQ ID NO: 2; no. 22;

b) it is tested whether the resulting PRRS virus is attenuated.

Further, the present invention includes a method of attenuating the European PRRS virus, in which:

a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the ORF3 positions corresponding to positions 267 to 287 of SEQ ID NO: 2; no. 23;

b) it is tested whether the resulting PRRS virus is attenuated.

Further, the present invention includes a method of attenuating the European PRRS virus, in which:

a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the positions corresponding to positions 201 to 221 of ORF5 according to SEQ ID NO: 2; no. 24;

b) it is tested whether the resulting PRRS virus is attenuated.

In this context, the term "corresponding" has the meaning given above, that is, the two positions correspond to each other if they can be aligned as a pair in sequence alignment, such as by using BLAST. Preferably, the modification of the invention results in a change in the amino acid sequence that encodes the protein. In preferred embodiments, the modifications are deletions and / or substitutions, preferably double or multiple mutations. In a preferred embodiment, two or more of the above modifications are combined. In another preferred embodiment, the sequence of each of ORF2, ORF3 and ORF5 is modified. Preferably, the ORF2 sequence is modified in at least two, preferably at least three, positions.

Preferably, the above method comprises modification (s) that result in one or more of the following features: OFR2 encoding the protein

Having 12 amino acid (s) at one or more amino acid sequence positions corresponding to positions 47, 88 and / or 95 of SEQ ID NO: 2; no. 22, substituted or deleted; ORF3 encoding a protein having an amino acid at an amino acid sequence position corresponding to position 93 of SEQ. no. 23 substituted or deleted; and / or ORF5 encoding a protein having an amino acid at an amino acid sequence position corresponding to position 71 of SEQ. no. 24 substituted or deleted. Preferably all of the above positions are mutated.

Preferably, the above method of the invention comprises a modification (s) that results in one or more, preferably all, of the following features: OFR2 encoding a protein that does not have phenylalanine at an amino acid sequence position corresponding to position 47 of SEQ. no. 22, an ORF2 encoding a protein that has no valine at the amino acid sequence position corresponding to position 88 of SEQ ID NO: 2; no. 22, an ORF2 that does not have phenylalanine at an amino acid sequence position corresponding to position 95 of SEQ ID NO: 2; no. 22, ORF3 which does not have a serine at the amino acid sequence position corresponding to position 93 of SEQ ID NO: 22; no. 23, and / or ORF5 that does not have a leucine at an amino acid sequence position corresponding to position 71 of SEQ ID NO: 23. no. 24th

Preferably, the above method of the invention comprises a modification (s) that results in one or more, preferably all, of the following features: OFR2 encoding a protein having a serine at an amino acid sequence position corresponding to position 47 of SEQ. no. 22, an ORF2 encoding a protein having a phenylalanine at an amino acid sequence position corresponding to position 88 of SEQ. no. 22, ORF2 having a leucine at an amino acid sequence position corresponding to position 95 of SEQ. no. 22, an ORF3 having a proline at an amino acid sequence position corresponding to position 93 of SEQ ID NO: 22; no. 23, and / or ORF5 having a phenylalanine at an amino acid sequence position corresponding to position 71 of SEQ. no. 24th

Preferably, the method of the invention comprises a modification (s) that results in one or more, preferably all of the following features: ORF2 having C at a position corresponding to position 140 of SEQ. no. 22, an ORF2 having a T at a position corresponding to position 262 of SEQ. no. 22, ORF2 having a C in position

-13 corresponding to position 283 of SEQ. no. 22, an ORF3 having C at a position corresponding to position 277 of SEQ. no. 23 and / or ORF5 having a T at a position corresponding to position 211 of SEQ. no. 24th

In addition, the present invention relates to an attenuated European virus obtainable by any of the above methods.

Further, the present invention encompasses a nucleic acid that comprises the encoding information of an attenuated European PRRS virus as described above. As mentioned above, it may be a ribonucleic acid (RNA). Such a nucleic acid may furthermore be a deoxyribonucleic acid which is complementary to such a ribonucleic acid, i. cDNA, or any other type of DNA. In a preferred embodiment, such cDNA is infectious. That is, if such cDNA is introduced into a suitable host cell, said cell will begin to generate viral particles. The present invention further relates to RNA, cDNA or other DNA comprising any of the above mutations, or more of the above mutations.

Further, the present invention encompasses a vaccine comprising an attenuated European PRRS virus as described in combination with a pharmaceutically acceptable carrier.

Further, the present invention comprises a method of inoculating pigs against PRRS, characterized in that an effective amount of the above vaccine is administered to the pig.

Further, the present invention relates to the use of an attenuated European PRRS virus as described for the production of a PRRS vaccine.

In accordance with the present invention, the nucleotides and amino acids are numbered according to a publicly available Lelystad agent as described above. However, as shown in Figures 1 to 4, ORFs ("open reading frames = ORFs") are numbered separately as some of them overlap.

The nucleotides of the specific sites where the attenuated European virus differs from the virulent wild type are in the ORF2 nucleotides 11915-11935 (Table 1 corresponding to numbers 130 to 150 in Figure 1), 12037-12057 (Table 2, numbers 252-272 in Figure 1) ), 12058-12078 (Table 3, Nos. 273-293 in Figure 1); in ORF3 12660-12680 (Table 4; numbers 267-287 in Figure 3) and / or in ORF5 1368413704 (Table 5; numbers 201-221 in Figure 4). Through mutation Lelystad

- 14agens at one or more of the above positions at any of the nucleotides listed in the tables and / or by deleting said nucleotides at these positions, the skilled artisan will obtain live attenuated European PRRS virus vaccine strains. Mutations, such as substitution or deletion, at these sites are limited only by the condition that the virus must still be able to replicate, i. it must still be a living virus. This can be determined without undue experimentation. A person of ordinary skill in the art can, for example, introduce e.g. one single mutation to each site described based on the provided tables, e.g. at position 11915, it may introduce A, C or G, or may delete a nucleotide at that position (which is T). A non-limiting example is shown in Figures 1-3 (ORF2, ORF3 and ORF5 of Lelystad B and attenuated virus A) and in Example 1.

The invention encompasses such viruses in which only one nucleotide, but also several nucleotides, or even all nucleotides, e.g. one or more triplets encoding one or more amino acids at said positions. However, the sequence must not be mutated to such an extent that the virus is no longer capable of replicating, i.e. the live virus is encoded according to the invention.

Other nucleic acids outside these regions may also be mutated, but this is not essential to the invention (see Figure 1, e.g., position 426 in Lelystad-B ORF2 in which C is instead of T).

Said mutations may be carried out by standard genetic engineering methods known in the art, in particular by site-specific mutagenesis. In the context of the present invention, the term "site-specific mutagenesis" means a genetic engineering technique that allows for controlled mutation at preselected nucleic acid sites. Generally, such a technique requires at least partial knowledge of the sequence of such a nucleic acid. The classical attenuation method through serial passage of the batch does not allow mutation at preselected sites. Such genetic engineering methods are well known in the art (see, e.g., Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Chapter 15; Wu (Ed. (1993), Methods in Enzymology vol. 217, pp. 173-285).

As a starting material for introducing mutations, a cDNA clone of a virulent PRSSV strain, e.g. Lelystad agents (CNCM 1-1102), generated by methods known in the art (Boyer and Haenni. Infectious transcripts and cDNAs of RNA viruses. Virology (1994) 198: 415-426). For example, an infectious PRRSV copy may be prepared as described in WO 00/53787; Meulenberg et al., Adv. Exp. Biol. (1998) 440: 199-206; Meulenberg et al., J. Virol. (1998) 72 (1): 380-387, which can then be mutated in accordance with the invention. The cited references provide detailed procedures on how to obtain infectious PRRSV cDNA clones and how to create mutants thereof. The mutated clone or its infectious transcripts generated in vitro can then be transfected into suitable host cells, which will then generate attenuated virus.

In particular, it was surprisingly found that the 11925, 12047 and 12068 ORF2 sites (see Figure 1); The 12670 ORF3 (see Figure 2) and / or 13694 ORF5 (see Figure 4) are still altered compared to the virulent field strain of Lelystad agent. Therefore, another preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention, in which:

(a) ORF2 comprises C, A or G at position 11925 and / or C, T or A at position 12047 and / or A, C or G at position 12068 or a deletion at said position (s) and / or

(b) ORF3 comprises A, C or G at position 12670 or a deletion at said position and / or

(c) ORF5 comprises G, A, or T at position 13694 or a deletion at said position.

More specifically, it was found that the 11925 site in ORF2 is still changed to C, the 12047 site in ORF2 is still changed to T, and the 12068 site in ORF2 is still changed to C (see Figure 1); site 12670 in ORF3 is still changed to C (see Figure 2) and / or 13694 ORF5 is still changed to T (see Figure 4) compared to the virulent field strain of Lelystad agent. Therefore, another, more preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention, wherein the nucleic acid is further characterized in that:

(a) ORF2 comprises a C at position 11925 and / or a T at position 12047 and / or a C at position 12068 or a deletion at said position (s), and / or

(b) ORF3 comprises a C at position 12670 or a deletion at said position and / or

c) ORF5 comprises a T at position 13694 or a deletion at said position.

Another, more preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention, which is designated as attenuated virus A in the figures, the nucleic acid of which is further characterized in that:

a) ORF2 comprises a nucleic acid as defined in SEQ. no. 1 and / or

b) ORF3 comprises a nucleic acid as defined in SEQ. no. 2 and / or

c) ORF4 comprises a nucleic acid as defined in SEQ. no. 3 and / or

d) ORF5 comprises a nucleic acid as defined in SEQ. no. 4, or a fragment, allelic variant, functional variant, variant based on degeneracy of the nucleic acid code, a fusion molecule or a chemical derivative thereof.

A "fragment" of the invention is any immunogenic subunit of the PRRS virus or ORF of the invention, i. any polypeptide subset that is encoded by a shorter nucleic acid molecule as described above, but still retains activity.

A "functional variant" of the PRRS virus or ORF of the invention is a PRRS virus or ORF that has a biological activity (either functional or structural) that is substantially similar to that of the PRRS virus or ORF of the invention. The term "functional variant" also includes "fragment", "allelic variant", "functional variant", "variant based on nucleic acid degeneracy" or "chemical derivatives". Such a "functional variant" can e.g. carrying one or more point mutations, one or more nucleic acid substitutions, deletions or insertions, or one or more amino acid substitutions, deletions or insertions. Said functional variant still retains its biological activity, e.g. function as a vaccine strain, at least in part, or also have an improved biological activity.

A "genetic code degenerate variant" is a variant due to the fact that a particular amino acid can be encoded by several different nucleotide triplets. Said variant still retains its biological activity, at least in part, or has an improved said biological activity.

A "fusion molecule" can be a PRRS virus or ORF of the invention fused e.g. with a reporter, such as a radiolabel, chemical

A molecule such as a fluorescent label or any other molecule known in the art.

As used herein, a "chemical derivative" of the invention is a PRRS virus or ORF of the invention chemically modified or containing other chemical groups that are not normally part of the molecule. Such groups can improve solubility, absorption, biological half-life of the molecule, etc.

A molecule is "substantially similar" to another molecule if both molecules have substantially similar structures or biological activity. Thus, assuming that two molecules have similar activity, they are considered variants, as this term is used herein even if the structure of one of the molecules is not in the other, or even if the sequence of the amino acid residues is not identical.

Another, most preferred embodiment of the present invention is an attenuated European PRRS virus of the invention (referred to as attenuated virus A in the figures), wherein the nucleic acid is characterized in that:

a) ORF2 consists of a nucleic acid as defined in SEQ. no. 1 and / or

b) ORF3 consists of a nucleic acid as defined in SEQ. no. 2 and / or

c) ORF4 consists of a nucleic acid as defined in SEQ. no. 3 and / or

d) ORF5 consists of a nucleic acid as defined in SEQ. no. 4th

Another preferred embodiment of the present invention is an attenuated European PRRS virus according to the invention (referred to as attenuated virus A in the figures), wherein the nucleic acid is characterized in that it comprises a nucleic acid as defined in SEQ. no. 5, or a fragment, allelic variant, functional variant, variant based and degeneracy of the nucleic acid code, fusion molecule or chemical derivative thereof.

Another preferred embodiment of the present invention is the attenuated European PRRS virus of the invention (LELYSTAD-B in the figures), wherein said nucleic acid is further characterized in that:

a) ORF2 comprises a nucleic acid as defined in SEQ. no. 6 and / or

b) ORF3 comprises a nucleic acid as defined in SEQ. no. 7 and / or

c) ORF4 comprises a nucleic acid as defined in SEQ. no. 8 and / or

d) ORF5 comprises a nucleic acid as defined in SEQ. no. 9 and / or a fragment, allelic variant, functional variant, variant based and degeneracy of the nucleic acid code, fusion molecule or chemical derivative.

Another preferred embodiment of the present invention is the attenuated European PRRS virus of the invention (LELYSTAD-B in the figures), wherein said nucleic acid is further characterized in that:

a) ORF2 consists of a nucleic acid as defined in SEQ. no. 6 and / or

b) ORF3 consists of a nucleic acid as defined in SEQ. no. 7 and / or

c) ORF4 consists of a nucleic acid as defined in SEQ. no. 8 and / or

d) ORF5 consists of a nucleic acid as defined in SEQ. no. 9th

Another important embodiment of the present invention is an attenuated European PRRS virus (attenuated virus A in the figures), wherein the PRRS virus is characterized in that:

a) ORF1a comprises an amino acid as defined in SEQ. no. 10 and / or

b) ORF1b comprises an amino acid as defined in SEQ. no. 11 and / or

c) ORF2 comprises an amino acid as defined in SEQ. no. 12 and / or

d) ORF3 comprises an amino acid as defined in SEQ. no. 13 and / or

e) ORF4 comprises an amino acid as defined in SEQ. no. 14 and / or

f) ORF5 comprises an amino acid as defined in SEQ. no. 15 and / or

g) ORF6 comprises an amino acid as defined in SEQ. no. 16 and / or

h) ORF7 comprises an amino acid as defined in SEQ. no. Or a fragment thereof, allelic variant, functional variant, variant based and degeneracy of a nucleic acid code, a fusion molecule or a chemical derivative.

Another, more preferred embodiment of the present invention is an attenuated European PRRS virus (attenuated virus A in the figures), wherein the PRRS virus is characterized in that:

a) ORF1a consists of an amino acid as defined in SEQ. no. 10 and / or

b) ORF1b consists of an amino acid as defined in SEQ. no. 11 and / or

c) ORF2 consists of an amino acid as defined in SEQ. no. 12 and / or

d) ORF3 consists of an amino acid as defined in SEQ. no. 13 and / or

e) ORF4 consists of an amino acid as defined in SEQ. no. 14 and / or

f) ORF5 consists of an amino acid as defined in SEQ. no. 15 and / or

g) ORF6 consists of an amino acid as defined in SEQ. no. 16 and / or

h) ORF7 consists of an amino acid as defined in SEQ. no. 17th

Another very important embodiment of the present invention is the attenuated European PRRS virus (LELYSTAD-B in the figures), characterized in that

a) ORF2 comprises an amino acid as defined in SEQ. no. 18 and / or

b) ORF3 comprises an amino acid as defined in SEQ. no. 19 and / or

c) ORF4 comprises an amino acid as defined in SEQ. no. 20 and / or

d) ORF5 comprises an amino acid as defined in SEQ. no. 21 or a fragment thereof, allelic variant, functional variant, variant based and degeneracy of the nucleic acid code, fusion molecule or chemical derivative.

Another very important embodiment of the present invention is the attenuated European PRRS virus (LELYSTAD-B in the figures), characterized in that

a) ORF2 consists of an amino acid as defined in SEQ. no. 18 and / or

b) ORF3 consists of an amino acid as defined in SEQ. no. 19 and / or

c) ORF4 consists of an amino acid as defined in SEQ. no. 20 and / or

d) ORF5 consists of an amino acid as defined in SEQ. no. 21st

Yet another important embodiment of the present invention is a nucleotide sequence encoding a virus of the invention as described above. Such nucleotide sequences comprise the sequences described in the Sequence Listing (e.g., with SEQ ID NOS: 1 to 9 (SEQ ID NO: <400)) The invention further relates to the proteins shown in SEQ ID NOs 10 to 21.

Yet another preferred embodiment of the present invention is a nucleotide sequence of the invention that has been modified to encode a virulent marker and / or a serological marker. As stated on the introductory pages, the ability to differentiate between a less virulent live vaccine strain of a pharmaceutical composition and a virulent wild-type viral infection is important to manage pig health. This is often difficult, especially if the clinical symptoms of the field infection are not specific or are obscured by other infections or if the time of observation and assessment is short. Recombinant generation of the viruses of interest allows for the introduction of modifications into the genetic code that introduce a serological marker and / or a virulent marker. Serological marker indicates

An antigen-detectable molecule, such as a peptide, protein, glycoprotein, which can be isolated from infected cells or body fluids such as, but not limited to, pharyngeal or nasal fluid or urine. A virulent marker must be understood as a marker in the genetic code that can be identified by recombinant analytical methods such as, but not limited to, PCR and routine sequencing. Therefore, in a preferred embodiment, the present invention relates to a nucleotide sequence of the invention that has been modified to encode a virulent marker and / or a serological marker. In particular, mutations or deletions introduced to attenuate the virus are useful as virulent and serological markers. By monitoring these mutations at the claimed virulent specific sites, it is possible to predict the appearance of possible virulent revertants at an early stage.

Yet another preferred embodiment of the present invention is a nucleotide sequence of the invention wherein the nucleic acid encoding said marker is located between any of the open reading frames encoding structural viral proteins.

Further, the invention relates to a method of generating an infectious live attenuated PRRS virus, comprising producing a recombinant nucleic acid comprising at least one complete DNA copy or an in vitro transcribed RNA copy or derivative of either DNA or RNA, wherein said nucleotide sequence is a nucleotide sequence of the invention. Thus, in accordance with the invention, the method results in a PRRS virus as described above. One of skill in the art may utilize site-specific mutagenesis (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Chapter 15; Wu (Ed.) (1993), Methods in Enzymology vol. 217, pp. 173-285) or any other method for introducing a mutation (s) to specifically introduce a mutation (s) to obtain a PRRS virus as described above.

The method described in the following preferred embodiment will lead (at the genomic level) to the PRRS virus of the invention as described above. Thus, in another preferred embodiment, the invention relates to a method as described for generating an infectious attenuated PRRS virus, characterized by the following steps:

a) The PRRS virus of the invention is used to infect a suitable cell line,

b) said PRRS virus is further attenuated by passage on cell cultures.

Another preferred embodiment relates to a method as described wherein said cell line is an embryonic monkey kidney cell line or preferably a Mare cell or a derivative thereof (see below).

Another preferred embodiment of the invention relates to a method as described in which the PRRS virus is the virus (s) of the invention as described above.

Furthermore, the present invention relates to a cell line comprising the PRRS virus of the invention. Examples of such cell lines include permanent cell lines known to the skilled person, preferably porcine, monkey or human cell lines, such as human embryonic kidney (HEK) 293, BHK, GH3, H4, U373, NT2, PC12, COS, CHO, Ltk-, fibroblasts. , myelomas, neuroblatomas, hybridomas, oocytes, embryonic stem cells), insect cell lines (e.g., using baculovirus vectors such as pPbac or pMbac (Stratagene, La Jolla, USA)), yeasts (e.g., Pichia pastoris, or using yeast expression vectors) , such as pYESHIS (Invitrogen, San Diego, USA), and fungi.

Further, in a preferred embodiment, the invention relates to a cell line according to the invention which is an embryonic monkey kidney cell or, preferably, a Mare cell, or a derivative thereof.

Further, the present invention includes a method or process of attenuating the European PRRS virus, characterized in that:

a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the ORF2 positions corresponding to positions 130 to 150 and / or positions 252 to 272 and / or positions 273 to 293 of SEQ ID NO: 2; no. 22;

(b) it is tested whether the resulting PRRS virus is attenuated.

In this context, a position in a nucleic acid or amino acid sequence "corresponding" to a position in another sequence means that if the two sequences have sufficient structural similarity, they can be aligned through a standard matching algorithm such as BLAST (Altschul, SF, Gish, W. Miller, W., Myers, EV & Lipman, DJ (1990) &quot; Basic local

-22 alignment search toll. 'J. Mol. Biol. 215: 403-41; Gish, W. & States, D.J. (1993) "Identification of protein coding regions by database similarity search." Nature Genet. 3: 266-272; Madden, T.L., Tatusov, R.L. & Zhang, J. (1996) "Applications of Network BLAST Server" Meth. Enzymol. 266: 131-141; Zhang, J. & Madden, T.L. (1997) "PowerBLAST: A New Network BLAST Application for Interactive or Automated Sequence Analysis and Annotation." Genome Res. 7: 649-656; Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLST: a new generation of protein databasesearch programs Nucleic Acids Res. 25: 3389-3402), and in performing such alignment, the two positions would be aligned as a pair.

A further embodiment of the present invention relates to a method of attenuating the European PRRS virus, comprising:

a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the ORF3 positions corresponding to positions 267 to 287 of SEQ ID NO: 2; no. 23;

(b) it is tested whether the resulting PRRS virus is attenuated.

A further embodiment of the present invention relates to a method of attenuating the European PRRS virus, comprising:

a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the positions corresponding to positions 201 to 221 of ORF5 in SEQ ID NO: 2; no. 24;

(b) it is tested whether the resulting PRRS virus is attenuated.

Preferably, the modification as described above results in a change in the amino acid sequence of the encoded protein. Preferably, the modification is a deletion or substitution. In a preferred embodiment, the sequence of each of ORF2, ORF3 and ORF5 is modified. In another preferred embodiment, the ORF2 sequence is modified in at least two, preferably at least three, positions. Preferably, the modification results in one or more of the following features; OFR2 encoding a protein having an amino acid at one or more amino acid sequence positions corresponding to positions 47, 88 and / or 95 of the amino acid sequence of the encoded sequence. no. 22, substituted or deleted;

-23ORF3 encoding a protein having an amino acid corresponding to position 93 in the amino acid sequence of the encoded sequence. no. 23 substituted or deleted;

and / or ORF5 encoding a protein having an amino acid corresponding to position 71 of the amino acid sequence of the encoded sequence. no. 24 substituted or deleted.

More preferably, a modification made in this way results in one or more, preferably all of the following features: OFR2 encoding a protein having a serine at a position corresponding to position 47 of the amino acid sequence of the encoded sequence. no. 22, an ORF2 encoding a protein having phenylalanine at a position corresponding to position 88 of the amino acid sequence of the encoded sequence. no. 22, ORF2 having a leucine at a position corresponding to position 95 of the amino acid sequence of the encoded sequence. no. 22, an ORF3 having a proline at a position corresponding to position 93 of the amino acid sequence of the encoded sequence. no. 23, and / or ORF5 having a phenylalanine at a position corresponding to position 71 in the amino acid sequence of the encoded sequence. no.

24th

In preferred embodiments, the modification results in one or more, preferably all of the following features: ORF2 having a C at a position corresponding to position 140 in SEQ. no. 22, an ORF2 having a T at a position corresponding to position 262 in SEQ. no. 22, an ORF2 having a C at a position corresponding to position 283 in SEQ. no. 22, an ORF3 having a C at a position corresponding to position 277 in SEQ. no. 23 and / or ORF5 having a T at a position corresponding to position 211 in SEQ. no. 24th

In another embodiment, the present invention relates to an attenuated European PRRS virus obtainable by the method described above.

In another embodiment, the present invention relates to an attenuated European PRRS virus having ORF2 that differs from SEQ. no. 22 in one or more positions 130 to 150 and / or one or more positions 252 to 272 and / or one or more positions 273 to 293.

In another embodiment, the present invention relates to an attenuated European PRRS virus having ORF3 that differs from SEQ. no. 23 in one or more positions 267 to 287.

In another embodiment, the present invention relates to an attenuated European PRRS virus having ORF5 that differs from SEQ. no. 24 at one or more of positions 201 to 221.

In another embodiment, the present invention relates to a vaccine comprising an attenuated European PRRS virus as described above in combination with a pharmaceutically acceptable carrier. In another embodiment, the present invention relates to a method for vaccination of pigs against PRRS, comprising administering an effective amount of such a vaccine to a pig. Alternatively, the present invention relates to the use of an attenuated European PRRS virus as described for the production of a PRRS vaccine.

Advantageously, the live attenuated PRRS virus may be used for the treatment, prophylaxis or diagnosis of diseases caused by wild-type PRRS virus. Examples of such diseases and uses are given in Example 1. The invention further relates to the use of the viruses according to the invention. Their defined molecular basis of attenuation makes them superior to viruses known in the art. In particular, the use of viruses according to the invention which contain deletions at virulent specific sites is advantageous since the deletions are less susceptible to reversion.

Another preferred embodiment of the present invention is a pharmaceutical composition comprising one or more PRRS viruses of the invention and a pharmaceutically acceptable carrier. A preferred object is a pharmaceutical composition comprising not only said European PRRS virus of the invention, but also a attenuated US PRRS virus, such as a virus sold in a pharmaceutical formulation under the trade name RespPRRS / Ingelvac® PRRS MLV, Boehringer Ingelheim. The pharmaceutically acceptable carrier may contain physiologically acceptable compounds which serve, for example, to stabilize or to enhance absorption or form part of a PRRS slow release formulation of the invention. Such physiologically acceptable compounds include, for example, carbohydrates such as glucose, sucrose or dextrans, antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, or other stabilizers or excipients (see also e.g. Remington's Pharmaceutical Sciences (1990), 18th ed. Mack Publ., Easton). One of ordinary skill in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the mode of administration of the composition. Most preferably, the composition is formulated by obtaining a virus-containing supernatant (tissue culture fluid) from the infected cell culture

Freeze-drying said supernatant, optionally after addition of a stabilizer. The freeze-dried composition may be reconstituted with water prior to administration. In another example, a suitable carrier would be a physiological salt solution. Preferably, the pharmaceutical composition is injected intramuscularly or intradermally. The vaccine of the invention may be administered to piglets, depending on the method of vaccinating the sows, at 1, 3, 6 or 10 weeks of age, sows prior to mating and / or 6 weeks prior to shedding (booster vaccination) or boars every six months (boosters).

Another preferred embodiment of the present invention is the use of the PRRS virus of the invention for the manufacture of a vaccine for the prophylaxis and treatment of PRRS infections.

The following example serves to illustrate the present invention in more detail, but should not be construed as limiting the scope of the invention described herein.

Overview of the figures in the drawing

Figure 1: Sequence comparison of wild-type Lelystad virus published in GenBank, attenuated virus A (abbreviated Vir.A) and attenuated Lelystad virus B

Genomic region: ORF 2

Number of nucleotides: 750

Mutations (non-synonymous nucleotide changes) of the invention are indicated in bold and in boxes (see claims 2 and 3).

Figure 2: Sequence comparison of wild-type Lelystad virus published in GenBank, attenuated virus A (abbreviated Vir.A) and attenuated Lelystad virus B

Genomic region: ORF 3

Number of nucleotides: 798

Mutations (non-synonymous nucleotide changes) of the invention are indicated in bold and in boxes (see claims 2 and 3).

Figure 3: Sequence comparison of wild-type Lelystad virus, published in GenBank, attenuated virus A (abbreviated Vir.A) and attenuated Lelystad virus B

-26Genomic region: ORF 4

Number of nucleotides: 552

Figure 4: Sequence comparison of wild-type Lelystad virus published in GenBank, attenuated virus A (abbreviated Vir.A) and attenuated Lelystad virus B

Genomic region: ORF 5

Number of nucleotides: 606

Mutations (non-synonymous nucleotide changes) of the invention are indicated in bold and in boxes (see claims 2 and 3).

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Introduction of weakness

This example provides a clear guide to comparing the virulent nature of two different strains of PRRS viruses. Lelystad agents (CDI-NL-2.91) with a low number of passages (no more than five) in cell culture can serve as a reference strain for a typical virulent European strain.

At least 10 gilts of first gilts that are obtained from a farm without PRRS are included in the group for each experiment. Animals are tested for PRRS virus specific serum antibodies and negative for PRRSV. All animals included in one test are from the same source and breed and are from a farm where no PRRSV infection has occurred in previous history. The grouping of animals is random. Vaccination is performed on day 85-90 of pregnancy by intranasal administration of 1 ml PRRSV with 10 ⁵ TDCID 50 (third passage) into the nostrils. There are at least three groups for each test kit:

One group for infection with Lelystad agent (CDI-NL-2.91); one test group for infection with a probable attenuated virus; and one strict control group.

The study value is confirmed when strict controls remain PRRS negative throughout the study and at least 25% fewer healthy pigs are born in the Lelystad-infected group compared to strict controls.

Attenuation, in other words, lower virulence, is defined as a statistically significant change in one or more parameters determining reproductive performance.

A significant reduction in at least one of the following parameters for the test group is preferred:

- frequency of stillbirths

- abortion at or before 112 days of pregnancy

- number of mummified piglets

- number of live and weak piglets

- mortality before weaning or, in addition, a significant increase in one of the following parameters for the test group is beneficial:

- number of weaned piglets per sow

- number of live healthy piglets born per sow

- compared to the group infected with Lelystad.

By way of example, the following results may be obtained in a clinical assay as described with Lelystad agent 147 times passaged on cell culture:

Passage level living / healthy living / weak stillborn mummified average of births per sow 5 30.5% 45,5% 17.9% 6.2% 11 147 71.9% 10,5% 17,54% 0 11.4

Data are shown on the reproductive performance of sows from sows that have been inoculated as described above with Lelystad agent passaged on cell culture 5 times (group 1) and with Lelystad agent passaged on cell culture

-28147 times (group 2). In another group of 3, the animals served as a strict control and were inoculated only with cell culture supernatant without PRRSV:

Group Inoculum passage level Duration of frenzy in days Total number of born piglets Live / healthy Live / weak Mŕtvonarodené mummified 1 5 115 15 5 7 2 1 1 5 111 7 5 1 1 0 1 5 113 6 2 2 1 1 1 5 110 14 2 10 2 0 1 5 115 13 0 8 4 1 average v skup.1 11 2.8 5.6 2.0 0.6 % 100 30.5 45.5 17.9 6.2 2 147 115 13 11 1 1 0 2 147 113 12 12 0 0 0 2 147 115 10 0 4 6 0 2 147 115 8 8 0 0 0 2 147 115 14 10 1 3 0 Avg. 2 11.4 8.2 1.2 2 0 % 100 71.93 10.53 17.54 0 3 - 117 12 11 1 0 0 3 - 115 9 8 1 0 0 3 - 116 14 9 5 0 0 3 - 115 6 6 0 0 0 3 - 115 14 11 3 0 0 3 - 116 15 14 1 0 0

average v skúp. 3 11.7 9.8 1.8 0 0 % 100 86.1 13.9 0 0

-30List of sequences <110> Boehringer Ingelheim Vetmedica GmbH <120> Live attenuated PRRS virus <130> 1-1176 <160> 29 <170> Patentln Ver. 2.1 <210> 1 <211> 750 <212> DNA <213> PRRS virus <400> 1 atgcaatggg tccttgttag caggatggtt ctgccatt'ca ccggatgtcc tcccaattaa caagcggcc.t atagttactc tcacgactcg acgttggacc tttcagacaat ctctcccgaa cacaatttgc ttgatgagat ggaagcaggc atttccaaaa tgatgctaaa gcgttgagct ggctcatcag tagtgctttg caacacatca agtaaaatca attgttattt cttctcagag ctatcgaagg attcaagcac ggtctctcgt ggttggtgag cctggccgca aaatcttgcc catcttcccc tgtgcacgct gcttcgaatt ttcgagctga gccagctgtt tccttgccat tggtttgctc tccťatgaag ccattgggta cgcatttacc gccactctca gtagaggcgg gttggcaatg acgacaggta tccatttttt ccagctctac cgtggacgcc actgtttggg cgcgcttctc gcttgttgcc tgctttggca agaccatgga cgaagctgtc attcttgccg tgagcctaca cgaggcccaa cctctgtggc gctatgtttt ttcactgagt ttcaccgtcg cgttcgcgct caactgdaga catgcgagtt acattcaggt aaggctcgat ctttctcagc gtacaäcacc gttgaccgac ttcatctgtt tggtttccat

120

180

240 300.

360

420

480

540

600

660

720

750 · <212> DNA <213> PRRS virus <40Q> 2 atggctcatc catagtgctt ggcaacacat caagcggctc aggtgtgagg ctcaaacttg ttccatccgg cagttcattt tccgcattat gaatggctgc cgttcgcctg cggctgccgg cagcgcaaga cccagtacat <210> 3 <211> 552 <212> DNA agtgtgcacg tggcttcgaa cattcgagct gccaaaggct agcgtgacca agggttatta agttgttcgg gtgccgagca atgcggcata ggccactctt taagccctgt tttcatggtc ggaaattccc cacgataa cttccatttt ttccagctct gaccatcaac cgagcccggt tgatgagttg tgcttggctg gatagggaat tgatggacag ttaccaccac ttcctcctgg ttctcgacgc cttcaggaca ttcggaaagt ttcctctgtg acgctatgtt tacaccatat cgtaacatgt ttaatgccca gcttttttgt gtgtcgcgcg aattcaaccg caaatagacg ctggtgctca atctatcaga tcaattgtct cgtcccaatg gcttcatctg tttggtttcc gcatgccctg ggtgcaaaat tcccgtccgg ccttttccta tcttcgtgga tatctaccgg ggggcaattg atatatcatg tattgagacc ccgacctcac tcgtgaagcc ttaccttgtt attggcccac ttctaccagt agggtatgac gtacgacaac cgcggcccaa caagcgacac acacaacatc gttccatttg gtttctgagg aacacgaccg ggggtctcag gtcggtactc

120

180

240

300

360

420

480

540

600

660

720

780

798

-31 <213> PRRS virus <400 3 atggctgcgg ccactctttt cctcctggct ggtgctcaat atatcatggt ttctgaggcg 60 ttcgcctgta agccctgttt ctcgacgcat ctatcagata ttgagaccaa cacgaccgcg 120 gctgccggtt tcatggtcct tcaggacatc aattgtctcc gacctcacgg ggtctcagca 180 gcgcaagagg aaattccctt cggaaagtcg tcccaatgtc gtgaagccgt cggtactccc 240 cagtacatca cgataacggc taacgtgacc gacgaatcat acttgtacaa cgcggacttg 300 ctgatgcttt ctgcgtgcct tttccacgcc tcagaaatga gcgagaaagg cttcaaagtt 360 atctttggga atgtctctgg cgttgtttcc gcttgtgtca atttcacaga ttatgtggcc 420 catgtgaccc aacataccca gcagcatcat ttggtaattg atcacattcg gttgctgcat 480 ttcctgacac catctgcaat gaggtgggct acaaccattg cttgtttgtt cgccattctc ttggcgatat 540 g _552nd

<210> 4 <211> 606 <212> DNA <213> PRRS virus <400> 4 .atgagatgtt ctcacaaatt ggggcgtttc ttgactccgc actcttgctt ctggtggttt 60tttttgctgt gtaccggctt gtcctggtcc tttgccgatg gcaacggcaa cagctčgaca 120 taccaataca tatataactt gacgatatgc gagctgaatg.ggaccgactg gttgtccagc 180 cattttggtt gggcagtcga gacctttgtg ttttacccgg ttgccactca tatcctctca - 240 ctgggttttc tcacaacaag ccattttttt gacgcgctcg. gtctcggcgc · tgtatccact. 3 00 '.gcaggatttg ttggcgggcg gtatgtaatc tgcagdgtct.acggcgcttg tgctttcgca 360 gcgttcgtat gttttgtcat ccgtgctgct aaaaattgca · tggcctgccg ctatgcccgt 4.20 acccggttta ccaacttcat tgtagacaac cgggggagag ttcatcgatg gaagtctcca 480 atagtggtag aaaaattggg caaagccgaa gtcgacggca acctcgtcac catcaaacat 540 gtcgtcctcg aaggggttaa agctcaaccc ttgačgagga cttcggctga gcaatgggag 600 gcctag 606 <210> 5 <211> 14815 <212> DNA <213> PRRS virus <400> 5 gganacatac acgacacttc tagtgtttgt gtaccttgga ggcgtgggta cagccccgcc 60 ccaccccttg gcccctgttc tagcccaaca ggtatccttc tctctcgggg cgagtgcgcc 120 gcctgctgct cccttgcagc gggaaggacc tcccgagtat ttccggagag cacctgcttt 180 acgggatctc caccctttaa ccatgtctgg gacgttctcc cggtgcatgt gcaccccggc 240 tgcccgggta ttttggaacg ccggccaagt cttttgcaca cggtgtctca gtgcgcggtc 300 tcttctctct ccagagcttc aggacactga cctcggtgca gttggcttgt tttacaagcc 360 tagggacaag cttcactgga aagtccctat cggcatccct caggtggaat gtactccatc 420 cgggtgctgt tggctctcag ctgttttccc ttgtga aggttgctga tgttttgtac cgtgacggtt gcttggcacc 540 tcgacacctt cgtgaactcc aagtttacga gcgcggctgc aactggtacc cgatcacggg 600 gcccgtgccc gggatgggtt tgtttgcgaa ctccatgcac gtatccgacc agccgttccc 660 tggtgccacc catgtgttga ctaactcgcc tttgcctcaa caggcttgtc ggcagccgtt 720 ctgtccattt gaggaggctc attctagcgt gtacaggtgg aagaaatttg tggttttcac 780 ggactcctcc ctcaacggtc gatctcgcat gatgtggacg ccggaatccg atgattcagc 840 cgccctggag gtactaccgc ctgagttaga acgtcaggtt gaaatcctca ttcggagttt 900 tcctgctcat caccctgtcg acctggccga ctgggagctc actgagtccc ctgagaacgg 960

-32tttttccttc aacacgtctc attcttgcgg tcaccttgtc caaaaccccg acgtgtttga 1020 tggcaagtgc tggctctcct gctttttggg ccagtcggcc gaagtgcgct gccatgagga 1080 acatctagct gacgccttcg gttaccaaac caagtggggc gtgcatggta agtacctcca 1140 gcgcaggctt caagttcacg gcattcgtgc tgtagtcgat cctgacggtc. ccattcacgt 1200 tgaagcgctg tcttgccccc agtcttggat caggcacctg actctgaatg atgatgtcac 1260 cccaggattc gttcgcctga catcccttcg cattgtgccg aacacagagc ctaccacttc 1320 ccggatcttt cggtttggag cgcataagtg gtatggcgct gccggcaaac gggctcgtgc 1380 taagcgtgcc gctaaaagtg agaaggattc ggctcccacc cccaaggttg ccctgcctgt 14'40 ccccacctgt ggaattacca cctactctcc accgacagac gggtcttgtg gttggcatgt 1500 ccttgccgcc ataatgaacc ggatgataaa tggtgacttc acgtcccctc tgactcagta 1560 caacagacca gaggatgatt gggcttctga ttatgatctt gttcaggcga- ttcaatgtct 1620 acaactgcct gctaccgtgg ttcggaatcg cgcctgtcct aacgccaagt accttataaa 1680 acttaacgga gttcactggg aggtagaggt gaggtctgga atggctcctc gctcccttcc 1740 tcgtgaatgt gtggttggcg tttgctctga aggctgtgtc gcaccgcctt atccagcaga 1800 cgggctacct aaacgtgcac tcgaggcctt ggcgtctgct tacagactac cctccgattg 1860 tgttagctct ggtattgctg actttcttgc taatccacct cctcaggaat tctggaccct 1920 cgacaaaatg ttgacctccc cgtcaccaga gcggtccggc ttctctagtt tgtataaatt 1980 actattagag gttgttccgc aaaaatgcgg tgccacggaa ggggctttca tcta tgctgt 2040 • tgagaggatg ttgaaggatt 'gtccgagctc caaacaggcc atggcccttc tggcaäaaat 2100 taaagttcca tcctcaaagg ccccgtctgt gtccctggac gggtgtttcc ctacggatgt 2160 tccagccgac ttcgagccag catctccgga aaggccagct ggtctaatta acctggtagg 2220 cgggaatttg tccccctcag actccatgaa agaaaacatg cbcaatagac gggaagacga 2280 accactggat ttgtcccaac cagcaccagc tgccacaacg acccttgtga gagagcaaac 2340 acccgacaac ccaggttctg atgccggtgc cctccccgtc accgttcgag. aatttgtccc 2400 gacggggcct atactccgtc atgttgagca ctgcggcacg gagtcgggcg acagcagttc 2460 gcctttggac cagtctgatg cgcaaaccct • ggaccagcct ttaaatctat ccctggccgc -2520 '. ttggccag.tg agggccaccg · cgtctgaccc tggctgggtc cacggtaggc gcgagcctgt 258 0: ttttgtaaag cctcgaaatg ctttctctga tggcgattca gcccttgcgta tcgggggggca 2700ccctgtcgac ttgacgactt cgaacgaggc cctctctgta gtcgaccctt tcgaatttgc 2760 cgaactcaag cgcccgcgtt tctccgcaca agccttaatt. gaccgaggcg gtccacttgc 2820 cgatgtccat gcgaaaataa agaaccgggt atatgaacag tgcctccaag cttgtgagcc 2880 cggtagtcgt gcaaccccag ccaccaggga gtggctcgac aaaatgtggg atagggtgga 2940 catgaaaact tggcgctgca cctcgcagtt ccaagctggt cgcattcttg cgtccctcaa 3000 attcctccct gacatgattc aagacacacc gcctcctgtt cccaggaaga accgagctag 3060 tgacaatgcc ggcctgaagc aaccggtggc acagtgggat aggaaattga gtgtgacccc 3120 ccccccaaaa ccggttgggc cagtgcttga ccagaccgtc cctccgccta cggatatcca 3180 gcaagaagat gtcaccccct ccgatgggcc accccatgcg ccggattttc ctagtcgagt 3240 gagcacgggc gggagttgga aaggccttat gctttccggc acccgtctcg cggggtctat 3300 cagtcagcgc ctcatgacat gggtttttga agttttctcc cacctcccag cttttatgct 3360 cacacttttc tcgccacggg gctctatggc tccaggtgat tggttgtttg caggtgtcgt 3420 • tttactcgct ctcttgctct gtcgttctta cccgatactc ggatgccttc ccctattggg 3480 tgtcttttct ggttctttgc ggcgtgttcg tctgggtgtt tttggttctt ggatggcttt 3540 tgctgtattt ttattctcga ctccatccaa cccagtcggt tcttcttgtg accacgattc 3600 gccggagtgt catgctgagc ttttggctct tgagcagcgc CAA ctttggg aacctgtgcg 3660 cggccttgtg gtcggcccct'cgggcctctt atgtgtcatt cttggcaagt tactcggtgg 3720 gtcacgttat ctctggcatg ttttcctacg tttatgcatg cttgcggatt tggccctttc 3780 tcttgtttat gtggtgtccc aggggcgttg tcacaagtgt tggggaaagt gtataaggac 3840 agctcctgcg gaggtggctc ttaatgtatt tcctttcttg cgcgccaccc gtgcctctct 3900 tgtatccttg tgtgatcgat tccaaacgcc aaaaggggtt gatcctgtgc acttggcaac 3960 gggttggcgc gggtgctggc gtggtgagag tcccattcat caaccacacc aaaagcccat 4020 agcttatgcc aatttggatg aaaagaaaat atctgctcaa acggtggttg ctgtcccata 4080 cgatcccagt caggctgtca aatgcctgaa agttctgcag gcgggagggg ctatcgtggá 4140 ccagcctaca cctgaggtcg ttcgcgtgtc cgagatcccc ttctcagccc catttttccc 4200 aaaagttcca gtcaacccag attgcagggt tgtggtagat tcggacactt · ttgtggctgc 4260 ggtccgctgc ggttactcga cagcacaact ggtcctgggc cggggcaact ttgccaagtt 4320

-33aaatcagacc ccccccagga actctatctc caccaaaacg actggtgggg cctcttacac 4380 ccttgctgtg gctcaagtgt ctgcgtggac tcttgttcat ttcatcctcg gtctttggtt 4440 cacatcacct caagtgtgtg gccgaggaac cgctgaccca tggtgttcaa atcctttttc 4500 atatcctacc tatggccccg gagttgtgtg ctcctctcga ctttgtgtgt ctgccgäcgg 4560 ggtcaccctg ccattgttct 'cagccgtggc acaactctcc ggtagagagg tggggatttt 4620 tattttggtg ctcgtctcct tgactgcttt ggcccaccgc atggctctta aggcagacat 4680 gttagtgatc ttttcggctt tctgtgctta cgcctggccc atgagctcct ggttaat -ctg 4740 cttctttcct atactcttga agtgggttac ccttcaccct ctcactatgc tttgggtgca 4800 ctcattcttg gtgttttgtc tgccagcagc cggcatcctc tcactaggga taactggcct 4860 tctctgggca attggccgct ttacccaggt tgccggaatt attacacctt atgacatcca 4920 ccagtacacc tctgggccac gtggtgcagc tgctgtggcc acagccccag aaggcactta 4980 .tatggacgcc gtccggagag ctgctttaac tgggcgaact ttaatcttca ccccgtictgc 5040 .agttggatcc cttctcgaag gtgctttcag gactcataaa ccctgcctta acaccgtgaa 5100 tgttgtaggc tcttcccttg gttccggagg ggttttcacc attgatggca gaagaactgt 5160 cgtcaatgct gcccatgtgt tgaacggcga cacagctaga gtcaccggcg actcctacaa 5220 ccgcatgcac actttcaaga ccaatggtga ttatgcctgg tcccatgctg atgactggca 5280 • gggcgttgcc cctgtggtca aggttgcgaa ggggtaccgc ggtcgtgcct actggcaaac 5340 atcaaatggt gtcgaacccg gtatcattgg ggaagggttc gccttctgtt ttactaáctg 5400 tggcgattcg gggtcacccg tcatctcaga atctggtgat cttattggaa tccacaccgg 5460 • ttcaaacaaa cttggttctg gtcttgtgac aacccctgaa ggggagacct gcaccatícaa 5520 • agaaaccaag ctctčtgacc.tttccagaca ttttgcaggc ccaagcgttc ctcttgggga 5580 "cattaaat.tg agtccggcca tcatccctga tgtaacatcc attccgagtg acttggcatc .5640 gctcctagcc tccgtccctg · tagtggaagg cggcctctcg accgttcaac ttttgťgtgt 5700 .ctttttcctt ctctggcgca tgatgggcca tgcctggaca cccattgttg ccgtgggctt 5760 ctttttgctg aatgaaattc ttccagcag't · · tttggtccga gccgtgtttt cttttgcact 5820. ctttgtgctt gcatgggcca ccccctggtc tgcacaggtg ttgatgatta gactcctcac 5880 '· .ggcatctctc aaccgcaaca agctttctct ggcgttctac -gcactcgggg gtgtcg.tcgg' 5940 • .tttggccgct gaaatcggga cttttg ctgg cagattgtct gaattgtctc aagctdbttc. 6 0001 gacatactgc ttcttaccta gggtccttgc tatgaccagt tgtgttccca ccatcatcat 6060.cggtggactc cataccctcg gtgtgattct gtggttattc aaataccggt gcctccacaa 6120catgctggtt · ggtgatggga gtttctcaag cgccttcttc ctacggtatt ttgcagaggg 6180. taatctcaga aaaggtgttt cacagtcctg tggcatgaat aacgagtccc taacggctgc 6240 tttagcttgc aagttgtcac aggctgacct tgattttttg tccagcttaa cgaacttcaa 6300 gtgctttgta tctgcttcaa acatgaaaaa tgctgccggc cagtacattg aagcagcgta 6360 tgccaaggcc ctgcgccaag agttggcctc tctagttcag attgacaaaa tgaaaggagt 6420 tttgtccaag ctcgaggcct ttgctgaaac agccaccccg tcccttgaca taggtgacgt '6480 gattgttctg cttgggcaac atcctcacgg atccatcctc gatattaatg tggggactga 6540 aaggaaaact gtgtccgtgc aagagacccg gagcctaggc ggctccaaat tcagtgtttg 6600 tactgtcgtg tccaacacac cc'gtggacgc cttaaccggc atcccactcc agacaccaac 6660 ccctcttttt gagaatggtc cgcgtcatcg cagcgaggaa gacgatctta aagtcgagag 6720 gatgaagaaa cactgtgtat ccctcggctt ccacaacatc aatggcaaag tttactgcaa 6780 aatttgggac aagtctaccg gtgacacctt ttacacggat gattcccggt acacccaaga 6840 ccatgctttt caggacaggt cagccgacta cagagacagg gactatgagg gtgtgcaaac 6900 cgccccccaa cagggatttg atccaaagtc tgaaaccccg gttggcaccg ttgtgatcgg 6960 cggtattacg tataacaggt atctgatcaa aggtaaagag gttctggtťc ccaagcctga 7020 caactgcctt gaagctgcca agctgtccct tgagcaagct ctcgctggga tgggccaaac 7080 ttgcgacctt acagctgccg aggtggaaaa gctaaagcgc atcattagtc aactccaagg 7140 cttgaccact gaacaggctt taaactgtta gccgccagcg gcttgacccg ctgtggccgc 7200 ggcggcctag ttgtaactga aacggcggta aaaattataa aataccacag cagaactttc 7260 accttaggcc ctttagacct aaaagtcact tccgaggtgg aggtaaagaa atcaactgag 7320 cagggccacg ctgttgtggc aaacttatgt tccggtgtca tcttgatgag acctcaccca 7380 ccgtcccttg ttgacgttct tctgaaaccc ggacttgata caacacccgg cattcaacca 7440 gggcatgggg ccgggaatat gggcgtggac ggttctattt gggattttga aaccgcacc'c 7500 acaaaggcag aactcgagtt atccaagcaa ataatccaag catgtgáagt taggcgcggg 7560 gacgccccga acctccaact cccttacaag ctctatcctg ttagggggga tcctgagcgg 7620 cataaaggcc gccttatcaa caccaggttt ggagatttac cttacaaaac tcctcaagac7680

-34accaagtccg caatccacgc ggcttgttgc ctgcacccca acggggcccc agtgtctgat 7740 ggtaaatcca cactaggtac cactcttcaa catggtttcg agctttatgt ccctactgtg 7800 ccctatagtg tcatggagta ccttgattca cgccctgaca ccccttttat gtgtactaaa 7860 catggcactt ccaaggctgc tgcagaggac ctccaaaaat acgacctatc cacccaagga 7920 tttgtcctgc ctggggtcct acgcctagta cgcagattca tctttggcca tattggtaag 7980 gcgccgccat tgttcctccc atcaacttat cccgccaaga actctatggc agggatcaat 8040 ggccagaggt tcccaacaaa ggacgttcag agcatacctg aaattgatga aatgtgtgcc 8100 cgcgccgtca aggagaattg gcaaactgtg acaccttgta ccctcaagaa acagtactgt 81'60 tccaagccca aaaccaggac catcctgggc accaacaact ttattgcctt ggctcacaga 8220 tcggcgctca gtggtgtcac ccaggcattc atgaagaagg cttggaagtc cccaattgcc 8280 ttggggaaaa acaaattcaa ggagctgcat tgcactgtcg ccggcagatg tcttgaggcc 8340 'gacttggcct cctgtgaccg cagcaccccc gccattgtaa gatggtttgt tgccaacctc 8400 ctgtatgaac ttgcaggatg tgaagagtac ttgcctagct atgtgcttaa ttgctgccat 8460 gacctcgtgg caacacagga tggtgccttc acaaaacgcg gtggcctgtc gtccggggac 8520 c ccgtcacca gtgtgtccaa caccgtatat tcactggtaa tttatgccca gcacatggta 8580 ttgtcggcct tgaaaatggg tcatgaaatt ggtcttaagt tcctcgagga acagctcaaa 8640 ttcgaggacc tccttgaaat tcagcctatg ttggtatact ctgatgacct tgtcttgtac 8700 gctgaaagac CCACC-TCCA caattaccac tggtgggtcg agcaccttga cctgatgctg 87.60 ggtttcagaa · cggacccaaa gaaaaccgtc ataactgata aacccagctt cctcggctgc 8820 .agaattgagg cagggcgaca gctagtcccc -aatcgcgacc gcatcctggc tgctcttgca 8880tatcacatga aggcgcagaa cgcctcagag tattatgcgt ctgctgccgc aatcctgatg · 894Ό '-gattcatgtg -cttgcattga ccatgaccct gagtggtatg aggacctcat ctgcggtatt -9000> gcccggtgcg

gccaaagc.cg actatgcgtc cgcctgtggg cttgatttgt gtttgttcca ttcgcacttt 9180 '• catcaacact-gccctgtcac tctgagctgc -ggtcaccatg ccggttcaaa ggaatgttcg 9240 · • cagtgtctccc;

ccatacaaac ctcctcgcac tgtcatcatg aaggtgggta ataaaacaac- ggccctcgat .9360 · · ccggggaggt • accagtcccg tcgaggtctc gttgcagtca agaggggtat tgcaggcaat -94-2-0 'gaagttgatc tttctgatgg agactaccaa gtggtgcctc ttttgccgac ttgcaaagac 9480. · .ataaaaatgg tgaaggtggc ttgcaatgta ctactcagca agttcatagt agggccacca 9540;

ggttcaggaa agaccacctg gctactgagt caagtccagg acgatgatgt catttacaca 9600cccacccatc. -agactatgtt tgatatagtc agtgctctca aagtttgcag gtattccgtt 9660 ccaggagcct caggactccc tttcccacca cctgccaggt ccgggccgtg ggttaggctt 9720 attgccagcg ggcacgtccc tggccgagta tcatacctcg atgaggctgg atattgtaat 9780 catctggaca -ttcttagact gctttccaaa acaccccttg tgtgtttggg tgaccttcag 984Ó caacttcacc ctgtcggctt tgattcctrc tgttatgtgt tcgatcagat gcctcagaag 9900 cagctgacca ctatttacag atttggccct aacatttgcg cagccatcca gccttgttac 9960 agggaaaaac ttgaatctaa ggctaggaac accagggtgg tttttaccac ccggcctgtg 10020 gcctttggtc aggtgctgac accataccat aaagatcgca tcggctctgc gataaccata 10080 gattcatccc agggggccac ctttgatatt gtgacattgc atctaccatc gccaaagtcc 10140 ctaaataaat cccgagcact tgtagccatc actcgggcaa gacacgggtt gttcatttat 10200 gaccctcata accagctcca ggagtttttc aatctaaccc ctgagcgcac tgattgtaac 10260 cttgtgttca gctgtgggga tgagctggta gttctgaatg cggataatgc agtcacaact 10320 gtagcgaagg ccctagagac aggtccatct cgatttcgag tatcagaccc gaggtgcaag 10380 tctctcttag ccgcttgttc ggccagtctg gaagggagct gtatgccact accgcaagtg 10440 GCAC AACC tggggtttta cttttccccg gacagtccag tatttgcacc tctgccaaaa 10500 gagttggcgc cacattggcc agtggttacc caccagaaca atcgggcgtg gcctgatcga 10560 cttgtcgcta gtatgcgccc aattgatgcc cgctacagca agccaatggt cggtgcaggg 10620 • tatgtggtcg ggccgtccac ctttcttggt actcctggcg tggtgtcata ctatctcaca 10680 ctatacatca ggggtgaacc tcaggccttg ccagaaacac tcgtttcaac aggacgtata 10740 gccacagatt gtcgggagta tctcgacgcg gctgaggaag aggcagcaaa agaactcccc 10800 cacgcattca ttggcgatgt caaaggtacc acggtggggg ggtgtcatca cattacatca 10860 aaatacctac ctaggtccct gcctaaggac tctgttgccg tagttggagt aagttcgccc 10920 ggcagggctg ctaaagccgt gtgcactctc accgatgtgt acctccccga actccggcca 10980 tatctgcaac ctgagacggc atcaaatactc

-35cgactaatgg tctggaaagg agccaccgcc tatttccagt tggaagggct tacatggtcg 11100 gcgctgcccg actatgccag gtttattcag ctgcccaagg atgccgttgt atacatetgat 11160 ccgtgtatag gaccggaaac agccaaccgt aaggtcgtgc gaaccacaga ctggcgggcc 112-2 0 gacctagcag tgacaccgta tgattacggc gcccagaaca ttttgacaac agcctggttc 11280 gaggacctcg ggccgcagtg gaagattttg gggttacagc cctttaggcg agcatttggc 11340 tttgaaaaca ctgaggattg ggcaatcctt gcacgccgta tgaatgacgg caaggactac 11400 actgactata actggaactg tgttcgagaa cgcccacacg ccatctacgg gcgtgctcgt 11460 gaccatacgt atcattttgc ccctggcaca gaattgcagg tagagctagg taaaccccgg 11520 ctgccgcctg ggcaagtgcc _gtgaa.ttcgg agtgatgcaa tggggttact gtggagtaaa 11580 atcagccagc tgttcgtgga cgccttcact gagttccttg ttagtgtggt tgatattgtt 11640 attttccttg ccateactgtt tgggttcacc gtcgcaggat ggttactggt cttccttctc 11700 agagtggttt- gctccgcgct tctccgttcg cgctctgcca ttcactctcc cgaactatcg 11760 aaggtcctat gaaggcttgt tgcccaactg cagaccggat gtcccacaat ttgcattcaa 11820 gcacccattg ggtatgcttt ggcacatgcg agtttccaaa ttaattgatg agatggtctc 11880 tcgtcgcatt taccagacca tggaacattc aggtcaagcg gcctggaagc aggcggttgg 11940 .tgaggccact ctcacgaagc tgtcaaggct cgatatagtt actcatttcc aacacdtggc 12000 cgcagtagag gcggattctt 'gccgctttct cagctcacga ctcgtgatgc taaaaaatct 12060 .tgccgttggc aatgtgagcc tacagtacaa caccacgttg gaccgcgttg agctcatctt 12120 ccccacgcca ggtacgaggc ccaagttgac cgacttcaga caatggctca tcagtgtgca 12180 -.cgcttccatt ttttcctctg tggcttcatc tgttaccttg ttcatagtgc tttggcttcg 12240 taattccagct ctacgctatg tttttggttt ccattggccc .acggcaacac atcattcgag 12300 ctgaccatpa-actacaccat atgcatgccc tgttctacca gt.caagcggc tcgccaaagg 12360 ctcgagcccg gtcgtaacat catcccgtcc gggtacgaca. acctcaaact · tgagggttat. 12480. • tatgcttggc tggctttttt gtccttttcc tacgcggccc -aattccatcc ggagttgttc -12540 gggataggga- -atgtgtcgcg cgtcttcgtg gacaagcgac. accagttcat ttgtgccgag 12600 • catgatggac. agaattcaac cgtatctacc ggacacaaca'.tctccgcatt atatgcggca 12660: .tattaccacc-: accaaataga cgggggcaat tggttccatt 'bggaatggct gcggccactc- 12720 • ttttcctcct ggctggtgct · caatatatca tggtttctga-.ggcgttcgcc tgtaagccct 12780 -.gtttctcgac igcatc.tatca gatattgaga ccaacacgac cg.cggctgcc ggtt.tcatgg 1284 0 .tccttcagga catcaattgt -ctccgacctc acggggtctc agcagcgcaa gaggaaattc 12900, -ccttcggaaa gtcgtcccaa .tgtcgtgaag ccgtcggtac tccccagtac atcacgataa 12960 ícggctaacgt gaccgacgaa tcatacttgt acaacgcgga cttgctgatg ctttctgcgt 13020 gcctttt.cca cgcctcagaa atgagcgaga aaggcttcaa agttatcttt gggaatgtct 13 0-80 zctggcgttgt ttccgcttgt gtcaatttca cagattatgt ggcccatgtg acccaacata 13140 -.cccagcagca tcatttggta -attgatcaca ttcggttgct gcatttcctg acaccatctg 13200 caatgaggtg ggctacaacc · attgcttgtt tgttcgccat tctcttggcg atatgagatg 13260 ttctcacaaa ttggggcgtt tcttgactcc gcactcttgc ttctggtggt tttttttgct 13320 gtgtaccggc ttgtcctggt cctttgccga tggcaacggc aacagctcga cataccaata 13380 .catatataac ttgacgatat gcgagctgaa tggg accgac tggttgtcca gccattttgg 13440 ttgggcagtc gagacctttg tgttttaccc ggttgccact catatcctct cactgggttt 13500 tctcacaaca agccattttt ttgacgcgct cggtctcggc gctgtatcca ctgcaggatt 13560 tSttSSCSgS cggtatgtac tctgcagcgt ctacggcgct tgtgctttcg cagcgttcgt 13620 atgttttgtc atccgtgctg ctaaaaattg catggcctgc cgctatgccc gtacccggtt 13680 taccaacttc attgtagaca accgggggag agttcatcga tggaagtctc caatagtggt 13740 agaaaaattg ggcaaagccg aagtcgacgg caacctcgtc accatcaaac atgtcgtcct 13800 cgaaggggtt aaagctcaac ccttgacgag gacttcggct gagcaatggg aggcctagac 13860 gatttttgca acgat-CCTA cgccgcacaa aagctcgtgc tagcctttag catcacatac 13920 acacctataa tgatatacgc ccttaaggtg tcacgcggcc gactcctggg gctgttgcac 13980 atcctaatat ttctgaactg ttcctttaca ttcggataca tgacatatgt gcattttcaa 14040 • tccaccaacc gtgtcgcact taccctgggg gctgttgtcg cccttctgtg gggtgtttac 14100 agcttcacag aatcatggaa gtttatcact tccagatgca gattgtgttg ccttggccgg 14160 cgatacattc tggcccctgc ccatcacgta gaaagtgctg caggtctcca ttcaatctča 14220 gcgtctggta accgagcata cg ctgtgaga aagcccggac taacatcagt gaacggcact 14280 ctagtaccag gacttcggag cctcgtgctg ggcggcaaac gagctgttaa acgaggagtg 14340 gttaacctcg tcaagtatgg ccggtaaaaa ccagagagag aagaa

-36tccgatgggg aatggccagc cagtcaatca actgtgccag ttgctgggtg caatgataaa 14460 .gtcccagcgc cagcaaccta ggggaggaca ggccaaaaag aaaaagcctg agaagccaca 14520 .ttttcccctg gctgctgaag atgacatccg gcaccacctc acccagactg aacgctccct 14580 ctgcttgcaa tcgatccaga cggctttcaa tcaaggcgca ggaactgcgt cgctttcatc 14640 cagcgggaag gtcagttttc aggttgagtt tatgctgccg gttgctcata cagtgcgcct 14700 gattcgcgtg acttctacat ccgccagtca gggtgcaagt taatttgaca gtcaggtgaa 14760 • tggccgcgat tggcgtgtgg cctctgagtc acctattcaa ttagggcggt catag 14815 <210> 6 <211> 750 <212> DNA <213> PRRS virus <400> 6

• .atgcaatggg gtcactgtgg agtaaaatca gccagctgtt cgtggacgcc ttcactgagt · 60's tccttgttag tgtggttgat. attgccattt · tccttgccat actgtttggg ttcaccgtcg 12.0. caggatggtt actggtcttt cttctcagag tggtttgctc cgcgcttctc cgttcgcgct -180 'ctgccatt.ca ctcteccgaa ctatcgaagg tcatatgaag gc.ttgttgcc' caactgcaga 240 ccggatgtcc cacaätttgc agtcaagcac ccattgggya 'tgttttggca catgcgagtt 3 00 • • tcccacttga ttgatgagat ggtctctcgt cgcatttacc agaccatgga acattcaggt · 360 .caagcggcct ggaagcaggt ggttggtgag gccactctca cgaagctgtc agggctcgat 42.0 atagttactc- atttecaaca catggccgca gtggaggcgg attcttgccg ctttctcagc · 480 tcacgactcg tgatgctaaa aaatcttgcc gttggcaatg tgagcctaca-gtacaacacc 540 .acgttggacc · gcgttgagct catcttcccc acgggcccc. ..ttcagacaat. ggctcatcag tgtgcacgct tccatttttt cctctgtggc ttcatctgtt 660accttgttca tagfcgctttg gcttcgaatt ccagctctac gctatgtttt · tggtttccat 720 tggcccacgg caaca.catca-'btcgagctga · 750 <210> 7 <211> 798 <212> DNA <213> PRRS virus <400> 7 atggctcatc agtgtgcacg cttccatttt ttcctctgtg gcttcatctg ttaccttgtt 60 catagtgctt tggcttcgaa ttccagctct acgctatgtt tttggtttcc attggcccac 120 ggcaacacat cattcgagct gaccatcaac tacaccatat gcatgccctg ttctaccagt 180 caagcggctc gccaaaggct cgagcccggt catagcatgt ggtgcaaaat agggcatgac 240 aggtgtgagg agcgtgacca tgatgagttg ttaatgccca tcccgtccgg gtacgacaac 300 ctcaaacttg agggttatta tgcttggctg gcttttttgt ccttttccta 'cgcggcccaa 360 ttccatccgg agttgttcgg gatagggaat gtgtcgcgcg tcttcgtgga caagcgacac 420 cagttcattt gtgccgagca tgatggacac aattcaaccg tgtctaccgg acacaacatc 480 tccgcattat atgcggcata ttaccaccac caaatagacg ggggcaattg gttccatttg 540 gaatggctgc ggccactctt ttcttcctgg ctggtgctca acatatcatg gtttctgagg 600 cgttcgcctg taagccctgt ttctgcagac gctgccgg tttcatggtc cttcaggaca tcaattgttt ccgacctcac ggggtctcag 720 cagcgcaaga gaaaatttcc ttcggaaagt cgtcccaatg tcgtgaagcc gtcggtactc 780 cccagtacat cacgataa 798 <210>

-37 <400> 8 atggctgcgg ccactctttt cttcctggct ggtgctcaac atatcatggt ttctgaggcg 60 ttcgcctgta agccctgttt ctcgacgcat ctatcagata ttaagaccaa- cacgaccgcg 120 gctgccggtt tcatggtcct tcaggacatc aattgtttcc gacctcacgg ggtctcagca 1.80 gcgcaagaga aaatttcctt cggaaagtcg tcccaatgtc gtgaagccgt cggtactccc 240 cagtacatca cgataacggc taacgtgacc gacgaatcat acttgtacaa cgcggacctg 300 ctgatgcttt ctgcgtgcct tttctacgcc tcagaaatga gcgagaaagg cttcaaagtc 360 atctttggga atgtctctgg cgttgtttct gcttgtgtca atttcacaga ttatgtggcc 420 catgtgaccc aacataccca gcagcatcat ctggtagttg atcacattcg gttgctgcat 480 ttcctgacac catctgcaat gaggtgggct acaaccattg cttgtttgct cgccaťtctc ttggcnatat 540 g, 552 <210> 9 <211> 606 <212> DNA <213> PRRS virus <400> 9 atgagatgtt ctcacaaatt ggggcgttccttgactccgc actcttgctt- ctggtggctt 60 tttttgctgt · gtaccggctt gtcctggtcc ctgggttttc ..tcacaacaag ccattttttt gacgcgctcg gtctcggcgc tgtatccact 300 gcaggatttg · ttggcgggcg gtacgtactc tgcagcgtct acggcgcttg tgctttcgca 360 gcgttcgtat gttttgtcat ccgtgctgct aaaaattgca tggcctgccg ctatgcccgt 420 acccggttta ccaacttcat tgtggacgaocgggggagag ttcatcgatg gaagtctcca 480 atagtggtag aaaaattggg caaagccgaa gtcgatggca acctcgtcac catcaaacat 540 gtcgtcctcg aaggggttaa agctcaaccc ttgacgagga cttcggctga gcaatgggag gcctag 600 606 <210> 10 <211> 2396 <212> PRT <213> PRRS virus

<400> 10 Met Ser 1 Gly Thr Phe 5 Ser Arg Cys Met Cys 10 Thr for Ala Ala Arg 15 wall Phe Trp same time Ala 20 Gly gin wall Phe Cys 25 Thr Arg Cys Leu Ser 30 Ala Arg ser Leu Leu 35 Ser for Glu Leu gin 40 Asp Thr Asp Leu Gly 45 Ala wall Gly Leu Phe 50 Tyr Lys for Arg Asp 55 Lys Leu His Trp Lys 60 wall for Ile Gly Ile 65 for gin wall Glu Cys 70 Thr for Ser Gly Cys 75 Cys Trp Leu Ser Ala 80 wall Phe for Leu Ala 85 Arg Met Thr Ser Gly 90 same time His same time Phe Leu 95 gin

Arg Leu Val Lys wall Ala Asp • 105 Tyr Arg. Asp Gly Cys 110 Leu Ala 100 • For Arg His 115 Leu Arg Glu Leu gin 120 wall Tyr Glu Arg Gly 125 Cys same time Trp Tyr for 130 Ile Thr Gly for wall 135 for Gly Met Gly Leu 140 Phe Ala same time Ser Met 145 His wall Ser Asp gin 150 for Phe for Gly Ala 155 Thr His wall Leu Thr 160 same time Ser for Leu for 165 gin gin Ala Cys Arg 170 gin for Phe Cys for 175 Phe Glu Glu Ala His 180 Ser Ser wall Tyr Arg 185 Trp Lys Lys Phe wall 190 wall Phe Thr Asp Ser 195 Ser Leu same time Gly Arg 200 Ser Arg Met Met Trp 205 Thr for Glu Ser Asp 210 Asp Ser Ala Ala Leu 215 Glu wall Leu for for 220 Glu Leu Glu Arg Gin • 225 wall Glu • clay Leu Ile · 230 Arg Ser Phe- Pro Ala 235 His His for wall Asp 240 Leu Ala Asp Trp Glu • 245 Leu Thr Glu; Ser for 250 Glu same time Gly Phe Ser 255 Phe same time Thr Ser His 260 Ser Cys Gly His Leu 265 wall gin same time for Asp 270 wall Phe Asp Gly Lys 275 Cys Trp Leu Ser Cys 280 Phe Leu Gly gin Ser 285 Ala Glu wall Arg Cys 290 His Glu Glu His Leu 295 Ala Asp Ala Phe Gly 300 Tyr gin Thr Lys Trp 305 Gly wall His Gly Lys 310 Tyr Leu gin Arg Arg 315 Leu gin wall His Gly 320 Ile Arg Ala wall wall 325 Asp for Asp Gly for 330 Ile His wall Glu Ala 335 Leu Ser Cys for gin 340 Ser Trp Ile Arg His 345 Leu Thr Leu same time Asp Asp 350 wall Thr for Gly 355 Phe wall Arg Leu Thr 360 Ser Leu. Arg Ile wall 3 65 Pro. same time Thr Glu for Thr Thr Ser. Arg Ile Phe. Arg Phe Gly. Ala His Lys Trp Tyr

370 375 380

Gly Ala Ala Gly Lys Arg

385 390 395 400 Lys Asp Ser Ala for 405 Thr for Lys wall Ala 410 Leu for wall for Thr 415 Cys Gly Ile Thr Thr 420 Tyr Ser for for Thr 425 Asp Gly Ser Cys Gly 430 Trp His wall Leu Ala Ala 435 Ile Met same time Arg 440 Met Ile same time Gly Asp 445 Phe Thr Ser for Leu 450 Thr Gin Tyr same time Arg 455 for Glu Asp Asp Trp 460 Ala Ser Asp Tyr Asp 465 Leu Val Gin Ala Ile 470 gin Cys Leu gin Leu 475 for Ala Thr wall wall 480- Arg same time Arg Ala Cys 485 for same time Ala Lys Tyr 490 Leu Ile Lys Leu same time 495 Gly . wall His Trp Glu. wall 500 Glu wall Arg Ser 505 Gly Met Ala for • Arg 510 Ser Leu for Arg Glu Cys 515 wall wall Gly wall 520 Cys Ser Glu Gly Cys 525 wall Ala for for Tyr 530 Pro Ala Asp Gly Leu 535 for Lys Arg Ala Leu 540 Glu Ala Leu Ala Ser 545 Ala Tyr Arg Leu for 550 Ser Asp Cys wall Ser 555 Se'r Gly Ile Ala Asp 560 Phe Leu Ala Asn for 565 for for gin Glu Phe 570 Trp Thr Leu Asp Lys 575 Met Leu Thr Ser Pro 5B0 Ser for Glu Arg Ser 585 Gly Phe Ser Ser Leu 590 Tyr Lys Leu Leu Leu Glu 595 wall wall for gin 600 Lys Cys Gly Ala Thr 605 Glu Gly Ala Phe Ile 610 Tyr Ala wall Glu Arg 615 Met Leu Lys Asp Cys 620 for Ser Ser Lys gin 625 Ala Met Ala Leu Leu 630 Ala Lys Ile Lys wall 635 for Ser Ser Lys Ala 640 for Ser Val Ser Leu 645 Asp Gly Cys Phe for 650 Thr Asp wall Pro. Ala 655 Asp Phe Glu Pro Ala 660 Ser for Glu. Arg. Xaa 665 Xaa Xaa. Xaa Xaa Xaa: 670 Xaa Xaa Xaa Xaa: Xaa Xaa Xaa Xaa: Xaa. Xaa: Xaa. Xaa: Xaa: Xaa: Xaa: Xaa: Xaa Xaa

675 680 685

Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 690 695 700 Xaa 705 Xaa Xaa Xaa Xaa Xaa 710 Xaa Xaa Xaa Xaa Xaa 715 Xaa Xaa Xaa Xaa Xaa 720 Xaa Xaa Xaa Xaa Xaa 725 Xaa Xaa Xaa Xaa Xaa 730 Xaa Xaa Xaa Xaa Xaa 735 Xaa Xaa Xaa Xaa Ala 740 Gly Leu Ile same time Leu 745 wall Gly Gly same time Leu 750 Ser for Ser Asp Ser 755 Met Lys Glu same time Met 760 Leu same time Ser Arg Glu 765 Asp Glu for Leu Asp 770 Leu Ser gin for Ala 775 for Ala Ala Thr Thr 780 Thr Leu wall Arg. Glu 785 gin Thr for Asp same time 790 for Gly Ser Asp Ala 795 Gly Ala Leu for wall 800 Thr wall Arg Glu Phe 805 wall for Thr Gly for 810 Ile Leu Arg His wall 815 Glu His Cys Gly Thr 820 Glu Ser Gly Asp Ser 825 Ser Ser for Leu Asp 830 gin Ser Asp Ala gin 835 Thr Leu Asp gin for 840 Leu same time Leu Ser Leu 845 Ala Ala Trp for wall 850 Arg Ala Thr Ala Ser 855 Asp for Gly Trp wall 860 His Gly Arg Arg Glu 865 for wall Phe wall Lys 870 for Arg same time Ala Phe 875 Ser Asp Gly Asp Ser 880 Ala Leu gin Phe Gly 885 Glu Leu Ser Glu Ser 890 Ser for wall Ile Glu 895 Phe Asp Arg Thr Lys 900 Asp Ala for wall Val r 905 Asp Ala for wall Asp 910 Leu Thr Thr Ser same time 915 Glu Ala Leu Ser wall 920 wall Asp for Phe Glu 925 Phe Ala Glu Leu Lys 93 0 Arg for Arg Phe Ser 935 Ala gin Ala Leu Ile 940 Asp Arg Gly Gly for 945 Leu Ala Asp wall His 950 Ala Lys Ile Lys same time 955 Arg wall Tyr Glu gin 960 Cys Leu gin Ala Cys Glu for Gly Ser Arg Ala Thr for Ala Thr Arg

965 970 975

Glu Trp Leu Lp Met Lp Met Val Lp Met Lp Thr Trp Arg

980 985 990

Cys Thr Ser Gin Phe 995 Gin Ala Gly Arg 1000 Ile Leu Ala Ser Leu Lys Phe Leu Pro Asp Met ile Gin Asp Thr Pro for Pro Val Pro Arg Lys same time 1010 1015 1020 Arg Ala Ser Asp Asn Ala Gly Leu Lys gin For Val Ala Gin Trp Asp 1025 1030 1035 1040 Arg Lys Leu Ser Val Thr Pro Pro Lys Pro Val Gly Pro Val Leu 1045 1050 1055 Asp Gin Thr Val Pro Pro Pro Thr Asp Ile Gin Gin Glu Thr 1060 1065 1070 Pro Ser Asp Gly Pro For His Ala Pro Asp Phe Ser Ser Val Ser 1075 1080 1085 Thr Gly Gly Ser Trp Lys Gly Leu Met Leu Ser Gly Thr Arg Leu Ala 1090 1095 1100 Gly Ser Ser Gin Arg Leu Met Thr Trp Val Phe Glu Ser 1105 1110 1115 1120 His Leu For Ala Phe Met Leu Thr Leu Phe Ser Pro Arg Gly Ser Met 1125 1130 1135 Ala Pro Gly Asp Trp Leu Phe Ala wall Val Leu Leu Leu 1140 1145 1150 Leu Cys Arg Ser Tyr For Leu Gly Cys Leu For Leu Leu Gly wall 1155 1160 1165 Phe Ser Gly Ser Leu Arg Arg Val Arg Leu Gly Val Phe Gly Ser Trp 1170 1175 11B0 Met Ala Phe Phe Leu Phe Thr Pro Ser Asn Pro Val Gly 1185 1190 1195 1200 Ser Ser Cys Asp His Asp Ser Pro Glu Cys His Ala Glu Leu Leu Ala 1205 1210 1215 Leu Glu Gin Arg Leu Trp Glu Pro wall Arg Gly Val Val Gly 1220 1225 1230 Pro Ser Gly Leu Leu Cys Val Ile Leu Gly Lys Leu Gly Gly Ser

1235 1240 1245

Arg Thr Leu Trp His Val Phe Leu Arg Leu Cys Met Leu Ala Asp Leu 1250 1255 1260

Ala Leu Ser Leu Val Gin Gly Arg Cys His Lys Cys 1265 1270 1275 1280

Trp Gly Lys Cys White Arg Thr Ala Pro Ala Glu Val Ala Leu Asn Val

1285 1290 1295 Phe Pro Phe Leu Arg Ala Thr Arg Ala Ser Leu Val Ser Leu Cys Asp 1300 1305 1310 Arg Phe Gin Thr Pro Lys Gly Val · Asp Pro Val His Leu Ala Thr Gly 1315 1320 1325 Arg Gly Cys Trp Arg Gly Glu Ser Pro His Gin Pro His Gin 1330 1335 1340 Lys For Aim Ala Tyr Ala Asn Leu Asp Glu Lys Lys White Ser Ala Gin 1345 1350: 1355 1360 Thr Val Val Ala Val Pro Tyr Asp Pro Ser Gin Ala Val Lys 1365 1370 1375 Lys Val Leu Gin Ala Gly Gly Ala ile Val Asp Gin Pro 1380 1385 1390 Val Val Arg Val Ser Glu White Pro Phe Ser Ala Pro Phe Phe Lys 1395 1400 1405 Val Pro .Val Asn Pro Asp Val Val Val Asp Ser Asp Thr Phe 1410 1415 1420 Val Ala Val Arg Gly Tyr Ser Thr Ala Gin Leu 1425 1430 1435 1440 Arg Gly Asn Phe Ala Lys Leu Asn Gin Thr Pro Pro Arg Asn Ser ile 1445 1'450 1455 Ser Thr Lys Thr Thr Gly Gly Ala Ser Tyr Thr Leu Ala 1460 1465 1470 Val Ser Trp Thr Leu Val His Phe White Leu Gly Leu Php Thr 1475 1480 1485 Ser Pro Gin Val Cys Gly Arg Gly Thr Ala Asp Pro Trp Cys Ser Asn 1490 1495 1500 Pro Phe Ser Tyr Pro Thr Tyr Gly For Gly Val Cys Ser Ser Arg 1505 1510 1515 1520 Leu Cys Val Ser Ala Asp Gly Val Thr Leu For Leu Phe Ser Ala Val 1525 1530 1535 Ala Gin Leu Ser Gly Arg Glu Val Gly White Phe I Leu Val Leu Val 1540 1545 1550 Ser Leu Thr Ala Leu Ala His Arg Met Leu Lys Ala Asp Met Leu

1555 1560 1565

Val White Phe Ser Ala Phe Cys Ala Tyr Ala Trp Pro Ser Ser Trp 1570 1575 1580

Leu ile 1585 Cys Phe Phe Pro 1590 Ile Leu Leu Lys Trp Val Thr 1595 Leu His For 1600 Leu Thr Met Leu Trp Val His Phe Leu Val Phe Leu Pro Ala 1605 1610 1615 Ala Gly Ile Leu Ser Leu Gly Thr Gly Leu Leu Ala ile Gly 1620 1625 1630 Arg Phe Thr Gin Val Ala Gly Thr For Tyr Asp ile His gin 1635 1640 1645 Tyr Thr Ser Gly Pro Arg Gly Ala Ala Ala Val Ala Thr Ala Pro Glu 1650 1655 1660 Gly Thr Tyr Met Ala Ala wall Arg Arg Ala Ala Leu Thr Gly Arg Thr 1665 1670 1675 1680 'Leu ile Phe Thr Pro Ser Ala Val Gly Ser Leu Glu Gly Ala Phe 1685 1690 1695 Arg Thr His Lys For Cys Leu Asn Thr Asn Val Val Gly Ser Ser 1700 1705 1710 Leu Gly Ser Gly Gly Val Phe Thrile Asp Arg Arg Thr Val wall 1715 1720 1725 Thr Ala • Ala His Val Leu same time Gly Asp Thr Ala Arg Val Thr Gly Asp 1730 1735 1740 Ser Tyr same time Arg Met His Thr Phe Lys Thr Asn Gly Asp Tyr Ala Trp 1745 1750 1755 1760 Ser His Ala Asp Asp Trp gin Gly Val Ala For Val Val Lys Val Ala 1765 1770 1775 Lys Gly Tyr Arg Gly Arg Ala Tyr Trp Gin Thr Ser Thr Gly Val Glu 1780 1,785 1790 Pro Gly Ile Gly Glu Gly Phe Cys Phe Thr Asn Cys Gly 1795 1800 1805 Asp Ser Gly Ser Pro Val Ile Ser Glu Ser Gly Asp Leu Gly Ile 1810 1815 1820 His Thr Gly Ser Asn Lys Leu Gly Ser Gly Leu Val Thr Thr Pro Glu 1825 1830 1835 1840 Gly Glu Thr Cys Thr White Lys Glu Thr Lys Leu Ser Asp Leu Ser Arg 1845 1850 1855 His Phe Ala Gly Pro Ser wall For Leu Gly. Asp Lys' Goals Leu Ser for

1860 1865 1870

Ala White Pro Asp Val Thr Ser Pro White Asp Leu Ala Ser Leu 1875 1880 1B85

Leu Ala Ser 1890 wall For Val Val 1895 Glu Gly Gly Leu Ser 1900 Thr Val Gin Leu Leu Cys Val Phe Phe Leu Trp Arg Met Met Gly His Ala Trp Thr 1905 1910 1915 1920 For the Val Ala Val Gly Phe Leu Leu Asn Glu Leu Pro Ala 1925 1930 1935 Val Leu Arg Ala Val Phe Ser Phe Val Leu Trp 1940 1945 1950 Ala Thr Pro Trp Ser Ala Gin wall Leu Met ile Arg Leu Leu Thr Ala 1955 1960 1965 Ser Leu Asn Arg Asn Lys Leu sera Leu Ala Phe Tyr Ala Leu Gly Gly 1970 1975 1980 Val Val Gly Leu Ala Ala Glu Ile Gly Thr Phe Ala Gly Arg Leu Ser 1985 1990 1995 2000 Glu Leu Ser gin Ala Leu Ser Thr Tyr Cys Phe Leu For Arg Val Leu 2005 2010 2015 Ala Met Thr Ser Cys Val Pro Thr Gly Gly Leu His Thr 2020 2025 2030 Gly Val Ile Leu Trp Leu Phe Lys Tyr Arg. Cys Leu His Asn Met 2035 2040 2045 Gly Asp Gly Ser Phe Ser Ser Ala Phe Phe Leu Arg Tyr Phe 2050 2055 2060 Ala Glu Gly same time Leu Arg Lys Gly Val Ser Gin Ser Cys Gly Met same time 2065 2070 2075 2080 Asn Glu Leu Thr Ala Ala Leu Lys Leu Ser Gin Ala Asp 2085 2090 2095 Asp Phe Leu Ser Ser Leu Thr Asn Phe Lys Cys Phe Val Ser Ala 2100 2105 2110 Ser Asn Met Lys Asn Ala Ala Gly Gin Tyr White Glu Ala Ala Tyr Ala

2115 2120

Lys Ala Leu Arg Gin Glu Leu Ala Ser Leu Val Gin White Asp Lys Met 2130 21352140

Lys Gly Val Leu Ser Lys Leu Glu Ala Phe Ala Glu Thr

Ser Leu Asp Goals Gly Asp Val Goals Val Leu Leu Gly Gin His Pro His

2165 21702175

Gly Ser Leu Asp Asn Val Gly Thr Glu Arg Lys Thr Val Ser

-452180 2185 2190

Val Gin Thr Arg. Ser Leu Gly Ser Thr 2195 2200 2205 wall Val Ser Asn Thr For Val Asp Ala Leu Thr Gly White For Leu gin 2210 2215 2220 Thr Pro Thr Pro Leu Phe Glu Arg His Arg Ser Glu Glu 2225 2230 2235 2240 Asp Asp Leu Lys Val Glu Arg Met His Cys Val Ser Leu Gly 2245 2250 2255 Phe His Asn Asn Gly Lys Val Tyr Cys Lys White Trp Asp Lys Ser 2260 2265 2270 Thr Gly Asp Thr Phe Tyr Thr Asp Asp Ser Arg Tyr Thr Gin Asp Hi's 2275 2280 2285 Ala Phe Gin Asp Arg Ser Ala Asp Tyr Arg Asp Arg Asp Tyr Glu Gly 2290 2295 2300 wall Gin Thr Ala Gin Gin Gly Phe Asp For Lys Ser Glu Thr for 2305 2310 2315 2320 wall Gly Thr Val Val Gly Gly Gly Thr Tyr Asn Arg Tyr Leu Ile 2325 2330 2335th Lys Gly Lys Glu Val Leu Lys Pro Asp Asn Cys Leu Glu Ala 2340 2345 2350 Ala Lys Leu Ser Leu Glu Ala Ala Leu Ala Gly Met Gly Gin Thr Cys 2355 2360 2365 Asp Leu Thr Ala Glu Val Glu Lys Leu Lys Arg Ili I Ser gin 2370 2375 2380 Leu Gin Leu Thr Thr Glu Gin Ala Leu Asn Cys

2385 2390 2395 <210 11 <211> 1463 <212> PRT <213> PRRS virus <400 11

Thr 1 Gly Phe Lys Leu 5 Leu Ala Ala Ser Gly 10 Leu Thr Arg Cys Gly 15 Arg Gly Gly Leu wall 20 wall Thr Glu Thr Ala 25 wall Lys Ile Ile Lys 30 Tyr His Ser Arg Thr 35 Phe Thr Leu Gly for 40 Leu Asp Leu Lys wall 45 Thr Ser Glu

wall Glu 50 wall Lys Lys Ser Thr 55 Glu gin Gly His Ala 60 wall wall Ala same time Leu 65 Cys Ser Gly wall Ile 70 Leu .met Arg for His 75 for for Ser Leu wall 80 Asp wall Leu Leu Lys 85 for Gly Leu Asp Thr 90 Thr for Gly Ile gin 95 for Gly His Gly Ala 100 Gly same time Met Gly wall 105 Asp Gly Ser Ile Trp 110 Asp Phe Glu Thr Ala 115 for Thr Lys Ala Glu 120 Leu Glu Leu Ser Lys 125 gin Ile Ile gin Ala 13 0 Cys Glu wall Arg Arg 135 Gly Asp Ala for same time 140 Leu gin Leu for Tyr 145 Lys Leu Tyr for wall 150 Arg Gly Asp for Glu 155 Arg His Lys Gly Arg 160 Leu Ile same time Thr Arg 165 Phe Gly Asp Leu for 170 Tyr Lys Thr for gin 175 Asp Thr Lys Ser Ala 180 Ile His Ala Ala Cys 185 Cys Leu His for same time 190 Gly Ala for wall Ser 195 Asp Gly Lys Ser Thr 200 Leu Gly Thr Thr Leu 205 gin His Gly Phe Glu 210 Leu Tyr wall for Thr .215 wall for Tyr Ser wall 220 Met Glu Tyr Leu Asp 225 Ser Arg for Asp Thr 230 for Phe Met Cys Thr 235 Lys His Gly Thr Ser 240 Lys Ala Ala Ala Glu 245 Asp Leu gin Lys Tyr 250 Asp Leu Ser Thr gin 255 Gly Phe wall Leu for 260 Gly wall Leu Arg Leu 265 wall Arg Arg Phe Ile 270 Phe Gly His Ile Gly Lys Ala for for Leu Phe Leu for Ser Thr Tyr for Ala

275 280 285

Lys same time 290 Ser Met Ala Gly Ile 295 same time Gly gin Arg Phe 300 for Thr Lys Asp wall 305 gin Ser Ile for Glu 310 Ile Asp Glu Met Cys 315 Ala Arg Ala wall Lys 320 Glu same time Trp gin Thr wall Thr for Cys Thr Leu Lys Lys gin Tyr Cys

(+420) 325 330 335

Ser Lys Pro Lys Thr Arg Thr White Leu Gly Thr Asn Asn Phe White Ala

340 345 350 Leu Ala His 355 Arg Ser Ala Leu Ser 360 Gly wall Thr Gin Ala 365 Phe Met Lys Lys Ala Trp 370 Lys Ser for Ala Ala 375 Leu Gly Lys Asn Lys 380 Phe Lys Glu Leu 385 His Cys Thr wall Ala 390 Gly Arg Cys Leu Glu 395 Ala Asp Leu Ala Ser 400 Cys Asp Arg Ser Thr 405 for Ala ile wall Arg 410 Trp Phe Val Ala same time 415 Leu Leu Tyr Glu Leu 420 Ala Gly Cys Glu Glu 425 Tyr Leu Pro Ser Tyr 430 wall Leu same time Cys Cys 435 His Asp Leu Val Ala 440 Thr gin Asp Gly Ala 445 Phe Thr Lys Arg Gly Gly 450 Leu Ser Ser Gly Asp 455 for wall Thr Ser Val 460 Ser same time Thr wall 465 Tyr Ser Leu wall Ile 470 Tyr Ala gin His Met 475 Val Leu Ser Ala Leu 480 Lys Met Gly His Glu 485 Ile Gly Leu Lys Phe 490 Leu Glu Glu gin Leu 495 Lys Phe Glu Asp Leu 500 Leu Glu ile Gin for 505 Met Leu Val Tyr Ser 510 Asp Asp Leu Val Leu 515 Tyr Ala Glu Arg Pro 520 Thr Phe for Asn Tyr 525 His Trp Trp wall Glu His 530 Leu Asp Leu Met Leu 535 Gly Phe Arg Thr Asp 540 for Lys Lys Thr 545 Val ile Thr Asp Lys 550 Pro Ser Phe Leu Gly 555 Cys Arg Ile Glu Ala 560 Gly Arg Gin Leu wall 565 for Asn Arg Asp Arg 570 Ile Leu Ala Ala Leu 575 Ala Tyr His Met Lys 580 Ala gin Asn Ala Ser 585 Glu Tyr Tyr Ala Ser 590 Ala Ala Ala Leu 595 Met Asp Ser Cys Ala 600 Cys Ile Asp His Asp 605 for Glu Trp Tyr Glu Asp 610 Leu Ile Cys Gly ile. 615 Ala. Arg Cys. Ala Arg 620 Gin. Asp Gly Tyr Ser Phe for Gly Pro. Ala Phe Phe 1 Met Ser: Met Trp i Glu: Lys Leu

(+420) 625 630 635 640

Arg Ser His Asn Glu Gly Lys Lys Phe Arg His Cys Gly White Cys Asp 645 650 655 Ala Lys Ala Asp 660 Tyr Ala Ser Ala Cys 665 Gly Leu Asp Leu Cys 670 Leu Phe His Ser His 675 Phe His gin His Cys 680 for wall Thr Leu Ser 685 Cys Gly His His Ala 690 Gly Ser Lys Glu Cys 695 Ser gin Cys gin Ser 700 for wall Gly Ala Gly Arg 705 Ser for Leu Asp 710 Ala wall Leu Lys gin 715 Ile for Tyr Lys for 720 for Arg Thr wall Ile 725 Met Lys wall Gly same time 730 Lys Thr Thr Ala Leu 735 Asp for Gly Arg Tyr 740 gin Ser Arg Arg Gly 745 Leu wall Ala wall Lys 750 Arg Gly Ile Ala Gly 755 same time Glu wall Asp Leu 760 Ser Asp Gly Asp Tyr 765 gin wall wall for Leu 770 Leu for Thr Cys Lys 775 Asp Ile same time Met wall 780 Lys wall Ala Cys same time 785 wall Leu Leu Ser Lys 790 Phe Ile wall Gly for 795 for Gly Ser Gly Lys 800 Thr Thr Trp Leu Leu 805 Ser gin wall gin Asp 810 Asp Asp wall Ile Tyr 815 Thr for Thr His gin 820 Thr Met Phe Asp Ile 825 wall Ser Ala Leu Lys 830 wall Cys Arg Tyr Ser 835 wall for Gly Ala Ser 840 Gly Leu for Phe for 845 for for Ala Arg Ser 850 Gly for Trp wall Arg 855 Leu Ile Ala Ser Gly 860 His wall for Gly Arg 865 wall Ser Tyr Leu Asp 870 Glu Ala Gly Tyr Cys 875 same time His Leu Asp Ile 880 Leu Arg Leu Leu Ser 885 Lys Thr for Leu wall 890 Cys Leu Gly Asp Leu 895 gin gin Leu His for 900 wall Gly Phe Asp Ser 905 Xaa Cys Tyr wall Phe 910 Asp gin Met for gin Lys gin Leu Thr Thr Ile Tyr Arg Phe Gly for · temporarily Ile

915 920 925

Cys Ala Ala Gin Pro Cys Tyr Arg Glu Lys Leu Glu Ser Lys Ala 930 935 940

Arg 945 Asn Thr Arg Val Val Phe 950 Thr Thr Arg for 955 Val Ala Phe Gly 960 wall Leu Thr for Tyr His Lys Asp Arg Ile Gly Ser Ala Ile Thr Ile 965 970 975 Asp Ser Ser gin Gly Ala Thr Phe Asp Ile wall Thr Leu His Leu for 980 985 990 Ser for Lys Ser Leu same time Lys Ser Arg Ala Leu wall Ala Ile Thr Arg 995 1000 1005 Ala Arg His Gly Leu Phe Ile Tyr Asp for His same time gin Leu gin Glu 1010 1015 1020 Phe Phe same time Leu Thr for Glu Arg Thr Asp Cys same time Leu wall Phe Ser 1025 1030 1035 1040 Cys Gly Asp Glu Leu wall wall Leu same time Ala Asp same time Ala wall Thr Thr 1045 1050 1055 wall Ala Lys Ala Leu Glu Thr Gly for Ser Arg Phe Arg wall Ser Asp 1060 1065 1070 for Arg Cys Lys Ser Leu Leu Ala Ala Cys Ser Ala Ser Leu Glu Gly 1075 1080 1085 Ser Cys Met for Leu for gin wall Ala His same time Leu Gly Phe Tyr Phe · 1090 1095 1100 Ser for Asp Ser for wall Phe Ala for Leu for Lys Glu Leu Ala pro- 1105 1110 1115 1120 His Trp for wall wall Thr His gin same time same time Arg Ala Trp for Asp Arg 1125 1130 1135 Leu wall Ala Ser Met Arg for Ile Asp Ala Arg Tyr Ser Lys for Met 1140 1145 1150 wall Gly Ala Gly Tyr wall wall Gly for Ser Thr Phe Leu Gly Thr for 1155 1160 1165 Gly wall wall Ser Tyr Tyr Leu Thr Leu Tyr Ile Arg Gly Glu for gin 1170 1175 1180 Ala Leu for Glu Thr Leu wall Ser Thr Gly Arg Ile Ala Thr Asp Cys 1185 1190 1195 1200 Arg Glu Tyr Leu Asp Ala Ala Glu Glu Glu Ala Ala Lys Glu Leu for 1205 1210 1215 His. Ala Phe Ile Gly Asp wall Lys Gly Thr Thr wall Gly Gly Cys. His 1220 1225 123 0 His Ile Thr Ser Lys' Tyr Leu For Arg Ser Leu for Lys Asp Ser ' wall

1235 1240 1245 Ala Val 1250 wall Gly wall Ser Ser 1255 for Gly Arg Ala Ala 1260 Lys Ala wall Cys Thr Leu 1265 Thr Asp wall Tyr Leu 1270 for Glu Leu Arg 1275 Tyr Leu Gin Pro 1280 Glu Thr Ala Ser Lys 1285 Cys Trp Lys Leu Lys Leu Asp 1290 Phe Arg Asp 1295 wall Arg Leu Met Val 1300 Trp Lys Gly Ala Thr Ala Tyr Phe 1305 Gin Leu 1310 Glu Gly Leu Thr Trp 1315 Ser Ala Leu Pro Asp. 1320 Tyr Ala Arg Phe White 1325 gin Leu for Lys Asp 1330 Ala wall wall Tyr ile 1335 Asp For Cys Goals Gly 1340 for Ala Thr Ala Asn Arg 1345 Lys wall Val Arg Thr 1350 Thr Asp Trp Arg Al 1355 Asp Leu Ala Val 1360 Thr Pro Tyr Asp Tyr 1365 Gly Ala gin Asn ile - Leu Thr 1370 Thr Ala Trp 1375 Phe Glu Asp Leu Gly 1380 for Gin Trp Lys White Leu Gly Leu 1385 Gin Pro 1390 Phe Arg Arg Ala Phe 13 95 Gly Phe Glu Asn Thr 1400 Glu Asp Trp Ala white 1405 Leu Ala Arg Arg Met 1410 • Asn Asp Gly Lys Asp 1415 Tyr Thr Asp Tyr Asn 1420 Trp same time Cys wall Arg Glu Arg for His Ala ile Tyr Gly Arg Ala Arg Asp His Thr Tyr

1425 1430 1435 1440

His Phe Ala Gly Thr Glu Leu Gin Val Glu Leu Gly Lys Pro Arg 1445 1450 1455

Gly Gin Val Pro Pro

1460 <210> 12 <211> 249 <212> PRT <213> PRRS virus <400> 12

Met Gin Trp Gly Tyr Cys

For Ser Leu Ser Ser Leu Leu Val Trp Leu Clay Leu Leu Phe Ser Leu

25 30

for Tyr Cys 35 Leu Gly Ser for Ser 40 gin Asp Gly Tyr Trp 45 Ser Ser Phe Ser Glu 50 Trp Phe Ala for Arg 55 Phe Ser wall Arg Ala 60 Leu for Phe Thr Leu 65 for same time Tyr Arg Arg 70 Ser Tyr Glu Gly Leu 75 Leu for same time Cys Arg 80 for Asp wall for gin 85 Phe Ala Phe Lys His 90 for Leu Gly Met Leu 95 Trp His Met Arg wall 100 Ser gin Leu Ile Asp 105 Glu Met wall Ser Arg Arg 110 Ile Tyr gin Thr 115 Met Glu His Ser Gly 120 gin Ala Ala Trp Lys 125 gin Ala wall Gly Glu 13 0 Ala Thr Leu Thr Lys 135 Leu Ser Arg Leu Asp 140 Ile wall Thr His Phe 145 gin His Leu Ala Ala 150 wall Glu Ala Asp Ser 155 Cys Arg Phe Leu Ser ' 160 Ser Arg Leu wall Met 165 Leu Lys same time Leu Ala 170 wall Gly same time wall Ser 175 Leu · gin Tyr same time Thr 180 Thr Leu Asp Arg wall 185 Glu Leu Ile Phe for 190 Thr for Gly Thr Arg 195 for Lys Leu Thr Asp 200 Phe Arg gin Trp Leu 205 Ile Ser wall His Ala 210 Ser Ile Phe Ser Ser 215 wall Ala Ser Ser wall 220 Thr Leu Phe Ile wall 225 Leu Trp Leu Arg Ile 230 for Ala Leu Arg Tyr 235 wall Phe Gly Phe His 240 Trp for Thr Ala Thr 245 His His Ser Ser

<210> 13 <211> 265 <212> PRT <213> PRRS virus <400> 13

Met Ala His

Gin Cys Ala Arg Phe His 4

Phe Phe Leu Cys

Gly Phe White

Cys Tyr Leu Val His Ser Ala Leu Ala Ser Asn Ser Ser Ser Thr Leu

25 30

Cys Phe Trp 35 Phe Pro Leu Ala His Gly Asn Thr Ser Phe Glu Leu Thr 40 45 Ile same time Tyr Thr Ile Cys Met for Cys Ser Thr Ser gin Ala Ala Arg 50 55 60 gin Arg Leu Glu for Gly Arg same time Met Trp Cys Lys Ile Gly Tyr Asp 65 70 75 80 Arg Cys Glu Glu Arg Asp His Asp Glu Leu Leu Met for Ile for Ser 85 90 95 Gly Tyr Asp same time Leu Lys Leu Glu Gly Tyr Tyr Ala Trp Leu Ala Phe 100 105 110 Leu Ser Phe Ser Tyr Ala Ala gin Phe His for Glu Leu Phe Gly Ile 115 120 125 Gly same time wall Ser Arg wall Phe wall Asp Lys Arg His gin Phe Ile Cys 130 135 140 Ala Glu His Asp Gly gin same time Ser Thr wall Ser Thr Gly His same time Ile 145 150 155 160 Ser Ala Leu Tyr Ala Ala Tyr Tyr His His gin Ile Asp Gly Gly same time 165 170 175 Trp Phe His Leu Glu Trp Leu Arg for Leu Phe Ser Ser Trp Leu Val · 180 185 • 190 Leu same time Ile Ser Trp Phe Leu Arg Arg Ser for wall Ser for wall · ser 195 200 205 Arg Arg Ile Tyr gin Ile Leu Arg for Thr Arg for Arg Leu for wall 210 215 220 Ser Trp Ser Phe Arg Thr Ser Ile wall Ser Asp Leu Thr Gly Ser gin 225 230 235 240 gin Arg Lys Arg Lys Phe for Ser Glu Ser Arg for same time wall wall Lys 245 250 255 for Ser wall Leu for Ser Thr Ser Arg

260 265 <210> 14 <211> 183 <212> PRT <213> PRRS virus <400> 14

Met Ala Ala

Ala

Thr

Leu

Phe

Leu

Leu

Ala

Gly

Ala

gin

Tyr ile

Met

His

Leu

Ser

Val Glu

Ala

Phe

Ala

Cys

Lys

for

Cys

Phe

Ser

Thr

Asp Glu Thr same time Thr Thr Gla Phe Met Val Leu gin 35 40 45 Asp Ile same time Cys Leu Arg for His Gly wall Ser Ala Ala gin Glu Glu 50 55 60 Ile for Phe Gly Lys Ser Ser gin Cys Arg Glu Ala wall Gly Thr for 65 70 75 80 gin Tyr Ile Thr Ile Thr Ala same time wall Thr Asp Glu Ser Tyr Leu Tyr 85 90 95 same time Ala Asp Leu Leu Met Leu Ser Ala Cys Leu Phe His Ala Ser Glu 100 105 110 Met Ser Glu Lys Gly Phe Lys wall Ile Phe Gly same time wall Ser Gly wall 115 120 125 wall Ser Ala Cys wall same time Phe Thr Asp Tyr wall Ala His wall Thr gin 130 135 140 His Thr gin Gin His His Leu wall Ile Asp His Ile Arg Leu Leu His 145 150 155 160 Phe Leu Thr for Ser Ala Met Arg Trp Ala Thr Thr Ile Ala Cys Leu 165 170 175 Phe Ala Ile Leu Leu Ala Ile

180 <210> 15 <211> 201 <212> PRT <213> PRRS virus <400> 15

Met 1 Arg Cys Ser His 5 Lys Leu Gly Arg Phe 10 Leu Thr for His Ser 15 Cys Phe Trp Trp Phe 20 Phe Leu Leu Cys Thr 25 Gly Leu Ser Trp Ser 30 Phe Ala Asp Gly same time 35 Gly same time Ser Ser Thr 40 Tyr gin Tyr Ile Tyr 45 same time Leu Thr Ile Cys 50 Glu Leu same time Gly Thr 55 Asp Trp Leu Ser Ser 60 His Phe Gly Trp Ala 65 wall Glu Thr Phe wall 70 Phe Tyr for wall Ala 75 Thr His Ile Leu Ser 80

Leu Gly Phu Leu Thr Thr Ser Phu Phe Asp Ala Leu Gly Leu Gly

90 95

Ala wall Ser Thr 100 Ala Gly, Phe Val Gly Gly Arg - Tyr Val Leu Cys Ser 105 110 wall Tyr Gly 115 Ala Cys Ala Phe Ala 120 Ala Phe wall Cys Phe 125 wall Ile Arg Ala Ala 130 Lys same time Cys Met Ala 135 Cys Arg Tyr Ala Arg 140 Thr Arg Phe Thr same time 145 Phe Ile wall Asp same time 150 Arg Gly Arg wall His 155 Arg Trp Lys Ser for 1'60 Ile wall wall Glu Lys 165 Leu Gly Lys Ala Glu 170 wall Asp Gly same time Leu 175 wall Thr Ile Lys His 180 wall wall Leu Glu Gly 185 wall Lys Ala gin for 190 Leu Thr Arg Thr Ser 195 Ala Glu gin Trp Glu 200 Ala

<210> 16 <211> 173 <212> PRT <213> PRRS virus <400 16

Met 1 Gly Gly Leu Asp 5 Asp Phe Cys same time Asp 10 for Ile Ala Ala gin 15 Lys Leu wall Leu Ala 20 Phe Ser Ile Thr Tyr 25 Thr for Ile Met Ile 30 Tyr Ala Leu Lys wall 35 Ser Arg Gly Arg Leu 40 Leu Gly Leu Leu His 45 Ile Leu Ile Phe Leu 50 same time Cys Ser Phe Thr 55 Phe Gly Tyr Met Thr 60 Tyr wall His Phe gin 65 Ser Thr same time Arg wall 70 Ala Leu Thr Leu Gly 75 Ala wall wall Ala Leu 80 Leu Trp Gly wall Tyr 85 Ser Phe Thr Glu Ser 90 Trp Lys Phe Ile Thr 95 Ser Arg Cys Arg Leu 100 Cys Cys Leu Gly Arg 105 Arg Tyr Ile Leu Ala 110 for Ala His His wall 115 Glu Ser Ala Ala Gly 120 Leu His Ser Ile Ser 125 Ala Ser Gly same time Arg 130 Ala Tyr Ala wall Arg 135 Lys Pro Gly Leu Thr 140 Ser wall same time Gly

-55Thr Leu Val Pro Gly Leu Arg

Lys Arg Ala

155 160

Val Lys Arg Gly Val Val Asn Leu Val 165

Lys Tyr Gly Arg

170 <210> 17 <211> 128 <212> PRT <213> PRRS virus <400> 17

Met Ala 1 Gly Lys Asn Gin Ser Gin Lys Ser Thr Ala 15 for 5 10 Met Gly same time Gly gin for wall same time gin Leu Cys gin Leu Leu Gly Ala 20 25 30 Met Ile Lys Ser gin Arg gin gin for Arg Gly Gly gin Ala Lys Lys 35 40 45 Lys Lys for Glu Lys for His Phe for Leu Ala Ala Glu Asp Asp Ile 50 55 60 Arg His His Leu Thr gin Thr Glu Arg Ser Leu Cys Leu gin Ser Ile • 65 70 75 80 gin Thr Ala Phe same time gin Gly Ala Gly Thr Ala Ser Leu Ser Ser Ser 85 90 95 Gly Lys wall Ser Phe gin wall Glu Phe Met Leu for wall Ala His Thr 100 105 110 wall Arg Leu Ile Arg wall Thr Ser Thr Ser Ala Ser gin Gly Ala Ser 115 120 125

<210> 18 <211> 249 <212> PRT <213> PRRS virus <400> 18

Met First gin Trp Gly His 5 Cys Gly wall Lys Ser 10 Ala Ser Cys Ser Trp 15 Thr for Ser Leu Ser 20 Ser Leu Leu wall Trp 25 Leu Ile Leu Ser Phe 30 Ser Leu for Tyr Cys 35 Leu Gly Ser for Ser 40 gin Asp Gly Tyr Trp 45 Ser Ser Phe Ser Glu 50 Trp Phe Ala for Arg 55 Phe Ser wall Arg Ala 60 Leu for Phe Thr

Leu 65 For Asn Tyr Arg Arg Ser 70 Tyr Glu Gly Leu Leu 75 for Asn Cys Arg 80 for Asp wall for gin Phe Ala Phe Lys His for Leu Gly Met Leu Trp 85 90 95 His Met Arg wall Ser His Leu Ile Asp Glu Met wall Ser Arg Arg Ile 100 105 110 Tyr gin Thr Met Glu His Ser Gly gin Ala Ala Trp Lys gin wall wall 115 120 125 Gly Glu. Ala Thr Leu Thr Lys Leu Ser Gly Leu Asp Ile wall Thr His 130 135 140 Phe gin Xaa Leu Ala Ala wall Glu Ala Asp Ser Cys Arg Phe Leu Ser 145 150 155 160 Ser Arg Leu wall • Met Leu Lys same time Leu Ala wall Gly same time wall Ser Leu 165 170 175 gin Tyr • Asn Thr Thr Leu Asp Arg wall Glu Leu Ile Phe for Thr for 180 185 190 • Gly Thr Arg for Lys Leu Thr Asp Phe Arg gin Trp Leu Ile Ser wall 195 20.0 205 • His Ala Ser Ile Phe Ser Ser wall Ala Ser Ser wall Thr Leu Phe Ile 210 215 220 wall Leu Trp Leu Arg Ile for Ala Leu Arg Tyr wall Phe Gly Phe His 225 230 235 240 Trp for Thr Ala Thr His His Ser Ser

245 <210> 19 <211> 265 <212> PRT <213> PRRS virus <400> 19

Met 1 Ala His gin Cys 5 Ala Arg Phe His Phe 10 Phe Leu Cys Gly Phe 15 Ile Cys Tyr Leu wall 20 His Ser Ala Leu Ala 25 Ser same time Ser Ser Ser 30 Thr Leu Cys Phe Trp 35 Phe for Leu Ala His 40 Gly same time Thr Ser Phe 45 Glu Leu Thr Ile same time 50 Tyr Thr Ile Cys Met 55 for Cys Ser Thr Ser 60 gin Ala Ala Arg

gin 65 Arg Leu Glu for Gly His Ser 70 Met Trp Cys Lys 75 Ile Gly His Asp 80 Arg Cys Glu Glu Arg Asp His Asp Glu Leu Leu Met for Ile for Ser 85 90 95 Gly Tyr Asp same time Leu Lys Leu Glu Gly Tyr Tyr Ala Trp Leu Ala Phe 100 105 110 Leu Ser Phe Ser Tyr Ala Ala gin Phe His for Glu Leu Phe Gly Ile 115 120 125 Gly same time wall Ser Arg wall Phe wall Asp Lys Arg His gin Phe Ile Cys 130 135 140 Ala Glu His Asp Gly His same time Ser Thr wall Ser Thr Gly His same time I-treatment 145 150 155 160 Ser Ala Leu Tyr Ala Ala Tyr Tyr His His gin Ile Asp Gly Gly ASN 165 170 175 Trp Phe His Leu Glu Trp Leu Arg for Leu Phe Ser Ser Trp Leu wall 180 185 190 Leu same time Ile Ser Trp Phe Leu Arg Arg Ser for wall Ser for wall Ser 195 200 205 Arg Arg Ile Tyr gin Ile Leu Arg for Thr Arg for Arg Leu for wall 210 215 220 Ser Trp Ser Phe Arg Thr Ser Ile wall Ser Asp Leu Thr Gly Ser gin 225 230 235 240 gin Arg Lys Arg Lys Phe for Ser Glu Ser Arg for same time wall wall Lys 245 250 255 for Ser wall Leu for Ser Thr Ser Arg

260 265 <210> 20 <211> 183 <212> PRT <213> PRRS virus <400> 20

Met 1 Ala Ala Ala Thr 5 Leu Phe Phe Leu Ala 10 Gly Ala gin His Ile 15 Met wall Ser Glu Ala 20 Phe Ala Cys Lys for 25 Cys Phe Ser Thr His 30 Leu Ser Asp Ile Lys 35 Thr same time Thr Thr Ala 40 Ala Ala Gly Phe Met 45 wall Leu gin Asp Ile same time Cys Phe Arg for His Gly wall Ser Ala Ala gin Glu Lys 50 55 6.0

Ile 65 Ser Phe Gly Lys Ser 70 Ser gin Cys Arg Glu 75 Ala wall Gly Thr for 80 gin Tyr Ile Thr Ile 85 Thr Ala same time wall Thr 90 Asp Glu Ser Tyr Leu 95 Tyr same time Ala Asp Leu 100 Leu Met Leu Ser Ala 105 Cys Leu Phe Tyr Ala 110 Ser Glu Met Ser Glu • 115 Lys Gly Phe Lys wall 120 Ile Phe Gly same time wall 125 Ser Gly wall wall Ser 130 Ala Cys wall same time Phe 135 Thr Asp Tyr wall Ala 140 His wall Thr gin His 145 Thr gin gin His His 150 Leu wall wall Asp His 155 Ile Arg Leu Leu His 160 Phe Leu Thr for Ser 165 Ala Met Arg Trp Ala 170 Thr Thr Ile Ala Cys 175 Leu Leu Ala Ile Leu Leu Ala Ile

180 <210> 21 <211> 201 <212> PRT <213> PRRS virus <400> 21

Met 1 Arg Cys Ser His 5 Lys Leu Gly Arg Ser 10 Leu Thr for His Ser 15 Cys Phe Trp Trp Leu 20 Phe Leu Leu Cys Thr 25 Gly Leu Ser Trp Ser 30 Phe Ala Asp Gly same time 35 Gly Asp Ser Ser Thr 40 Tyr gin Tyr Ile Tyr 45 Asp Leu Thr Ile Cys 50 Glu Leu same time Gly Thr 55 Asp Trp Leu Ser Ser 60 His Phe Gly Trp Ala 65 wall Glu Thr Phe wall 70 Phe Tyr for wall Ala 75 Thr His Ile Leu Ser 80 Leu Gly Phe Leu Thr 85 Thr Ser His Phe Phe 90 Asp Ala Leu Gly Leu 95 Gly Ala wall Ser Thr 100 Ala Gly Phe wall Gly 105 Gly Arg Tyr wall Leu 110 Cys Ser

Val Tyr Gly Ala Ala Phe Ala Ala Phe Val Cys Phe Val ile Arg

115 120 125

Ala Ala 130 Lys same time Cys Met Ala 135 Cys Arg Tyr Ala Arg 140 Thr Arg Phe Thr same time 145 Phe Ile wall Asp Asp Arg 150 Gly Arg wall His 155 Arg Trp Lys Ser for 160 Ile wall wall Glu Lys 165 Leu Gly Lys Ala Glu 170 wall Asp Gly same time Leu 175 wall Thr Ile Lys His 180 wall wall Leu Glu Gly 185 wall Lys Ala gin for 190 Leu Thr Arg Thr Ser Ala Glu gin Trp Glu Ala

195 200 <210> 22 <211> 750 <212> DNA <213> PRRS Lelystad Agents ORF2 <400> 22

ATGCAATGGG GTCACTGTGG AGTAAAATCA GCCAGCTGTT CGTGGACGCC TTCACTGAGT 60 TCCTTGTTAG TGTGGTTGAT ATTGCCATTT TCCTTGCCAT ACTGTTTGGG TTCACCGTCG 120 CAGGATGGTT ACTGGTCTTT CTTCTCAGAG TGGTTTGCTC CGCGCTTCTC CGTTCGCGCT 180 'CTGCCATTCA CTCTCCCGAA CTATCGAAGG TCCTATGAAG GCTTGTTGCC CAACTGCAGA 240 CCGGATGTCC CACAATTTGC AGTCAAGCAC CCATTGGGyA TGTTTTGGCA CATGCGAGTT 300 TCCCACTTGA TTGATGAGAT GGTCTCTCGT CGCATTTACC AGACCATGGA ACATTCAGGT 360 CAAGCGGCCT GGAAGCAGGT GGTTGGTGAG GCCACTCTCA CGAAGCTGTC AGGGCTCGAT 420 ATAGTTACTC ATTTCCAA.CA CCTGGCCGCA GTGGAGGCGG ATTCTTGCCG CTTTCTCAGC 480 'TCACGACTCG TGATGCTAAA AAATCTTGCC GTTGGCAATG TGAGCCTACA GTACAAGACC 540 ACGTTGGACC GCGTTGAGCT CATCTTCCCC ACGCCAGGTA CGAGGCCCAA GTTGACCGAT 600 TTCAGACAAT GGCTCATCAG TGTGCACGCT TCCATTTTTT CCTCTGTGGC TTCATCTGTT 660 ACCTTGTTCA TAGTGCTTTG GCTTCGAATT CCAGCTCTAC GCTATGTTTT TGGTTTCCAT 720 TGGCCCACGG CAACACATCA TTCGAGCTGA 750 <210> 23 <211> 798 <212> DNA <213> PRRS Lelystad agent ORF3 <400> 23

ATGGCTCATC AGTGTGCACG CTTCCATTTT TTCCTCTGTG GCTTCATCTG TTACCTTGTT 60 CATAGTGCTT TGGCTTCGAA TTCCAGCTCT ACGCTATGTT TTTGGTTTCC ATTGGCCCAC 120 GGCAACACAT CATTCGAGCT GACCATCAAC TACACCATAT GCATGCCCTG TTCTACCAGT 180 CAAGCGGCTC GCCAAAGGCT CGAGCCCGGT CGTAACATGT GGTGCAAAAT AGGGCATGAC 240 AGGTGTGAGG AGCGTGACCA TGATGAGTTG TTAATGTCCA TCCCGTCCGG GTACGGACAA 300 CTCAAACTTG AGGGTTATTA TGCTTGGCTG GCTTTTTTGT CCTTTTCCTA CGCGGCCCAA 360 TTCCATCCGG AGTTGTTCGG GATAGGGAAT GTGTCGCGCG TCTTCGTGGA CAAGCGACAC 420 CAGTTCATTT GTGCCGAGCA TGATGGACAC AATTCAACCG TATCTACCGG ACACAACATC 480 TCCGCATTAT ATGCGGCATA TTACCACCAC CAAATAGACG GGGGCAATTG GTTCCATTTG 540 GAATGGCTGC GGCCACTCTT TTCTTCCTGG CTGGTGCTCA ACATATCATG GTTTCTGAGG 600 CGTTCGCCTG TAAGCCCTGT TTCTCGACGC ATCTATCAGA TATTGAGACC AACACGACCG 660

-60CGGCTGCCGG TTTCATGGTC CTTCÄGGACA TCAATTGTTT CCGACCTCAC GGGGTCTCAG CAGCGCAAGA GAAAATTTCC TTCGGAAAGT CGTCCCAATG TCGTGAAGCC GTCGGTACTC CCCAGTACAT CACGATAA

720

780

798 <210> 24 <211> 606 <212> DNA <213> PRRS Lelystad Agents ORF5 <400> 24

ATGAGATGTT CTCACAAATT TTTTTGCTGT GTACCGGCTT TACCAATACA TATATAACTT CATTTTGGTT GGGCAGTCGA CTGGGTTTTC TCACAACAAG GCAGGATTTG

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ACTCTTGCTT CTGGTGGCTT 60 GCAACGGCGA CAGCTCGACA 120 GGACCGACTG GTTGTCCAGC 80

TTGCCACTCA TATCCTCTCA 240 GTCTCGGCGC TGTATCCACT 300ACGGCGCTTG TGCTTTCGCA 3.60 TGGCCTGCCG CTATGGCCGT 42.0 TTCATCGATG GAAGTCTCCA 480 ACCTCGTCAC CATCAAACAT 540 CTTCGGCTGA 600 GCAATGGGG

606 <210> 25 <211> 21 <212> DNA <213> PRRS attenuation site I ORF2 <400> 25

TACTGGTCTT TCTTCTCAGA G 21 <210> 26 <211> 21 <212> DNA <213> PRRS attenuation site II ORF2 <400> 26

ACAATTTGCA GTCAAGCACC C 21 <210> 27 <211> 21 <212> DNA <213> PRRS attenuation site III ORF2 <400> 27

ATTGGyATG TTTTGGCACA T

-61 <210> 28 <211> 21 <212> DNA <213> PRRS ORF3 attenuation site <400> 28

GTTGTTAAT GTCCATCCCGT C 21 <210> 29 <211> 21 <212> DNA <213> PRRS attenuation site ORF5 <400> 29

GACCTTTGTG CTTTACCCGG T

Claims (42)

PATENT CLAIMS An attenuated European PRRS virus encoded by a nucleic acid comprising ORF1, ORF2, ORF3, ORF4, ORF5, ORF6 and ORF7, wherein: (a) ORF2 contains at positions 11915-11935 at least one of the nucleotides as shown in Table 1: A T G A C C A G A A C G A A G A G T C T C C C A C T T C A C C A A C C A C A C A C A G G T G A A G T G G G T G G T G T G T G T and in positioner h 12037-12C At least one of the nucleotides as set forth in U.S. Pat Table 2: T G T T A A A C G T C A G T T C G T G G G C A C C C C C T A C T C A C C T A C A A A G T G G G G G A T G A G T G G A T G T T T and at positions 12058-12C 78 at least one of the nucleotides as disclosed in U.S. Pat Table 3: T A A C C C A T A C A A A A C C G T G T A C C C T T T C C C T C C C C T T A C A C C G G G A A A G G G A G G G G A A T G T G G a / a or a deletion in said semi he (polo and / or (b) ORF3 contains at positions 12660-12680 at least one of the nucleotides as shown in Table 4: C A A C A A T T A C A G G T A G G G C A G T C C T C C C C C T C A A C C A A A T C A A G G A G G G G G A G T T G G T T T A G T a / a or a deletion in said semi ie (semi and / or (c) ORF5 contains at positions 13684-13704 at least one of the nucleotides shown in Table 5: C T G G A A A C A C G A A A T G G G C C A T C A A C C C T C T A C C C C A A A T T C A G T T G G G A G A T G G G G T T T A A G a / a or a deletion in said semi he (polo Hach). The attenuated European PRRS virus of claim 1, wherein (a) ORF2 comprises C, A or G at position 11925 and / or C, T or A at position 12047 and / or A, C or G at position 12068 or a deletion at said position (s) and / or (b) ORF3 comprises A, C or G at position 12670 or a deletion at said position and / or (c) ORF5 comprises G, A, or T at position 13694 or a deletion at said position. An attenuated European PRRS virus according to claim 1 or 2, wherein the nucleic acid is characterized in that: (a) ORF2 comprises a C at position 11925 and / or a T at position 12047 and / or a C at position 12068 or a deletion at said position (s), and / or (b) ORF3 comprises a C at position 12670 or a deletion at said position and / or c) ORF5 comprises a T at position 13694 or a deletion at said position. An attenuated European PRRS virus according to any one of claims 1 to 3, wherein the nucleic acid is characterized in that: a) ORF2 comprises a nucleic acid as defined in SEQ. no. 1 and / or b) ORF3 comprises a nucleic acid as defined in SEQ. no. 2 and / or c) ORF4 comprises a nucleic acid as defined in SEQ. no. 3 and / or d) ORF5 comprises a nucleic acid as defined in SEQ. no. 4, or a fragment, allelic variant, functional variant, variant based on degeneracy of the nucleic acid code, fusion molecule or chemical derivative thereof. An attenuated European PRRS virus according to any one of claims 1 to 4, wherein the nucleic acid is characterized in that: a) ORF2 consists of a nucleic acid as defined in SEQ. no. 1 and / or b) ORF3 consists of a nucleic acid as defined in SEQ. no. 2 and / or c) ORF4 consists of a nucleic acid as defined in SEQ. no. 3 and / or d) ORF5 consists of a nucleic acid as defined in SEQ. no. 4th An attenuated European PRRS virus according to any one of claims 1 to 5, wherein the nucleic acid is characterized in that it comprises a nucleic acid as defined in SEQ. no. 5 or a fragment, allelic variant, functional variant, variant based on degeneracy of the nucleic acid code, a fusion molecule or a chemical derivative. An attenuated European PRRS virus according to any one of claims 1 to 6, wherein the nucleic acid is characterized in that it consists of a nucleic acid as defined in SEQ. no. 5th The attenuated European PRRS virus according to any one of claims 1 to 3, wherein the nucleic acid is further characterized in that: a) ORF2 comprises a nucleic acid as defined in SEQ. no. 6 and / or b) ORF3 comprises a nucleic acid as defined in SEQ. no. 7 and / or c) ORF4 comprises a nucleic acid as defined in SEQ. no. 8 and / or d) ORF5 comprises a nucleic acid as defined in SEQ. no. 9 and / or a fragment, allelic variant, functional variant, variant based and degeneracy of the nucleic acid code, fusion molecule or chemical derivative. An attenuated European PRRS virus according to any one of claims 1 to 3, wherein the nucleic acid is further characterized in that: a) ORF2 consists of a nucleic acid as defined in SEQ. no. 6 and / or b) ORF3 consists of a nucleic acid as defined in SEQ. no. 7 and / or c) ORF4 consists of a nucleic acid as defined in SEQ. no. 8 and / or d) ORF5 consists of a nucleic acid as defined in SEQ. no. 9th 10. Weakened European PRRS virus, which is characterized by: a) ORF1a comprises an amino acid as defined in SEQ. no. 10 and / or b) ORF1b comprises an amino acid as defined in SEQ. no. 11 and / or c) ORF2 comprises an amino acid as defined in SEQ. no. 12 and / or d) ORF3 comprises an amino acid as defined in SEQ. no. 13 and / or e) ORF4 comprises an amino acid as defined in SEQ. no. 14 and / or f) ORF5 comprises an amino acid as defined in SEQ. no. 15 and / or g) ORF6 comprises an amino acid as defined in SEQ. no. 16 and / or h) ORF7 comprises an amino acid as defined in SEQ. no. Or a fragment thereof, allelic variant, functional variant, variant based and degeneracy of a nucleic acid code, a fusion molecule or a chemical derivative. 11. Weakened European PRRS virus, which is characterized by: a) ORF1a consists of an amino acid as defined in SEQ. no. 10 and / or b) ORF1b consists of an amino acid as defined in SEQ. no. 11 and / or c) ORF2 consists of an amino acid as defined in SEQ. no. 12 and / or d) ORF3 consists of an amino acid as defined in SEQ. no. 13 and / or e) ORF4 consists of an amino acid as defined in SEQ. no. 14 and / or f) ORF5 consists of an amino acid as defined in SEQ. no. 15 and / or g) ORF6 consists of an amino acid as defined in SEQ. no. 16 and / or h) ORF7 consists of an amino acid as defined in SEQ. no. 17th 12. Weakened European PRRS virus, which is characterized by: a) ORF2 comprises an amino acid as defined in SEQ. no. 18 and / or b) ORF3 comprises an amino acid as defined in SEQ. no. 19 and / or c) ORF4 comprises an amino acid as defined in SEQ. no. 20 and / or d) ORF5 comprises an amino acid as defined in SEQ. no. 21 or a fragment thereof, allelic variant, functional variant, variant based and degeneracy of the nucleic acid code, fusion molecule or chemical derivative. 13. Weakened European PRRS virus, which is characterized by: a) ORF2 consists of an amino acid as defined in SEQ. no. 18 and / or b) ORF3 consists of an amino acid as defined in SEQ. no. 19 and / or c) ORF4 consists of an amino acid as defined in SEQ. no. 20 and / or d) ORF5 consists of an amino acid as defined in SEQ. no. 21st The nucleotide sequence encoding the virus of any one of claims 1 to 13. The nucleotide sequence of claim 14, which has been modified to encode a virulent marker and / or a serological marker. The nucleotide sequence of claim 14 or 15, wherein the marker encoding nucleotide sequence is located between any of the open reading frames encoding the structural viral proteins. 17. A method of generating an infectious live attenuated PRRS virus comprising producing a recombinant nucleic acid comprising at least one complete DNA copy or an in vitro transcribed RNA copy or a derivative thereof, wherein the nucleotide sequence is a nucleotide sequence according to any one of claims 14 to 14 16th 18. A method for generating an infectious live attenuated PRRS virus comprising the steps of: a) The PRRS virus of any one of claims 1 to 13 is used to infect a suitable cell line; b) PRRS virus is attenuated by passage on cell culture. 19. The method of claim 18, wherein the cell line is a Mare cell or a derivative thereof. A method according to any one of claims 18 or 19, characterized in that the PRRS virus is a virus according to any one of claims 1 to 13. The method of any one of claims 18 to 20, wherein the PRRS virus is a virus according to claim 5, 9, 11 or 13. A cell line comprising the PRRS virus according to any one of claims 1 to 13. The cell line of claim 22 which is a Mare cell or a derivative thereof. A pharmaceutical composition comprising a PRRS virus according to any one of claims 1 to 13 and a pharmaceutically acceptable carrier. Use of a PRRS virus according to any one of claims 1 to 13 for the manufacture of a vaccine for the prophylaxis and treatment of PRRS infections. 26. A method of attenuating the European PRRS virus, characterized in that (a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the ORF2 positions corresponding to positions 130 to 150 and / or positions 252 to 272 and / or positions 273 to 293 of SEQ ID NO: 2; no. 22; b) it is tested whether the resulting PRRS virus is attenuated. 27. A method of attenuating the European PRRS virus, characterized in that a) the nucleotide sequence of the virus is modified by site-specific mutagenesis in at least one of the ORF3 positions corresponding to positions 267 to 287 of SEQ ID NO: 2; no. 23; b) it is tested whether the resulting PRRS virus is attenuated. 28. A method of attenuating the European PRRS virus, characterized in that a) the nucleotide sequence of the virus is modified by site-specific mutagenesis at least at one of the positions corresponding to positions 201 to 221 in ORF5 of SEQ. no. 24; b) it is tested whether the resulting PRRS virus is attenuated. The method of any one of claims 26 to 28, wherein the modification results in a change in the amino acid sequence of the encoded protein. The method of any one of claims 26 to 29, wherein the modification is a deletion or a substitution. A method according to any one of claims 26 to 30, wherein the sequence of each of ORF2, ORF3 and ORF5 is modified. Method according to claim 31, characterized in that the ORF2 is modified in at least two, preferably at least three positions. 33. The method of any one of claims 26 to 32, wherein the modification results in one or more of the following: OFR2 encoding a protein having an amino acid at one or more amino acid sequence positions corresponding to positions 47, 88, and / or or 95 in the amino acid sequence of the encoded SEQ. no. 22, substituted or deleted; ORF3 encoding a protein having an amino acid corresponding to position 93 of the amino acid sequence of the encoded sequence. no. 23 substituted or deleted; and / or ORF5 encoding a protein having an amino acid corresponding to position 71 of the amino acid sequence of the encoded sequence. no. 24 substituted or deleted. The method of claim 33, wherein the modification results in one or more, preferably all, of the following features: OFR2 encoding a protein having a serine at a position corresponding to position 47 of the amino acid sequence of the encoded sequence. no. 22, an ORF2 encoding a protein having phenylalanine at a position corresponding to position 88 of the amino acid sequence of the encoded sequence. no. 22, ORF2 having leucine at a position corresponding to position 95 of the amino acid sequence of the encoded sequence. no. 22, ORF3 having a proline at a position corresponding to position 93 of the amino acid sequence of the encoded sequence. no. 23, and / or ORF5 having a phenylalanine at a position corresponding to position 71 of the amino acid sequence of the encoded sequence. no. 24th The method of claim 34, wherein the modification results in one or more, preferably all of the following features: ORF2 having C at a position corresponding to position 140 of SEQ. no. 22, an ORF2 having a T at a position corresponding to position 262 of SEQ. no. 22, an ORF2 having a C at a position corresponding to position 283 of SEQ. no. 22, an ORF3 having C at a position corresponding to position 277 of SEQ. no. 23 and / or ORF5 having a T at a position corresponding to position 211 of SEQ. no. 24th An attenuated European PRRS virus obtainable by the method of any one of claims 26 to 35. 37. A weakened European PRRS virus having ORF2 that differs from SEQ. no. 22 at one or more of positions 130 to 150 and / or at one or more of positions 252 to 272 and / or at one or more of positions 273 to 293. 38. An attenuated European PRRS virus having ORF3 that differs from SEQ. no. 23 in one or more positions 267 to 287. 39. A weakened European PRRS virus having ORF5 that differs from SEQ. no. 24 at one or more of positions 201 to 221. 40. A vaccine comprising an attenuated European PRRS virus according to any one of claims 36 to 39 together with a pharmaceutically acceptable carrier. Use of the attenuated European PRRS virus according to claims 36 to 39 for the production of a vaccine for vaccination of pigs. Use of the attenuated European PRRS virus according to any one of claims 36 to 39 for the production of a PRRS vaccine. 1/6 Fig. ΙΑ Lelystad Vir.A Lelystad-b 10 20 30 40 50 60 ATGCAATGGG GTCÄCTGTGG AGTAAAATCA 'GCCAGCTGTT CGTGGACGCC TTCACTGAGT ............ T ........................ ........................ 100 110 120 Lelystad TCCTTGTTAG TGTGGTTGAT ATTGCCATTT TCCTTGCCAT ACTGTTTGGG TTCACCGTCG Vir.A ........................ TT ...................... ............ Lelystad-b ........................ T ...................... ............. Lelystad Vir.A Lelystad-b 130 140 CAGGATGGTT ACTGGTCTTE ................... NO ................... no. 150 160 170 180 CTTCTCAGAG TGGTTTGCTC CGCGCTTCTC CGTTCGCGCT 190 200 210. 220 230 240 Lelystad CTGCCATTCA CTCTCCCGAA CTATCGAAGG TCCTATGAAG GCTTGTTGCC CAACTGCAGA Vir.A ........................ Lelystad-b ........................ ........................... ....... Lelystad Vir.A Lelystad 250 270 280 260 290 CCGGATGTCC CACAATTTGC AC ..................... StCAAGCAC · CCÄTTGGGyA TGÉ No ................ T. . . ČTľTTGGCA CATGCGAGTT * 1 ..................... No ................ T. ..č Ί 310 32.0 330th 340 350 360 Lelystad TCCCACTTGA TTGATGAGAT GGTCTCTCGT CGCATTTACC AGACCATGGA ACATTCAGGT Vir.A ..... A. .A. Lelystad-b 370 380 390 400 410 420 Lelystad CAAGCGGCCT GGAAGCAGGT GGTTGGTGAG GCCACTCTCA CGAAGCTGTC AGGGCTCGAT Vir.A ......... C .A ........ Lelystad-b 430 440 450. 460 470 480 Lelystad ATAGTTACTC ATTTCCAACA CCTGGCCGCÁ GTGGAGGCGG attcttgccg CTTTCTCAGC Vir.A . .A ....... Lelystad-b ..... C .... ........ Y. 490 500 510 520 530 540 Lelystad Vir.A TCACGACTCG TGATGCTAAA AAATCTTGCC GTTGGCAATG TGAGCCTACA GTACAACACC Lelystad-b ............................................... ............. 550 560 570 580 590 600 Lelystad ACGTTGGACC GCGTTGAGCT CATCTTCCCC ACGCCAGGTA CGAGGCCCAA GTTGACCGAT Vir.A ......... C Lelystad-b 610 620 63 0 640 650 660 Lelystad Vir.A TTCAGACAAT GGCTCATCAG TGTGCACGCT TCCATTTTTT CCTCTGTGGC TTCATCTGTT Lelystad-b 670 680 690 700 710 720 Lelystad ACCTTGTTCA TAGTGCTTTG GCTTCGAATT CCAGCTCTAC GCTATGTTTT TGGTTTCCAT Vir.A ............................................... ............. Lelystad-b ............................................... ............. 2/6 Fig. 1B Lelystad Vír. Lelystad-b 730 740 750 TGGCCCACGG CAACACATCA TTCGAGCTGA 3/6 Fig. 2A LELYSTAD Vir.A 10 ATGGCTCATC 20 AGTGTGCACG ³⁰ CTTCCATTTT • 40 TTCCTCTGTG 50 GCTTCATCTG 60 TTACCTTGTT Lelystad-b 70 80 90 100 110 120 LELYSTAD Lelystad-b CATAGTGCTT TGGCTTCGAA TTCCAGCTCT ACGCTATGTT TTTGGTTTCC ATTGGCCCAC 130 140 150 160 170 180 Lelystad Vir.A GGCAACACAT CATTCGAGCT GACCATCAAC TACACCATAT GCATGCCCTG TTCTACCAGT Lelystad-b 190 200 210 220 230 240 LELYSTAD CAAGCGGCTC GCCAAAGGCT CGAGCCCGGT CGTAACATGT GGTGCAAAAT AGGGCATGAC Vir.A Lelystad-b .... T ..... N. -G ..... LELYSTAD Vir.A Lelystad-b 250 260 270 280 290 300 AGGTGTGAGG AGCGTGACCA TGATGAGTTG TTAATGBCCA TCCCGTCCGG GTACGGACAA No ................................... No .................................... 310 320 330 340 350 360 LELYSTAD CTCAAACTTG AGGGTTATTA TGCTTGGCTG .......................... Lelystad-b ..................... .............................. · ......... 370 380 390 400 410 420 LELYSTAD Vir.A TTCCATCCGG AGTTGTTCGG GATAGGGAAT GTGTCGCGCG TCTTCGTGGA .CAAGCGACAC Lelystad-b 430 440 450 460 470 480 LELYSTAD CAGTTCATTT GTGCCGAGCA TGATGGACAC AATTCAACCG TATCTACCGG ACACAACATC Lelystad-b ......... G .G ........ 490 500 510 520 530 540 LELYSTAD Vir.A TCCGCATTAT ATGCGGCATA TTACCACCAC CAAATAGACG GGGGCAATTG GTTCCATTTG Lelystad-b 550 560 570 580 590 600 LELYSTAD GAATGGCTGC GGCCACTCTT TTCTTCCTGG CTGGTGCTCA ACATATCATG GTTTCTGAGG Vir.A ....................... C ................. T ..... ............. Lelystad-b ............................................... ............. 610 620 630 640 650 660 LELYSTAD CGTTCGCCTG TAAGCCCTGT TTCTCGACGC ATCTATCAGA TATTGAGACC AACACGACCG Vir.A ............................................. Lelystad-b ............................................ A LELYSTAD Lelystad-b 670 680 690 700 710 720 CGGCTGCCGG TTTCATGGTC CTTCAGGACA TCAATTGTTT CCGACCTCAC C ...................... 4/6 Fig. 2B LELYSTAD Vir.A Lelystad-b LELYSTAD Lelystad-b 730 740 750 760 770 780 CAGCGCAAGA GAAAATTTCC TTCGGAAAGT ...................... 790 798 'CCCAGTACAT CACGATAA 5/6 Fig. 3 LELYSTAD Vir.A 10 ATGGCTGCGG 20 CCACTCTTTT 30 CTTCCTGGCT .c ........ 40 • GGTGCTCAAC ......... T 50 ATATCATGGT 60 TTCTGAGGCG Lelystad-B 70 80 90 100 110 120 LELYSTAD TTCGCCTGTA AGCCCTGTTT CTCGACGCAT CTATCAGATA TTGAGACCAA CACGACCGCG Vir.A Lelystad-B . .A ....... 130 140 150 160 170 180 LELYSTAD GCTGCCGGTT TCATGGTCCT TCAGGACATC AATTGTTTCC GACCTCACGG GGTCTCAGCA Vir.A ...... C. . . Lelystad-B 190 200 210 220 230 240 LELYSTAD GCGCAAGAGA AAATTTCCTT CGGAAAGTCG TCCCAATGTC GTGAAGCCGT CGGTACTCCC Vir.A ......... G ..... C .... Lelystad-B 250 260 270 280 290 300 LELYSTAD CAGTACATCA CGATAACGGC TAACGTGACC GACGAATCAT ACTTGTACAA CGCGGACCTG Vir.A ....... T. . Lelystad-B 310 320 330 340 350 360 LELYSTAD CTGATGCTTT CTGCGTGCCT TTTCTACGCC TCAGAAATGA GCGAGAAAGG CTTCAAAGTC Vir.A C ..... .... ......... T Lelystad-B 370 380 390 400 410 420 LELYSTAD ATCTTTGGGA ATGTCTCTGG CGTTGTTTCT GCTTGTGTCA ATTTCACAGA TTATGTGGCC Vir.A c ......... Lelystad-B 430 440 450 460 470 480 LELYSTAD CATGTGACCC AACATACCCA GCAGCATCAT CTGGTAATTG ATCACATTCG GTTGCTGCAT Vir.A T ......... Lelystad-B G ....... . . 490 500 510 520 530 540 LELYSTAD TTCCTGACAC CATCTGCAAT GAGGTGGGCT ACAACCATTG CTTGTTTGTT CGCCATTCTC Vir.A Lelystad-B ........ C. Lelystad Lelystad-B 550 TTGGCAATAT GA ..... G ...... ..... N ...... 6/6 Fig. 4 LELYSTAD Vir.A LELYSTAD-B Lelystad Vir.A LELYSTAD-B 10 20 30 40 50 60 ATGAGATGTT CTCACAAATT GGGGCGTTTC TTGACTCCGC ACTCTTGCTT CTGGTGGCTT 70 80 90 100 110 120 TTTTTGCTGT GTACCGGCTT GTCCTGGTCC TTTGCCGATG GCAACGGCGA CAGCTCGACA ........ A. LELYSTAD Vir.A LELYSTAD-B 130 140 150 160 170 180 TACCAATACA TATATAACTT GACGATATGC GAGCTGAATG GGACCGACTG GTTGTCCAGC LELYSTAD Vir.A LELYSTAD-B 190 • CATTTTGGTT GGGCAGTCGA 210 220240 ÍCGG TTGCCACTCA TATCCTCTCA 250 260 270 280 290 300 LELYSTAD CTGGGTTTTC TCACAACAAG CČATTTTTŤ GACGCGCTCG GTCTCGGCGC TGTATCCACT ’ Vir.A ............................................... .............. LELYSTAD-B ............................................... ............. 310 320 330 340 350 360 LELYSTAD GCAGGAŤTTG TTGGCGGGCG GTACGTACTC TGCAGCGTCT ACGGCGCTTG TGCTTTCGCA Vir.A ... T ...... LELYSTAD-B 370 380 390 ^: 400 410 420 LELYSTAD GCGTTCGTAT GTTTTGTCAT CCGTGCTGCT AAAAATTGCA TGGCCTGCCG CTATGCCCGT Vir.A LELYSTAD-B 430 440 450 460 470 480 LELYSTAD Vir.A ACCCGGTTTA CCAACTTCAT TGTGGACGAC ... A ... A .. CGGGGGAGAG TTCATCGATG GAAGTCTCCA LELYSTAD-B 490 500 510 520 530 540 LELYSTAD Vir.A LELYSTAD-B ATAGTGGTAG AAAAATTGGG CAAAGCCGAA GTCGATGGCA. ..... C .... ACCTCGTCAC CATCAAACAT 550 560 570 580 590 600 LELYSTAD GTCGTCCTCG AAGGGGTTAA AGCTCAACCC TTGACGAGGA CTTCGGCTGA GCAATGGGAG Vir.A ............................................... ............. LELYSTAD-B ............................................... ... .......... 606 LELYSTAD GCCTAG Vir.A ...... LELYSTAD-B ......