CA2267994C - Truncated platelet-activating factor acetylhydrolase - Google Patents

Abstract

The present invention provides purified and isolated polynucleotide sequences encoding human plasma platelet-activating factor acetylhydrolase. Also provided are materials and methods for the recombinant production of platelet-activating factor acetylhydrolase products which are expected to be useful in regulating pathological inflammatory events.

Description

WO 99109147 PCTlUS971I4212 TRUNCATED PLATELET-ACTIVATING FACTOR ACETYLHYDROLASE
FIELD OF THE INVENTION
The present invention relates generally to platelet-activating factor acetylhydrolase and more specifically to novel purified and isolated polynucleotides encoding human plasma platelet-activating factor acetyihydrolase, to the platelet-activating factor acetylhydrolase products encoded by the polynucleoddes, to materials and methods for the recombinant production of platelet-activating factor acetylhydrolase products and to antibody substances specif c for platelet-activating factor acetylhydrolase.
BACKGROUND
Platelet-activating factor (PAF) is a biologically active phospholipid synthesized by various cell types. In vivo and at normal concentrations of 10-10 to 10-9 M, PAF activates target cells such as platelets and neutrophils by binding to specific G protein-coupled cell surface receptors [Venable et al. , J. Lipid Res. , 34:
691-701 (1993)]. PAF has the structure I-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine. For optimal biological activity, the sn-1 position of the PAF
glycerol backbone must be in an ether linkage with a fatty alcohol and the sn-position must have a phosphocholine head group.
PAF functions in normal physiological processes (e.g., inflammation, hemostasis and parturition) and is implicated in pathological inflammatory responses (e. g. , asthma, anaphylaxis, septic shock and arthritis) [Venable et al. , supra, and Lindsberg et al. , Ann. lVeurol. , 30: I 17-129 ( 1991 )] . The likelihood of PAF
involvement in pathological responses has prompted attempts to modulate the activity of PAF and the major focus of these attempts has been the development of antagonists of PAF activity which interfere with binding of PAF to cell surface receptors.
See, for example, Heuer et al., Clin. Exp. Allergy, 22: 980-983 (1992).
The synthesis and secretion of PAF as well as its degradation and clearance appear to be tightly controlled. To the extent that pathological inflammatory actions of PAF result from a failure of PAF regulatory mechanisms giving rise to excessive production, inappropriate production or lack of degradation, an alternative means of modulating the activity of PAF would involve mimicing or augmenting the natural process by which resolution of inflammation occurs.
Macrophages [Stafforini et al. , J. Biol. Chem. , 265( 17): 9682-9687 ( 1990)], hepatocytes and the human hepatoma cell line HepG2 [Satoh et al., J. Clin.
Invest., 87: 476-481 (1991) and Tarbet et al., J. Biol. Chem., 265(25): 16667-16673 (1991)]
have been reported to release an enzymatic activity, PAF acetylhydrolase (PAF-AH), that inactivates PAF. In addition to inactivating PAF, PAF-AH also inactivates oxidatively fragmented phospholipids such as products of the arachidonic acid cascade that mediate inflammation. See, Stremler et al. , J. Biol. Chem. , 266(17):

11103 (1991). The inactivation of PAF by PAF-AH occurs primarily by hydrolysis of the PAF sn-2 acetyl group and PAF-AH metabolizes oxidatively fragmented phospholipids by removing sn-2 acyl groups. Two types of PAF-AH have been identified: cytoplasmic forms found in a variety of cell types and tissues such as endothelial cells and erythrocytes, and an extracellular form found in plasma and serum. Plasma PAF-AH does not hydrolyze intact phospholipids except for PAF
and this substrate specificity allows the enzyme to circulate in vivo in a fully active state without adverse effects. The plasma PAF-AH appears to account for all of the PAF
degradation in human blood ex vivo [Stafforini et al., J. Biol. Chem., 262(9):

4230 (1987)].
While the cytoplasmic and plasma forms of PAF-AH appear to have identical substrate specificity, plasma PAF-AH has biochemical characteristics which distinguish it from cytoplasmic PAF-AH and from other characterized lipases.
Specifically, plasma PAF-AH is associated with lipoprotein particles, is inhibited by diisopropyl fluorophosphate, is not affected by caicium ions, is relatively insensitive to proteolysis, and has an apparent molecular weight of 43,000 daltons. See, Stafforini et al. (1987), supra. The same Stafforini et al. article describes a procedure for partial purification of PAF-AH from human plasma and the amino acid composition of the plasma material obtained by use of the procedure.
Cytoplasmic PAF-AH has been purified from erythrocytes as reported in Stafforini et al. , J. Biol.
Chem., 268(6): 3857-3865 (1993) and ten amino terminal residues of cytoplasmic PAF-AH are also described in the article. Hattori et al. , J. Biol. Chem. , 268(25):
18748-18753 {1993) describes the purification of cytoplasmic PAF-AH from bovine brain. Subsequent to filing of the parent application hereto the nucleotide sequence of bovine brain cytoplasmic PAF-AH was published in Hattori et al. , J. Biol.
Chem. , 269(237): 23150-23155 (1994). On January 5, 1995, three months after the filing date of the parent application hereto, a nucleotide sequence for a lipoprotein associated phospholipase A2 (Lp-PLA2) was published in Smithkline Beecham PLC
Patent Cooperation Treaty (PCT) International Publication No. WO 95/00649. The nucleotide sequence of the Lp-PLA2 differs at one position when compared to the nucleotide sequence of the PAF-AH of the present invention. The nucleotide difference {corresponding to position 1297 of SEQ ID NO: 7) results in an amino acid difference between the enzymes encoded by the polynucleotides. The amino acid at position 379 of SEQ ID NO: 8 is a valine while the amino acid at the corresponding position in Lp-PLA2 is an alanine. In addition, the nucleotide sequence of the PAF-AH of the present invention includes 124 bases at the 5' end and twenty bases at the 3' end not present in the Lp-PLA2 sequence. Three months later, on April 10, 1995, a Lp-PLA2 sequence was deposited in GenBank under Accession No. U24577 which differs at eleven positions when compared to the nucleotide sequence of the PAF-AH
- of the present invention. The nucleotide differences (corresponding to position 79, 81, 84, 85, 86, 121, 122, 904, 905, 911, 983 and 1327 of SEQ ID NO: 7) results in four amino acid differences between the enzymes encoded by the polynucleotides.
The amino acids at positions 249, 250, 274 and 389 of SEQ ID NO: 8 are lysine, aspartic acid, phenylalanine and leucine, respectively, while the respective amino acid at the corresponding positions in the GenBank sequence are isoleucine, arginine, ieucine and serine.
The recombinant production of PAF-AH would make possible the use of exogenous PAF-AH to mimic or augment normal processes of resolution of inflammation in vivo. The administration of PAF-AH would provide a physiological advantage over administration of PAF receptor antagonists because PAF-AH is a product normally found in plasma.
Moreover, because PAF receptor antagonists which are structurally related to PAF inhibit native PAF-AH activity, the desirable metabolism of PAF and of oxidatively fragmented phospholipids is thereby prevented. Thus, the inhibition of PAF-AH activity by PAF receptor antagonists counteracts the competitive blockade of the PAF receptor by the antagonists. See, Stremler et al., supra. In addition, in locations of acute inflammation, for example, the release of oxidants results in inactivation of the native PAF-AH
enzyme in turn resulting in elevated local levels of PAF and PAF-like compounds which would compete with any exogenously administered PAF receptor antagonist for binding to the PAF
receptor. In contrast, treatment with recombinant PAF-AH
would augment endogenous PAF-AH activity and compensate for any inactivated endogenous enzyme.
There thus exists a need in the art to identify and isolate polynucleotide sequences encoding human plasma PAF-AH, to develop materials and methods useful for the recombinant production of PAF-AH and to generate reagents for the detection of PAF-AH in plasma.
SUMMARY OF THE INVENTION
The present invention provides novel purified and isolated polynucleotides (i.e., DNA and RNA both sense and antisense strands) encoding human plasma PAF-AH or enzymatically active fragments thereof.
The invention also provides a purified and isolated human plasma platelet-activating factor acetylhydrolase (PAF-AH) polypeptide product which is lacking up to the first twelve N-terminal amino acids of the -4a-mature human PAF-AH amino acid sequence set out in SEQ ID NO: 8.
Preferred DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. The DNA sequence encoding PAF-AH that is set out in SEQ ID NO: 7 and DNA
sequences which hybridize to the noncoding strand thereof under standard stringent conditions or which would hybridize but for the redundancy of the genetic code, are contemplated by the invention. Also contemplated by the invention are biological replicas (i.e., copies of isolated DNA sequences made in vivo or in vi tro) of DNA sequences of the invention.
Autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating PAF-AH sequences and especially vectors wherein DNA encoding PAF-AH is operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided.
The invention also contemplates a human PAF-AH
polypeptide product which has an amino acid replacement in the sequence of SEQ ID NO: 8 selected from the group consisting of: (a) D 286 A; (b) D 286 N; and (c) D 304 A.
The invention also contemplates an isolated polynucleotide encoding a human PAF-AH polypeptide product having Met46 of SEQ ID NO: 8 as the N-terminal residue and Ile4zs or Asn441 as the C-terminal residue .

-5_ According to another aspect of the invention, procaryotic or eucaryotic host cells are stably transformed with DNA sequences of the invention in a manner allowing the desired PAF-AH to be expressed therein. Host cells expressing PAF-AH products can serve a variety of useful purposes. Such cells constitute a valuable S source of immunogen for the development of antibody substances specifically immunoreactive with PAF-AH. Host cells of the invention are conspicuously useful in methods for the large scale production of PAF-AH wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.
A non-immunological method contemplated by the invention for purifying PAF-AH from plasma includes the following steps: (a) isolating low density lipoprotein particles; (b) solubilizing said low density lipoprotein particles in a buffer comprising IOmM CHAPS to generate a first PAF-AH errayme solution;
(c) applying said first PAF-AH enzyme solution to a DEAF anion exchange column;
(d) washing said DEAF anion exchange column using an approximately pH 7.5 buffer comprising 1mM CHAPS; (e) eluting PAF-AH enzyme from said DEAF anion exchange column in fractions using approximately pH 7.5 buffers comprising a gradient of 0 to 0.5 M NaCI; (f) pooling fractions eluted from said DEAF anion exchange column having PAF-AH enzymatic activity; (g) adjusting said pooled, active fractions from said DEAF anion exchange column to lOmM CHAPS to generate a second PAF-AH enzyme solution; (h) applying said second PAF-AH enzyme solution to a blue dye ligand affinity column; (i) eluting PAF-AH enzyme from said blue dye ligand affinity column using a buffer comprising lOmM CHAPS and a chaotropic salt;
(j) applying the eluate from said blue dye ligand affinity column to a Cu ligand affinity column; (k) eluting PAF-AH enzyme from said Cu ligand aff nity column using a buffer comprising IOmM CHAPS and imidazole; (1) subjecting the eluate from said Cu figand affinity column to SDS-PAGE; and (m) isolating the approximately 44 kDa PAF-AH enzyme from the SDS-polyacrylamide gel.
Preferably, the buffer of step (b) is 25 mM Tris-HCI, IOmM CHAPS, pH 7.5; the buffer of step (d) is 25 mM Tris-HCI, 1mM CHAPS; the column of step (h) is a Blue Sepharose Fast Flow*column; the buffer of step (i) is 25mM Tris-HCI, IOmM
*Trade-mark I i~ I

CHAPS, 0.5M KSCN, pH 7.5; the column of step (j) is a Cu Chelating Sepharose column; and the buffer of step (k) is 25 mM Tris-HCI, lOmM CHAPS; 0.5M NaCI, 50mM imidazole at a pH in a range of about pH 7.5-8Ø
A method contemplated by the invention for purifying enzymatically-active PAF-AH from E. coli producing PAF-AH includes the steps of: (a) preparing a centrifugation supernatant from lysed E. coli producing PAF-AH enzyme; (b) applying said centrifugation supernatant to a blue dye ligand affinity column;
(c) eluting PAF-AH enzyme from said blue dye ligand affinity column using a buffer comprising lOmM CHAPS and a chaotropic salt; (d) applying said eluate from said blue dye ligand affinity column to a Cu Iigand affinity column; and (e) eluting PAF-AH enzyme from said Cu )rgand affinity column using a buffer comprising lOmM
CHAPS and imidazole. Freferably, the column of step (b) is a Blue Sepharose Fast Flow ~ column; the buffer of step (c) is 25mM Tris-HCI, lOmM CHAPS, 0.5M
KSCN, pH 7.5; the column of step (d) is a Cu Chelating Sepharose column; and the buffer of step (e) is 25mM Tris-HCI, l OmM CHAPS, 0.5M NaCI, 100mM imidazole, pH 7.5.
Another method contemplated by the invention for purifying enzymatically-active PAF-AH from E. coli producing PAF-AH includes the steps of:
(a) preparing a centrifugation supernatant from lysed E. coli producing PAF-AH
enzyme; (b) diluting said centrifugation supernatant in a low pH buffer comprising IOmM CHAPS; (c) applying said diluted centrifugation supernatant to a cation exchange column equilibrated at about pH 7.5; (d) eluting PAF-AH enzyme from said cation exchange column using 1M salt; (e) raising the pH of said eluate from said canon exhange column and adjusting the salt concentration of said eluate to about 0.5M salt; (f) applying said adjusted eluate from said cation exchange column to a blue dye ligand affinity column; (g) eluting PAF-AH enzyme from said blue dye ligand affinity column using a buffer comprising about 2M to about 3M salt;
and (h) dialyzing said eluate from said blue dye ligand affinity column using a buffer comprising about 0.1 ~ Tween Preferably, the buffer of step (b) is 25mM MES, l OmM CHAPS, 1 mM EDTA, pH 4.9; the column of step (c) is an S sepharose column equilibrated in 25mM MES, lOmM CHAPS, 1mM EDTA, 50mM NaCI, pH

5.5; PAF-AH is eluted in step (d) using 1mM NaCI; the pH of the eluate in step (e) *Trade-mark is adjusted to pH ?.5 using 2M Tris base; the column in step (f) is a sepharose column; the buffer in step (g) is 25mM Tris, lOmM CHAPS, 3M NaCI, 1mM
EDTA, pH 7.5; and the buffer in step (h) is 25mM Tris, 0.5M NaCI, 0.1 % Tween 80, pH 7.5.
Still another method contemplated by the invention for purifying enzymatically-active PAF-AH from E. coli includes the steps of: (a) preparing an E. coli extract which yields solubilized PAF-AH supernatant after lysis in a buffer containing CHAPS; (b) dilution of said supernatant and application to a anion exchange column equilibrated at about pH 8.0; (c) eluting PAF-AH enzyme from said anion exchange column; (d) applying said adjusted eluate from said anion exchange column to a blue dye ligand affinity column; (e) eluting the said blue dye ligand affinity column using a buffer comprising 3.OM salt; (f) dilution of the blue dye eluate into a suitable buffer for performing hydroxylapatite chromatography;
(g) performing hydroxylapatite chromatography where washing' and elution is accomplished using buffers (with or without CHAPS); . (h) diluting said hydroxylapatite eluate to an appropriate salt concentration for canon exchange chromatography; (i) applying said diluted hydroxylapatite eluate to a ration exchange column at a pH ranging between approximately 6.0 to 7.0; (j) elution of PAF-AH
from said ration exchange column with a suitable formulation buffer; (k) performing ration exchange chromatography in the cold; and (1) formulation of PAF-AH in liquid or frozen form in the absence of CHAPS.
Preferably in step (a) above the lysis buffer is 25mM Tris, 100mM
NaCI, 1mM EDTA, 20mM CHAPS, pH 8.0; in step (b) the dilution of the supernatant for anion exchange chromatography is 3-4 fold into 25mM Tris, 1mM
EDTA, lOmM CHAPS, pH 8.0 and the column is a Q-Sepharose column equilibrated with 25mM Tris, 1mM EDTA, 50mM NaCI, IOmM CHAPS, pH 8.0; in step (c) the anion exchange column is eluted using 25mM Tris, 1mM EDTA, 350mM NaCI, IOmM CHAPS, pH 8.0; in step (d) the eluate from step (c) is applied directly onto a blue dye affinity column; in step (e) the column is eluted with 3M NaCI, lOmM
CHAPS, 25mM Tris, pH 8.0 buffer; in step (f) dilution of the blue dye eluate for hydroxylapatite chromatography is accomplished by dilution into lOmM sodium phosphate, 100mM NaCI, lOmM CHAPS, pH 6.2; in step (g) hydroxylapatite *Trade-mark II I

_g_ chromatography is accomplished using a hydroxylapatite column equilibrated with IOmM sodium phosphate, 100mM NaCI, IOmM CHAPS and elution is accomplished using SOmM sodium phosphate, 100mM NaCI (with or without) lOmM CHAPS, pH
7.5; in step (h) ~ dilution of said hydroxylapatite eluate for ration exchange chromatography is accomplished by dilution into a buffer ranging in pH from approximately 6.0 to 7.0 comprising sodium phosphate (with or without CHAPS);
in step (i) a S Sepharose column is equilibrated with SOmM sodium phosphate, (with or without) lOmM CHAPS, pH 6.8; in step (j) elution is accomplished with a suitable formulation buffer such as potassium phosphate SOmM, l2.SmM aspartic acid, I25mM NaCI, pH 7.5 containing 0.01 ~ Tween-80; and in step {k) ration exchange chromatrography is accomplished at 2-8' C. Examples of suitable formulation buffers for use in step (1) which stabilize PAF-AH include SOmM potassium phosphate, l2.SmM Aspartic acid, 125mM NaCI pH 7.4 (approximately, with and without the addition of Tween-80 and or Pluronic F68) or 25mM potassium phosphate buffer containing (at least) 125mM NaCI, 25mM arginine and 0.01 ~ Tween-80 (with or without Pluronic F6~ at approximately 0.1 and 0.5 ~o).
Yet another method contemplated by the invention for purifying enzymatically active rPAF-AH products from E. roll includes the steps of: (a) preparing an E. roll extract which yields solubilized rPAF-AH product supernatant after lysis in a buffer containing Triton X-100, (b) dilution of said supernatant and application to an immobilized metal affinity exchange column equilibrated at about pH 8.0; (c) eluting rPAF-AH product from said immobilized metal affinity exchange column with a buffer comprising imidazole; (d) adjusting the salt concentration and applying said eluate from said immobilized metal affinity column to an hydrophobic interaction column (HIC#1); (e) eluting said HIC#1 by reducing the salt concentration and/or increasing the detergent concentration; (f) titrating said HIC#1 eluate to a pH
of about 6.4; (g) applying said adjusted HIC#1 eluate to a ration exchange column (CF.X#I) equilibrated at about pH 6.4; (h) eluting said.CEX#1 with concentration?
sodium chloride; (i) adjusting said CEX#1 eluate with sodium chloride to a concentration of about 2.OM; (j) applying said adjusted CEX#I eluate to a hydrophobic interaction column (HIC#2) equilibrated at about pH 8.0 and about 2.OM
sodium chloride; (k) eluting said HIC#2 by reducing the salt concentration andlor *Trade-mark I

increasing the detergent concentration; (1) diluting said HIC/!2 eluate and adjusting to a pH of about 6.0; (m) applying said adjusted HIC//2 eluate to a ration exchange column (CEX#2) equilibrated at about pH 6.0; (n) eluting the rPAF-AH product from said CEX//2 with a suitable formulation buffer.
Preferably, in step (a) above the lysis buffer is .90mM TRIS, 0.125 %
Triton X-100, 0.6M NaCI, pH 8.0, and lysis is carried out in a high pressure homogenizer; in step (b) the supernatant is diluted into equilibration buffer (20mM
TRIS, O.SM NaCI, 0.196 Triton X-100, pH 8.0), a zinc chelate column (Chelating Sepharose Fast Flow, Pharmacia, Uppsala, Sweden) is charged, equilibrated with . equilibration buffer, loaded with the diluted supernatant, and washed with 20mM
TRIS, O.SM NaCI, 4M urea, 0.196 Triton X-100, pH 8.0, followed by washing with 20mM TRIS, O.SM NaCI, 0.02 % Triton X-100, pH 8.0; in step (c) elution is accomplished with 20mM Tris, SOmM imidazole, 0.02 % Triton X-100, pH 8.0; in step (d) the eluate is adjusted to 1 mM EDTA and 2M NaCI, a Phenyl Scphamse 6 Fast Flow (Pharmacia) is equilibrated with equilibration buffer (2.OM NaCI, 25mM
Tris, 0.02 % Triton X-100, pH 8.0), loaded with the adjusted eluate from step (c) at room temperature, washed with equilibration buffer, arid washed with 25mM
NaP04, 0.02 % Triton X-100, pH6.5 at a flow rate of 34cm/hr; in step (e) elution is accomplished with 25mM NaP04, 3 96 Triton X-100, pH 6.5; in step (g) a Macro-Prep High S Column (Bio-Rad Labs, Richmond, CA) is equilibrated with equilibration buffer (20mM NaP04, 0.02 9b Triton X-100, pH 6.4), loaded with the adjusted eluate from step (f), washed with equilibration buffer, and washed with 25mM Tris, 0.02 % Triton X-100, pH 8.0; in step (h) elution is accomplished with 25mM Tris, 0.02 f6 Triton X-100, 1.3M NaCI, pH 8.0; in step (j) a Bakerbond Wide Pore Hi-Propyl C3 (Baker, Phillipsburg, Nn is equilibrated with equilibration buffer (2.OM NaCI, 25mM Tris, 0.02 % Triton X-100, pH 8.0), loaded with adjusted eluate from step (i) at room temperature, washed with equilibration buffer, and washed with 25mM Tris, 0.02 % Triton X-100, pH 8.0 at 30 cm/hr; in step (k) elution is accomplished with l OmM Tris, 3.0 % Triton X-100, pH 8.0; in step (1) dilution is in:o equilibration buffer (20mM succinate, 0.1 % PLURONIC F68, pH 6.0); in step (m) a SP Sepharose Fast Flow (Pharmacia) column is equilibrated with the equilibration buffer of step (1), loaded with eluate from step (I), and washed with equilibration *Trade-mark i buffer; and in step (n) elution is accomplished with SOmM NaP04, 0.7M NaCI, 0.1 PLURONIC F68, 0.02 % TWEEN 80, pH 7.5.
PAF-AH products may be obtained as isolates from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving procaryotic or eucaryotic host cells of the invention.
PAF-AH
products having part or all of the amino acid sequence set out in SEQ ID NO: 8 are contemplated. Specifically contemplated are fragments lacking up to the first twelve N-terminal amino acids of the mature human PAF-AH amino acid sequence set out in SEQ ID NO: 8, particularly those having Met46, A1a47 or A1a48 of SEQ ID NO:
8 as the initial N-terminal amino acid. Also contemplated are fragments thereof lacking up to thirty C-terminal amino acids of the amino acid sequence of SEQ
ID
NO: 8, particularly those having I1e429 and Leu431 as the C-terminal residue.
Further contemplated are variants of PAF-AH or PAF-AH or which have an amino acid replacement in the sequence of SEQ ID NO: 8 selected from the group consisting of S 108 A, S 273 A, D 286 A, D 286 N, D 296 A, D 304 A, D 338 A, H 351 A, H 395 A, H 399 A, C 67 S, C 229 S, C 291 S, C 334 S, C 407 S, D 286 A, D 286 N and D 304 A. As noted above, polynucleotides (including DNA) encoding such fragments or variant fragments are provided by the invention, as well as methods of recombinantly producing such fragments or variants by growing host cells comprising such DNA. Presently preferred PAF-AH products include the prokaryotic polypeptide expression products of DNA encoding amino acid residues Met46 through Asn441 of SEQ ID NO: 8, designated rPH.2, and the prokaryotic polypeptide expression products of DNA encoding amino acid residues Met46 through I1e429 of SEQ ID NO: 8, designated rPH.9. Both the rPH.2 and rPH.9 products display less amino-terminal heterogeneity than, for example, the corresponding prokaryotic expression products of DNA encoding the full mature sequence of PAF-AH
preceded by a translation initiation codon. Moreover, the rPH.9 product displays greater carboxy terminal homogeneity (consistency). The use of mammalian host cells is expected to provide for such post-translational modifications (e.g., myristolation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. PAF-AH products of the invention may be full length polypeptides, fragments or variants. Variants may comprise PAF-AH analogs wherein one or more of the specified (i. e. , naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss of one or more of the enzymatic activities or immunological characteristics specific to PAF-AH; or (2) with specific disablement of a particular biological activity of PAF-AH. Proteins or other molecules that bind to PAF-Al;i may be used to modulate its activity.
Also comprehended by the present invention are antibody substances (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins specific for PAF-AH. Specifically illustrating binding proteins of the invention are the monoclonal antibodies produced by hybridomas 90G 11 D and 90F2D which were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 on September 30, 1994 and were respectively assigned Accession Nos. HB 11724 and HB 11725. Also illustrating binding proteins of the invention is the monoclonal antibody produced by hybridoma I43A which was deposited with the ATCC on June 1, 1995 and assigned Accession No. HB 11900.
Proteins or other molecules (e.g., lipids or small molecules) which specifically bind to PAF-AH can be identified using PAF-AH isolated from plasma, recombinant PAF-AH, PAF-AH variants or cells expressing such products. Binding proteins are useful, in turn, in compositions for immunization as well as for purifying PAF-AH, and are useful for detection or quantification of PAF-AH in fluid and tissue samples by known immunologicai procedures. Anti-idiotypic antibodies specific for PAF-AH-specific antibody substances are also contemplated.
The scientific value of the information contributed through the disclosures of DNA and amino acid sequences of the present invention is manifest.
As one series of examples, knowledge of the sequence of a cDNA for PAF-AH
makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences encoding PAF-AH and specifying PAF-AH expression control regulatory sequences such as promoters, operators and the like. DNA/DNA hybridization procedures carned out with DNA sequences of the invention under conditions of stringency standard in the art are likewise expected to allow the isolation of DNAs encoding WO 99!09147 PCTIUS97114212 allelic variants of PAF-AH, other structurally related proteins sharing one or more of the biochemical and/or immunological properties of PAF-AH, and non-human species proteins homologous to PAF-AH. The DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout" strategies [see, e.g., Kapecchi, Science, 244:

(1989)], of rodents that fail to express a functional PAF-AH enzyme or that express a variant PAF-AH enzyme. Polynucleotides of the invention when suitably labelled are useful in hybridization assays to detect the capacity of cells to synthesize PAF-AH. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alterations) in the PAF-AH locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of PAF-AH by those cells which ordinarily express the same.
Administration of PAF-AH preparations of the invention to mammalian subjects, especially humans, for the purpose of ameliorating pathological inflammatory conditions is contemplated. Based on implication of the involvement of PAF in pathological inflammatory conditions, the administration of PAF-AH
is indicated, for example, in treatment of asthma [Miwa et al., J. Clin. Invest., 82:
1983-1991 (1988); Hsieh et al., J. Allergy Clin. Immunol., 91: 650-657 (1993);
and Yamashita et al., Allergy, 49: 60-63 (1994)], anaphylaxis [Venable et al., supra], shock [Venable et al., supra], reperfusion injury and central nervous system ischemia [Lindsberg et al. (1991), supra], antigen-induced arthritis [Zarco et al., Clin. Exp.
Immunol. , 88: 318-323 (1992)], atherogenesis [Handley et al. , Drug Dev. Res.
, 7:
361-375 (1986)], Crohn's disease [Denizot et al., Digestive Diseases and Sciences, 37(3): 432-437 (1992)], ischemic bowel necrosis/necrotizing enterocolitis [Denizot et al., supra and Caplan et al., Acta Paediatr., Suppl. 396: 11-17 (1994)], ulcerative colitis (Denizot et al., supra), ischemic stroke [Satoh et al., Stroke, 23:

(1992)], ischemic brain injury [Lindsberg et al., Stroke, 21: 1452-1457 (1990) and Lindsberg et al. (1991), supra], systemic lupus erythematosus [Matsuzaki et al., Clinica Chimica Acta, 210: 139-144 (1992)], acute pancreatitis [Kald et al., Pancreas, 8(4): 440-442 (1993)], septicemia (Kald et al., supra), acute post streptococcal glomerulonephritis [Mezzano et al. , J. Am. Soc. Nephrol. , 4:

WO 99/09147 PCTIUS97/142t2 (1993)], pulmonary edema resulting from IL-2 therapy [Rabinovici et al., J.
Clin.
Invest., 89: 1669-1673 (1992)], allergic inflammation [Watanabe et al., Br. J.
Pharmacol., 111: 123-130 (1994)], ischemic renal failure [Grino et al., Annals of Internal Medicine, 121(5): 345-347 (1994); preterm labor [Hoffman et al., Am.
J.
S Obstet. Gynecol. , 162(2): 525-528 ( 1990) and Maki et al. , Proc. ll~atl.
Acad. Sci.
USA, 85: 728-732 (1988)]; adult respiratory distress syndrome [Rabinovici et al., J.
Appl. Physiol., 74(4): 1791-1802 (1993); Matsumoto et al., Clin. Fxp.
Pharmacol.
Physiol., 19 509-SIS (1992); and Rodriguez-Roisin et al., J. Clin. Invest., 93: 188-194 (1994)]. Also contemplated is the use of PAF-AH preparations to treat human immunodeficiency virus (HIV) infection of the central nervous system.
"Treatment"
as used herein includes both prophylactic and therapeutic treatment.
Animal models for many of the foregoing pathological conditions have been described in the art. For example, a mouse model for asthma and rhinitis is described in Example 16 herein; a rabbit model for arthritis is described in Zarco et at. , supra; rat models for ischemic bowel necrosislnecrotizing enterocolitis are described in Furukawa et al., Ped. Res., 34,(2): 237-241 (1993) and Caplan et al., supra; a rabbit model far stroke is described in Lindsberg et al., (1990), supra; a mouse model for lupus is described in Matsuzaki et al., supra; a rat model for acute pancreatitis is described in Kald et al., supra: a rat model for pulmonary edema resulting from IL-2 therapy is described in Rabinovici et al., supra; a rat model of allergic inflammation is described in Watanabe et al. , supra); a canine model of renal allograft is described in Watson etal., Transplantation, 56(4): 1047-1049 (1993); and rat and guinea pig models of adult respiratory distress syndrome are respectively described in Rabinovici et al., supra. and Lellouch-Tubiana, Am. Rev. Respir.
Dis., 137: 948-954 (1988).
Specifically contemplated by the invention are PAF-AH compositions for use in methods for treating a mammal susceptible to or suffering from PAF-mediated pathological conditions comprising administering PAF-AH to the mammal in an amount sufficient to supplement endogenous PAF-AH activity and to inactivate pathological amounts of PAF in the mammal.
Therapeutic/pharmaceutical compositions contemplated by the invention include PAF-AH products and a physiologically acceptable diluent or Garner and may also include other agents having anti-inflammatory effects. Dosage amounts indicated would be sufficient to supplement endogenous PAF-AH activity and to inactivate pathological amounts of PAF. For general dosage considerations see Remmington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co., Easton, PA (1990).
Dosages will vary between about 0.1 to about 1000 tcg PAF-AHlkg body weight.
Therapeutic compositions of the invention may be administered by various routes depending on the pathological condition to be treated. For example, administration may be by intraveneous, subcutaneous, oral, suppository, and/or pulmonary routes.
For pathological conditions of the lung, administration of PAF-AH by the pulmonary route is particularly indicated. Contemplated for use in pulmonary administration are a wide range of delivery devices including, for example, nebulizers, metered dose inhalers, and powder inhalers, which are standard in the art.
Delivery of various proteins to the lungs and circulatory system by inhalation of aerosol formulations has been described in Adjei et al., Pharm. Res., 7(6):

(1990) (leuprolide acetate); Braquet et al., J. Cardio. Pharm., 13(Supp. 5):
s. 143-146 (1989) (endothelin-1); Hubbard et al., Annals of Internal Medicine, Ill(3), 206-212 (1989) (al-antitrypsin); Smith et al., J. Clin. Invest., 84: 1145-1146 (1989) (a-1-proteinase inhibitor); Debs er al. , J. Immunol., 140: 3482-3488 (1933) (recombinant gamma interferon and tumor necrosis factor alpha); Patent Cooperation Treaty (PCT) International Publication No. WO 94/20069 published September 15, 1994 (recombinant pegylated granulocyte colony stimulating factor).
BRIEF DESCRIPTION OF THE DRAWING
Numerous other aspects and advantages of the present invention will be apparent upon consideration of the following detailed description thereof, reference being made to the drawing wherein:
FIGURE 1 is a photograph of a PVDF membrane containing PAF-AH
purified from human plasma;
FIGURE 2 is a graph showing the enzymatic activity of recombinant human plasma PAF-AH;
FIGURE 3 is a schematic drawing depicting recombinant PAF-AH
fragments and their catalytic activity;

FIGURE 4 depicts mass spectroscopy results for a recombinant PAF-AH product, rPH.2.
FIGURE 5 depicts mass spectroscopy results for a recombinant PAF-AH product, rPH.9.
FIGURE 6 is a bar graph illustrating blockage of PAF-induced rat foot edema by locally administered recombinant PAF-AH of the invention;
FIGURE 7 is a bar graph illustrating blockage of PAF-induced rat foot edema by intravenously administered PAF-AH;
FIGURE 8 is a bar graph showing that PAF-AH blocks PAF-induced edema but not zymosan A-induced edema;
FIGURES 9A and 9B present dose response results of PAF-AH anti-inflammatory activity in rat food edema;
FIGURES l0A and lOB present results indicating the in vivo efficacy of a single dose of PAF-AH over time;
FIGURE 11 is a line graph representing the pharmacokinetics of PAF-AH in rat circulation; and FIGURE i2 is a bar graph showing the anti-inflammatory effects of PAF-AH in comparison to the lesser effects of PAF antagonists in rat foot edema.
FIGURE 13 presents results indicating that PAF-AH neutralizes the apoptotic effects of conditioned media from HIV-I-infected and activated monocytes.
DETAILED DESCRIPTION
The following examples illustrate the invention. Example i presents a novel method for the purification of PAF-AH from human plasma. Example 2 describes amino acid microsequencing of the purified human plasma PAF-AH. The cloning of a full length cDNA encoding human plasma PAF-AH is described in Example 3. Identification of a putative splice variant of the human plasma PAF-AH
gene is described in Example 4. The cloning of genomic sequences encoding human plasma PAF-AH is described in Example 5. Example 6 desribes the cloning of canine, murine, bovine, chicken, rodent and macaque cDNAs homologous to the human plasma PAF-AH cDNA. Example 7 presents the results of an assay evidencing the enzymatic activity of recombinant PAF-AH transiently expressed in COS 7 cells. Example 8 describes the expression of full length, truncated and chimeric human PAF-AH DNAs in E. coli, S. cerevisiae and mammalian cells.
Example 9 presents protocols for purification of recombinant PAF-AH from E.
coli and assays confirming its enzymatic activity. Example 10 describes various recombinant PAF-AH products including amino acid substitution analogs and amino and carboxy-truncated products, and describes experiments demonstrating that native PAF-AIi isolated from plasma is glycosylated. Results of a Northern blot assay for expression of human plasma PAF-AH RNA in various tissues and cell lines are presented in Example I1 while results of in situ hybridization are presented in Example 12. Example 13 describes the development of monoclonal and polyclonal antibodies specific for human plasma PAF-AH. Examples 14, 15, 16, 17, 18 and respectively describe the in vivo therapeutic effect of administration of recombinant PAF-AH products of the invention on acute inflammation, pleurisy, asthma, necrotizing enterocolitis, adult respiratory distress syndrome and pancreatitis in animal models. Example 20 describes the in vitro effect of recombinant PAF-AH
product on neurotoxicity associated with HIV infection. Example 21 presents the results of immunoassays of serum of human patients exhibiting a deficiency in PAF-AH activity and describes the identification of a genetic lesion in the patients which is apparently responsible for the deficiency.
Example 1 PAF-AH was purified from human plasma in order to provide material for amino acid sequencing.
A. Optimization of Purification Conditions Initially, low density lipoprotein (LDL) particles were precipitated from plasma with phosphotungstate and solubilized in 0.1 % Tween 20 and subjected to chromatography on a DEAF column (Pharmacia, Uppsala, Sweden) according to the method of Stafforini et al. (1987), supra, but inconsistent elution of PAF-AH
activity from the DEAE column required reevaluation of the solubilization and subsequent puriflcatian conditions.

Tween 20, CHAPS (Pierce Chemical Co., Rocl~ord, IL) and octyl glucoside were evaluated by centrifugation and gel filtration chromatography for their ability to solubilize LDL particles. CHAPS provided 25 ~b greater recovery of solubilized activity than Tween 20 and 300 ~ greater recovery than ocxyl glucoside.
LDL precipitate solubilized with lOmM CHAPS was then fractionated on a DBAE
Sepharose Fast Flow column (an anion exchange column; Pharmacia) with buffer containing 1 mM CHAPS to provide a large pool of partially purified PAF-AH
("the DEAF pool") for evaluation of additional columns. .
The DEAF pool was used as starting material to test a variety of chromatography columns for utility in further purifying the PAF-AH activity.
The columns tested included: Blue Sepharose Fast FlovV (Pharmacia), a dye ligand affinity column; S-Sepharose Fast Flov~i (Pharmacia), a ration exchange column; Cu Chelating Sepharose (Pharmacia), a metal ligand affinity column; Practogel S
(EM
Separations, Gibbstown, N~, a ration exchange column; and Sephacryl-20Q
(Pharmacia), a gel filtration column. These chromatographic procedures all yielded low, unsatisfactory levels of purification when operated in 1mM CHAPS.
Subsequent gel filtration chromatography on Sephacryl S-200 in 1mM CHAPS generated an enzymatically active fraction which eluted over a broad size range rather than the expected 44 kDa approximate size. Taken together, these results indicated that the LDL proteins were aggregating in solution.
Different LDL samples were therefore evaluated by analytical gel filtration chromatography for~aggregation of the PAF-AH activity. Samples from the DEAF pool and of freshly solubilized LDL precipitate were analyzed on Superose (Pharmacia) equilibrated in buffer with 1mM CHAPS. Both samples eluted over a very broad range of molecular weights with most of the activity eluting above kDa. When the samples were then analyzed on Superose 12 equilibrated with lOmM
CHAPS, the bulls of the activity eluted near 44 kDa as expected for PAF-AH
activity.
However, the samples contained some PAF-AH activity in the high molecular weight region corresponding to aggregates.
Other samples eluted PAF-AH activity exclusively in the approximately 44 kDa range when they were subsequently tested by gel filtration. These samples were an LDL precipitate solubilized in IOmM CHAPS in the presence of O.SM NaCI
*Trade-mark _I8_ and a fresh DEAF pool that was adjusted to lOmM CHAPS after elution from the DEAF column. These data indicate that at least lOmM CHAPS is required to maintain non-aggregated PAF-AH. Increase of the CHAPS concentration from 1mM
to lOmM after chromatography on DEAF but prior to subsequent chromatographic steps resulted in dramatic differences in purification. For example, the degree of PAF-AH purification on S-Sepharose Fast Flow was increased from 2-fold to 10-fold.
PAF-AH activity bound the Blue Sepharose Fast Flow column irreversibly in 1mM
CHAPS, but the column provided the highest level of purification in lOmM
CHAPS.
The DEAF chromatography was not improved with prior addition of lOmM CHAPS.
Chromatography on Cu Chelating Sepharose after the Blue Sepharose Fast Flow column concentrated PAF-AH activity 15-fold. It was also determined that PAF-AH activity could be recovered from a reduced SDS-polyacrylamide gel, as long as samples were not boiled. The activity of material eluted from the Cu Chelating Sepharose column when subjected to SDS-polyacrylamide gel electrophoresis coincided with a major protein band when the gel was silver stained.
B. PAF-AH Purification Protocol The novel protocol utilized to purify PAF-AH for amino acid sequencing therefore comprised the following steps which were performed at 4°C.
Human plasma was divided into 900 ml aliquots in 1 liter Nalgene bottles and adjusted to pH 8.6. LDL particles were then precipitated by adding 90 mI of 3.
85 %
sodium phosphotungstate followed by 23 ml of 2M MgCl2. The plasma was then centrifuged for 15 minutes at 3600 g. Pellets were resuspended in 800 ml of 0.2 sodium citrate. LDL was precipitated again by adding 10 g NaCI and 24 ml of 2M
MgCl2. LDL particles were pelleted by centrifugation for 15 minutes at 3600 g.
This wash was repeated twice. Pellets were then frozen at -20°C. LDL
particles from SL of plasma were resuspended in 5 L of buffer A (25mM Tris-HCI, IOmM
CHAPS, pH 7.5) and stirred overnight. Solubilized LDL particles were centrifuged at 3600 g for 1.5 hours. Supernatants were combined and filtered with Whatman filter paper to remove any remaining solids. Solubilized LDL supernatant was loaded on a DEAF Sepharose Fast Flow column (11 cm x 10 cm; 1 L resin volume; 80 ml/minute) equilibrated in buffer B (25mM Tris-HCI, ImM CHAPS, pH 7.5). The I I~ I

column was washed with buffer B until absorbance returned to baseline. Protein was eluted with an 8 L, 0 - 0.5M NaCl gradient and 480 ml fractions were collected.
This step was necessary to obtain binding to the Blue Sepharose Fast Flow column below. Fractions were assayed for acetylhydrolase activity essentially by the method described in Example 4.
Active fractions were pooled and sufficient CHAPS was added to make the pool about 1 OmM CHAPS . The DEAF pool was loaded overnight at 4 mUminute onto a Blue Sepharose Fast Flow column (5 cm x 10 cm; 200 ml bed volume) equilibrated in buffer A containing 0.5M NaCI. The column was washed with the equilibration buffer at 16 ml/minute until absorbance returned to baseline.
PAF-AH
activity was step eluted with buffer A containing 0.5M KSCN (a chaotmpic salt) at 16 ml/minute and collected in 50 ml fractions. This step resulted in greater than 1000-fold purification. Active fractions were pooled, and the pool was adjusted to pH
8.0 with I M Tris-HCl pH 8Ø The active pool from Blue Sepharose Fast Flow chromatography was loaded onto a Cu Chelating Sepharose column (2.5 cm x 2 cm;
10 ml bed volume; 4 ml/minute) equilibrated in buffer C [25mM Tris-HCI, lOmM
CHAPS, 0.5M NaCI, pH 8.0 (pH 7.5 also worked)], and the column was washed with 50 ml buffer C. PAF-AH activity was eluted with 100 ml 50mM imidazole in buffer C and collected in 10 ml fractions. Fractions containing PAF-AH
activity were pooled and dialyzed against buffer A. In addition to providing a 15-fold concentration of PAF-AH activity, the Cu Chelating Sepharose column gave a small purification. The Cu Chelating Sepharose pool was reduced in 50 mM DTT for 15 minutes at 37°C and loaded onto a 0.75 mm, 7.5 R~ polyacrylamide gel.
Gel slices were cut every 0.5 cm and placed in disposable microfuge tubes containing 200 ~cl '25 25mM Tris-HCl, lOmM CHAPS, 150mM NaCI. Slices were ground up and allowed to incubate overnight at 4°C. The supernatant of each gel slice was then assayed for PAF-AH activity to determine which protein band on SDS-PAGE contained PAF-AH
activity. PAF-AH activity was found in an approximately 44 kDa band. Protein from a duplicate gel was electrotransferred to a PVDF membrane (Immobilon-P, Millipore) and stained with Coomassie Blue. A photograph of the PVDF membrane is presented in FIGURE 1.
*Trade-mark As presented in Table 1 below, approximately 200 ~g PAF-AH was purified 2 x 106-fold from 5 L human plasma. In comparison, a 3 x 104-fold purification of PAF-AH activity is described in Stafforini et al. (1987), supra.
Table 1 J~ Sample Vol.ActivityTotal Prot. Specific% RecoveryFold Purification ml (cpm ActivityConc. Activityof ActivityStep Cum.
x 1~ (cpm (mg/ (cpm Sten Cum.
x x 1~ ml~ 1~

Plasma 500023 116 62 0.37 100 100 1 I

LDL 450022 97 1.76 12 84 84 33 33 DEAF 420049 207 1.08 46 212 178 3.7 124 Blue 165 881 14 0.02 54200 70 126 1190 1.5 x Cu 12 12700 152 0.15 82200 104 I31 1.5 2.2 x SDS-PAGE --- --- --- --- --- --- --- ~ 2.2 10 x In summary, the following steps were unique and critical for successful purification of plasma PAF-AH for microsequencing: {1) solubilization and chromotography in IOmM CHAPS, (2) chromatography on a blue ligand affinity column such as Blue Sepharose Fast Flow, (3) chromatography on a Cu ligand affinity column such as Cu Chelating Sepharose, and (4) elution of PAF-AH from SDS-PAGE.
Example 2 For amino acid sequencing, the approximately 44 kDa protein band from the PAF-AH- containing PVDF membrane described in Example 1 was excised and sequenced using an Applied Biosystems 473A Protein sequencer. N-terminal sequence analysis of the approximately 44 kDa protein band corresponding to the PAF-AH activity indicated that the band contained two major sequences and two minor sequences. The ratio of the two major sequences was 1:1 and it was therefore difficult to interpret the sequence data.

To distinguish the sequences of the two major proteins which had been resolved on the SDS gel, a duplicate PVDF membrane containing the approximately 44 kDa band was cut in half such that the upper part and the lower part of the membrane were separately subjected to sequencing.
The N-terminal sequence obtained for the lower half of the membrane was:
SEQ ID NO: 1 FKDLGEENFKALVLIAF
A search of protein databases revealed this sequence to be a fragment of human serum albumin. The upper half of the same PVDF membrane was also sequenced and the N-terminal amino acid sequence determined was:
SEQ ID NO: 2 IQVLMAAASFGQTKIP
This sequence did not match any protein in the databases searched and was different from the N-terminal amino acid sequence:
SEQ ID NO: 3 MKPLVVFVLGG
which was reported for erythrocyte cytoplasmic PAF-AH in Stafforini et al.
(1993), supra. The novel sequence (SEQ ID NO: 2) was utilized for cDNA cloning of human plasma PAF-AIi as described below in Example 3.
Example 3 A full length clone encoding human plasma PAF-AH was isolated from a macrophage cDNA library.
A. Construction of a Macrophage cDNA LibrarX
Poly A+ RNA was harvested from peripheral blood monocyte-derived macrophages. Double-stranded, blunt-ended cDNA was generated using the Invitrogen Copy Kit (San Diego, CA) and BstXI adapters were ligated to the cDNA
prior to insertion into the mammalian expression vector, pRcICMV (Invitrogen).
The resulting plasmids were introduced into E. coli strain XL-1 Blue by electroporation.
Transformed bacteria were plated at a density of approximately 3000 colonies per agarose plate on a total of 978 plates. Plasmid DNA prepared separately from each plate was retained in individual pools and was also combined into larger pools representing 300,000 clones each.
B. Library Screenin~by PCR
The macrophage library was screened by the polymerise chain reaction utilizing a degenerate antisense oligonucleotide PCR primer based on the novel N-terminal amino acid sequence described in Example 2. The sequence of the primer is set out below in IUPAC nomenclature and where "I" is an inosine.
SEQ ID NO: 4 5' ACATGAATTCGGIATCYTTIGTYTGICCRAA 3' The colon choice tables of Wada et al., Nuc. Acids Res., 195: 1981-1986 (1991) were used to select nucleotides at the third position of each colon of the primer. The primer was used in combination with a primer specific for either the SP6 or T7 promoter sequences, both of which flank the cloning site of pRc/CMV, to screen the macrophage library pools of 300,000 clones. All PCR reactions contained 100 ng of template cDNA, 1 ~cg of each primer, 0.125mM of each dNTP, lOmM Tris-HCl pH
8.4, SOmM MgCl2 and 2.5 units of Taq polymerise. An initial denaturation step of 94°C for four minutes was followed by 30 cycles of amplification of 1 minute at 94°C, 1 minute at 60°C and 2 minutes at 72°C. The resulting PCR product was cloned into pBluescript SK- (Stratagene, La Jolla, CA) and its nucleotide sequence determined by the dideoxy chain termination method. The PCR product contained the sequence predicted by the novel peptide sequence and corresponds to nucleotides 1 to 331 of SEQ ID NO: 7.
The PCR primers set out below, which are specific for the cloned PCR
fragment described above, were then designed for identifying a full length clone.
Sense Primer (SEQ ID NO: 5) 5' TATTTCTAGAAGTGTGGTGGAACTCGCTGG 3' Antisense Primer (SEQ ID NO: 6) 5' CGATGAATTCAGCTTGCAGCAGCCATCAGTAC 3' PCR reactions utilizing the primers were performed as described above to first screen the cDNA pools of 300,000 clones and then the appropriate subset of the smaller pools of 3000 clones. Three pools of 3000 clones which produced a PCR product of the expected size were then used to transform bacteria.
C. Liblanr Screenin~by Hybridization DNA from the transformed bacteria was subsequently screened by hybridization using the original cloned PCR fragment as a probe. Colonies were blotted onto nitrocellulose and prehybridized and hybridized in 50 %
formamide, 0.75M sodium chloride, 0.075M sodium citrate, O.OSM sodium phosphate pH 6.5, 1 % polyvinyl pyrolidine, 1 % Ficoll, 1 % bovine serum albumin and 50 ng/ml sonicated salmon sperm DNA. The hybridization probe was labeled by random hexamer priming. After overnight hybridization at 42°C, blots were washed extensively in 0.03M sodium chloride, 3mM sodium citrate, 0.1 % SDS at 42°C. The nucleotide sequence of 10 hybridizing clones was determined. One of the clones, clone sAH 406-3, contained the sequence predicted by the original peptide sequence of the PAF-AH activity purified from human plasma. The DNA and deduced amino acid sequences of the human plasma PAF-AH are set out in SEQ ID NOs: 7 and 8, respectively.
Clone sAH 406-3 contains a 1.52 kb insert with an open reading frame that encodes a predicted protein of 441 amino acids. At the amino terminus, a relatively hydrophobic segment of 4I residues precedes the N-terminal amino acid (the isoleucine at position 42 of SEQ ID NO: 8) identified by protein microsequencing. The encoded protein may thus have either a long signal sequence or a signal sequence plus an additional peptide that is cleaved to yield the mature functional enzyme. The presence of a signal sequence is one characteristic of secreted proteins. In addition, the protein encoded by clone sAH 406-3 includes the consensus GxSxG motif (amino acids 271-275 of SEQ ID NO: 8) that is believed to contain the active site serine of all known mammalian lipases, microbial lipases and serine proteases. See Chapus et al., Biochimie, 70: 1223-1224 (1988) and Brenner, Nature, 334: 528-530 (1988).
Table 2 below is a comparison of the amino acid composition of the human plasma PAF-AH of the invention as predicted from SEQ ID NO: 8 and the amino acid composition of the purportedly purified material described by Stafforini et al. (1987), supra.
Table 2 Clone sAH 406-3 Stafforini et al.

Ala 26 24 Asp & Asn 48 37 Cys 5 14 Glu & Gln 36 42 Phe 22 12 Gly 29 58 His 13 24 Ile 31 17 Lys 26 50 Leu 40 26 Met 10 7 Pro 15 11 Arg 18 16 Ser 27 36 Thr 20 15 Val 13 14 Trp 7 Not determined Tyr 14 13 The amino acid composition of the mature form of the human plasma PAF-AH of the invention and the amino acid composition of the previously purified material that was purportedly the human plasma PAF-AH are clearly distinct.
When alignment of the Hattori et al., supra nucleotide and deduced amino acid sequences of bovine brain cytoplasmic PAF-AH with the nucleotide and amino acid sequences of the human plasma PAF-AH of the invention was attempted, no significant structural similarity in the sequences was observed.

Example 4 A putative splice variant of the human PAF-AH gene was detected when PCR was performed on macrophage and stimulated PBMC cDNA using primers that hybridized to the 5' untranslated region (nucleotides 31 to 52 of SEQ ID
NO: 7) and the region spanning the translation termination codon at the 3' end of the PAF-AH cDNA (nucleotides 1465 to 1487 of SEQ ID NO: 7). The PCR reactions yielded two bands on a gel, one corresponding to the expected size of the PAF-AH cDNA
of Example 3 and the other was about 100 by shorter. Sequencing of both bands revealed that the larger band was the PAF-AH cDNA of Example 3 while the shorter band lacked exon 2 (Example 5 below) of the PAF-AH sequence which encodes the putative signal and pro-peptide sequences of plasma PAF-AH. The predicted catalytic triad and all cysteines were present in the shorter clone, therefore the biochemical activity of the protein encoded by the clone is likely to match that of the plasma enzyme.
To begin to assess the biological relevance of the PAF-AH splice variant that is predicted to encode a cytoplasmically active enzyme, the relative abundance of the two forms in blood monocyte-derived macrophages was assayed by RNase protection. Neither message was present in freshly isolated monocytes but both messages were found at day 2 of in vitro differentiation of the monocytes into macrophages and persisted through 6 days of culture. The quantity of the two messages was approximately equivalent throughout the differentiation period.
In contrast, similar analyses of neural tissues revealed that only full length message predicted to encode the full length extracellular form of PAF-AH is expressed.
Example 5 Genomic human plasma PAF-AIi sequences were also isolated. The structure of the PAF-AH gene was determined by isolating lambda and P1 phage clones containing human genomic DNA by DNA hybridization under conditions of high stringency. Fragments of the phage clones were subcloned and sequenced using primers designed to anneal at regular intervals throughout the cDNA clone sAH

3. In addition, new sequencing primers designed to anneal to the intron regions flanking the exons were used to sequence back across the exon-intron boundaries to confirm the sequences. Exon/intron boundaries were defined as the points where the genomic and cDNA sequences diverged. These analyses revealed that the human PAF-AH gene is comprised of 12 exons.
Exons 1, 2, 3, 4, 5, 6, and part of 7 were isolated from a male fetal placental library constructed in lamda FIX (Stratagene). Phage plaques were blotted onto nitrocellulose and prehybridized and hybridized in 50 % formamide, 0.75M
sodium chloride, 75mM sodium citrate, 50mM sodium phosphate (pH 6.5), 1 polyvinyl pyrolidine, 1 % Ficoll, 1 % bovine serum albumin, and 50 ng/ml sonicated salmon sperm DNA. The hybridization probe used to identify a phage clone containing exons 2-6 and part of 7 consisted of the entire cDNA clone sAH 406-3.
A clone containing exon 1 was identified using a fragment derived from the 5' end of the cDNA clone (nucleotides 1 to 312 of SEQ ID NO: 7). Both probes were labelled with 32P by hexamer random priming. After overnight hybridization at 42 ° C, blots were washed extensively in 30mM sodium chloride, 3mM
sodium citrate, 0.1 % SDS at 42 ° C. The DNA sequences of exons 1, 2, 3, 4, 5, and 6 along with partial surrounding intron sequences are set out in SEQ ID NOs: 9, 10, 11, 12, 13, and 14, respectively.
The remainder of exon 7 as well as exons 8, 9, 10, 11, and 12 were subcloned from a Pl clone isolated from a human P1 genomic library. P1 phage plaques were blotted onto nitrocellulose and prehybridized and hybridized in 0.75M
sodium chloride, 50mM sodium phosphate (pH 7.4), 5mM EDTA, 1 % polyvinyl pyrolidine, 1 % Ficoll, 1 % bovine serum albumin, 0.5 % SDS, and 0.1 mg/ml total human DNA. The hybridization probe, labeled with 32P by hexamer random priming, consisted of a 2.6 kb EcoRl fragment of genomic DNA derived from the 3' end of a lambda clone isolated above. This fragment contained exon 6 and the part of exon 7 present on the phage clone. After overnight hybridization at 65 ° C, blots were washed as described above. The DNA sequences of exons 7, 8, 9, 10, 11, and 12 along with partial surrounding intron sequences are set out in SEQ ID NOs:
15, 16, 17, 18, 19, and 20, respectively.

Example 6 Full length plasma PAF-AH cDNA clones were isolated from mouse, canine, bovine and chicken spleen cDNA libraries and a partial rodent clone was isolated from a rat thymus cDNA library. The clones were identified by low stringency hybridization to the human cDNA (hybridization conditions were the same as described for exons 1 through 6 in Example 5 above except that 20 %
formamide instead of 50 % formamide was used). A 1 kb HindIll fragment of the human PAF-AH sAH 406-3 cDNA clone (nucleotides 309 to 1322 of SEQ ID NO: 7) was used as a probe. In addition, a partial monkey clone was isolated from macaque brain cDNA by PCR using primers based on nucleotides 285 to 303 and 851 to 867 of SEQ
ID NO: 7. The nucleotide and deduced amino acid sequences of the mouse, canine, bovine, chicken, rat, and macaque cDNA clones are set out in SEQ ID NOs: 21, 22, 23, 24, 25, and 26, respectively.
A comparison of the deduced amino acid sequences of the cDNA
clones with the human cDNA clone results in the amino acid percentage identity values set out in Table 3 below.
Table 3 Human Dog Mouse Bovine Chicken Dog 80 100 64 82 50 Mouse 66 64 100 64 47 Monkey 92 82 69 80 52 Rat 74 69 82 69 55 Bovine 82 82 64 100 50 Chicken 50 50 47 50 100 About 38 % of the residues are completely conserved in all the sequences. The most divergent regions are at the amino terminal end (containing the signal sequence) and the carboxyl terminal end which are shown in Example 10 as not critical for enzymatic activity. The Gly-Xaa-Ser-Xaa-GIy motif (SEQ ID NO:
27) found in neutral lipases and other esterases was conserved in the bovine, canine, mouse, rat and chicken PAF-AH. The central serine of this motif serves as the active site nucleophile for these enzymes. The predicted aspartate and histidine components of the active site (Example l0A) were also conserved. The human plasma PAF-AH
of the invention therefore appears to utilize a catalytic triad and may assume the alai hydrolase conformation of the neutral lipases even though it does not exhibit other sequence homology to the lipases.
Moreover, human plasma PAF-AH is expected to have a region that mediates its specific interaction with the low density and high density lipoprotein particles of plasma. Interaction with these particles may be mediated by the N-terminal half of the molecule which has large stretches of amino acids highly conserved among species but does not contain the catalytic triad of the enzyme.
Example 7 To determine whether human plasma PAF-AH cDNA clone sAH 406-3 (Example 3) encodes a protein having PAF-AH activity, the pRcICMV expression construct was transiently expressed in COS 7 cells. Three days following transfection by a DEAF Dextran method, COS cell media was assayed for PAF-AH activity.
Cells were seeded at a density of 300,000 cells per 60 mm tissue culture dish. The following day, the cells were incubated in DMEM containing 0.5 mg/ml DEAF dextran, O.1mM chloroquine and 5-10 ~cg of plasmid DNA for 2 hours.
Cells were then treated with 10% DMSO in phosphate-buffered saline for 1 minute, washed with media and incubated in DMEM containing 10 % fetal calf serum previously treated with diisopropyl fluorophosphate (DFP} to inactivate endogenous bovine serum PAF-AH. After 3 days of incubation, media from transfected cells were assayed for PAF-AH activity. Assays were conducted in the presence and absence of either 10 mM EDTA or 1 mM DFP to determine whether the recombinant enzyme was calcium-independent and inhibited by the serine esterase inhibitor DFP
as previously described for plasma PAF-AH by Stafforini et al. (1987), supra.
Negative controls included cells transfected with pRc/CMV either lacking an insert or having the sAH 406-3 insert in reverse orientation.
PAF-AH activity in transfectant supernatants was determined by the method of Stafforini et al. (1990), supra, with the following modifications.
Briefly, PAF-AH activity was determined by measuring the hydrolysis of 3H-acetate from [acetyl-3H] PAF (New England Nuclear, Boston, MA). The aqueous free 3H-acetate was separated from labeled substrate by reversed-phase column chromatography over octadecylsilica gel cartridges (Baker Research Products, Phillipsburg, PA).
Assays were carned out using 10 ~cl transfectant supernatant in O.1M Hepes buffer, pH
7.2, in a reaction volume of 50 ~I. A total of 50 pmoles of substrate were used per reaction with a ratio of 1:5 labeled: cold PAF. Reactions were incubated for minutes at 37°C and stopped by the addition of 40 ~,1 of 10M acetic acid. The solution was then washed through the octadecylsilica gel cartridges which were then rinsed with O.1M sodium acetate. The aqueous eluate from each sample was collected and counted in a liquid scintillation counter for one minute. Enzyme activity was expressed in counts per minute.
As shown in FIGURE 2, media from cells transfected with sAH 406-3 contained PAF-AH activity at levels 4-fold greater than background. This activity was unaffected by the presence of EDTA but was abolished by 1mM DFP. These observations demonstrate that clone sAH 406-3 encodes an activity consistent with the human plasma enzyme PAF-AH.
Example 8 Full length and various truncated human plasma PAF-AH DNAs and a chimeric mouse-human PAF-AH DNA were expressed in E. coli and yeast and stably expressed in mammalian cells by recombinant methods.
A. Expression in E. coli PCR was used to generate a protein coding fragment of human plasma PAF-AH cDNA from clone sAH 406-3 which was readily amenable to subcloning into an E. coli expression vector. The subcloned segment began at the 5' end of the human gene with the codon that encodes I1e42 (SEQ ID NO: 8), the N-terminal residue of the enzyme purified from human plasma. The remainder of the gene through the native termination codon was included in the construct. The 5' sense PCR primer utilized was:

SEQ ID NO: 28 TATTCTAGAATTATGATACAAGTATTAATGGCTGCTGCAAG
3' and contained an XbaI cloning site as well as a translation initiation codon (underscored). The 3' antisense primer utilized was:
5 SEQ ID NO: 29 5' ATTGATATCCTAATTGTATTTCTCTATTCCTG 3' and encompassed the termination codon of sAH 406-3 and contained an EcoRV
cloning site. PCR reactions were performed essentially as described in Example 3.
The resulting PCR product was digested with XbaI and EcoRV and subcloned into a pBR322 vector containing the Trp promoter [deBoer et al., PNAS, 80:21-25 (1983)]
immediately upstream of the cloning site. E. coli strain XL-1 Blue was transformed with the expression construct, and cultured in L broth containing 100 tcg/ml of carbenicillin. Transformants from overnight cultures were pelleted and resuspended in lysis buffer containing 50mM Tris-HCl pH 7.5, 50mM NaCI, lOmM CHAPS, 1mM EDTA, 100 wg/ml lysozyme, and 0.05 trypsin-inhibiting units (TILnlml Aprotinin. Following a 1 hour incubation on ice and sonication for 2 minutes, the lysates were assayed for PAF-AH activity by the method described in Example 4.
E. coli transformed with the expression construct (designated trp AH) generated a product with PAF-AH activity. See Table 6 in Example 9.
Constructs including three additional promoters, the tacll promoter (deBoer, supra), the arabinose (ara) B promoter from Salmonella typhimurium [Horwitz et al., Gene, 14: 309-319 (1981)], and the bacteriophage T7 promoter, were also utilized to drive expression of human PAF-AH sequences in E. coli.
Constructs comprising the Trp promoter {pUC trp AH), the tacll promoter (pUC tac AH), and the araB promoter {pUC ara AH) were assembled in plasmid pUCl9 (New England Biolabs, MA) while the construct comprising the T7 promoter (pET AH) was assembled in plasmid pETlSB (Novagen, Madison, WI). A construct containing a hybrid promoter, pHAB/PH, consisting of the araB promoter fused to the ribosome binding sites of the T7 promoter region was also assembled in pETlSB. AlI E.
coli constructs produced PAF-AH activity within a range of 20 to 50 U/mIlOD6(y(1.
This activity corresponded to a total recombinant protein mass of ~ 1 % of the total cell protein.

Several E. coli expression constructs were also evaluated which produce PAF-AH with extended amino termini. The N-terminus of natural plasma PAF-AH was identified as I1e42 by amino acid sequencing (Example 2). However, the sequence immediately upstream of I1e42 does not conform to amino acids found at signal sequence cleavage sites [i.e., the "-3-1-rule" is not followed, as lysine is not found at position -1; see von Heijne, Nuc. Acids Res., 14:4683-4690 (1986)].
Presumably a more classical signal sequence (M 1-A 17 or M 1-P21 ) is recognized by the cellular secretion system, followed by endoproteolytic cleavage. The entire coding sequence for PAF-AH beginning at the initiating methionine {nucleotides to 1487 of SEQ ID NO: 7) was engineered for expression in E. coli using the trp promoter. As shown in Table 4, this construct made active PAF-AH, but expression was at about one fiftieth of the level of the original construct beginning at I1e42.
Another expression construct, beginning at Va118 (nucleotides 213 to 1487 of SEQ
ID NO: 7), produced active PAF-AH at about one third the level of the original construct. These results suggest that amino terminal end extensions are not critical or necessary for activity of recombinant PAF-AH produced in E. coli.
Table 4 PAF-AH activitX (Ulml/OD6~
Construct L_,ysate Media pUC trp AH (I1e42 N-terminus) 177.7 0.030 pUC trp AH Metl 3.1 0.003 pUC trp AH Va118 54.6 0.033 Truncated recombinant human PAF-AH products were also produced in E. coli using a low copy number plasmid and a promoter that can be induced by the addition of arabinose to the culture. One such N-terminally truncated PAF-AH
product is the recombinant expression product of DNA encoding amino acid residues Met46 through Asn~l of the polypeptide encoded by full length PAF-AH cDNA
(SEQ ID NO: 8), and is designated rPH.2. The plasmid used for production of rPH.2 in bacterial cells was pBAR2lPH.2, a pBR322-based plasmid that carnes (1) nucleotides 297 to 1487 of SEQ ID NO: 7 encoding human PAF-AH beginning with the methionine codon at position 46, (2) the araB-C promoters and araC gene from the arabinose operon of Salmonella typhimurium, (3) a transcription termination sequence from the bacteriophage T7, and (4) a replication origin from bacteriophage fl.
Specifically, pBAR2/PH.2 included the following segments of DNA:
(1) from the destroyed AatII site at position 1994 to the EcoRI site at nucleotide 6274, vector sequence containing an origin of replication and genes encoding resistance to either ampicillin or tetracycline derived from the bacterial plasmid pBR322; (2) from the EcoRI site at position 6274 to the XbaI site at position I31, IO DNA from the Salmonella typhimurium arabinose operon {Genbank accession numbers M11045, M11046, MI 1047, J01797); (3) from the XbaI site at position to the NcoI site at position 170, DNA containing a ribosome binding site from pET-21b (Novagen, Madison, WI); (4) from the NcoI site at position I70 to the XhoI
site at position 1363, human PAF-AH cDNA sequence; and (5) from the XhoI site at position 1363 to the destroyed Aatli site at position 1993, a DNA fragment from pET-21b (Novagen) that contains a transcription termination sequence from bacteriophae T7 and an origin of replication from bacteriophage fl.
Another PAF-AH product, designated rPH.9, is the recombinant expression product of DNA encoding amino acid residues Met46 through I1e429 of the polypeptide encoded by full length PAF-AH cDNA (SEQ ID NO: 8). The DNA
encoding rPH.9 was inserted into the same vector used for production of rPH.2 in bacterial cells. This plasmid was designated pBAR2/PH.9 and specifically included the following segments of DNA: (1) from the destroyed Aatl1 site at position to the EcoRI site at nucleotide 6239 of the vector sequence containing an origin of replication and genes encoding resistance to either ampicillin or tetracycline derived from the bacterial plasmid pBR322; (2) from the EcoRI site at position 6239 to the Xbal site at position 131, DNA from the Salmonella typhimurtum arabinose operon (Genbank accession numbers M11045, MI 1046, M 11047, J01797); (3) from the Xbal site at position 131 to the Ncol site at position 170, DNA containing a ribosome binding site from pET-21b {Novagen, Madison, WI); (4) from the NcoI site at position 170 to the XhoI site at position 1328, human PAF-AH DNA sequence; (5) from the XhoI site at position 1328 to the destroyed Aatll site at position 1958, a DNA fragment from pET-21b (Novagen, Madison, WI) that contains a transcription termination sequence from bacteriophage T7 and a origin of replication from bacteriophage fl.
Expression of PAF-AH products in pBAR2/PH.2 and pBAR2/PH.9 is under the control of the araB promoter, which is tightly repressed in the presence of glucose and absence of arabinose, but functions as a strong promoter when L-arabinose is added to cultures depleted of glucose. Selection for cells containing the plasmid can be accomplished through the addition of either ampicivin (or related antibiotics) or tetracycline to the culture medium. A variety of E. coli strains can be used as a host for recombinant expression of PAF-AH products, including but not limited to strains prototrophic for arabinose metabolism such as W3110, DHSa, BL21, C600, JM101 and their derivatives, strains containing mutations reducing proteolysis such as CAG629, KY1429, and strains defective in their ability to degrade arabinose such as SB7219 and MC 1061. The advantage of using a strain that is unable to break down arabinose is that the inducer (arabinose) for production of PAF-AH is not depleted from the medium during the induction period, resulting in higher levels of PAF-AH compared to that obtained with strains that are capable of metabolizing arabinose. Any suitable media and culturing conditions may be used to express active PAF-AH products in various E. coli strains. For example, either rich media formulations such LB, EDM295 (a M9 based minimum medium supplemented with yeast extract and acid hydrolysed casein), or "defined" media such as A675, an A based minimal medium set at pH 6.75 employing glycerol as a carbon source and supplemented with trace elements and vitamins, permit substantial production of rPAF-AH products. Tetracycline is included in the media to maintain selection of the plasmid.
The plasmid pBAR2/PH.2 was transformed into the E. coli strain MC 1061 (ATCC 53338), which carnes a deletion of the arabinose operon and thereby cannot metabolize arabinose. MC 1061 is also a leucine auxotroph and was cultivated by batch-fed process using a defined media containing casamino acids that complement the leucine mutation.
The E. coli MI061 cells transformed with pBAR2/PH.2 were grown at 30 ° C in batch media containing 2 gml L glucose. Glucose serves the dual purpose of carbon source for cell growth, and repressor of the arabinose promoter.
When batch glucose levels were depleted ( < 50 mg/L), a nutrient feed (containing 300 gm/L
glucose) was started. The feed was increased linearly for 16 hours at a rate which limited acid bi-product formation. At this point, the nutrient feed was switched to media containing glycerol instead of glucose. Simultaneously, 500 gmlL L-arabinose was added to a final concentration of 5 gm/L. The glycerol feed was kept at a constant feed rate for 22 hours. Cells were harvested using hollow-fiber filtration to concentrate the suspension approximately 10-fold. Cell paste was stored at -?0° C.
A final cell mass of about 80 gm/L was obtained (OD600 - 50-60) with a PAF-AH
activity of 65-70 UIOD/ml representing about 10 % of total cell protein. The final culture volume of about 75 liters contained 50-60 gm PAF-AH.
High level production of rPAF-AH products can be achieved when pBAR2lPH.2 or PH.9 is expressed by strains SB72I9 or MC1061. Other strains deficient in arabinose degradation are suitable for high cell density production.
Preferably, the cells are cultured under the following conditions.
Exponentially growing SB7219;pBAR2/PH.2 and SB7219;pBAR2/PH.9 strains are seeded into fermentors containing batch medium containing 2 g/L glucose. Once glucose is consumed, the tanks are fed with a glycerol solution containing trace elements, vitamins, magnesium and ammonium salt to maintain healthy exponential growth.
The tanks are maintained at 30°C, provided air to supply oxygen and agitated to maintain the dissolved oxygen level above about 15 % saturation. When the cell density of the culture is above I I O g/L (wet cell mass), constant feed rate is imposed and a bolus addition of L-arabinose is added to the culture (about 0.5 %
final).
Product formation is observed for I6-22 hours. The cultures typically achieve g/L (dry cell weight). Cells are harvested by centrifugation, stored at -70°C, and rPAF-AH product purified for analysis. Specific productivities in excess of unitslml/OD600 are routinely obtained.
B. Expression in Yeast Cells Recombinant human PAF-AH was also expressed in Saccharomyces cerevisiae. The yeast ADH2 promoter was used to drive rPAF-AH expression and produced 7 U/mllOD600 (Table 5 below).

Table 5 Enzyme Activity Construct Promoter Strain (tJ/ml/OD) pUC tac AH tac E. coli W3110 30 pUC trp AH trp E. coli W3110 40 S pUC ara AH araB E. coli W3110 20 pET AH T7 E. coli BL21 (DE3)SO

(Novagen) pHAB/PH araBlT7 E. coli XL-1 34 pBAR2/PH. 2 araB MC 1061 9p pYep ADH2 AH ADH2 Yeast BJ2.28 7 C. Expression of PAF-AH in mammalian cells 1. Expression of Human PAF-AH cDNA Constlvcts Plasmids constructed for expression of PAF-AH, with the exception of pSFN/PAFAH.1, employ a strong viral promoter from cytomegalovirus, a polyadenylation site from the bovine growth hormone gene, and the SV40 origin of replication to permit high copy number replication of the plasmid in COS
cells.
Plasmids were electroporated into cells.
A first set of plasmids was constructed in which the 5' flanking sequence (pDC 1/PAFAH.1 ) or both the 5' or 3' flanking sequences (PDC 1 /PAFAH.2) of the human PAF-AH cDNA were replaced with flanking sequences from other genes known to be expressed at high levels in mammalian cells.
Transfection of these plasmids into COS, CHO or 293 cells led to production of PAF-AH at about the same level (0.01 units/ml or 2-4 fold above background) as that cited for clone sAH 406-3 in Example 7 after transient transfection of COS cells.
Another plasmid was constructed which included a Friend spleen focus-forming virus promoter instead of the cytomegalovirus promoter. The human PAF-AH cDNA was inserted into plasmid pmH-neo [Hahn et al., Gene, 127: 267 (1993)] under control of the Friend spleen focus-forming virus promoter. Transfection of the myeloma cell line NSO with the plasmid which was designated pSFN/PAFAH. l and screening of several hundred clones resulted in the isolation of two transfectants (4B11 and 1C11) that made 0.15-0.5 unitslml of PAF-AH activity. Assuming a specific activity of units/milligram, the productivity of these two NSO transfectants corresponds to about 0.1 mglliter.
2. Expression of Mouse-Human Chimeric PAF-AH Gene Constructs A construct (pRc/MS9) containing the cDNA encoding mouse PAF-AH
in the mammalian expression vector pRc/CMV resulted in production of secreted PAF-AH at the level of 5-10 units/ml (1000 fold above background) after transfection into COS cells. Assuming that the specific activity of the mouse PAF-AH is about the same as that of the human enzyme, the mouse cDNA is therefore expressed at a 500-1000 fold higher Level than is the human PAF-AH cDNA.
To examine the difference between the expression levels of human and mouse PAF-AH in COS cells, two mouse-human chimeric genes were constructed and tested for expression in COS cells. The first of these constructs, pRc/PH.MHCI, contains the coding sequence for the N-terminal 97 amino acids of the mouse PAF-AH polypeptide (SEQ ID NO: 21 ) fused to the C-terminal 343 amino acids of human PAF-AH in the expression vector pRc/CMV (Invitrogen, San Diego, CA). The second chimeric gene, in plasmid pRcIPH.MHC2, contains the coding sequence for the N-terminal 40 amino acids of the mouse PAF-AH polypeptide fused to the C-terminal 400 residues of human PAF-AH in pRcICMV. Transfection of COS cells with pRc/PH.MHCI led to accumulation of 1-2 units/m1 of PAF-AH activity in the media. Conditioned media derived from cells transfected with pRcIPH.MHC2 was found to contain only 0.01 units/mI of PAF-AH activity. From these experiments, it appears that the difference in expression level between mouse and human PAF-AH
genes is attributable at least in part to the polypeptide segment between the residues 40 and 97, or the corresponding RNA or DNA segment encoding this region of the PAF-AH protein.

3. Recoding of the First 290 by of the PAF-AH Coding Sequence One hypothesis for the low level of human PAF-AH synthesized in transfected mammalian cells is that the codons utilized by the natural gene are suboptimal for efficient expression. However, it does not seem likely that codon usage can account for 500-1000 fold difference in expression levels between the mouse and human genes because optimizing codons generally has at most only a fold effect on expression. A second hypothesis to explain the difference between the mouse and human PAF-AH expression levels is that the human PAF-AH mRNA in the 5' coding region forms a secondary structure that leads to either relatively rapid degradation of the mRNA or causes inefficient translation initiation or elongation.
To test these hypotheses, a synthetic fragment encoding the authentic human PAF-AH protein from the amino-terminus to residue 96 but in which most of the codons have been substituted ("recoded") with a codon of a different sequence but encoding the same amino acid was constructed. Changing the second codon from GTG to GTA resulted in the creation of an Asp718 site, which was at one end of the synthetic fragment and which is present in the mouse cDNA. The other end of the fragment contained the BamHI site normally found at codon 97 of the human gene.
The approximately 290 by Asp718/BamHI fragment was derived from a PCR
fragment that was made using the dual asymmetric PCR approach for construction of synthetic genes described in Sandhu et al., Biotechniques, 12: 14-16 (1992).
The synthetic Asp718lBamHI fragment was ligated with DNA fragments encoding the remainder of the human PAF-AH molecule beginning with nucleotide 453 of SEQ ID
NO: 7 such that a sequence encoding authentic human PAF-AH enzyme was inserted into the mammalian expression vector pRc/CMV (Invitrogen, San Diego) to create plasmid pRc/HPH.4. The complete sequence of the recoded gene is set out in SEQ
ID NO: 30. The 5' flanking sequence adjacent to the human PAF-AH coding sequence in pRc/HPH.4 is from that of a mouse cDNA encoding PAF-AH in pRc/MS9 (nucleotides 1 to 116 of SEQ ID NO: 21).
To test expression of human PAF-AH from pRc/HPH.4, COS cells were transiently transfected with pRc/HPH.4 (recoded human gene), pRclMS9 (mouse PAF-AH), or pRc/PH.MHCI (mouse-human hybrid 1). The conditioned media from the transfected cells were tested for PAF-AH activity and found to contain 5.7 units/ml (mouse gene)., 0.9 units/ml (mouse-human hybrid 1), or 2.6 units/ml (recoded human gene). Thus, the strategy of recoding the first 290 by of coding sequence of human PAF-AH was successful in boosting expression levels of human PAF-AH from a few nanograms/ml to about 0.5 microgramlml in a transient COS cell transfection. The recoded PAF-AH gene from pRcIHPH.4 will be inserted into a mammalian expression vector containing the dihydrofolate reductase {DHFR) gene and DHFR-negative Chinese hamster ovary cells will be transfected with the vector. The transfected cells will be subjected to methotrexate selection to obtain clones making high levels of human PAF-AH due to gene amplification.
Example 9 Recombinant human plasma PAF-AH (beginning at I1e42) expressed in E. coli was purified to a single Coomassie-stained SDS-PAGE band by various methods and assayed for activities exhibited by the native PAF-AH enzyme.
A. Purification of Recombinant PAF-AH
1 S The first purification procedure utilized is similar to that described in Example 1 for native PAF-AH. The following steps were performed at 4°C.
Pellets from 50 ml PAF-AH producing E. coli {transformed with expression construct trp AH) were lysed as described in Example 8. Solids were removed by centrifugation at 10,000 g for 20 minutes. The supernatant was loaded at 0.8 mllminute onto a Blue Sepharose Fast Flow column (2.5 cm x 4 cm; 20 ml bed volume) equilibrated in buffer D (25mM Tris-HCI, lOmM CHAPS, O.SM NaCI, pH 7.5). The column was washed with 100 ml buffer D and eluted with 100 ml buffer A containing O.SM
KSCN at 3.2 ml/minute. A 15 mi active fraction was loaded onto a 1 ml Cu Chelating Sepharose column equilibrated in buffer D. The column was washed with 5 rnl buffer D followed by elution with 5 ml of buffer D containing 100mM
imidazole with gravity flow. Fractions containing PAF-AH activity were analyzed by SDS-PAGE.
The results of the purification are shown in Table b wherein a unit equals ~.mol PAF hydrolysis per hour. The purification product obtained at 4°C
appeared on SDS-PAGE as a single intense band below the 43 kDa marker with some diffuse staining directly above and below it. The recombinant material is significantly more pure and exhibits greater specific activity when compared with PAF-AH
preparations from plasma as described in Example 1.
Table 6 Sample Volume Activity Total Prot Conc Specific % Recovery Fold (units/ Act. m lmL Activity of Activity Purification ml~ (units (units/ Stev Cum. Step Cum.
x mgl 10~
Lysate 4.5 989 4451 15.6 63 100 100 1 1 Blue 15 64 960 0.07 914 22 22 14.4 14.4 Cu 1 2128 2128 0.55 3869 220 48 4.2 61 When the same purification protocol was performed at ambient temperature, in addition to the band below the 43 kDa marker, a group of bands below the 29 kDa marker correlated with PAF-AH activity of assayed gel slices. These lower molecular weight bands may be proteolytic fragments of PAF-AH that retain enzymatic activity.
A different purification procedure was also performed at ambient temperature. Pellets (100 g) of PAF-AH-producing E. coli (transformed with the expression construct pUC trp AH) were resuspended in 200 mI of lysis buffer (25mM
Tris, 20mM CHAPS, SOmM NaCI, 1 mM EDTA, SO ~cg/ml benzamidine, pH 7.5) and lysed by passing three times through a microfluidizer at 15,000 psi.
Solids were removed by centrifugation at 14,300 x g for 1 hour. The supernatant was diluted 10 fold in dilution buffer [25mM MES (2-[N-morpholino] ethanesulfonic acid), lOmM
CHAPS, 1mM EDTA, pH 4.9] and loaded at 25 ml/minute onto an S Sepharose Fast Flow Column (200 ml) (a ration exchange column) equilibrated in Buffer E (25mM
MES, IOmM CHAPS, 1mM EDTA, SOmM NaCI, pH 5.5). The column was washed with 1 liter of Buffer E, eluted with 1M NaCI, and the eluate was collected in 50 ml fractions adjusted to pH 7.5 with 0.5 ml of 2M Tris base. Fractions containing PAF-AH activity were pooled and adjusted to 0.5M NaCI. The S pool was loaded at 1 ml/minute onto a Blue Sepharose Fast Flow column (2.5 cm x 4 cm; 20 ml) equilibrated in Buffer F (25mM Tris, IOmM CHAPS, 0.5M NaCI, 1mM EDTA, pH
7.5). The column was washed with 100 ml Buffer F and eluted with 100 ml Buffer F containing 3M NaCI at 4 ml/minute. The Blue Sepharose Fast Flow chromatography step was then repeated to reduce endotoxin levels in the sample.
Fractions containing PAF-AH activity were pooled and dialyzed against Buffer G
(25mM Tris pH 7.5, 0.5M NaCI, 0.1 % Tween 80, lnlM EDTA).
The results of the purification are shown in Table 7 wherein a unit equals ~cmol PAF hydrolysis per hour.
Table 7 Sample Volume Activity Total Prot Conc Specific % Recovery Fold ml (units/ Act. m /mL Activity of Activity Purification ml~ (units (units/ Sten Cum. Step Cum.
x 1~
Lysate 200 5640 1128 57.46 98 100 100 1 1 S 111 5742 637 3.69 1557 57 56 16 16 Blue 100 3944 394 0.84 4676 35 b2 3 48 The purification product obtained appeared on SDS-PAGE as a single intense band below the 43 kDa marker with some diffuse staining directly above and below it.
The recombinant material is significantly more pure and exhibits greater specific activity when compared with PAF-AH preparations from plasma as described in Example 1.
Yet another purification procedure contemplated by the present invention involves the following cell lysis, clarification, and first column steps. Cells are diluted 1:1 in lysis buffer (25mM Tris pH 7.5, 150mM NaCI, 1 % Tween 80, 2mM EDTA). Lysis is performed in a chilled microfluidizer at 15,000-20,000 psi with three passes of the material to yield > 99 % cell breakage. The lysate is diluted 1:20 in dilution buffer (25mM Tris pH 8.5, ImM EDTA) and applied to a column packed with Q-Sepharose Big Bead chromatography media (Pharmacia) and equilibrated in 25mM Tris pH 8.5, 1mM EDTA, 0.015 % Tween 80. The eluate is diluted 1:10 in 25mM MES pH 5.5, 1.2M Ammonium sulfate, ImM EDTA and applied to Butyl Sepharose chromography media (Pharmacia) equilibrated in the same buffer. PAF-AH activity is eluted in 25mM MES pH 5.5, 0.1 % Tween 80, 1mM
EDTA.
Still another method contemplated by the invention for purifying enzymatically-active PAF-AH from E. toll includes the steps of: (a) preparing an E. toll extract which yields solubilized PAF-AH supernatant after lysis in a buffer containing CHAPS; (b) dilution of the said supernatant and application to a anion exchange column equilibrated at about pH 8.0; (c) eluting PAF-AH enzyme from said anion exchange column; (d) applying said adjusted eluate from said anion exchange column to a blue dye ligand affinity column; (e) eluting the said blue dye ligand affinity column using a buffer comprising 3.OM salt; (f) dilution of the blue dye eiuate into a suitable buffer for performing hydroxylapatite chromatography;
(g) performing hydroxylapatite chromatography where washing and elution is accomplished using buffers (with or without CHAPS); (h) diluting said hydroxylapatite eluate to an appropriate salt concentration for cadon exchange chromatography; (i) applying said diluted hydroxylapatite eluate to a cation exchange column at a pH ranging between approximately 6.0 to 7.0; (j) elution of PAF-AH
from said canon exchange column with a suitable formulation buffer; (k) performing cation exchange chromatography in the cold; and (1) formulation of PAF-AH in liquid or frozen form in the absence of CHAPS.
Preferably in step (a) above the lysis buffer is 25mM Tris, 100mM
NaCI, 1 mM EDTA, 20mM CHAPS, pH 8.0; in step (b) the dilution of the supernatant for anion exchange chromatography is 3-4 fold into 25mM Tris, 1mM
EDTA, lOmM CHAPS, pH 8.0 and the column is a Q-Sepharose column equilibrated with 25mM Tris, 1mM EDTA, 50mM NaCI, lOmM CHAPS, pH 8.0; in step (c) the anion exchange column is eluted using 25mM Tris, 1 mM EDTA, 350mM NaCI, IOmM CHAPS, pH 8.0; in step (d) the eluate from step (c) is applied directly onto a blue dye affinity column; in step (e) the column is eluted with 3M NaCI, lOmM
CHAPS, 25mM Tris, pH 8.0 buffer; in step (f) dilution of the blue dye eluate for hydroxylapatite chromatography is accomplished by dilution into IOmM sodium phosphate, IOOmM NaCI, IOmM CHAPS, pH 6.2; in step (g) hydroxylapatite chromatography is accomplished using a hydroxylapatite column equilibrated with IOmM sodium phosphate, 100mM NaCI, lOmM CHAPS and elution is accomplished using 50mM sodium phosphate, 100mM NaCI (with or without) lOmM CHAPS, pH
7.5; in step (h) dilution of said hydroxylapatite eluate for ration exchange chromatography is accomplished by dilution into a buffer ranging in pH from approximately 6.0 to 7.0 comprising sodium phosphate (with or without CHAPS);
in step (i) a S Sepharose column is equilibrated with 50mM sodium phosphate, (with or without) IOmM CHAPS, pH 6.8; in step (j) elution is accomplished with a suitable formulation buffer such as potassium phosphate 50mM, 12.5mM aspartic acid, I25mM NaCI, pH 7.5 containing 0.01 % Tween-80; and in step (k) ration exchange chromatrography is accomplished at 2-8 ° C . Examples of suitable formulation buffers for use in step (1) which stabilize PAF-AH include 54mM potassium phosphate, 12.5mM Aspartic acid, 125mM NaCl pH 7.4 (approximately, with and without the addition of Tween-80 and or Pluronic F68) or 25mM potassium phosphate buffer containing (at least) 125mM NaCI, 25mM arginine and 0.01 ~ Tween-80 (with or without Pluronic F68 at approximately 0.1 and 0.5 % ).
B. Activit~r of Recombinant PAF-AH
The most remarkable property of the PAF acetylhydrolase is its marked specificity for substrates with a short residue at the sn-2 position of the substrate.
This strict specificity distinguishes PAF acetylhydrolase from other forms of PLA2.
Thus, to determine if recombinant PAF-AH degrades phospholipids with long-chain fatty acids at the sn-2 position, hydrolysis of 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (arachidonoylPC) was assayed since this is the preferred substrate for a well-characterized form of PLA2. As predicted from previous studies with native PAF-AH, this phospholipid was not hydrolyzed when incubated with recombinant PAF-AH. In additional experiments, arachidonoylPC was included in a standard PAF
hydrolysis assay at concentrations ranging from 0 to 125 ~.M to determine whether it inhibited the hydrolysis of PAF by recombinant PAF-AH. There was no inhibition of PAF hydrolysis even at the highest concentration of PAF-AH, which was 5-fold greater than the concentration of PAF. Thus, recombinant PAF-AH exhibits the same substrate selectivity as the native enzyme; long chain substrates are not recognized.
Moreover, recombinant PAF-AH enzyme rapidly degraded an oxidized phospholipid (glutaroylPC) which had undergone oxidative cleavage of the Sn-2 fatty acid.
Native plasma PAF-AH has several other properties that distinguish it from other phospholipases including calcium-independence and resistance to compounds that modify sulfhydryl groups or disrupt disulfides.
Both the native and recombinant plasma PAF-AH enzymes are sensitive to DFP, indicating that a serine comprises part of their active sites. An unusual feature of the native plasma PAF acetylhydrolase is that it is tightly associated with lipoproteins in circulation, and its catalytic efficiency is influenced by the lipoprotein environment. When recombinant PAF-AH of the invention was incubated with human plasma (previously treated with DFP to abolish the endogenous enzyme activity), it associated with low and high density lipoproteins in the same manner as the native activity. This result is significant because there is substantial evidence that modification of low density lipoproteins is essential for the cholesterol deposition observed in atheromas, and that oxidation of lipids is an initiating factor in this process. PAF-AH protects low density lipoproteins from modification under oxidizing conditions in vitro and may have such a role in vivo. Administration of PAF-AH is thus indicated for the suppression of the oxidation of lipoproteins in atherosclerotic plaques as well as to resolve inflammation.
These results all confirm that the cDNA clone sAH 4.06-3 encodes a protein with the activities of the the human plasma PAF acetylhydrolase.
Example 10 Various other recombinant PAF-AH products were expressed in E.
coli. The products included PAF-AH analogs having single amino acid mutations and PAF-AH fragments.
A. PAF-AH Amino Acid Substitution Products PAF-AH is a lipase because it hydrolyses the phospholipid PAF.
While no obvious overall similarity exists between PAF-AH and other characterized lipases, there are conserved residues found in comparisons of structurally characterized lipases. A serine has been identified as a member of the active site.
The serine, along with an aspartate residue and a histidine residue, form a catalytic triad which represents the active site of the lipase. The three residues are not adjacent in the primary protein sequence, but structural studies have demonstrated that the three residues are adjacent in three dimensional space. Comparisons of structures of mammalian lipases suggest that the aspartate residue is generally twenty-four amino acids C-terminal to the active site serine. In addition, the histidine is generally 109 to 111 amino acids C-terminal to the active site serine.
By site-directed mutagenesis and PCR, individual codons of the human PAF-AH coding sequence were modified to encode alanine residues and were expressed in E. coli. As shown in Table 8 below wherein, for example, the abbreviation "S 108A" indicates that the serine residue at position 108 was changed to all alanine, point mutations of Ser273, Asp296, or His351 completely destroy PAF-AH activity. The distances between active site residues is similar for PAF-AH
(Ser to Asp, 23 amino acids; Ser to His, 78 amino acids) and other iipases. These experiments demonstrate that Ser273, Asp296, and His351 are critical residues for activity and are therefore likely candidates for catalytic triad residues.
Cysteines are often critical for the functional integrity of proteins because of their capacity to form disulfide bonds. The plasma PAF-AH enzyme contains five cysteines. To determine whether any of the five is critical for enzyme actvity, each cysteine was mutated individually to a serine and the resulting mutants were expressed in E. coli.
Preliminary activity results using partially purified preparations of these recombinantly produced mutants are shown below in the second column of Table 8, while results using more purled preparations are shown below in the third column of Table 8. The data show that all of the cysteine mutants had largely equivalent activity, so that none of the cysteines appears to be necessary for PAF-AH
activity.
Other point mutations also had little or no effect on PAF-AH catalytic activity. In Table 8, "++++" represents wild type PAF-AH activity of about 40-b0 UImI/OD600, "+++" represents about 20-40 U/mUOD600 activity, "++"
represents about 10-20 U/ml/OD600 activity, "+" represents 1-10 UImUOD600 activity, and "-" indicates < 1 U/ml/OD600 activity.

Table 8 Mutation PAF-AH activitySpecific PAF-AH activity of purified preparations Wild type + + + + 6.9 mmollmg/hr S108A ++++

D286N + +

D304A ++++

D338A ++++

H395A, H399A + + + +

C67S + + + 5.7 mmol/mglhr C229S + 6.5 mmol/mglhr I5 C291 S + 5.9 mmollmglhr C334S + + + + 6. 8 mmol/mg/hr C407S + + + 6.4 mmoUmg/hr C67S, C334S, C407S 6.8 mmol/mg/hr B. PAF-AH Frag_ment Products C-terminal deletions were prepared by digesting the 3' end of the PAF-AH coding sequence with exonuclease 13I for various amounts of time and then ligadng the shortened coding sequence to plasmid DNA encoding stop codons in all three reading frames. Ten different deletion constructs were characterized by DNA
sequence analysis, protein expression, and PAF-AH activity. Removal of twenty-one to thirty C-terminal amino acids greatly reduced catalytic activity and removal of fifty-two residues completely destroyed activity. See FIGURE 3.
Similar deletions were made at the amino terminal end of PAF-AH.
Fusions of PAF-AH with E. coli thioredoxin at the N-terminus were prepared to facilitate consistent high level expression PAF-AH activity [LaVallie et al., WO 99!09147 PCT/US97/14212 Bioltechnology, 11:187-193 (1993)]. Removal of nineteen amino acids from the naturally processed N-terminus (I1e42) reduced activity by 99 % while removal of twenty-six amino acids completely destroyed enzymatic activity in the fusion protein.
See FIGURE 3. Deletion of twelve amino acids appeared to enhance enzyme activity about four fold.
In subsequent purifications of PAF-AH from fresh human plasma by a method similar to that described in Example 1 (Microcon 30 filter from Amicon were utilized to concentrate Blue sepharose eluate instead of a Cu column), two N-termini in addition to I1e42 were identified, Ser35 and Lys55. The heterogeneity may be the natural state of the enzyme in plasma or may occur during purification.
The purified material described above was also subject to analysis for glycosylation. Purified native PAF-AH was incubated in the presence or absence of N-Glycanase, an enzyme that removes N-linked carbohydrates from glycoproteins.
The treated PAF-AH samples were electrophoresed through a 12 % SDS
polyacrylamide gel then visualized by Western blotting using rabbit polyclonal antisera. Protein not treated with N-Glycanase migrated as a diffuse band of kDa whereas the protein treated with the glycanase migrated as a tight band of about 44 kDa, demonstrating that native PAF-AH is glycosylated.
N-terminal heterogeneity was also observed in purified preparations of recombinant PAF-AH (I1e42 N-terminus) . These preparations were a mixture of polypeptides with N-termini beginning at A1a47, I1e42, or the artificial initiating Met-1 adjacent to I1e42.
1. Preliminay comparison of PAF-AH fragments with PAF-AH
In view of the observed heterogeneity of recombinantly produced PAF-AH, other recombinant products were prepared and tested for homogeneity after recombinant expression and purification. The composition of the recombinant expression products of pBAR2/PH.2 and pBAR2/PH.9 in E. coli strain MC1061 was analyzed at different time points during the production phase of cell fermentation.
Partially purified samples of the recombinant PH.2 and PH.9 from cells collected at time points ranging between 5 and 22 hours after induction of protein expression were analyzed by matrix assisted laser desorption ionization mass spectrometry (MALDI-MS).
When the PH.2 expression vector was utilized, two peaks were observed in the spectrum of the partially purified protein at a mass value expected for S rPAF-AH protein. Two peaks were observed at all time points, with greater heterogeneity being observed at time points when fermentation is stressed as indicated by an accumulation of acetate and/or a depletion of oxygen in the media. The accuracy of the MALDI-MS technique in this mass range was approximately t 0.3 % , about the mass of one amino acid. The higher mass peak observed was consistent with the presence of the expected full length translation product for the PH.2 vector, minus the translation initiating methionine which is expected to be post-translationally removed. The lower mass peak was approximately 1200 atomic mass units less.
When the PH.9 expression vector was utilized, a single peak predominated in the spectrum of the partially purified protein at a mass value expected for rPAF-AH protein. This single peak was observed at all time points, with no increase in heterogeneity seen at different time points. The observed mass of this protein was consistent with the presence of the expected full length translation product for the PH.9 vector, minus the initiating methionine.
2. Purification of PAF-AH fragments Recombinantly expressed rPH.2 (the expression product of DNA
encoding Met46-Asn~l) and rPH.9 (the expression product of DNA encoding Met46-I1e429) p~~~ons were purified for further comparison with purified rPAF-AH (expression product of DNA encoding I1e42-Asn~l). rPH.9 was produced by E. toll strain SB7219 and purified generally according to the zinc chelate purification procedure described above, while rPH.2 was produced by E. toll strain MC106I
and purified as described below. The transformed cells were lysed by dilution of the cell paste with lysis buffer (100 mM succinate, 100 mM NaCI, 20 mM CHAPS, pH 6.0).
The slurry was mixed and lysed by high pressure dismption. The lysed cells were centrifuged and the supernatant containing rPH.2 was retained. The clarified supernatant was diluted 5-fold in 25 mM sodium phosphate buffer containing, 1 mM

WO 99/09147 PCTlUS97/14212 EDTA, 10 mM CHAPS, pH 7Ø The diluted supernatant was then applied to the Q
Sepharose column. The column was washed first with 3 column volumes of 25 mM
sodium phosphate buffer containing 1 mM EDTA, 50 mM NaCI, 10 mM CHAPS, pH 7.0 (Wash I), then washed with 10 column volumes of 25 mM Tris buffer containing 1 mM EDTA, IO mM CHAPS, pH 8.0 (Wash 2) and with 10 column volumes of 25 mM Tris buffer containing 1 mM EDTA, 100 mM NaCI, 10 mM
CHAPS, pH 8.0 (Wash 3). Elution was accomplished with 25 mM Tris buffer containing 1 mM EDTA, 350 mM NaCI, 10 mM CHAPS, pH 8Ø The Q Sepharose eluate was diluted 3-fold in 25 mM Tris, 1 mM EDTA, 10 mM CHAPS, pH 8.0 then applied to a Blue Sepharose column. The column was washed first with 10 column volumes of 25 mM Tris, I mM EDTA, 10 mM CHAPS, pH 8Ø The column was then washed with 3 column volumes of 25 mM Tris, 0.5 M NaCI, 10 mM CHAPS, pH 8Ø Elution was accomplished with 25 mM Tris, 3.0 M NaCI, 10 mM CHAPs, pH 8Ø The Blue Sepharose eluate was diluted 5-fold in 10 mM sodium phosphate, 10 mM CHAPS, pH 6.2 then applied to the chromatography column. The column was washed with 10 column volumes of 10 mM sodium phosphate, 100 mM NaCI, 0.1 % Pluronic F68, pH 6.2. rPH.2 was eluted with 120 mM sodium phosphate, 100 mM NaCI, 0.1 % Pluronic F-68, pH 7.5. The hydroxyapatite eluate was diluted 6-fold with 10 mM sodium phosphate, 0.1 % Pluronic F68, pH 6.8. The diluted hydroxyapatite eluate was adjusted to pH 6.8 using 0.5 N succinic acid and then applied to a SP Sepharose column. The SP Sepharose column was washed with 10 column volumes 50 mM sodium phosphate, 0.1 % Fluronic F68, pH 6.8 and eluted with 50 mM sodium phosphate, I25 mM NaCI, 0.1 % Pluronic F68, pH 7.5. The eluted rPH.2 was formulated by diluting to a final concentration of 4 mg/ml in mM sodium phosphate, 125 mM NaCI, 0.15 % Pluronic F68, pH 7.5, and Tween 80 was added to a final concentration of 0.02 % Tween 80. The formulated product was then filtered through a 0.2~u membrane and stored prior to use.
3. Comparison of PAF-AH fragments with PAF-AH bv, seauen The purified rPH.2 and rPH.9 preparations were compared with purified rPAF-AH preparations by N-terminal sequencing using an Applied Biosystems Model 473A Protein Sequencer (Applied Biosystems, Foster City, CA) WO 99109147 PCTlUS97114212 and by C-terminal sequencing using a Hewlett-Packard Model GI009A C-terminal Protein Sequencer. The rPH.2 preparation had less N-terminal heterogeneity compared to rPAF-AH. The N-terminus analysis of the rPH.9 preparation was similar to that of rPH.2, but less C-terminal heterogeneity was observed for the rPH.9 preparation relative to rPH.2.
The purified rPH.2 preparation contained a major sequence with an N-terminus of A1a47 (about 86-89 %) and a minor sequence with an N-terminus of A1a48 (about 11-14%), with the ratio of the two N-termini being fairly consistent under different fermentation conditions. The purified rPH.9 preparation also contained a major sequence with an N-terminus of Ata47 (about 83-90%) and a minor sequence with an N-terminus of A1a48 (about 10-17 % ). In contrast, attempts to produce in bacteria the polypeptide beginning at I1e42 (rPAF-AH) resulted in a varying mixture of polypeptides with N-termini beginning at A1a47 (20-53 %}, I1e42 (8-10%), or at the artificial initiating Met_I methionine (37-72 % ) adjacent to I1e42. For rPH.2 and rPH.9, the initiating methionine is efficiently removed by an amino-terminal peptidase after bacterial synthesis of the polypeptide, leaving the alanine at position 47 (or the alanine at position 48) as the N-terminal residue.
C-terminal sequencing was carried out on one lot of rPH.2, which was observed to have a C-terminus of HOOC-Asn-Tyr as the major sequence (about 80%), consistent with the predicted HOOC-Asn~I-Tyr~O C-terminus of the translation product, while about 20 % was HOOC-Leu. After the rPH.2 preparation had been fractionated by SDS-PAGE, additional sequencing of the primary and secondary bands yielded a C-terminal sequence of HOOC-Leu-Met from a lower secondary band (AHL, described below in section B.S.) consistent with a product that is 10 amino acids shorter than the full length translation product, as well as low levels of HOOC-His. Further peptide mapping has shown that additional C-termini are present in some lots of PH.2 protein. The C-terminus of rPH.9 was primarily HOOC-Ile-His (about ?8 to 91 %, depending on the lot) by direct sequencing, consistent with the predicted HOOC-Ile42g-His428 C-terminus of the translation product. There appears to be some background ("noise") in this technique, so low levels of other sequences could not be ruled out.

-$0-4. Comparison of PAF-AH fragments with PAF-AH by MALDI-MS
MALDI-MS was performed on purified rPH.2 and rPH.9 preparations.
The rPH.2 spectrum exhibited two peaks in the spectrum at a mass value expected for the rPAF-AH product (see FIGURE 4), similar to the pattern observed with the partially purified protein in section B.1. above. The secondary, lower molecular weight peak was typically present at approximately 20 % to 30 ~ of the total.
The rPH.9 spectrum showed a predominant peak at a mass consistent with that expected for the full length translation product for the PH.9 vector, minus the translation initiating methionine (see FIGURE 5). A small slightly lower molecular weight shoulder peak was also observed for rPH.9 that represented approximately 5 %
of the total.
5. Comparison of PAF-AH fragments with PAF-AH by SDS-PAGE
Sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) was performed vn purified rPAF-AH, rPH.2 and rPH.9 preparations. A complicated banding pattern was observed for rPH.2 around the electrophoretic migration range expected for the rPAF-AH product, based on protein molecular weight standards.
One, or in some gels, two predominant bands were seen, with readily observed secondary bands above and below the primary band. These upper secondary, middle primary and lower secondary bands, respectively, were termed AHU, AHM and AHL. All of these bands reacted with an anti-rPAF-AH monoclonal antibody on Western blot and have thus been identified as rPAF-AH related products. The upper secondary band AHU increased in intensity over time with storage of the protein and presumably represents a modified form of the rPAF-AH product. The SDS-PAGE
of the rPAF-AH preparation is similar to that of rPH.2. There are two major bands that migrate near the expected molecular weight for rPAF-AH, as well as a minor band above and a shadow below the major bands. In contrast, rPH.9 displayed a single predominant band on SDS-PAGE with no apparent splitting. Faint bands at a slightly lower molecular weight and at an expected dimer position were also seen.
No AHU-like band was observed.
The composition of the purified rPH.2 and rPH.9 preparations was also analyzed on 2D gels (isoelectric focusing (IEF) in urea followed by SDS-PAGE
in the ~iI

second dimension). For rPH.9, the 2D gels showed five main spots separated in the IEF direction. The charge heterogeneity appeared consistent between lots of rPH.9.
In contrast, the 2D gel pattern of rPH.2 was more complicated as it contained approximately 15 spots separated in the IEF and SDS-PAGE dimensions.

6. Comparison of activity of PAF-AH fragments with PAF-AH
Purified rPH.2 and rPH.9 have enzymatic activity indistin4guishable from that of endogenous PAF-AH purified from senior, and rPH.2 and rPH.9 bind to lipropotein in a similar manner as purified endogenous PAF-AH.
Example 11 A preliminary analysis of expression patterns of human plasma PAF
AH mRNA in human tissues was conducted by Northern blot hybridization.
RNA was prepared from human cerebral cortex, heart, kidney, placenta, thymus and tonsil using RNA Stat 60 (Tel-Test "B", ~iiendswood, TX).
Additionally, RNA was prepared from the human hematopoietic precursor-like cell IS line, THP-1 (ATCC TIB 202), which was induced to differentiate to a macrophage-like phenotype using the phorbol ester phorbolmyristylacetate (PMA). Tissue RNA
and RNA prepared from the premyelocytic THP-1 cell line prior to and 1 to 3 days after induction were electrophoresed through a 1.2 °~ agarose formaldehyde gel and subsequently transferred to a nitrocellulose membrane. The full length human plasma PAF-AH cDNA, sAH 406-3, was labelled by random priming and hybridized to the membrane under conditions identical to those described in Example 3 for library screening. Initial results indicate that the PAF-AH probe hybridized to a 1.8 kb band in the thymus, tonsil, and to a lesser extent, the placental RNA.
PAF is synthesized in the brain under normal physiological as weU as pathophysiological conditions. Given the known pro-infla.mmatory and potential neurotoxic properties of the molecule, a mechanism for localization of PAF
synthesis or for its rapid catabolism would be expected to be critical for the health of neural tissue. The presence of PAF acetylhydrolase in neural tissues is consistent with it playing such a protective role. Interestingly, both a bovine heterotrimeric intracellular PAF-AH [the cloning of which is described in Hattori et al., J.
Biol.
*Trade-mark Chem., 269(37): 23150-23155 (1994)] and PAF-AH of the invention have been identified in the brain. To determine whether the two enzymes are expressed in similar or different compartments of the brain, the human homologue of the bovine brain intracellular PAF-AH cDNA was cloned, and its mRNA expression pattern in the brain was compared by Northern blotting to the mRNA expression pattern of the PAF-AH of the invention by essentially the same methods as described in the foregoing paragraph. The regions of the brain examined by Northern blotting were the cerebellum, medulla, spinal cord, putamen, amygdala, caudate nucleus, thalamus, and the occipital pole, frontal lobe and temporal lobe of the cerebral cortex.
Message of both enzymes was detected in each of these tissues although the heterotrimeric intracellular form appeared in greater abundance than the secreted form.
Northern blot analysis of additional tissues further revealed that the heterotrimeric intracellular form is expressed in a broad variety of tissues and cells, including thymus, prostate, testis, ovary, small intestine, colon, peripheral blood leukocytes, macrophages, brain, liver, skeletal muscle, kidney, pancreas and adrenal gland. This ubiquitous expression suggests that the heterotrimeric intracellular PAF-AH has a general housekeeping function within cells.
The expression of PAF-AH RNA in monocytes isolated from human blood and during their spontaneous differentiation into macrophages in culture was also examined. Little or no RNA was detected in fresh monocytes, but expression was induced and maintained during differentiation into macrophages. There was a concomitant accumulation of PAF-AH activity in the culture medium of the differentiating cells. Expression of the human plasma PAF-AH transcript was also observed in the THP-1 cell RNA at 1 day but not 3 days following induction.

cells did not express mRNA for PAF-AH in the basal state.
Example 12 PAF-AH expression in human and mouse tissues was examined by in situ hybridization.
Human tissues were obtained from National Disease Research Interchange and the Cooperative Human Tissue Network. Normal mouse brain and spinal cord, and EAE stage 3 mouse spinal cords were harvested from S/JLJ
mice.

~ WO 99/09147 PCTNS97/14212 Normal S/JIJ mouse embryos were harvested from eleven to eighteen days after fertilization.
The tissue sections were placed in Tissue Tek II cryomolds {Miles Laboratories, Inc., Naperville, IL) with a small amount of OCT compound {Miles, Inc., Elkhart, IN). They were centered in the cryomold, the cryomold filled with OCT compound, then placed in a container with 2-methylbutane [C2H5CH(CH3)2, Aldrich Chemical Company, Inc. , Milwaukee, WI] and the container placed in liquid nitrogen. Once the tissue and OCT compound in the cryomold were frozen, the blocks were stored at -80 ° C until sectioning. The tissue blocks were sectioned at 6 ,um thickness and adhered to Vectabond (Vector Laboratories, Inc., Burlingame, CA) coated slides and stored at -70 ° C and placed at 50 ° C for approximately 5 minutes to warm them and remove condensation and were then fixed in 4 % paraformaldehyde for 20 minutes at 4 ° C, dehydrated (70 % , 95 % , 100 % ethanol) for 1 minute at 4 ° C
in each grade, then allowed to air dry for 30 minutes at room temperature.
Sections were denatured for 2 minutes at 70 ° C in 70 % formamide/2X SSC, rinsed twice in 2X SSC, dehydrated and then air dried for 30 minutes. The tissues were hybridized in situ with radiolabeled single-stranded mRNA generated from DNA derived from an internal 1 Kb HindllI fragment of the PAF-AH gene (nucleotides 308 to 1323 of SEQ m NO: 7) by in vitro RNA transcription incorporation 35S-UTP (Amersham) or from DNA derived from the heterotrimeric intracellular PAF-AH cDNA
identified by Hattori et al. The probes were used at varying lengths from 250-500 bp.
Hybridization was carried out overnight (12-I6 hours) at 50 ° C; the 35S-labeled riboprobes (6 x 105 cpm/section), tRNA (0.5 ~cg/section) and diethylpyrocarbonate {depc)-treated water were added to hybridization buffer to bring it a final concentration of 50% formamide, 0.3M NaCI, 20 mM Tris pH 7.5, 10% dextran sulfate, 1 X Denhardt's solution, 100 mM dithiothretol (DTT) and 5 mM EDTA.
After hybridization, sections were washed for 1 hour at room temperature in 4X
SSCI10 mM DTT, then for 40 minutes at 60°C in 50% formamide/1X SSCI10 mM
DTT, 30 minutes at room temperature in 2X SSC, and 30 minutes at room temperature in 0.1X SSC. The sections were dehydrated, air dried for 2 hours, coated with Kodak NTB2 photographic emulsion, air dried for 2 hours, developed (after storage at 4 ° C in complete darkness) and counterstained with hematoxylinleosin.
A. Brain Cerebellum. In both the mouse and the human brains, strong signal was seen in the Purkinje cell layer of the cerebellum, in basket cells, and individual neuronal cell bodies in the dentate nucleus (one of the four deep nuclei in the cerebellum). Message for the heterotrimeric intracellular PAF-AH was also observed in these cell types. Additionally, plasma PAF-AH signal was seen on individual cells in the granular and molecular layers of the grey matter.
Hippocampus. In the human hippocampus section, individual cells throughout the section, which appear to be neuronal cell bodies, showed strong signal. These were identified as polymorphic cell bodies and granule cells.
Message for the heterotrimeric intracellular PAF-AH was also observed in hippocampus.
Brain stem. On both human and mouse brain stem sections, there was strong signal on individual cells in the grey matter.
Cortex. On human cortex sections taken from the cerebral, occipital, and temporal cortexes, and on mouse whole brain sections, individual cells throughout the cortex showed strong signal. These cells were identified as pyramidal, stellate and polymorphic cell bodies. There does not appear to be differentiation in the expression pattern in the different layers of the cortex. These in situ hybridization results are different from the results for cerebral cortex obtained by Northern blotting.
The difference is likely to result from the greater sensitivity of in situ hybridization compared to that of Northern blotting. As in the cerebellum and hippocampus, a similar pattern of expression of the heterotrimeric intracellular PAF-AH was observed.
Pituitary. Somewhat weak signal was seen on scattered individual cells in the pars distalis of the human tissue section.
B. Human colon Both normal and Crohn's disease colons displayed signal in the lymphatic aggregations present in the mucosa of the sections, with the level of signal WO 99/09147 PCTNS971142i2 being slightly higher in the section from the Crohn's disease patient. The Crohn's disease colon also had strong signal in the lamina propria. Similarly, a high level of signal was observed in a diseased appendix section while the normal appendix exhibited a lower but still detectable signal. The sections from the ulcerative colitis patient showed no evident signal in either the lymphatic aggregations or the lamina propna.
C. Human tonsil and th, Strong signal was seen on scattered groups of individual cells within the germinal centers of the tonsil and within the thymus.
D. Human lymph node Strong signal was observed on the lymph node section taken from a normal donor, while somewhat weak signal was observed in the lymph nodules of the section from a donor with septic shock.
E. Human small intestine Both normal and Crohn's disease small intestine had weak signal in the Peyer's patches and lamina propria in the sections, with the signal on the diseased tissue slightly higher.
F. Human spleen and lung Signal was not observed on any of the spleen (normal and splenic abcess sections) or lung (normal and emphysema sections) tissues.
G. Mouse spinal cord In both the normal and EAE stage 3 spinal cords, there was strong signal in the grey matter of the spinal cord, with the expression being slightly higher in the EAE stage 3 spinal cord. In the EAE stage 3 spinal cord, cells in the white matter and perivascular cuffs, probably infiltrating macrophages and/or other leukocytes, showed signal which was absent in the normal spinal cord.

F. Mouse embryos In the day 11 embryo signal was apparent in the central nervous system in the fourth ventricle, which remained constant throughout the embryo time course as it developed into the cerebellum and brain stem. As the embryos matured, signal became apparent in central nervous system in the spinal cord (day 12), primary cortex and ganglion Gasseri (day 14), and hypophysis (day 16). Signal was observed in the peripheral nervous system (beginning on day 14 or 15) on nerves leaving the spinal cord, and, on day 17, strong signal appeared around the whiskers of the embryo.
Expression was also seen in the liver and lung at day 14, the gut (beginning on day 15), and in the posterior portion of the mouth/throat (beginning on day 16).
By day 18, the expression pattern had differentiated into signal in the cortex, hindbrain (cerebellum and brain stem), nerves leaving the lumbar region of the spinal cord, the posterior portion of the mouth/throat, the liver, the kidney, and possible weak signal in the lung and gut.
G. Summary PAF-AH mRNA expression in the tonsil, thymus, lymph node, Peyer's patches, appendix, and colon lymphatic aggregates is consistent with the conclusions that the probable predominant in vivo source of PAF-AH is the macrophage because these tisues all are populated with tissue macrophages that serve as phagocytic and antigen-processing cells.
Expression of PAF-AH in inflamed tissues would be consistent with the hypothesis that a role of monocyte-derived macrophages is to resolve inflammation. PAF-AH would be expected to inactivate PAF and the pro-inflammatory phospholipids, thus down-regulating the inflammatory cascade of events initiated by these mediators.
PAF has been detected in whole brain tissue and is secreted by rat cerebellar granule cells in culture. In vitro and in vivo experiments have demonstrated that PAF binds a specific receptor in neural tissues and induces functional and phenotypic changes such as calcium mobilization, upregulation of transcription activating genes, and differentiation of the neural precursor cell line, PC12. These observations suggested a physiologic role for PAF in the brain, and i i consistent with this, recent experiments using hippocampal tissue section cultures and PAF analogs and antagonists have implicated PAF as an important retrograde messenger in hippocampal long term potendation. Therefore, in addition to its pathological effect in inflammation, PAF appears to participate in routine neuronal signalling processes. Expression of the extracellular PAF-AH. in the brain may seine to regulate the duration and magnitude of PAF-mediated signalling. ~~
Example 13 Monoclonal antibodies specific for recombinant human plasma PAF-AH
were generated using E. coti produced PAF AH as an immunogen.
Mouse X1342 was injected on day 0, day 19, and day 40 with recombinant PAF-AH. For the prefusion boost, the mouse was injected with the immunogen in PBS, four days later the mouse was sacrificed and its spleen removed sterilely and placed in lOml serum free RPMI 1640. A single-cell suspension was formed by grinding the spleen between the frosted ends of two glass microscope slides submerged in serum free RPMI 1640, supplemented with 2 mM L-glutamine;
1 mM sodium pyruvate, 100 units/ml penicillin, and 100 p,gl ml streptomycin (RPMI) ,.*
(Gibco, Canada). The cell suspension was filtered thmugh sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free ItPMI. Thymocytes taken from 3 naive Balb/c mice were prepared in a similar manner. NS-1 myeloma cells, kept in log phase in RPMI with 1196 fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described in the foregoing paragraph.
One x 108 spleen cells were combined with 2.0 x 107 NS-i cells, centrifuged and the supernatant was aspirated. The cell pellet was dislodged by tapping the tube and 1 ml of 37' C PEG 1500 (50 ~ in 75mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 7 ml of serum free ItPMI over 7 minutes. An additional 8 ml RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet 'was resuspended in 200 ml ItPMI
containing *Trade-mark 15 % FES, 100 ~cM sodium hypoxanthine, 0.4 ~uM aminopterin, 16 ~M thymidine (HAT) (Gibco), 25 unitslml IL-6 (Boehringer Mannheim) and 1.5 x 106 thymocyteslml and plated into 10 Corning flat bottom 96 well tissue culture plates (Corning, Corning New York).
On days 2, 4, and 6, after the fusion, 100 ~cl of medium was removed from the wells of the fusion plates and replaced with fresh medium. On day 8, the fusion was screened by ELISA, testing for the presence of mouse IgG binding to recombinant PAF-AH. Immulon 4 plates (Dynatech, Cambridge, MA) were coated for 2 hours at 37 ° C with 100 ng/well recombinant PAF-AH diluted in 25mM TRIS, pH 7.5. The coating solution was aspirated and 200u1/well of blocking solution [0.5 % fish skin gelatin (Sigma) diluted in CMF-PBS] was added and incubated for 30 minutes at 37 ° C. Plates were washed three times with PBS with 0.05 % Tween (PBST) and 50 wl culture supernatant was added. After incubation at 37 ° C for 30 minutes, and washing as above, 50 ~,I of horseradish peroxidase conjugated goat anti-15 mouse IgG(fc) (Jackson ImmunoResearch, West Grove, Pennsylvania) diluted 1:3500 in PBST was added. Plates were incubated as above, washed four times with PBST
and 100 ~cL substrate, consisting of 1 mglml o-phenylene diamine (Sigma) and 0.1 ~I/ml 30% H202 in 100 mM Citrate, pH 4.5, was added. The color reaction was stopped in 5 minutes with the addition of 50 ~.l of 15 % H2S04. A490 was read onn 20 a plate reader (Dynatech).
Selected fusion wells were cloned twice by dilution into 96 well plates and visually scoring the number of colonies/well after 5 days. Hybridomas cloned were 90D1E, 90E3A, 90E6C, 90G11D (ATCC HB 11724), and 90F2D (ATCC HB
1 /725).
The monoclonal antibodies produced by hybridomas were isotyped using the Isostrip system {Boehringer Mannheim, Indianapolis, II~. Results showed that the monoclonal antibodies produced by hybridomas from fusion 90 were all IgG 1.
All of the monoclonal antibodies produced by hybridomas from fusion 90 functioned well in ELISA assays but were unable to bind PAF-AH on Western blots. To generate antibodies that could recognize PAF-AH by Western, mouse #1958 was immunized with recombinant enzyme. Hybridomas were generated as described for fusion 90 but were screened by Western blotting rather than ELISA to identify Western-competent clones.
For Western analyses, recombinant PAF-AH was mixed with an equal volume of sample buffer containing 125mM Tris, pH 6. 8, 4 % SDS, 100mM
dithiothreitol and 0.05 % bromphenol blue and boiled for five minutes prior to loading onto a 12% SDS polyacrylamide gel (Novex). Following electrophoresis at 40 mAmps, proteins were electrotransferred onto a polyvinylidene fluoride membrane (Pierce) for 1 hour at 125 V in 192mM glycine, 25mM Tris base, 20 % methanol, and 0.41 % SDS. The membrane was incubated in 20mM Tris, 100mM NaCI (TBS) containing 5 % bovine senlm albumin (BSA, Sigma) overnight at 4°C. The blot was incubated 1 hour at room temperature with rabbit polyclonal antisera diluted i/8000 in TBS containing 5 % BSA, and then washed with TBS and incubated with alkaline phosphatase-conjugated goat anti-mouse IgG in TBS containing 5 % BSA for 1 hour at room temperature. The blot was again washed with TBS then incubated with 1 S 0.02 % S-bromo-4-chloro-3-indolyl phosphate and 0.03 % nitroblue tetrazolium in 100mM Tris-HCI, pH 9.5, 100mM NaCI, and SmM MgCl2. The reaction was stopped with repeated water rinses.
Selected fusion wells, the supernatants of which were positive in Western analyses, were processed as described above. Hybridoma 143A reacted with PAF-AH in Western blots and was cloned (ATCC HB 11900).
Polyclonal antisera specific for human plasma PAF-AH was raised in rabbits by three monthly immunizations with 100 ~.g of purified recombinant enzyme in Fmend's adjuvant.
Example 14 Experimental studies were performed to evaluate the in vivo therapeutic effects of recombinant PAF-AH of the invention on acute inflammation using a rat foot edema model [Henriques et al., Br. J. Pharmacol., 106: 579-582 (1992)].
The results of these studies demonstrated that rPAF-AH blocks PAF-induced edema.
Parallel studies were done to compare the effectiveness of PAF-AH with two commercially available PAF antagonists.

A. Preparation of PAF-AH
E. coli transformed with the PAF-AH expression vector puc trp AH
were lysed in a microfluidizer, solids were centrifuged out and the cell supernatants were loaded onto a S-Sepharose column (Pharmacia). The column was washed extensively with buffer consisting of 50mM NaCI, lOmM CHAPS, 25mM MES and 1mM EDTA, pH 5.5. PAF-AH was eluted by increasing the NaCI concentration of the buffer to 1M. Affinity chromatography using a Blue Sepharose column (Pharmacia) was then used as an additional purification step. Prior to loading the PAF-AH preparation on the Blue Sepharose column, the sample was diluted 1:2 to reduce the NaCI concentration to 0.5M and the pH was adjusted to 7.5. After washing the Blue Sepharose column extensively with buffer consisting of 0.5M
NaCl, 25mM tris, IOmM CHAPS and 1mM EDTA, pH 7.5 the PAF-AH was eluted by increasing the NaCI concentration to 3.OM.
Purity of PAF-AH isolated in this manner was generally 95 % as assessed by SDS-PAGE with activity in the range of 5000-10,000 Ulml.
Additional quality controls done on each PAF-AH preparation included determining endotoxin levels and hemolysis activity on freshly obtained rat erythrocytes. A buffer containing 25mM Tris, lOmM CHAPS, O.SM NaCI, pH 7.5 functioned as storage media of the enzyme as well as Garner for administration. Dosages used in experiments were based on enzyme activity assays conducted immediately prior to experiments.
B. Induction of Edema Six to eight-week-old female Long Evans rats (Charles River, Wilmington, MA), weighing 180-200 grams, were used for all experiments. Prior to experimental manipulations, animals were anesthetized with a mixture of the anesthetics Ketaset (Fort Dodge Laboratories, Fort Dodge, IA), Rompun (Miles, Shawnee Mission, KS), and Ace Promazine (Aveco, Fort Dodge, IA) administered subcutaneously at approximately 2.5 mg Ketaset, 1.6 mg Rompun, 0.2 mg Ace Promazine per animal per dose. Edema was induced in the foot by administration of either PAF or zymosan as follows. PAF (Sigma #P-1402) was freshly prepared for each experiment from a 19.1 mM stock solution stored in chloroform/methanol (9:1 ) a;i;

at -20' C. Required volumes were dried down under N2, diluted 1:1000 in a buffer containing 150mM NaCI, lOmM Tris pH 7.5, and 0.25 ~ BSA, and sonicated for five minutes. Animals received 50 ~cl PAF (final dose of 0.96 nmoles) subcutaneously between the hind foot pads, and edema was assessed after 1 hour and again after 2 hours in some experiments. Zymosan A (Sigma flA-8800) was freshly prepared for each experiment as a suspension of 10 mg/ml in PBS. Animals nxeived 50 ~d of zymosan (final dose of 500 ~.g) subcutaneously between the hind foot pads and edema was assessed after 2 hours.
Edema was quantitated by measuring the foot volume immediately prior to administration of PAF or zymosan and at indicated time point post-challenge with PAF or zymosan. Edema is expressed as the increase in foot volume in milliliters.
Volume displacement measurements were made on anesthetized animals using a plethysmometer (UGO Basile, model x!'7150) which measures the displaced water volume of the immersed foot. In order to insure that foot immersion was comparable from one time point to the next, the hind feet were marked in indelible ink where the hairline meets the heel. Repeated measurements of the same foot using this technique indicate the precision to be within 5 ~ .
C. PAF-AH Administration Routes and Dosaees PAF-AH was injected locally between the foot pads, or systematically by IV injection in the tail vein. For local administration rats received 100 ~1 PAF-AH (4000-6000 U/ml) delivered subcutaneously between the right hind foot pads.
Left feet served as controls by administration of 100 ~d carrier (buffered salt solution). ~ For systemic administration of PAF-AH, rats received the indicated units of PAF-AH in 300 ~.1 of carrier administered IV in the tail vein. Controls received the appropriate volume of carrier IV in the tail vein.
D. Local Administration of PAF-AH
Rats (N=4) were injected with 100 ~cl of PAF-AH (4000-6000 U/ml) subcutaneously between the right foot pads. Left feet were injected with 100 gel carrier (buffered salt solution). Four other rats were injected only with carrier. All rats were immediately challenged with PAF via subcutaneous foot injection and foot *Trade-mark volumes assessed 1 hour post-challenge. FIGURE 6, wherein edema is expressed as average increase in foot volume (m1) ~ SEM for each treatment group, illustrates that PAF-induced foot edema is blocked by local administration of PAF-AH. The group which received local PAF-AH treatment prior to PAF challenge showed reduced inflammation compared to the control injected group. An increase in foot volume of 0.08 ml ~ 0.08 (SEM) was seen in the PAF-AH group as compared to O.b3 ~ 0.14 (SEM) for the carrier treated controls. The increase in foot volume was a direct result of PAF injection as animals injected in the foot only with carrier did not exhibit an increase in foot volume.
E. Intravenous Administration of PAF-AH
Rats (N=4 per group) were pretreated IV with either PAF-AH (2000 U in 300 ~.1 Garner) or Garner alone, 15 minutes prior to PAF challenge. Edema was assessed 1 and 2 hours after PAF challenge. FIGURE 7, wherein edema is expressed as average increase in volume (ml) ~ SEM for each treatment group, illustrates that IV administration of PAF-AH blocked PAF induced foot edema at one and two hours post challenge. The group which received 2000 U of PAF-AH given by the IV
route showed a reduction in inflammation over the two hour time course. Mean volume increase for the PAF-AH treated group at two hours was 0.10 ml ~ 0.08 (SEM), versus 0.56 ml ~ 0.11 far carrier treated controls.
F. Comparison of PAF-AH Protection in Edema Induced by PAF or Zymosan Rats (N=4 per group) were pretreated IV with either PAF-AH (2000 U in 300 ~.l Garner) or carrier alone. Fifteen minutes after pretreatment, groups received either PAF or zymosan A, and foot volume was assessed after 1 and 2 hours, respectively. As shown in FIGURE 8, wherein edema is expressed as average increase in volume (ml) ~ SEM for each treatment group, systemic administration of PAF-AH (2000 U) was effective in reducing PAF-induced foot edema, but failed to block zymosan induced edema. A mean increase in volume of 0.08 + 0.02 was seen in the PAF-AH treated group versus 0.49 ~ 0.03 for the control group.

G. Effective Dose Titration of PAF-AH Protection In two separate experiments, groups of rats (N=3 to 4 per group) were pretreated IV with either serial dilutions of PAF-AH or carrier control in a 300 ~,1 volume, 15 minutes prior to PAF challenge. Both feet were challenged with PAF
(as described above) and edema was assessed after 1 hour. FIGURE 9 wherein edema is expressed as average increase in volume (ml) ~ SEM for each treatment group, illustrates the increase in protection from PAF-induced edema in rats injected with increasing dosages of PAF-AH. In the experiments, the ID50 of PAF-AH given by the IV route was found to be between 40 and 80 U per rat.
H. I_n Vivo Efficacv of PAF-AH as a Function of Time After Administration In two separate experiments, two groups of rats (N=3 to 4 per group) were pretreated IV with either PAF-AH (2000 U in 300 ~cl carrier) or carrier alone.
After administration, groups received PAF at time points ranging from 15 minutes to 47 hours post PAF-AH administration. Edema was then assessed 1 hour after PAF
challenge. As shown in FIGURE 10, wherein edema is expressed as average increase in volume (ml) ~ SEM for each treatment group, administration of 2000 U of PAF-AH protects rats from PAF induced edema for at least 24 hours.
I. Pharmacokinetics of PAF-AH
Four rats received 2000 U of PAF-AH by IV injection in a 300 ~cl volume. Plasma was collected at various time points and stored at 4°C
and plasma concentrations of PAF-AH were determined by ELISA using a double mAb capture assay. In brief, monoclonal antibody 90G1ID (Example 13) was diluted in SOmM
carbonate buffer pH 9.6 at 100 ng/ml and immobilized on Immulon 4 EI,ISA
plates overnight at 4 ° C. After extensive washing with PBS containing 0.05 %
Tween 20, the plates were blocked for 1 hour at room temperature with 0.5 % fish skin gelatin (Sigma) diluted in PBS. Serum samples diluted in PBS with lSmM CHAPS were added in duplicate to the washed ELISA plate and incubated for 1 hour at room temperature. After washing, a biotin conjugate of monoclonal antibody 90F2D
(Example 13) was added to the wells at a concentration of 5 ~.g/ml diluted in PBS and incubated for 1 hour at room temperature. After washing, SO wl of a 1:1000 dilution of ExtraAvidin (Sigma) was added to the wells and incubated for 1 hour at room temperature. After washing, wells were developed using OPD as a substrate and quantitated. Enzyme activity was then calculated from a standard curve. FIGURE
11, wherein data points represent means ~ SEM, shows that at one hour plasma enzyme levels approached the predicted concentration based on a 5-6 ml plasma volume for 180-200 gram rats, mean = 374 U/ml ~ 58.2. Beyond one hour plasma levels steadily declined, reaching a mean plasma concentration of 19.3 U/ml ~
3.4 at 24 hours, which is still considerably higher than endogenous rat PAF-AH
levels which have been found to be approximately 4 U/mI by enzymatic assays.
J. Effectiveness of PAF-AIi Versus PAF Antagonists Groups of rats (N=4 per group) were pretreated with one of three potential antiinflammatories: the PAF antagonist CV3988 (Biomol #L-103) administered IP (2 mg in 200 ~.1 EtOH), the PAF antagonist Alprazolam (Sigma #A-8800) administered IP (2 mg in 200 ~,l EtOH), or PAF-AH (2000 U) administered IV. Control rats were injected IV with a 300 ~,l volume of carrier. The PAF
antagonists were administered IP because they are solubilized in ethanol. Rats injected with either CV3988 or Alprazolam were challenged with PAF 30 minutes after administration of the PAF antagonist to allow the PAF antagonist to enter circulation, while PAF-AH and Garner-treated rats were challenged 15 minutes after enzyme administration. Rats injected with PAF-AH exhibited a reduction in PAF-induced edema beyond that afforded by the established PAF antagonists CV3988 and Alprazolam. See FIGURE 12 wherein edema is expressed as average increase in volume (ml) t SEM for each treatment group.
In summary, rPAF-AH is effective in blocking edema mediated by PAF in vivo. Administration of PAF-AH products can be either local or systemic by IV injection. In dosing studies, IV injections in the range of 160-2000 U/rat were found to dramatically reduce PAF mediated inflammation, while the ID50 dosage appears to be in the range of 40-80 Ulrat. Calculations based on the plasma volume for 180-200 gram rats predicts that a plasma concentration in the range of 25-40 U/ml should block PAF-elicited edema. These predictions are supported by preliminary pharmacokinetic studies. A dosage of 2000 U of PAF-AH was found to be effective in blocking PAF mediated edema for at least 24 hours. At 24 hours following administration of PAF-AH plasma concentrations of the enzyme were found to be approximately 25 U/ml. PAF-AH was found to block PAF-induced edema more effectively than the two known PAF antagonists tested.
Collectively, these results demonstrate that PAF-AH effectively blocks PAF induced inflammation and may be of therapeutic value in diseases where PAF
is the primary mediator.
Example IS
Recombinant PAF-AH of the invention was tested in a second in vivo model, PAF-induced pleurisy. PAF has previously been shown to induce vascular leakage when introduced into the pleural space [Henriques et al. , supra] .
Female rats (Charles River, 180-200 g) were injected in the tail vein with 200 ~cl of 1 %
Evans blue dye in 0.9 % with 300 ~,1 recombinant PAF-AH (1500 ~mol/ml/hour, prepared as described in Example I4) or with an equivalent volume of control buffer.
Fifteen minutes later the rats received an 100 ~cl injection of PAF (2.0 nmol) into the pleural space. One hour following PAF challenge, rats were sacrificed and the pleural fluid was collected by rinsing the cavity with 3 ml heparinized phosphate buffered saline.
The degree of vascular leak was determined by the quantity of Evans blue dye in the pleural space which was quantitated by absorbance at 620 nm. Rats pretreated with PAF-AH were found to have much less vascular leakage than control animals (representing more than an 80% reduction in inflammation).
The foregoing results support the treatment of subjects suffering from pleurisy with recombinant PAF-AH enzyme of the invention.
Example 16 Recombinant PAF-AH enzyme of the invention was also tested for efficacy in a model of antigen-induced eosinophil recruitment. The accumulation of eosinophils in the airway is a characteristic feature of late phase immune responses which occur in asthma, rhinitis and eczema. BALB/c mice (Charles River) were sensitized by two intraperitoneal injections consisting of 1 ~cg of ovalbumin (OVA) in 4 mg of aluminum hydroxide (Imject alum, Pierce Laboratories, Rockford, IL) given at a 2 week interval. Fourteen days following the second immunization, the sensitized mice were challenged with either aerosolized OVA or saline as a control.
Prior to challenge mice were randomly placed into four groups, with four micelgroup. Mice in groups 1 and 3 were pretreated with 140 ~1 of control buffer consisting of 25mM tris, 0.5M NaCI, 1mM EDTA and 0.1 % Tween 80 given by intravenous injection. Mice in groups 2 and 4 were pretreated with 750 units of PAF-AH {activity of 5,500 units/mI given in 140 ~1 of PAF-AH buffer). Thirty minutes following administration of PAF-AH or buffer, mice in groups 1 and 2 were exposed to aerosolized PBS as described below, while mice in groups 3 and 4 were exposed to aerosolized OVA. Twenty-four hours later mice were treated a second time with either 140 ~cl of buffer (groups 1 and 3) or 750 units of PAF-AH in 140 ~cl of buffer (groups 2 and 4) given by intravenous injection.
Eosinophil infiltration of the trachea was induced in the sensitized mice by exposing the animals to aerosolized OVA. Sensitized mice were placed in 50 ml conical centrifuge tubes (Corning) and forced to breath aerosolized OVA (50 mg/ml) dissolved in 0.9 % saline for 20 minutes using a nebulizer (Model 646, DeVilbiss Corp., Somerset, PA). Control mice were treated in a similar manner with the exception that 0.9 % saline was used in the nebulizer. Forty-eight hours following the exposure to aerosolized OVA or saline, mice were sacrificed and the tracheas were excised. Tracheas from each group were inbeded in OCT and stored at -70 ° until sections were cut.
To evaluate eosinophil infiltration of the trachea, tissue sections from the four groups of mice were stained with either Luna solution and hematoxylin-eosin solution or with peroxidase. Twelve 6 ~,m thick sections were cut from each group of mice and numbered accordingly. Odd numbered sections were stained with Luna stain as follows. Sections were fixed in formal-alcohol for 5 minutes at room temperature, rinsed across three changes of tap water for 2 minutes at room temperature then rinsed in two changed of dH20 for I minute at room temperature.
Tissue sections were stained with Luna stain 5 minutes at room temperature (Lung stain consisting of 90 ml Weigert's Iron hematoxylin and 10 ml of 1 % Biebrich Scarlet). Stained slides were dipped in 1 % acid alcohol six times, rinsed in tap water for 1 minute at room temperature. dipped in 0.5 % lithium carbonate solution five times and rinsed in running tap water for 2 minutes at room temperature.
Slides were dehydrated across 70 %-95 %-100 % ethanol 1 minute each, at room temperature, then cleared in two changes of xylene for 1 minute at room temperature and mounted in Cytoseal 60.
For the peroxidase stain, even numbered sections were fixed in 4 °
C
acetone for 10 minutes and allowed to air dry. Two hundred ~.1 of DAB solution was added to each section and allowed to sit 5 minutes at room temperature. Slides were rinsed in tap water for 5 minutes at room temperature and 2 drops of 1 % osmic acid was applied to each section for 3-5 seconds. Slides were rinsed in tap water for 5 minutes at room temperature and counterstained with Mayers hematoxylin at 25 ° C
at room temperature. Slides were then rinsed in running tap water for S
minutes and dehydrated across 70 %-95 % -100 % ethanol 1 minute each at room temperature.
Slides were cleared through two changes of xylene for 1 minute each at room temperature and mounted in Cytoseal 60.
The number of eosinophils in the submucosal tissue of the trachea was evaluated. Trachea from mice from groups 1 and 2 were found to have very few eosinophils scattered throughout the submucosal tissue. As expected tracheas from mice in group 3, which were pretreated with buffer and exposed to nebulized OVA, were found to have large numbers of eosinophils throughout the submucosal tissue.
In contrast, the tracheas from mice in group 4, which were pretreated with PAF-AH
and exposed to nebuiized OVA were found to have very few eosinophils in the submucosal tissue comparable to what was seen in the two control groups, groups 1 and 2.
Thus, therapeutic treatment with PAF-AH of subjects exhibiting a late phase immune response involving the accumulation of eosinophils in the airway, such as that which occurs in asthma and rhinitis is indicated.
Example 17 A PAF-AH product of the invention was also tested in two different rat models for treatment of necrotizing enterocolitis (NEC), an acute hemorrhagic necrosis of the bowel which occurs in low birth weight infants and causes a significant morbidity and mortality. Previous experiments have demonstrated that treatment with glucocorticoids decreases the incidence of NEC in animals and in premature infants, and the activity of glucocorticoids has been suggested to occur via an increase in the activity of plasma PAF-AH.
A. Activity in Rats With NEC Induced by PAF Challenge 1. Prevention of NEC
A recombinant PAF-AH product, rPH.2 (25,500 units in 0.3 ml, groups 2 and 4), or vehicle/buffer alone (25mM tris, O.SM NaCI, 1mM EDTA and 0.1 % Tween 80) (groups 1 and 3) was administered into the tail veins of female Wistar rats (n =3) weighing 180-220 grams. Either BSA (0.25 % )-saline (groups and 2) or PAF (0.2 ~ug/100 gm) suspended in BSA saline (groups 3 and 4) was injected into the abdominal aorta at the level of the superior mesenteric artery 15 minutes after rPH.2 or vehicle injection as previously described by Furukawa, et al.
(J.~'ediatr.Res. 34:237-241 (1993)). The small intestines were removed after 2 hours from the ligament of Trietz to the cecum, thoroughly washed with cold saline and examined grossly. Samples were obtained from microscopic examination from the upper, middle and lower portions of the small intestine. The tissues were fixed in buffered formalin and the sample processed for microscopic examination by staining with hematoxylin and eosin. The experiment was repeated three times.
Gross findings indicated a normal appearing bowel in groups treated with the vehicle of BSA saline. Similarly, rPH.2 injected in the absence of PAF had no effect on the gross findings. In contrast, the injection of PAF into the descending aorta resulted in rapid, severe discoloration and hemorrhage of the serosal surface of the bowel. A similar hemorrhage was noted when a section of the small bowel was examined on the mucosal side and the intestine appeared to be quite necrotic.
When rPH.2 was injected via the tail vein 15 minutes prior to the administration of PAF
into the aorta, the bowel appeared to be normal.
Upon microscopic examination, the intestine obtained from groups l, 2 and 4 demonstrated a normal villous architecture and a normal population of cells within the lamina propria. In contrast, the group treated with PAF alone showed a full thickness necrosis and hemorrhage throughout the entire mucosa.

The plasma PAF-AH activities were also determined in the rats utilized in the experiment described above. PAF-AH activity was determined as follows.
Prior to the tail vein injection, blood samples were obtained. Subsequently blood samples were obtained from the vena cava just prior to the injection of PAF
and at the time of sacrifice. Approximately 50 ~.1 of blood was collected in heparinized capillary tubes. The plasma was obtained following centrifugation (980 x g for minutes). The enzyme was assayed as previously described by Yasuda and Johnston, Endocrinology, 130:708-716 (1992).
The mean plasma PAF-AH activity of all rats prior to injection was found to be 75.5 ~ 2.5 units (1 unit equals I nmoles x min-1 x mi-1 plasma).
The mean plasma PAF-AH activities 15 minutes following the injection of the vehicle were 75.2 ~ 2.6 units for group 1 and 76.7 ~ 3.5 units for group 3. After 15 minutes, the plasma PAF-AH activity of the animals injected with 25,500 units rPH.2 was 2249 ~ 341 units for group 2 and 2494 ~ 623 units for group 4. The activity of groups 2 and 4 remained elevated (1855 ~ 257 units) until the time of sacrifice (2 114 hours after rPH.2 injection) (Group 2 = 1771 ~ 308; Group 4 = 1939 ~
478). These results indicate that plasma PAF-AH activity of the rats which were injected with the vehicle alone (groups I and 3) did not change during the course of the experiment. All the animals receiving the PAF injection alone developed NEC
while all rats that were injected with rPH.2 followed by PAF injection were completely protected.
2. Dose-Dependency of Prevention of NEC
In order to determine if the protection against NEC in rats was dose dependent, animals were treated with increasing doses of rPH.2 15 minutes prior to PAF administration. Initially, rPH.2, ranging from 25.5 to 25,500 units were administered into the tail vein of rats. PAF (0.4 ~.g in 0.2 ml of BSA-saline) was subsequently injected into the abdominal aorta 15 minutes after the administration of rPH.2. The small intestine was removed and examined for NEC development 2 hours after PAF administration. Plasma PAF-AH activity was determined prior to the exogenous administration of the enzyme, and 15 minutes and 2 1/4 hours after rPH.2 administration. The resutts are the mean of 2-5 animals in each group.

Gross findings indicated that all rats receiving less than 2,000 units of the enzyme developed NEC. Plasma PAF-AH activity in animals receiving the lowest protective amount of enzyme (2040 units) was 363 units per ml of plasma after 15 minutes, representing a five-fold increase over basal levels. When rPH.2 was administered at less than 1,020 total units, resultant plasma enzyme activity averaged approximately 160 or less, and all animals developed NEC.
3. Duration of Protection Against- NEC
In order to determine the length of time exogenous PAF-AH product afforded protection against development of NEC, rats were injected once with a fixed amount of the enzyme via the tail vein and subsequently challenged with PAF at various time points. rPH.2 (8,500 units in 0.3 ml) or vehicle alone was administered into the tail vein of rats, and PAF (0.36 dug in 0.2 ml of BSA-saline) was injected into the abdominal aorta at various times after the enzyme administration. The small intestines were removed 2 hours after the PAF injection for gross and histological examinations in order to evaluate for NEC development. Plasma PAF-AH
activities were determined at various times after enzyme administration and two hours after PAF administration. The mean value ~ standard error for enzyme activity was determined for each group.
Results indicated that none of the rats developed NEC within the first eight hours after injection of rPH.2, however 100 % of the animals challenged with PAF at 24 and 48 hours following injection of the enzyme developed NEC.
4. Reversal of NEC
In order to determine if administration of PAF-AH product was capable of reversing development of NEC induced by PAF injection, 25,500 units of enzyme was administered via injection into the vena cava two minutes following PAF
administration (0.4 ~cg). None of the animals developed NEC. However, when rPH.2 was administered via this route 15 minutes after the PAF injection, all animals developed NEC, consistent with the rapid time course of NEC development as induced by the administration of PAF previously reported Furukawa et al.
[supra].

The sum of these observations indicate that a relatively small (five-fold) increase in the plasma PAF-AH activity is capable of preventing NEC. These observations combined with previous reports that plasma PAF-AH activity in fetal rabbits [Maki, et al., Proc.Natl.Acad.Sci. (USA) 85:728-732 (1988)] and premature infants [Caplan, et al. , J. Pediatr. 116:908-964 ( 1990)] has been demonstrated to be relatively low suggests that prophylactic administration of human recombinant PAF-AH products to Iow birth weight infants may be useful in treatment of NEC.
B. Activity in a Neonatal Model of NEC
The efficacy of a PAF-AH product, rPH.2, was evaluated as follows in an NEC model in which newborn rats are stressed by formula feeding and asphyxia, two Gammon risk factors for the disease in humans. In this model, approximately 70-80% of the animals develop gross and microscopic intestinal injury similar to neonatal NEC by the third day of life. Newborn rats were obtained from pregnant Sprague-Dawley rats (Harlan Sprague-Dawley, Indianapolis, III that were anesthetized with C02 and delivered via abdominal incision. Newborn animals were collected, dried, and maintained in a neonatal incubator during the entire experiment.
First, separate groups of animals were used to assess the dosing and absorption characteristics of rPH.2. Normal newborn rat pups were given one of three different enteral or intraperitoneal doses of rPH.2 {3~, 15~, or 75~) at time 0, and blood was collected at 1 hour, 6 hours, or 24 hours later for assessment of plasma PAF-AH activity. PAF-AH activity was measured using a substrate incubation assay [Gray et al., Nature, 374:549 (1995)] and an ELISA utilizing an anti-human rPAF-AH monoclonal antibody for each sample (90F2D and 90G11D, described in Example i3). For selected samples, immunohistochemical analysis was performed using two different monoclonal antibodies developed against human rPAF-AH (90F2D and 90GlID, described in Example 13). Immunohistochemistry was done with standard techniques using a 1:100 dilution of the antibody and overnight incubations.
Following enteral dosing of rPH.2 in normal newborn rats, there was no measurable plasma PAF-AH activity at any time point using either the substrate incubation assay or the ELISA technique. With intraperitoneal administration of rPl<i.2, significant circulating PAF-AH activity was measurable using both methods by 1 hour after dosing, and this activity peaked at 6 hours. Higher doses of rPH.2 (from 3 to 75~, 10 to 250 In resulted in higher plasma PAF-AH activity.
Immunohistochemical analysis revealed the presence of rPAF-AH product in the epithelial cells of the intestinal mucosa following enteral administration.
The reactivity clustered mostly in the intestinal villi with minimal staining present in the crypt cells. There was more staining in the ileum than jejunum, and some rPAF-AH
product was immunochemically identified in portions of colon. There was no demonstrable staining in any control samples or in specimens recovered from animals dosed via the intraperitoneal route. Thus, enteral administration of rPAF-AH
product resulted in local mucosal epithelial accumulation of the enzyme without any measurable systemic absorption, while, in contrast, intraperitoneal administration of rPAF-AH product resulted in high circulating enzyme levels but no local mucosal accumulation.
In the NEC model, NEC was induced in newborn rats according to Capian et al., Pediatr. Pathol., 14:1017-1028 (1994). Briefly, animals were fed with newborn puppy formula reconstituted from powder (Esbiliac, Borden Inc) every three hours via a feeding tube. The feeding volume began at 0.1 ml/feed initially and advanced as tolerated to 0.4 ml/feed by the 4th day of the protocol. All animals were challenged with asphyxial insults twice daily by breathing 100 % nitrogen for seconds in a closed plastic chamber followed by exposure to cold (4°C) for 10 minutes. Bowel and bladder function was stimulated with gentle manipulation after every feeding. Animals were maintained for 96 hours or until they showed signs of distress. Morbid animals had abdominal distention, bloody stools, respiratory distress, cyanosis, and lethargy, and were euthanized via decapitation. After sacrifice, the intestine of each rat was examined grossly for signs of necrosis and then formalin-fixed for later histological analysis. Specimens were paraffin-embedded, sectioned with a microtome, stained with hematoxylin and eosin, and examined in a blinded fashion by two observers. Intestinal injury was scored as 1 + for epithelial cell lifting or separation, 2+ for sloughing of epithelial cells to mid villous level, 3+
for necrosis of entire villi, and 4+ for transmural necrosis.

To assess the efficacy of rPH.2, three different groups of rats were treated with the compound via enteral delivery, intraperitoneal delivery or both. The rPH.2 preparation had 0.8 mg/ml protein and approximately 4000 Units/mg PAF-AH
activity, with a < 0.5 EU/mg endotoxin/protein ratio. Enterally dosed animals were given 25~ (80 U) of rPH.2 via the orogastric tube diluted into each feeding (every three hours). Intraperitoneally dosed animals were given 75~ by intraperitoneal injection twice daily. Control animals received appropriate volumes of buffer (20 mM NaP04, pH 7.4) without the rPH.2 and were studied simultaneously with each experimental group. Mortality and signs of NEC were evaluated for each treatment group, and differences were analyzed statistically using Fischer's Exact test.
A p-value of < 0.05 was considered significant. Results are shown in Table 9 below.
Table 9 NEC Death Control (i.p. admin.) 7110 8/10 rPH.2 (240 U i.p. twice daily) 6/11 8/11 IS Control (enteral admin.) 19/26 21126 rPH.2 (80 U enterally every 3 hours) 6/26 7/26 Control (i.p.+enteral admin.) 10/i7 12/17 rPH.2 (240 U i.p. twice daily and 3/14 7114 80 U enteraIly every 3 hours) Data represent cumulative results from four different experiments for i.p.
dosing, four experiments for enteral dosing, and three experiments for i.p. +enteral dosing.
Enteral rPH.2 administration significantly reduced the incidence of both NEC and death compared to control animals. Results from four different enterally-dosed experiments showed that pretreatment with rPH.2 decreased NEC from 19/26 (control) to 6/26 (p < 0.001). Intestinal injury was variable among treated and control animals, but in most cases was characterized by midvillous necrosis in some segments. total villous necrosis in other areas, occasional areas of transmural necrosis, and remaining portions of normal intestinal histology. The worst degree of NEC in treated animals and control animals with intestinal injury was similar (median score 2.8 in controls vs. 2.4 in rPH.2-treated rats, p > 0.05).

Intlaperitoneal dosing with rPH.2 had no significant impact on NEC
or death in this model. 'The onset of symptoms was similar between this group and controls (40 t 5 hours in controls vs 36 ~ 7 hours in rPH.2-treated rats) and the degree of NEC in both groups was similar (median score 2.6 in controls vs. 2.5 in rPH.2-treated rats).
Additional experiments were done in which rats were dosed both enterally and intraperitoneally with rPH.2 at the same doses as the single treatment groups (25~ of rPH.2 in each feeding every three hours, plus 75a by intraperitoneal injection twice daily). Results are shown above in Table 9. Although there were no significant differences between treated and control groups in the incidence of death, the rPH.2 treatment significantly reduced the incidence of NEC (10/17 in controls vs.
3/14 in rPH.2-treated rats, p = 0.04). Of note, 6 out of the 7 animals who died in the rPH.2-treated group had positive blood cultures for E. coli obtained just prior to death.
These results further support the protective role of PAF-AH products in a neonatal model of non-PAF-induced NEC. Enteral treatment with rPAF-AH
product prevented NEC while intraperitoneal treatment at these doses had no demonstrable effect. These findings suggest that PAF-AH product supplementation for formula-fed premature newborns at risk for NEC may reduce the incidence of this disease.
Example 18 The efficacy of PAF-AH product in a guinea pig model of acute respiratory distress syndrome CARDS) was examined.
Platelet-activating factor (PAF) injected intravenously into guinea pigs produces a profound lung inflammation reminiscent of early ARDS in humans.
Within minutes after intravenous administration of PAF, the lung parenchyma becomes congested with constricted bronchi and bronchioles [Lellouch-Tubiana et al. , supra. Platelets and polymorphonuclear neutrophils begin to marginate and cellular aggregates are easily identified along arterioles of the lung [Lellouch-Tubiana, Br. J.
Exp Path., 66:345-355 (1985)]. PAF infusion also damages bronchial epithelial cells which dissociate from the airway walls and accumulate in the airway lumens.
This damage to airway epithelial cells is consistent with hyaline membrane formation that occurs in humans during the development of ALRDS. Margination of the neutrophils and platelets is quickly followed by diapedesis of these cells into the alveolar septa and alveolar spaces of the lung. Cellular infiltrates elicited by PAF are accompanied by significant vascular leakage resulting in airway edema [Kirsch, Exp. Lung Res. , 18:447-459 (1992)J. Evidence of edema is further supported by in vitro studies where PAF induces a dose-dependent (10-1000 ng/ml) extravasation of 1251 labeled fibrinogen in perfused guinea pig lungs [Basran, Br. J. Pharmacol., 77:437 (1982)].
Based on the above observations, an ARDS model in guinea pigs was developed. A cannula is placed into the jugular vein of anaesthetized male Hartly guinea pigs (approximately 350-400 grams) and PAF diluted in a 500 ~ul volume of phosphate buffered saline with 0.25 % bovine serum albumin as a carrier (PBS-BSA) is infused over a 15 minute period of time at a total dosage ranging from 100-ng/kg. At various intervals following PAF infusion, animals are sacrificed and lung tissue is collected. In guinea pigs infused with PAF, dose dependent lung damage and inflammation is clearly evident by 15 minutes and continues to be present at 60 minutes. Neutrophils and red blood cells are present in the alveolar spaces of PAF
treated guinea pigs but absent in control or sham infused animals. Evidence of epithelial cell damage is also evident and reminiscent of hyaline membrane formation in human ALZDS patients. Protein determinations done on bronchoalveolar lavage (BAL) samples taken from guinea pigs infused with PAF shows a dramatic accumulation of protein in the inflamed lung, clear evidence of vascular Leakage.
rPH.2 was found to completely protect against PAF mediated lung injury in the guinea pig model of ARDS. Groups of guinea pigs were pretreated with either rPH.2 (2000 units in 500 ~,l) or 500 ~,I of the PAF-AH buffer only.
Fifteen minutes later these guinea pigs were infused with 400 ng/kg PAF in a 500 ~,l volume, infused over a 15 minute period. In addition, a sham group of guinea pigs was infused with 500 ~,1 of PBS-BSA. At the completion of the PAF infusion the animals were sacrificed and BAL fluid was collected by lavaging the lungs 2X with lOml of saline containing 2 ~./ml heparin to prevent clotting. To determine protein concentration in the BAL, samples were diluted 1:10 in saline and the OD 280 was determined. BAL fluid from sham guinea pigs was found to have a protein concentration of 2.10 t 1.3 mglml. In sharp contrast, BAL fluid from animals infused with PAF was found to have a protein concentration of 12.55 ~ 1.65 mg/ml.
In guinea pigs pretreated with rPH.2, BAL fluid was found to have a protein concentration of 1.13 t 0.25 mg/ml which is comparable to the sham controls and demonstrates that PAF-AH product completely blocks lung edema in response to PAF.
Example 19 The efficacy of a PAF-AH product, rPH.2, was evaluated in two different models of acute pancreatitis.
A. Activity in a Rat Pancreatitis Model Male Wistar rats (200-250 g) were purchased from Charles River Laboratories (Wilmington, MA). They were housed in a climate controlled room at 23 t 2 ° C with a 12 hour light/dark cycle and fed standard laboratory chow with water ad libitum. Animals were randomly assigned to either control or experimental groups. Rats were anesthetized with 50 mglkg pentobarbital sodium intraperitoneally, and a polyvinyl catheter (size V3, Biolab products, Lake Havasu, AZ) was placed by cutdown into the jugular vein. The catheter was tunneled subcutaneously to exit in the dorsal cervical area, and the animals were allowed to recover from anesthesia.
The rats were given free access to water but were fasted overnight.
Experiments were performed the next day on conscious animals. During the interim, catheter patency was maintained by constant infusion of saline (0.2 ml/h). On the day of the experiment, the animals were intravenously injected with rPH.2 or vehicle control, followed by an infusion of either (1) 5 ~,g/kg per hour of caerulein for 3.5 hours, or (2) 10 ~.g/kg per hour of caerulein for 5 hours, (Research Plus, Bayonne, NJ}.
Immediately after completion of the infusion, the animals were anesthetized with pentobarbital sodium, their abdomens were opened, and 5 ml of blood aspirated from the inferior versa cava for subsequent assays. They were then sacrificed by exsanguination. Serum amylase, serum lipase and serum bilirubin were measured, and the pancreas was harvested. Pieces of pancreas were either fixed in a 4%
phosphate buffered formaldehyde solution for histological examination or immediately _77_ deep frozen at -80°C for measurements of myeloperoxidase activity.
Additional pieces of pancreas were assessed for pancreatic water content and pancreatic amylase and trypsin as described below. Myeloperoxidase activity, a measure of neutrophil sequestration, was assessed in the pancreas and lung as described below.
Pulmonary vascular permeability was also assessed as described below. Statistical analysis of the data was accomplished using unpaired Student's t-test. The data reported represent means + S.E.M. of at least three different experiments. Differences in the results were considered significant when p < 0.05.
1. Pancreatic water content Pancreas pieces were blotted dry and weighed (wet weight), and were then desiccated for 34 hrs at 120°C and reweighed (dry weight).
Pancreatic water content was calculated as the difference between wet and dry weight and expressed as a percentage of the pancreatic wet weight. A rise in pancreatic water content was considered to indicate the development of edema.
2. Serum and Pancreatic Am, lY ase Amylase activity in serum was measured using 4,6-ethylidene (G7)-p nitrophenyl (G1)-a1D-maltoplaside (ET-G7PNP) (Sigma Chemical Co., St. Louis, MO) as substrate according to Pierre et al., Clin. Chem., 22:1219 (1976).
Amylase activity in pancreatic tissue homogenized in 10 mM phosphate buffer, pH 7.4, was measured using the same method.
3. Pancreatic T sin Trypsin activity was measured fluorimetrically using Boc-Gin-Ala-Arg-MCA as the substrate. Briefly, 200 ~cl of the sample and 2.7m1 of 50 mM Tris-buffer (pH 8.0) containing 150 mM NaCI, 1mM CaCl2 and 0.1 % bovine serum albumin were mixed in a cuvette. One hundred ~l of substrate was added to the sample after 20 seconds of preincubation to start the reaction. The fluorescence reading was taken (excitation 380 nm, emission 440 nm) and expressed as slope. To allow pooling of data from different experiments trypsin activity in the fractions was expressed as percent of total trypsin activity.

_78-4. Histology and Moiphometry For light microscopy, complete random cross-sections of the head, body and tail of the pancreas were fixed in 10 % neutral phosphate-buffered formalin.
Paraffin embedded-5 ~,m sections were stained with hematoxylin-eosin (H&E) and examined in a blinded fashion by an experienced morphologist. Acinar cell injury/necrosis was defined as either (a) the presence of acinar cell ghosts or (b) vacuolization and swelling of acinar cells and destruction of the histo-architecture of whole or parts of the acini, both of which had to be associated with an inflammatory reaction. The amount of acinar cell injury/necrosis and the total area occupied by acinar tissue were each quantitated morphometrically using computerized planimetric image analysis video unit (model CCD-72, Dage-MTl, Michigan city, III equipped with NIH-1200 image analysis software. Ten randomly chosen microscopic fields (125x) were examined for each tissue sample. The extent of acinar cell injury/necrosis was expressed as the percent of total acinar tissue which was occupied by areas which met the criteria for injury/necrosis.
5. Pancreas and Lune Myleoperoxidase (MPO) Activity Measurement Neutrophil sequestration in pancreas and lung was evaluated by measurement of tissue myeloperoxidase activity. Tissue samples harvested at the time of sacrifice were stored at -70 °C until the time of assay. Samples (50 mg) were thawed and homogenized in I mL of 20 mM phosphate buffer (pH 7.4) and centrifuged (10,000 x g, 10 min 4 °C). The resulting pellet was resuspended in 50 mM phosphate buffer (pH 6.0) containing 0.5 % hexadecyltrimethylammonium bromide (Sigma, St. Louis, MO) and subjected to four cycles of freezing-thawing.
The suspension was then further disrupted by sonication for 40 sec. and centrifuged {10,000 x g, 5 min. at 4 °C). A reaction mixture consisting of the extracted enzyme, 1.6 mM tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO), 80 mM sodium phosphate buffer (pH 5.4) and 0.3 mM hydrogen peroxide was incubated at 37°C
for I IO sec, and the absorbance was measured at 655 nm in a CobasBio autoanalyzer.
This absorbance was then corrected for the fraction dry weight of the tissue sample.

6. Measurement of Pulmonary Vascular Permeabilitx Obstruction of the common biliopancreatic duct also typically results in severe pancreatids-associated lung injury quantifiable by lung vascular permeability and histological examination.
Two hours before the animals were killed, an intravenous bolus injection of 5 mg/kg fluorescein isothiocyanate albumin (FITC-albumin, Sigma Chemical Co., St. Louis, MO) was given. Pulmonary microvascular permeability was evaluated by quantifying the leakage of FITC-albumin from the vascular compartment into the bronchoalveolar space. Briefly, just after sacrifice, the right bronchus was blocked using a clamp and the trachea exposed. Subsequently, the right lung was lavaged by using a cannula inserted into the trachea. Three washes of saline (60 ml lavage) were pooled and the FITC fluorescence in serum and lavage was measured at excitation 494 nm and emission 520 nm. The fluorescence ratio of lavage fluid to blood was calculated and taken as a measure of microvascular 1 S permeability in the lung. The lung was also stained with H&E and examined histologically.
7. Effect of Caerulein and rPH.2 administration Infusion of caerulein alone at 5 ~cg/kg/h for 3.5 hours resulted in a typical mild secretagogue-induced pancreatitis in the rats, which was characterized by hyperamylasemia, pancreatic edema as measured by pancreatic water content, and histological changes including marked acinar cell vacuolization and pancreatic edema.
Saline infusion in control animals did not result in any of these biochemical or histological changes. Administration of rPH.2 intravenously at doses of 5, 10 or 20 mg/kg 30 min. before the start of caerulein infusion did not significantly alter the magnitude of the changes in pancreatic edema (water content) and histology that were induced by infusion of caerulein alone. Administration of rPH.2 also had no effect on caerulein-induced activation of pancreatic trypsinogen or amylase content.
Infusion of a higher dose of caerulein, 10 ,uglkg/h for 5 hours, to rats resulted in a more severe pancreatitis, characterized relative to the controls by a more pronounced increase in serum amylase activity and pancreatic edema, a marked increase in pancreatic MPO activity, and a significant increase in trypsinogen . WO 99109147 PCTIUS97/14212 activation and amylase activity in the pancreas. Pancreatic histology indicated not only pancreatic edema and acinar cell vacuolization but also some patchy necrosis and a few infiltrating cells.
Administration of rPH.2 (5 or 10 mglkg intravenously) 30 min. before the start of caerulein (10 ~cg/kg/h) infusion ameliorated the magnitude of many of the pancreatic changes induced by the infusion of caerulein alone. Results are shown in Table 10 below. rPH.2 treatment at a dose of 5mglkg resulted in decrease of serum amylase activity (from 10984 t 1412 to 6763 t 1256). The higher 10 mg/kg dose of rPH.2 did not result in further improvement of hyperamylasemia. Treatment with either 5 or 10 mg/kg rPH.2 also resulted in some decrease in caerulein-induced development of pancreatic edema as measured by water content (90.6110.27 for caerulein alone vs. 88.21 X0.61 for caerulein + 5 mglkg rPH.2). The 5 mg/kg dose of rPH.2 provided a significant amelioration of pancreatic MPO activity (2.92+0.32 fold increase over controls for caerulein alone vs. 1.19+0.21 for caerulein with rPH.2, p < 0.05). Higher doses of rPH.2 did not result in further improvement of MPO activity. Neither dose of rPH.2 significantly altered the extent of trypsinogen activation or the amylase content in the pancreas. Pancreatic histology indicated some improvement in microscopic necrosis and infiltration after rPH.2 pretreatment.
Pancreatitis associated lung injury has been observed both clinically and in several models of pancreatitis. Infusion of caerulein at 5 ~cg/kg/h for 3.5 h, which resulted in a mild form of pancreatitis, did not result in significant injury to the lungs.
However, infusion of caerulein at 10 ~,g/kg/h for 5 hours, which resulted in more severe pancreatitis, also resulted in lung injury quantified by increased lung vascular permeability (0.3110.04 to 0.7910.09), lung MPO activity (indicating neutrophil sequestration) and neutrophil infiltration on histological examination.
Administration of rPH.2 at a dose of 5 mg/kg 30 min prior to caerulein infusion significantly ameliorated the rise in lung MPO activity induced by the infusion of caerulein alone (3.55 ~ 0.93 for caerulein alone vs. 1.51 t 0.26 for caerulein with rPH.2). rPH.2 treatment significantly decreased the severity of microscopic changes observed in the lung tissue after caerulein infusion. The caerulein-induced increase in lung vascular permeability was reduced by rPH.2 treatment, although not statistically significant. The higher 10 mg/kg dose of rPH.2 WO 99/09147 PCT/US97/i 4212 was no more effective than the lower dose in decreasing the severity of caerulein-induced lung injury.
Table 10 Caerulein CER + CER +

Control (CER) 5 mg/kg 10 mg/kg (no CER) l0~cg/kg/h rPH.2 rPH.2 Serum Amylase 961 t 174 10984 t 14126763 t 1256 8576 t 1024 (U/I) Pancreas Water Content 72.7110.64 90.610.27 88.2110.61 89.0010.94 (%wet weight) Pancreas MPO (fold 1.0 2.920.32 1.1910.21 1.420.19 increase over control) Pancreas Trypsin Activity 0.12 t 0.069.70 t 2.50 8. 33 ~ 1. 9.15 t 1.28 ( 1000xslope/

~.g DNA

Pancreas Amylase 0.280.06 0.420.07 0.450.04 0.4610.044 Content (U/~.g DNA) Lung Vascular Permeability 0.3110.04 0.790.09 0.700.09 0.700.07 (Lavage/

Serum % ) Lung MPO

(fold 1.0 3.550.93 1.51 0.26 1.640.22 increase over control) B. Activity in an Opossum Pancreatitis Model Healthy, randomly trapped American opossums (DidelpJ~is virginiana) of either sex (2.0 kg to 4.0 kg) were obtained from Scott-Haas and housed in climate controlled rooms at 23 t2°C with a 12 hour lightldark cycle and fed a standard laboratory chow with water ad libitum. After an overnight fast, the animals were anesthetized with 50mg/kg sodium-pentobarbital i.p. (Veterinary Laboratories Inc., Lenexa, KS). A celiotomy was performed through a midline incision under sterile conditions and the common bile pancreatic duct was ligated in all animals to induce acute necrotizing pancreatitis. Additionally, the cystic duct was ligated to prevent the gallbladder from serving as a bile reservoir. The animals were randomly assigned to either control or experimental groups. Starting at Day 2 after ligation of the pancreatic duct, the experimental group received 5 mg/kg body weight per day of rPH.2 (supplied in a 4mg/ml solution) intravenously via the tail vein, while the control group received an intravenous injection of the same volume of placebo vehicle only. After 1 and 2 days of treatment (at Day 3 and Day 4 after ligation of the pancreatic duct) the animals were euthanized by a sodium-pentobarbital overdose.
Blood samples were drawn from the heart for measurements of serum amylase, serum lipase and serum bilirubin, and the pancreas was harvested. Pieces of pancreas were either fixed in a 4 % phosphate buffered formaldehyde solution for histological examination or immediately deep frozen at -80°C for measurements of myeloperoxidase activity. Additional pieces of pancreas were assessed for pancreatic water content and pancreatic amylase as described above in section A of this example.
Myeloperoxidase activity, a measure of neutrophil sequestration, was assessed in the pancreas as described above. Pulmonary vascular permeability was also assessed as described above.
The results reported represent mean ~ standard error of the mean (SEM) values obtained from multiple determinations in 3 or more separate experiments. The significance of changes was evaluated using Student's t-test when the data consisted of only two groups or by analysis of variance (ANOVA) when comparing three or more groups. If ANOVA indicated a significant difference, the data were analyzed using Tukey's method as a post hoc test for the difference between groups. A p-value of < 0.05 was considered to indicate a significant difference.

Results are shown in Table 11. Obstruction of the common biliopancreatic duct resulted in severe necrotizing pancreatitis characterized by hyperamylasemia, hyperlipasemia and extensive necrosis of the pancreas.
Furthermore, obstruction of the common biliopancreatic duct was associated with an S marked increase in serum bilirubin levels. Intravenous administration of rPH.2 (5 mg/kg/day) starting at Day 2 after ligation of the pancreatic duct ameliorated the magnitude of many of the pancreatic changes induced by duct obstruction and placebo treatment alone. One day of rPH.2 treatment reduced senim amylase levels in comparison to placebo treated animals, although the difference was not statistically significant, and two days of rPH.2 treatrnent (at Day 4 after ligation of the pancreatic duct) significantly reduced serum amylase levels compared to placebo. One or two days of rPH.2 treatment reduced serum lipase levels relative to controls, although the difference was not statistically significant. Two days of rPH.2 treatment reduced pancreatic amylase content relative to controls, although one day of treatment resulted in an increase in pancreatic amylase. Treatment with rPH.2 was not observed to affect serum bilirubin levels, pancreas myeloperoxidase activity or pancreas water content.
The major characteristic histological changes induced by obstruction of the biliopancreatic duct included marked necrosis, infiltration of inflammatory cells, acinar cell vacuolization, and marked distention of the acinar lumina.
Morphometrical examination of the pancreas for acinar cell injury showed a major protective effect of rPH.2 on the pancreas after one and two days of rPH.2 treatment.
After one day of rPH.2 treatment, the acinar cell injury was reduced to about 23 %
of total acinar cell tissue, compared to 48 % injury for the placebo-treated animals.
This reduction of acinar cell injury was even more pronounced after two days of treatment, at which time rPH.2 treatment resulted in about 35 % injury of the total acinar cell tissue, compared to about 60 % injury for the placebo-treated animals.
Lung vascular permeability, quantified by FITC injection showed a highly significant difference after one and two days of rPH.2 treatment compared to placebo group. Histological examination of the lung showed severe lung injury in all placebo-treated animals. Lung injury was characterized by an extensive inflammatory response with interstitial and intraalveolar infiltration of mainly macrophages, lymphocytes and neutrophils, and by a patchy but marked interstitial edema and thickening of the alveolar membranes. Administration of rPH.2 resulted in a marked decrease of infiltration of inflammatory cells and a reduction of interstitial edema at all times.
In summary, these results showed that administration of rPH.2 intravenously at a dose of 5 mglkg/day beginning at 48 hours after ligation of the pancreatic duct resulted in significant amelioration of the increase in blood levels of amylase and lipase and acinar cell injury as quandtated by morphometric analysis of H&E stained sections, and a significant decrease in the severity of pancreatitis-induced lung injury. Administration of rPAF-AH product in this clinically relevant model of pancreatitis showed beneficial effects in decreasing the severity of pancreatitis.

Table 11 After 1 After 2 day of days of treatment treatment (Sacrifice (Sacrifice at Day at Day 3) 4) rPH.2 5mg/kg rPH.2 Placebo Placebo 5mglkg Serum bilirubin 5.490.96 7.I0~0.60 6.540.55 4.9110.79 (mg/dl) Serum amylase 5618899 4288675 653811355 3106467*

(U/l) Serum lipase 2226 t 554 1241 t 263 1424257 1023 295 (U/l) Pancreas 'Water 81.1010.56 81.520.79 80.0511.07 79.320.49 Content {%) Pancreas MPO 1345 286 1142 t 83 I 149 t 1033 t (OD/fraction dry weight) Pancreatic Amylase 70692 1101 105 95085 712 t 131 (UI ~cg DNA) Lung Vascular Permeability 0.760.09 0.21 X0.04**0.5710.13 0.230.04*

(FITC Lavagel Serum % ) Acinar Cell Injury ( % of 48 % 23 % 60 % 35 Total Acinar Tissue) *p=0.02 vs. placebo **p < 0.001 vs.
placebo Example 20 A study was conducted to evaluate the effect of a PAF-AH product, rPH.2, on neurotoxicity associated with HIV infection. Human immunodeficiency virus type 1 (HIV-I) infection of the central nervous system results in neuronal loss by apoptosis. HIV-1-infected monocytes activated by a variety of antigenic stimuli, including contact with neural cells, secrete high levels of neurotoxic pro-inflammatory cytokines, including PAF. The effect of rPH.2 on the neurotoxicity of conditioned media from HIV-infected and activated monocytes was assessed.
Monocytes were infected with HIV and activated as follows.
Monocytes were recovered from peripheral bone marrow cells (PBMC) of HIV- and hepatitis B-seronegative donors after leukopheresis and purified ( > 98 ~ ) by countercurrent centrifugal elutriation as described in Genis et al. , J. Exp.
Med. , 176:1703-1718 (1992). Cells were cultured as adherent monolayers (1 x 104 cells/ml in T-75 culture flasks) in DMEM (Sigma, St. Louis, MO) with recombinant human macrophage colony stimulatory factor (MSCF) (Genetics Institute, Inc.
Cambridge, MA). Under these conditions, monocytes differentiate into macrophages. After 7-days of culture, macrophages were exposed to HIV-1~A (accession number M60472) at a multiplicity of infection (MOI) of 0.01 infectious virions/target cell.
Under these conditions, 20-50 ~ of the monocytes were infected at 7 days after inoculation, as determined by immunofluorescent and in situ hybridization techniques [Kalter et al., J. Immunol., 146:298-306 (1991)]. All cultures were refed with fresh medium every 2 to 3 days. Five to seven days after HIV-I infection and during the peak of reverse transcriptase activity (107 cpm/ml), assessed according to Kalter et al., supra, cultures of HIV-I-infected and parallel cultures of uninfected monocytes were stimulated with LPS (10 nglml) or vehicle for 30 min. at 37°C, then snap-frozen at -80°C until used in the neurotoxicity assay.
Human cerebral cortical neuron cell cultures were established as follows. Human fetal brain tissue was obtained from the telencephalon of second trimester (13-16 weeks gestation) human fetal brain tissue according to a modified procedure of Banker and Cowan, Brain Res., 126:397-425 (1977). Briefly, brain tissue was collected, washed in 30 ml of cold Hank's BSS (containing Ca+2 and Mg+2 + 25 mM HEPES, and 5X gentamicin), separated from adherent meninges and blood, and cut into 2 mm3 pieces. The tissue was forced through a 230 uM
Nitex bag and gently triturated through a flame-polished Pasteur pipet 10-15 times.
The tissue was centrifuged at 550 rpm, 5 minutes, 4°C, and the pellet was . resuspended in 5-10 ml of MEM-hipp (D-glucose, 5 grams/liter; L-glutamine, 2 mM;
HEPES, 10 mM; Na pyruvate, 1 mM; KCI, 20 mM) containing Nl components (insulin, 5 mg/l; transferrin, 5 mg/l; selenite, 5 ~cg/1, progesterone 20 nM;
putrescine, ~ WO 99!09147 PCT/US971I4212 _87-100 ,uM), as well as 10 % fetal calf serum (FCS), PSN antibiotic mix (penicillin, SO
mgll; streptomycin, SO mg/1; neomycin, 100 mgll), and fungizone {2.S mg/1).
The cell count and viability were determined by diluting Hank's BSS with 0.4 %
trypan blue (1:1 v/v) and counting with a hemocytometer. Cells were tently triturated S
S times with a 10 ml pipet and plated at a density of 105 cells/12 mm glass coverslip pre-coated with poly-L-lysine (70K-1SOK MW, Sigma, St. Louis, MO) placed in 24 well culture dishes. One ml of media was pipetted into each culture well.
Cells were cultured for 10-28 days at 37°C in a humidified atmosphere of S %
C02/9S % air, changing media every 3 days. Under these conditions, cultures were > 60-70 %
homogeneous for neurons, with 20-30 % astrocytes, < 1 % microglia and ~ 10 %
macrophage and microglia staining. After 14-28 days of culture, neuronal cultures express sufficient levels of N-methyl-D-aspartate (NMDA) or non-NMDA receptors to die after excitotoxic doses of NMDA or alpha-amino-3-hydroxy-S-methyl-4 isoxazole proprionic acid (AMPA).
1S The neurotoxicity assay was conducted as follows. The test samples, which were (a) conditioned media from LPS-stimulated HIV-1 infected monocytes, (b) control media, (c) conditioned media with added rPH.2 at SI ~cg/ml or (d) conditioned media with added vehicle for rPH.2, were applied to the neuronal cell cultures at a 1:10 v/v concentration for 24 hours. Neurotoxicity was measured by identifying apoptotic nuclei in situ on neuronal coverslips fixed in 4 paraformaldehyde, employing a commercial kit {Apop Tag; ONCOR, Gaithersburg, MD) that uses terminal deoxynucleotidyl transferase (TdT) to bind digoxigenin-dUPT
to free 3'-OH ends of newly cleaved DNA (TiJNEL staining). Digitized images of TUNEL-stained neurons in > 1S randomly selected microscopic fields were analyzed 2S for number of TUNEL-stained nucleilnumber of total neurons per SOX field using computerized morphometry (MCID, Imaging Research, St. Catherine, Ontario, Canada). Data were expressed at % neuronal nuclei positive for TUNEL staining ~
SEM and are shown in FIGURE 13. Tests of statistical significance between control and experimental treatments were determined by ANOVA or paired t-tests, with significance at p < O.OS. Quantitation of these cultures confirmed that conditioned media from HIV-infected and activated monocytes induced neuronal cell death in nearly 2S % of the total population of cerebral cortical neurons, and rPH.2 was able to reduce this toxicity to less than 5 9~ of the total neumris. The rPH.2 by itself was not neurotoxic, since 50 ~cg/ml rPH.2 had no effect on neuronal cell death relative to cultures treated with control media. These results clearly indicate that a major component of the neurotoxicity induced by application of conditioned media from activated HIV-1 infected rnonocytes must be due to PAF, since neurotoxity can be almost completely abrogated by co-incubation with PAF-AH product, the enzyme responsible for metabolism of PAF in the central nervous system. These findings suggest potential therapeutic interventions in the treatment of the CNS -neurologic disease associated with HIV-1 infection.
Example 21 Nearly four percent of the 3apanese population has low or undetectable levels of PAF-AH activity in their plasma. This deficiency has been correlated with severe respiratory symptoms in asthmatic children [Miwa et al., J. Clin.
Invert,. 82:
1983-1991 (1988)] who appear to have inherited the deficiency ~in an autosomal recessive manner.
To determine if the deficiency arises from an inactive but present enzyme or from an inability to synthesize -PAF-AH, plasma from multiple patients deficient in PAF-AH activity was assayed both for PAF-AH activity (by the method described in Example 10 for transfectants) and for the presence of PAF-AH
using the monoclonal antibodies 90G11D and 90F2D (Example 13) in a sandwich ELISA a~
follows. Immulon 4 flat bottom plates (Dynatech, Chantilly, VA) were coated with 100 ng/well of monoclonal antibody 9061 I D and stored overnight. The plates were blocked for 1 hour at room temperature with 0.5 9~ fish skin gelatin (Sigma) diluted in CMF-PBS and then washed three times. Patient plasma was diluted in PBS
containing lSmM CHAPS and added to each well of the plates (50 Icl/well). The plates were incubated for 1 hour at room temperature and washed four times.
Fifty ~cl of 5 ~g/ml monoclonal antibody 90F2D, which was biotinylated by standard methods and diluted in PBST, was added to each well, and the plates were incubaxed for 1 hour at room temperature and then washed three times. Fifty ~cl of ExtraAvidin-~' (Sigma) diluted 1 / 1000 in CMF-PEST was subsequently added to each well and plates were incubated for 1 hour at room temperature before development.
*Trade-mark A direct correlation between PAF-AH activity and enzyme levels was observed. An absence of activity in a patient's serum was reflected by an absence of detectable enzyme. Similarly, plasma samples with half the normal activity contained half the normal levels of PAF-AH. These observations suggested that the deficiency of PAF-AH activity was due to an inability to synthesize the enzyme or due to an inactive enzyme which the monoclonal antibodies did not recognize.
Further experiments revealed that the deficiency was due to a genetic lesion in the human plasma PAF-AH gene. Genomic DNA from PAF-AH deficient individuals was isolated and used as template for PCR reactions with PAF-AH
gene specific primers. Each of the coding sequence exons were initially amplified and sequenced from one individual. A single nucleotide change within exon 9 was observed (a G to T at position 996 of SEQ ID NO: 7). The nucleotide change results in an amino acid substitution of a phenylalanine for a valise at position 279 of the PAF-AH sequence (V279F). Exon 9 was amplified from genomic DNA from an additional eleven PAF-AH deficient individuals who were found to have the same point mutation.
To test whether this mutation crippled the enzyme, an E. coli expression construct containing the mutation was generated by methods similar to that described in Example 10. When introduced into E. toll, the expression construct generated no PAF-AH activity while a control construct lacking the mutation was fully active. This amino acid substitution presumably results in a structural modification which causes the observed deficiency of activity and lack of immunoreactivity with the PAF-AH antibodies of the invention.
PAF-AH specific antibodies of the invention may thus be used in diagnostic methods to detect abnormal levels of PAF-AH in serum (normal levels are about 1 to 5 U/ml) and to follow the progression of treatment of pathological conditions with PAF-AIi. Moreover, identification of a genetic lesion in the PAF
AH gene allows for genetic screening for the PAF-AH deficiency exhibited by the Japanese patients. The mutation causes the gain of a restriction endonuclease site (Mae II) and thus allows for the simple method of Restriction Fragment Length Polymorphism (RFLP) analysis to differentiate between active and mutant alleles.

See Lewin, pp. 136-141 in Genes V, Oxford University Press, New York, New York (1994).
Screening of genomic DNA from twelve PAF-AH deficient patients was carried out by digestion of the DNA with MaeII, Southern blotting, and hybridization with an exon 9 probe (nucleotides 1-396 of SEQ ID NO: 17). All patients were found to nave RFLPs consistent with the mutant allele.
While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the appended claims should be placed on the invention.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: ICOS CORPORATION
(ii) TITLE OF INVENTION: TRUNCATED PLATELET-ACTIVATING FACTOR
ACETYLHYDROLASE
(iii) NUMBER OF SEQUENCES: 30 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SMART & BIGGAR
(B) STREET: P.O. BOX 2999, STATION D
(C) CITY: OTTAWA
(D) STATE : ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) CURRENT APPLICATION DATA:
2 0 (A) APPLICATION NUMBER: CA
(B) FILING DATE: 13-AUG-1997 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SMART & BIGGAR
(B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 64267-976 3 O (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)-232-2486 (B) TELEFAX: (613)-232-8440 - 91a -(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu Ile Aia Phe (2) INFORMATION FOR SEQ ID N0:2:
{i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Ile Gln Val Leu Met Ala Ala Ala Ser Phe Gly Gln Thr Lys Ile Pro (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Met Lys Pro Leu Vai Val Phe Val Leu GIy Gly (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: group(13, 21, 27) (C) OTHER INFORMATION: /note= "The nucleotide at each of these positions is an inosine."
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO 9910914? PCT/US97/14212 (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:

(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1520 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
( ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: 162..1484 (xi) SEQUENCE DESCRIPTION: 5EQ ID N0:7:

GCTGTCGGCG
AGAAGCAGTC

GCGCCCAGGG
ACCCCAGTTC

AACTGCTGCT ATG
CAGCTCCCAA GTG
C

Met ro Pro Val P

CAT TTC CTC GTG

Lys Leu ValLeu Cys CysGly CysLeuAla Val Tyr His Phe Leu Val GAC TAC AAT AAA

Pro Phe TrpGln Ile ProVal AlaHisMet Ser Ser Asp Tyr Asn Lys GTC ATA GTA AGC

Ala Trp AsnLys Gln LeuMet AlaAlaAla Phe Gly Val Ile Val Ser AAA CGG AAT GGT

Gln Thr IlePro Gly GlyPro TyrSerVal Cys Thr Lys Arg Asn Gly ATG CAC AAT CGT

Asp Leu PheAsp Thr LysGly ThrPheLeu Leu Tyr Met His Asn Arg TCC AAT CGC ATC

TyrProSer Arg Leu ThrLeuTrp IlePro Gln Asp Asn Asp Asn Asp TTT

LysGluTyr Trp GlyLeuSer LysPhe LeuGlyThr HisTrpLeu Phe 105 110 lI5 ATT

MetGlyAsn Leu ArgLeuLeu PheGly SerMetThr ThrProAla Ile TCC

AsnTrpAsn Pro LeuArgPro GlyGlu LysTyrPro LeuValVa1 Ser GGT

PheSerHis Leu GlyAlaPhe ArgThr LeuTyrSer AlaIleGly Gly GCA

IleAspLeu Ser HisGlyPhe IleVal AlaAlaVal GluHisArg Ala GCA

AspArg5er Ser AlaThrTyr TyrPhe LysAspGln SerAlaAla Ala GAC

GluIleGly Lys SerTrpLeu TyrLeu ArgThrLeu LysGlnGlu Asp CAT

GluGluThr Ile ArgAsnGlu Glnval ArgGlnArg AlaLysGlu His GCT

CysSerGln Leu SerLeuIle LeuAsp IleAspHis GlyLysPro Ala GCA

ValLysAsn Leu AspLeuLys PheAsp MetGluGln LeuLysAsp Ala AGG

SerIleAsp Glu LysIleAla ValIle GlyHisSer PheGlyGly Arg ATT

AlaThrVal Gln ThrLeuSer GluAsp GlnArgPhe ArgCysGly Ile GAT

IleAlaLeu Ala TzpMetPhe ProLeu GlyAspGlu ValTyrSer Asp CAG

ArgIlePro Pro LeuPhePhe IleAsn SerGluTyr PheGlnTyr Gln ATC

ProAlaAsn Ile LysMetLys LysCys TyrSerPro AspLysGlu Ile ATT

ArgLysMet Thr IleArgGly SerVal HisGlnAsn PheAlaAsp Ile ACT ATT GGA CTC AAA
TTT TTA

Phe Phe Ala Thr Gly Lys Ile His Met Lys Lys Thr Ile Gly Leu Leu GAC ATT GAT AAC GCT

Gly Ile Asp Ser Asn Val Ala Leu Ser Lys Ser Asp Ile Asp Asn Ala GCA GGA CTT GAT GAT

Leu Phe Leu Gln Lys His Leu His Lys Phe Gln Ala Gly Leu Asp Asp GAC GAT GAG ATT GGG

Trp Cys Leu Ile Glu Gly Asp Asn Leu Pro Thr Asp Asp Glu Ile Gly ATT ATC ATG AAC TCA

Asn Asn Thr Thr Asn Gln His Leu Gln Ser Gly Ile Ile Met Asn Ser GAG TAAAAAAAA

Ile Lys Tyr Asn Glu (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 441 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
Met Val Pro Pro Lys Leu His Val Leu Phe Cys Leu Cys Gly Cys Leu Ala Val Val Tyr Pro Phe Asp Trp Gln Tyr Ile Asn Pro Val Ala His Met Lys Ser Ser Ala Trp Val Asn Lys Ile Gln Val Leu Met Ala Ala Ala Ser Phe Gly Gln Thr Lys Ile Pro Arg Gly Asn Gly Pro Tyr Ser Val Gly Cys Thr Asp Leu Met Phe Asp His Thr Asn Lys Gly Thr Phe Leu Arg Leu Tyr Tyr Pro Ser Gln Asp Asn Asp Arg Leu Asp Thr Leu 85 90 g5 Trp Ile Pro Asn Lys Glu Tyr Phe Tzp Gly Leu Ser Lys Phe Leu Gly 100 105 lI0 Thr His Trp Leu Met Gly Asn Ile Leu Arg Leu Leu Phe Gly Ser Met Thr Thr Pro Ala Asn Trp Asn Ser Pro Leu Arg Pro Gly Glu Lys Tyr Pro Leu Val Val Phe Ser His Gly Leu Gly Ala Phe Arg Thr Leu Tyr Ser Ala Ile Gly Ile Asp Leu Ala Ser His Gly Phe Ile Val Ala Ala Val Glu His Arg Asp Arg Ser Ala Ser Ala Thr Tyr Tyr Phe Lys Asp Gln Ser Ala Ala Glu Ile Gly Asp Lys Ser Trp Leu Tyr Leu Arg Thr Leu Lys Gln Glu Glu Glu Thr His Ile Arg Asn Glu Gln Val Arg Gln Arg Ala Lys Glu Cys Ser Gln Ala Leu Ser Leu Ile Leu Asp Ile Asp His Gly Lys Pro Val Lys Asn Ala Leu Asp Leu Lys Phe Asp Met Glu Gln Leu Lys Asp Ser Ile Asp Arg Glu Lys Ile Ala Val Ile Gly His Ser Phe Gly Gly Ala Thr Val Ile Gln Thr Leu Ser Glu Asp Gln Arg Phe Arg Cys Gly Ile Ala Leu Asp Ala Trp Met Phe Pro Leu Gly Asp Glu Val Tyr Ser Arg Ile Pro Gln Pro Leu Phe Phe Ile Asn Ser Glu Tyr Phe Gln Tyr Pro Ala Asn Ile IIe Lys Met Lys Lys Cys Tyr Ser Pro Asp Lys Glu Arg Lys Met Ile Thr Ile Arg Gly Ser Val His Gln Asn Phe Ala Asp Phe Thr Phe Ala Thr Gly Lys Ile Ile Gly His Met Leu Lys Leu Lys Gly Asp Ile Asp Ser Asn Val Ala Ile Asp Leu Ser 370 375 3g0 Asn Lys Ala Ser Leu Ala Phe Leu Gln Lys His Leu Gly Leu His Lys Asp Phe Asp Gln Trp Asp Cys Leu Ile Glu Gly Asp Asp Glu Asn Leu Ile Pro Gly Thr Asn Ile Asn Thr Thr Asn Gln His Ile Met Leu Gln Asn Ser Ser Gly Ile Glu Lys Tyr Asn (2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1123 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: Not Determined (xi) SEQUENCE DESCRIPTION: SEQ ID
N0:9:

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 417 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ( i.x) FEATURE

(A) NAME/KEY : exon (B) LOCATION: 145..287 (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:10:

WO 99/09I47 PCT/US97/t42I2 (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 498 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 251..372 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: I1:

TTTTCGAATT TGTATTGT 4 g 8 (2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 433 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 130..274 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:

(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 486 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 164..257 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:

(2) INFORMATION FOR 5EQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 363 base pairs (B) TYPE: nucleic acid (C) STRANDBDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 113..181 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:

(2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 441 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 68..191 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:

(2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 577 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 245..358 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:

(2) INFORMATION FOR SEQ ID N0:17:

(i) SEQUENCE CHARACTERISTICS:

(A} LENGTH: 396 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: exon (B} LOCATION: 108..199 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

TCATTTCTTC

TCTATTGATA

CAGACTCTTA

AGTAAATTAT

GGAAGGGGAT

ACATTTTCCT

(2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 519 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 181..351 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:

(2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 569 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix} FEATURE:
(A) NAME/KEY: exon (B) LOCATION: 156..304 (xi) SEQUENCE DESCRIPTION:
SEQ ID N0:19:

(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 469 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY : exon (B) LOCATION: 137..253 (xi} SEQUENCE DESCRIPTION: SEQ ID N0:20:

(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1494 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 117..1436 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
GGCACGAGCT CGCTCAGGGT TCTGGGTATC

AGGATCTGAC
TCGCTCTGGT
GGCATTGCTG

CGGGAGTCAG TGCAGTGACC CTGCTCAGCT CCTAAG

AGAACATCAA
ACTGAAGCCA

CTG

MetValProLeu Lys GlnAlaLeu PheCys LeuLeuCysCys Leu Leu TTT

ProTrpValHis Pro HisTxpGln AspThr SerSerPheAsp Phe Phe TTT

ArgProSerVal Met HisLysLeu GlnSer ValMetSerAla Ala Phe AAA

GlySerGlyHis Ser IleProLys GlyAsn GlySerTyrPro Val Lys ATG

GlyCysThrAsp Leu PheGlyTyr GlyAsn GluSerValPhe Val Met GCT

ArgLeuTyrTyr Pro GlnAspGln GlyArg LeuAspThrVal Trp Ala TAT

IleProAsnLys Glu PheLeuGly LeuSer IlePheLeuGly Thr Tyr AAT

ProSerIleVaI Gly IleLeuHis LeuLeu TyrGIySerLeu Thr Asn AAT

ThrProAlaSer Trp SerProLeu ArgThr GlyGluLysTyr Pro Asn CAT

LeuIleValPhe Ser GlyLeuGly AlaPhe ArgThrIleTyr Ser His ATT ATT TTT ATA ACT
GTG

AlaIleGly Gly LeuAlaSer Aen Gly IleVal AlaThrVal Ile Phe GAC TAC

GluHisArg Arg SerAlaSer Ala Thr PhePhe GluAspGln Asp Tyr AAA CTT

ValAlaAla Val GluAsnArg Ser Trp TyrLeu ArgLyeVal Lys Leu GAG GAA

LysGlnGlu Ser GluSerVal Arg Lys GlnVal GlnGlnArg Glu Glu TGT ATT

AlaIleGlu Ser ArgAlaLeu Ser Ala LeuAsp IleGluHis Cys Ile AAA GCT

GlyAspPro Glu AsnValLeu Gly Ser PheAsp MetLysGln Lys Ala GCT GCT

LeuLysAsp Ile AspGluThr Lys Ile LeuMet GlyHisSer Ala Ala GCA AGT

PheGlyGly Thr ValLeuGln Ala Leu GluAsp GlnArgPhe Ala Ser GTT TAT

ArgCysGly Ala LeuAspPro Trp Met ProVal AsnGluGlu Val Tyr AGA TTT

LeuTyrSer Thr LeuGlnPro Leu Leu IleAsn SerAlaLys Arg Phe CCA AAA

PheGlnThr Lys AspIleAla Lys Met LysPhe TyrGlnPro Pro Lys AGG GGG

AspLysGlu Lys AsnAspTyr Asn Gln LeuArg HisGlnAsn Arg Gly TTT ATA

PheAspAsp Thr PheValThr Gly Lys IleGly AsnLysLeu Phe Ile GGA GCC

ThrLeuLys Glu IleAspSer Arg Val IleAsp LeuThrAsn Gly Ala ATG TTA

LysAlaSer Ala PheLeuGln Lys His GlyLeu GlnLysAsp Met Leu TGG GAT

PheAspGln Asp ProLeuVal Glu Gly AspGlu AsnLeuIle Trp Asp CCC GCC

ProGlySer Phe AspAlaVal Thr Gln ProAla GlnGlnHis Pro Ala Ser Pro Gly Ser Gln Thr Gln Asn (2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2191 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 92..1423 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

ACCCTGGTTC
CGGCGAGCGG

AACCACTG G ATG AAA

Met Leu Pro Pro Leu His Lys TTC CTC TGC ACA CCT

AlaLeu Cys Cys Ser Leu Leu Val His Ile Asp Phe Leu Cys Thr Pro GAC AAT GCC ATT GCA

TrpGln Leu Pro Val His Arg Ser Ser Trp Ala Asp Asn Ala Ile Ala ATA GCT GCT GCA CAA

AsnLys Gln Leu Met Ala Ser Ile Arg Ser Arg Ile Ala Ala Ala Gln AAA AAT TAT GTC GAT

IlePro Gly Gly Ser Ser Gly Cys Thr Leu Met Lys Asn Tyr Val Asp TAT AAT ACC TTG TAT

PheAsp Thr Lys Gly Phe Arg Leu Tyr Pro Ser Tyr Asn Thr Leu Tyr GAT CAC ACG TGG AAA

GlnGlu Asp Ser Asp Leu Ile Pro Asn Glu Tyr Asp His Thr Trp Lys GGT AGT CTT ACA ATG

PhePhe Leu Lys Tyr Gly Pro Trp Leu Gly Lys Gly Ser Leu Thr Met 105 lI0 115 AGC TTT TCA ACA AAC

IleLeu Phe Phe Gly Val Thr Pro Ala Trp Asn Ser Phe Ser Thr Asn CTG ACT AAA CCA TTT

SerPro Arg Gly Glu Tyr Leu Ile Val Ser His Leu Thr Lys Pro Phe GGA TTC ATT TCT ATT

GlyLeu Ala Arg Thr Tyr Ala Ile Gly Asp Leu Gly Phe Ile Ser Ile 155 i60 165 TCA GAT

Ala His GlyPheIle ValAla AlaIleGlu HisArg GlySer Ser Asp TCT GAA

Ala Ala ThrTyrTyr PheLys AspGlnSer AlaAla IleGly Ser Glu AAA GAT

Asn Ser TrpSerTyr LeuGln GluLeuLys ProGly GluGlu Lys Asp CAT GAG

Ile Val ArgAsnGlu GlnVal GlnLysArg AlaLys CysSer His Glu GCT CCA

Gln Leu AsnLeuIle LeuAsp IleAspHis GlyArg IleLys Ala Pro GTA GAC

Asn Leu AspLeuGlu PheAsp ValGluGln LeuLys SerIle Val Asp AGG GGA

Asp Asp LysIleAla ValIle GlyHisSer PheGly AlaThr Arg Gly CTT GGG

Val Gln AlaLeuSer GluAsp GlnArgPhe ArgCys IleAla Leu Gly GAT TCC

Leu Ala TrpMetLeu ProLeu AspAspAla IleTyr ArgIle Asp Ser CAG TTT

Pro Pro LeuPhePhe IleAsn SerGluArg PheGln ProGlu Gln Phe 3i5 320 325 ATC GAA

Asn Lys LysMetLys LysCys TyrSerPro AspLys ArgLys Ile Glu ATT GAT

Met Thr IleArgGly SerVal HisGlnAsn PheAla PheThr Ile Asp ACA AAA

Phe Thr GlyLysIle ValGly TyrIlePhe ThrLeu GlyAsp Thr Lys GAT TCA

Ile Ser AsnValAla IleAsp LeuCysAsn LysAla LeuAla Asp Ser TTA CAG

Phe Gln LysHisLeu GlyLeu ArgLysAsp PheAsp TrpAsp Leu Gln TTG ACC

Ser Ile GluGlyLys AspGlu AsnLeuMet ProGly AsnIle Leu Thr CAG AAC

Asn Ile Thr Asn Glu His Asp Thr Leu Ser Pro Glu Ala Glu Gln Asn TCTTGTTTAA AAACTGTCAA

Lys Ser Asn Leu Asp (2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1533 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 62..1394 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

Met Leu Pro Ser Lys Leu His Ala Leu Phe Cys Leu Cys Thr Cys Leu Ala Leu Val Tyr Pro Phe Asp Trp Gln Asp Leu Asn Pro Val Ala Tyr Ile Glu Ser Pro Ala Trp Val Ser Lys Ile Gln Ala Leu Met Ala GCA ATT TCT AGA TCT
AAA GGA
ATC

AlaAlaAsn IleGlyGln SerLys IleProArg AsnGly SerTyr Gly ACT

SerValGly CysThrAsp LeuMet PheAspTyr AsnLys GlyThr Thr GAT

PheLeuArg LeuTyrTyr ProSer GlnAspAsp HisSer AspThr Asp CTT

LeuTrpIle ProAsnLys GluTyr PheLeuGly SerLye PheLeu Leu TTA

GlyThrHis TrpLeuVal GlyLys IleMetGly PhePhe GlySer Leu AGG

MetThrThr ProAlaAla TrpAsn AlaHisLeu ThrGly GluLys Arg GCA

TyrProLeu IleIlePhe SerHis GlyLeuGly PheArg ThrIle Ala GGG

TyrSerAla IleGlyIle AspLeu AlaSerHis PheIle ValAla Gly ACA

AlaValGlu HisArgAsp GlySer AlaSerSer TyrTyr PheLys Thr TGG

AspGlnSer AlaValGlu IleGly AsnLysSer LeuTyr LeuArg Trp CGA

ThrLeuLys ArgGlyGlu GluGlu PheProLeu AsnGlu GlnLeu Arg AGT

ArgGlnArg AlaLysGlu CysSer GlnAlaLeu LeuIle LeuAsp Ser GAT

IleAspHis GlyArgPro ValThr AsnValLeu LeuGlu PheAsp Asp AAA

ValGluGln LeuLysAsp SerIle AspArgAsp IleAla IleIle Lys ACT

GlyHisSer PheGlyGly AlaThr ValIleGln LeuSer GluAsp Thr TGG

GlnArgPhe ArgCysGly IleAla LeuAspAla MetPhe ProVal Trp CTC

GlyAspGlu ValTyrSer ArgIle ProGlnPro PhePhe IleAsn Leu CGA TAC TCT ATC
ATA
AGA
ATG
AAA
AAA
TGC

SerGlu Phe GlnTyrPro Asn Ile Arg Lys Cys Arg Ser Ile Met Lys CCT AAA ACA AGG TCG

PheLeu Asp ArgGluArg Met Ile Ile Gly Val Pro Lys Thr Arg Ser AAT ACT ACT AAA ATT

HisGln Phe ValAspPhe Phe Ala Ser Ile Gly Asn Thr Thr Lys Ile TTC GAC TCC GTA ATC

TyrLeu Thr LeuLysGly Ile Asp Asn Ala Ser Phe Asp Ser Val Ile LeuSer Lys AlaSerLeu Phe Leu Lys Leu Leu Asn Ala Gln His Gly GAT GAT GTT GGC GAT

GlnLys Phe AspGlnTrp Ser Leu Glu Glu His Asp Asp VaI Gly Asp ATT ATT ACC CAC GCC

AsnLeu Pro GlyThrAsn Asn Thr Asn Gln Ile Ile Ile Thr His AIa AAC GAG AAT GAT

LeuGln Ser ThrGlyIle Arg Pro Leu Asn Glu Asn Asp TTTCTCAAAT AGCTCATATT AAAAAATGTA GGCTATAGCA C;AAAAAAAAA AAAAAAAAAA 1524 (2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1876 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 468..1734 (xi) SEQUENCE
DESCRIPTION:
SEQ
ID N0:24:

WO 99!09147 PCTlUS97/14212 GGAGGACCCG TGCCCCCACC
GAGGTGGTGT
GCAGCCACAG

TCCCGGGGAG CAGCCCTGTG AGAGCACTGA

CTATACCCAA GCCGGCTGCT
CCCCCCGCAC

ACCCCGCCGT
GGGACCTTCT
GCTCTTCCCA

Met AlaSer LeuTrpVal ArgAla ArgArgVal PheMetLys SerArgAla SerGly PheSerAla LysAla AlaThrGlu MetGlySer GlyGlyAla GluLys GlyTyrArg IlePro AlaGlyLys GlyProHis AlaValGly CysThr AspLeuMet ThrGly AspAlaAla GluGlySer PheLeuArg LeuTyr TyrLeuSer CysAsp AspThrAsp ThrGluGIu ThrProTrp IlePro AspLysGlu TyrTyr GlnGlyLeu SerAspPhe LeuAsnVaI TyrArg AlaLeuGly GluArg LeuPheGln TyrTyrVal GlySerVal ThrCys ProAlaLys SerAsn AlaAlaPhe LysProGly GluLysTyr ProLeu LeuValPhe SerHis GlyLeuGly AlaPheArg ThrIleTyr SerAla IleCysIle GluMet AlaSerGln GlyPheLeu ValAlaAla ValGlu HisArgAsp GluSer AlaSerAla ThrTyrPhe CysLysLys LysAla AspSerGlu ProGlu GluAspGln ThrSerGly ValGluLys GluTrp IleTyrTyr ArgLys LeuArgAla GlyGluGlu GluArgCys LeuArg HisLysGln ValGln GlnArgAla GlnGluCys IleLysAla LeuAsn LeuIleLeu LysIle SerSerGiy GluGluVal MetAsnVal LeuAsn GAC CTG TCT GAT AGA
ACT

Ser Asp Phe TrpAsn His LysAsp Val Thr SerArg Asp Leu Ser Asp ATG TTT GCT GTT

Ile Ala Val GlyHis Ser GlyGly Thr Ile GluSer Met Phe Ala Val GAA AGG ATT CTT

Leu Ser Lys IleArg Phe CysGly Ala Asp AlaTxp Glu Arg Ile Leu GTA ACT AGC GTG

Met Leu Pra GlyAsp Asp TyrGln Ser Gln GlnPro Val Thr Ser Val ATT AAA TGG GCC

Leu Leu Phe AsnSer Glu PheGln Ala Asn IleLeu Ile Lys Trp Ala AAG AAT AAC AAA

Lys Met Lys LeuSer Ser AspThr Lys Met IleThr Lys Asn Asn Lys TCG AGC GAT ACT

Ile Lys Gly ValHis Gln PhePro Phe Phe ValSer Ser Ser Asp Thr ATT TTC AAA GAA

Gly Glu Ile GlyLys Phe LysLeu Gly Ile AspPro Ile Phe Lys Glu ATT AAC TCA GCC

Asn Glu Ala AspIle Cys HisAla Leu Phe LeuGln Ile Asn Ser Ala AGT GAT AAG GAT

Lys His Leu LeuLys Arg PheAsp Trp Ser LeuVal Ser Asp Lys Asp GGA ATT ACC ATC

Asp Gly Ile ProAsn Val SerGly Asn Asp LeuSer Gly Ile Thr Ile T AAGGAGTACA CAGCAGCAGG
AGAAGTACTG

Pro Thr Glu TGGCCACACA CACACAGCTT
TTGCTTGGAG

AAACAACAAA
AAAAAAAp,TC

(2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 517 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..514 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

GGG
CAT
TCT
TTT
GGA
GGA
GCA
ACA
GTT
TTT
CAA
GCC
CTA
AGT
GAA

Gly ly Ala His Thr Val Ser Phe Gln Phe Ala Leu Gly Ser Glu G

1 s to is TGT GCC

AspGln Arg Phe Arg Gly Ile Leu AspProTrp MetPhe Pro Cys Ala TAC GTT

ValSer Glu Glu Leu Ser Arg Pro GlnProLeu PhePhe Ile Tyr Val CAG AAG

AsnSer Ala Glu Phe Thr Pro Asp IleAlaLys MetLys Asn Gln Lys AAG AAA

PheTyr Gln Pro Asp Glu Arg Met IleThrIle LysGly Ser Lys Lys GCT ACT

ValHis Gln Asn Phe Asp Gly Phe ValThrGly LysIle Ile Ala Thr CTG GAC

GlyAsn Lys Leu 5er Lys Gly Ile AspSerArg ValAla Ile Leu Asp 100 105 lI0 GCT GCT

AspLeu Thr Asn Lys Ser Leu Phe LeuGlnLys HisLeu Gly Ala Ala GAT GAC

LeuHis Lys Asp Phe Gln Trp Cys LeuValGlu GlyGlu Asn Asp Asp GGG TTT

GluAsn Leu Ile Pro Ser Pro Asp ValValThr GlnSer Pro Gly Phe CCC CAC

AlaLeu Gln Ser Ser Gly Ser Asn GlnAsn Pro His (2)INFORMATION ID N0:26:
FOR
SEQ

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH:
580 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY:linear (ii)MOLECULE TYPE:cDNA

(ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION:1..580 (xi)SEQUENCE DESCRIPTION: D
SEQ I N0:26:

Gln Val Leu Met Ala Ala Ala Ser Phe Gly Glu Arg Lys Ile Pro Lys WO 99!09147 PCT/US97l142I2 GGT ACA

GlyAsn GlyPro TyrSerVal Cys AspLeu MetPheAsp Tyr Gly Thr CGT TAT

ThrLys LysGly ThrPheLeu Leu TyrPro SerGlnAsp Asp Arg Tyr ATC AAT

AspArg LeuAsp ThrLeuTrp Pro LysGlu TyrPheTrp Gly Ile Asn CAC CTT

LeuSer LysTyr LeuGlyLys Trp MetGly AsnIleLeu Ser His Leu ACT GCA

LeuLeu PheGly SerValThr Pro AsnTrp AenSerPro Leu Thr Ala CTT GTT

ArgPro GlyGlu LysTyrPro Val PheSer HisGlyLeu Gly Leu Val GCT GGC

AlaPhe ArgThr IleTyrSer Ile IleAsp LeuAlaSer His Ala Gly GAA AGA

GlyPhe IleVal AlaAlaVal His AspArg SerAlaSer Ala Glu Arg TCT GCA

ThrTyr TyrPhe LysAsnGln Ala GluIle GlyLysLys Ser Ser Ala AAA GAG

TrpLeu TyrLeu ArgThrLeu Glu GluGlu IleHisIle Arg Lys Glu GCA GAA

AsnLys GlnVal ArgGlnArg Lys CysSer GlnAlaLeu Ser Ala Glu Leu (2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide {xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
Gly Xaa Ser Xaa Gly (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:

(2) INFORMATION FOR 5EQ ID N0:29:
{i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs {B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:

(2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1335 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear {ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:

AACGGTTATT

ATGGATGTTT

CAACTCTGAA

TGATAAAGAA

CACTTTTGCA

AAATGTAGCT

ACTTCATAAA

TCCAGGGACC

AGAGAAATAC

Claims (16)

CLAIMS:

1. ~A purified and isolated human plasma platelet-activating factor acetylhydrolase (PAF-AH) polypeptide product which is lacking up to the first twelve N-terminal amino acids of the mature human PAF-AH amino acid sequence comprising amino acids 42 to 441 set out in SEQ ID NO: 8.

2. ~The PAF-AH polypeptide product of claim 1 selected from the group consisting of:
(a) polypeptides having Met46 of SEQ ID NO: 8 as the initial N-terminal amino acid;
(b) polypeptides having Ala47 of SEQ ID NO: 8 as the initial N-terminal amino acid; and (c) polypeptides having Ala48 of SEQ ID NO: 8 as the initial N-terminal amino acid.

3, ~The PAF-AH polypeptide product of claim 1 or 2 which is additionally lacking up to 30 C-terminal amino acids of the amino acid sequence of SEQ ID NO: 8.

4. ~The PAF-AH polypeptide product of claim 3 having as its C-terminal residue a residue of SEQ ID NO: 8 selected from the group consisting of:
(a) Ile429, (b) Leu431, and (c) Asn441.

5. ~A variant of the PAF-AH polypeptide product of claim 1 which has an amino acid replacement in the sequence of SEQ ID NO: 8 selected from the group consisting of:
(a) S 108 A, (b) S 273 A, (c) D 286 A, (d) D 286 N, (e) D 296 A, (f) D 304 A, (g) D 338 A, (h) H 351 A, (i) H 395 A, (j) H 399 A, (k) C 67 S, (l) C 229 S, (m) C 291 S, (n) C 334 S, and (o) C 407 S.

6. A human PAF-AH polypeptide product which has an amino acid replacement in the sequence of SEQ ID NO: 8 selected from the group consisting of:
(a) D 286 A;
(b) D 286 N; and (c) D 304 A.

7. An isolated polynucleotide encoding the PAF-AH
polypeptide product of any of claims 1 to 4 and 6, or encoding the variant of claim 5.

8. An isolated polynucleotide encoding a human PAF-AH
polypeptide product having Met46 of SEQ ID NO: 8 as the N-terminal residue and Ile429 or Asn441 as the C-terminal residue.

9. The polynucleotide of claim 7 or 8 which is a DNA.

10. A DNA vector comprising the DNA of claim 9.

11. A host cell stably transformed or transfected with the DNA according to claim 9 in a manner allowing expression in said host cell of a PAF-AH polypeptide product or variant.

12. A method of producing a PAF-AH polypeptide product or variant comprising growing the host cell according to claim 11 in a suitable nutrient and isolating said PAF-AH
polypeptide product or variant from said cell or the medium of its growth.

13. A PAF-AH polypeptide product produced by the method of claim 12.

14. A pharmaceutical composition comprising the PAF-AH
polypeptide product of any of claims 1 to 4, 6 and 13 or comprising the variant of claim 5, and a pharmaceutically acceptable diluent, adjuvant or carrier.

15. Use of the PAF-AH polypeptide product of any of claims 1 to 4 and 6, or the variant of claim 5, to treat a PAF mediated pathological condition.

16. The use according to claim 15 wherein the PAF
mediated pathological condition is selected from the group consisting of: pleurisy, asthma, rhinitis, necrotizing enterocolitis, acute respiratory distress syndrome, acute pancreatitis, neurological disease associated with HIV
infection, reperfusion injury, pre-term labor, and septicemia.