SK286518B6 - Truncated platelet-activating factor acetylhydrolase - Google Patents

Abstract

A purified and isolated human plasma platelet-activating factor acetylhydrolase (PAF-AH) polypeptide fragment which is lacking up to the first twelve N-terminal amino acids of the mature human PAF-AH amino acid sequence set out in SEQ ID NO:8, his variant or variant fragment. An isolated polynucleotide encoding a human PAF-AH which is a DNA, a DNA vector comprising said DNA, a host cell stably transformed or transfected with DNA, a method of producing a PAF-AH comprising growing a host cell and a pharmaceutical composition comprising the PAF-AH. PAF-AH and said pharmaceutical composition are useful for the treatment of pleurisy, asthma, rhinitis, necrotizing enterocolitis, acute respiratory distress syndrome, acute pancreatitis, reperfusion injury, septicemia, preterm labor or neurological disease associated with HIV infection.

Description

The present invention relates generally to PAF acetyl hydrolase (AH) (platelet activating hydrolyzing hydrolase), and more specifically to the newly purified and isolated polynucleotides encoding human plasma PAF acetyl hydrolase and to the PAF-AH products encoded by polynucleotides. Further materials and methods for producing recombinant PAF-AH products and antibodies against PAF-AH.

BACKGROUND OF THE INVENTION

PAF is a biologically active phospholipid synthesized by various cell types. In vivo and at normal concentrations of 10-10 to 10-9 M PAF activates target cells (such as platelets and neutrophils) by binding to specific surface receptors associated with G proteins (Venable et al., J. Lipid Res., 34, 691) 701 (1993)). PAF has the structure 1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine. For optimal biological activity, a fatty alcohol must be attached to the sn-1 position of the PAF backbone and a sn-3 position must have a phosphocholine leader.

PAF works in normal physiological processes (e.g., inflammation, haemostasis and delivery) and is believed to play a role in pathological inflammatory processes (e.g., asthma, anaphylaxis, septic shock and arthritis) (Venable et al., Supra, Lmdsberg et. al., Ann. Neurob, 30: 117-129 (1991) The likelihood of the role of PAF in pathological responses has led to attempts to modulate PAF activity, most of which have been directed towards the development of PAF activity antagonists that would interfere with PAF binding to cell surface receptors. See, e.g., Heuer et al., Clin Exp Allergy, 22: 980-983 (1992).

Synthesis and secretion of PAF, its degradation and purification are apparently highly controlled, to the extent that the pathological action of PAF may result from the breakdown of PAF regulatory mechanisms. This leads to its overproduction, inappropriate production or inability to degrade. An alternative source of modulating PAF activity would include mimicking or augmenting the natural processes that distinguish inflammation. Macrophages (Stafforini et al., J. Biol. Chem., 265 (17): 9682-9687 (1990), hepatocytes and human hepatoma HepG2 cell lines (Saton et al., J. Clin. Invest., 87: 476-). 481 (1991) and Tarbet et al., J. Biol. Chem., 266 (25): 16667 - 16673 (1991) described the release of the enzymatic activity, PAF acetyl hydrolase (PAF-AH), which inactivates PAF. PAF, PAF-AH also inactivates oxidatively fragmented phospholipids such as the arachidone cascade products that transmit inflammation (see Stremler et al., J. Biol. Chem., 266 (17): 11095-11103 (1991)). PAF-AH is mainly due to the hydrolysis of PAF at the sn-2 acetylated group, and PAF-AH metabolizes oxidatively fragmented phospholipids by removing the sn-2 acyl group Two types of PAF-AH have been identified: cytoplasmic form found in different cell and tissue types are endothelial and erythrocytes and extracellular form found in plasma and serum. it drolyses intact phospholipids with the exception of PAF, and this substrate specificity allows the enzyme to circulate in vivo in the fully active state without adverse effects. Plasma PAF-AH appears to be responsible for all PAF degradations in human blood ex vivo (Stafforini et al., J. Biol. Chem., 162 (9): 4223-430 (1987)).

While the cytoplasmic and plasma forms of PAF-AH appear to have identical substrate specificity, plasma PAF-AH appears to have biochemical properties that distinguish it from cytoplasmic PAF-AH and other lipases. In particular, plasma PAF-AH is associated with lipoprotein particles, is inhibited by disopropyl fluorophosphate, is unaffected by calcium ions, is relatively insensitive to proteolysis, and has a molecular weight of 43,000 Da (see Stafforini et al., (1987), supra). The same Stafforini paper describes a process for partial purification of PAF-AH from human plasma and the amino acid composition of the material obtained using this process. Cytoplasmic PAF-AH was purified from erythrocytes (Stafforini et al. J. Biol. Chem., 268 (6): 3857-3865 (1993)) and ten amino acid residues from the amino-terminus of cytoplasmic PAF-AH were also described in the article . Hattori et al., J. Biol. Chem. 268 (25): 18748-18753 described the purification of cytoplasmic PAF-AH from bovine brain. After the patent application was filed for this document, the nucleotide sequence of the cytoplasmic PAF-AH from bovine brain was blotted in the article by Hattori et al., J. Biol. Chem., 269 (237): 23150-23155 (1994). January 5, 1995, three months after filing a patent proposal for this document, the nucleotide sequence of lipoprotein-associated phospholipase A ₂ (Lp-PLA ₂ ) with Smithkline Beecham PLC Patent Cooperation Treaty (PTC) was published. W095 / 00,469th The Lp-PLA ₂ nucleotide sequence differs in one position compared to the PAF-AH nucleotide sequence of the present invention. The difference in nucleotide (corresponding to position 1297 of SEQ ID NO: 7) resulted in an amino acid difference between the enzymes encoded by these polynucleotides. The amino acid at position 379 of SEQ ID NO: 8 is valine, while the amino acid at position Lp-PLA ₂ is alanine. In addition, the PAF-AH nucleotide sequence of the present invention comprises 124 bases at the 5 'end and 20 bases at the 3' end are not present in the Lp-PLA ₂ sequence. After three months of April 10

SK 286518 la6 la 1995 to GenBank under Accession No. 5 024577 deposited Lp-PLA ₂ sequence which differs by 11 positions compared to the nucleotide sequence of PAF-AH of the present invention. Nucleotide differences (corresponding to positions 79, 81, 84, 85, 86, 121, 122, 904, 905, 911, 983 and 1327 of SEQ ID NO: 7) resulted in four amino acid differences for the enzymes encoded by these polynucleotides. The amino acids at positions 249, 250, 274, and 389 of SEQ ID NO: 8 are lysine, aspartic acid, phenylalanine, and leucine, while the corresponding amino acids at the respective gene bank positions (GenBank) are isoleucine, arginine, leucine, and serine.

Recombinant production of PAF-AH would allow the use of exogenous PAF-AH to mimic or augment normal in vivo inflammatory recognition processes. Administration of PAF-AH would provide a physiological advantage over the administration of PAF receptor antagonists, since PAF-AH is a substance normally found in plasma. PAF receptor antagonists that are structurally related to PAF also inhibit native PAF-AH activity. Thus, administration of PAF-AH would protect the desired metabolism of PAF and the metabolism of oxidatively fragmented phospholipids. In fact, inhibition of PAF-AH activity by PAF-AH receptor antagonists obstructs competitive blockade of PAF receptor by antagonists (see Stremler et al., Supra). In addition, at the site of acute inflammation, for example, oxidants are released which lead to inactivation of the native PAF-AH enzyme, resulting in increased local levels of PAF and PAF-like substances (PAF-like). These agents may further compete with any exogenously administered PAF receptor antagonist for binding to the PAF receptor. In contrast, treatment with recombinant PAF-AH would increase the endogenous activity of PAF-AH, thereby compensating for any inactivation of the endogenous enzyme. Thus, there is a need in the art for the identification and isolation of a polynucleotide sequence encoding human plasma PAF-AH, and for the development of material and methods useful for recombinant production of PAF-AH and production of substances for detecting PAF-AH in plasma.

SUMMARY OF THE INVENTION

A first aspect of the present invention is a purified and isolated human plasma platelet-activating factor (PAF-AH) polypeptide fragment that lacks up to the first twelve N-terminal amino acids of the mature human PAF-AH amino acid sequence of SEQ ID NO: 8.

In a preferred embodiment, the polypeptide fragment of PAF-AH

-is selected from the group consisting of

a) a polypeptide having Met1 _{6 of} SEQ ID NO: 8 as the starting N-terminal amino acid,

b) a polypeptide having Ala ₄ - SEQ ID NO: 8 as the starting N-terminal amino acid,

c) a polypeptide having Ala _{48 of} SEQ ID NO: 8 as the starting N-terminal amino acid and / or

it lacks up to 30 C-terminal amino acids of the amino acid sequence of SEQ ID NO: 8 and / or

- has, as its C-terminal residue, a residue selected from the group consisting of:

(a) Ile ₄₂ 9

(b) Leu ₄₃ and

(c) Asn ₄₄ .

The invention further provides a human (human) PAF-AH polypeptide fragment comprising Met _{46 of} SEQ ID NO: 8 as the N-terminal residue and Ile ₄₂ 9 or Asn ₄₄ as the C-terminal residue.

The invention also provides a variant PAF-AH polypeptide fragment according to a basic embodiment of the first aspect of the invention, which has an amino acid substitution selected from the group consisting of SEQ ID NO: 8.

(a) S 108 A

(b) S 273 A

(c) D 286 A

(d) D 286 N

(e) D 296 A

(f) D 304 A

(g) D 338 A

(h) H 351 A

(i) H 395

(j) H 399 A

(k) C 67 S

(l) OJ C 229 S

(m) C 291 S

(n) C 334 S;

(o) C 407 S;

and a variant human PAF-AH polypeptide having an amino acid substitution selected from the group consisting of SEQ ID NO: 8.

SK 286518-6

(a) D 286

(b) D 286 N.

(c) D 304 A.

The invention also provides an isolated polynucleotide encoding any of said PAF-AH polypeptide fragments, variants or variant fragments thereof, in particular an isolated polynucleotide encoding a human PAF-AH fragment or variant fragment showing Met ₄₆ in SEQ ID NO: 8 as the N-terminal residue, and Ilc ₄₂ 9 or Asn _44] , as the C-terminal residue. The polynucleotide may be DNA.

The invention further provides a DNA vector comprising said DNA and a host cell stably transformed or transfected with said DNA in a manner that allows expression of the PAF-AH polypeptide fragment, variant or variant fragment thereof in said host cell.

The invention also provides a method of producing a PAF-AH polypeptide fragment, variant thereof, or variant plasma PAF-AH fragment by culturing said host cell in a suitable nutrient medium, after which the PAF-AH fragment, variant or variant fragment thereof is isolated from the cells or their growth. the media. A PAF-AH polypeptide fragment, variant thereof, or variant fragment produced in this manner is also within the scope of the invention.

The present invention also provides a pharmaceutical composition comprising said PAF-AH fragment, variant or variant fragment thereof, and a pharmaceutically acceptable diluent, adjuvant or carrier.

The invention further provides a PAF-AH polypeptide fragment, variant or variant fragment thereof, and a pharmaceutical composition thereof, for use in treating a mammal susceptible to or afflicted with a PAF-mediated pathological condition, wherein the amount of PAF-AH product or pharmaceutical composition is sufficient. to complement PAF-AH activity and inactivate the pathological effects of PAF in a mammal. The pathological condition is pleurisia, asthma, rhinitis, necrotizing enterocolitis, acute respiratory distress syndrome, acute pancreatitis, reperfusion injury, septicemia, preterm labor or neurological disease associated with HIV infection.

The invention also provides the use of said PAF-AH polypeptide fragment, variant or variant fragment thereof, or said pharmaceutical composition for the manufacture of a medicament for said purpose.

The present invention provides novel and isolated polynucleotides (e.g., DNA and RNA - both strands) encoding human plasma PAF-AH or enzymatically active fragments thereof. Preferred DNA sequences of the invention include genomic and cDNA sequences, as well as partially or totally chemically synthesized DNA sequences. The present invention contemplates DNA sequences encoding PAF-AH that are described in SEQ ID NO: 7 and DNA sequences that hybridize under stringent conditions to the non-coding strand of the sequence or that would hybridize for redundancy of the genetic code. Also contemplated by the invention are biological replicas (e.g., copies of isolated DNA sequences generated in vivo or in vitro) of the DNA sequences of the invention. Also provided are autonomously replicating recombinant constructs such as plasmid and viral vectors incorporating PAF-AH sequences, and in particular vectors wherein the DNA encoding PAF-AH is operably linked to endogenous or exogenous expression control DNA sequences and transcriptional terminators.

According to another aspect of the invention, prokaryotic and eukaryotic host cells are stably transformed with DNA sequences of the invention in a manner allowing the desired expression of PAF-AH within these cells. Host cells expressing PAF-AH products can serve a variety of useful targets. Such cells create a valuable source of immunogens for the development of antibody substances specifically immunoreacting with PAFAH. The host cells of the invention are clearly useful in large-scale PAF-AH production methods, wherein the cells are grown in suitable culture media and the desired polypeptide products are isolated from these cells or from the medium in which the cells were grown, for example by immunoaffinity purification.

The non-immunological methods contemplated by the invention for plasma PAF-Ah purification include the following steps: a) isolating low density lipoprotein particles; b) solubilizing said low density lipoprotein particles in a buffer containing 10 mM CHAPS. Thus, a first solution of the PAF-AH enzyme is formed; c) applying said first PAF-AH enzyme solution to a DFAF anion innex column; d) washing said DEAE anion-exchange column with a pH of about 7.5 containing 1mM CHAPS e) eluting PAF-AH enzyme from said DEAF anion-exchange column into fractions with a pH of about 7.5 containing a NaCl gradient of 0 to 0.5M ; f) pooling the fractions having the enzymatic activity of PAF-AH eluted from said DFAF anion-exchange column, g) transferring said pooled active fractions from said DEAE anion-exchange column to 10 mM CHAPS, thereby forming a second solution of PAF-AH enzyme; h) loading said second enzyme solution on a blue dye ligand affinity column; i) eluting the PAF-AH enzyme from said affinity column with a blue dye ligand buffer containing 10 mM CHAPS and chaotropic salts; j) loading an eluate from said blue dye ligand affinity column onto a Cu ligand affinity column; k) eluting the PAF-AH enzyme from said affinity column with a Cu ligand buffer containing 10 mM CHAPS and imi4

286 Dazole; 1) loading the eluate from said Cu ligand affinity column on SDS-PAGE; and m) isolating the approximately 44 kDa PAF-AH enzyme from the SDS polyalkrylamide gel. Preferably, the buffer in step b) is 25 mM Tris-HCl, 10 mM CHAPS, pH 7.5; the buffer in step d) is 25 mM Tris-HCl, 1 mM CHAPS; the column of step h) is a Blue Sepharose Fast Flow column; the buffer in step i) is 25 mM Tris-HCl, 10 mM CHAPS, 0.5 KSCN, pH 7.5; the column in step j) is a Cu Chelating Sepharose column and the buffer of step k) is 25 mM Tris-HCl, 10 mM CHAPS, 0.5 M NaCl, 50 mM imidazole at a pH in the range of about 7.5 - 8.0.

The method contemplated by the invention for purifying an enzymatically active PAF-AH from E. coli producing PAF-AH comprises the steps of: b) loading said centrifugation supernatant onto a blue dye ligand affinity column; c) eluting the PAF-AH enzyme from said blue dye ligand affinity column containing 10 mM CHAPS and chaotropic salts; d) loading an eluate from said blue dye ligand affinity column onto a Cu ligand affinity column; e) eluting the enzyme PAF-AH from said affinity column with a Cu ligand buffer containing 10 mM CHAPS and imidazole. Preferably, the column of step b) is a Blue Sepharose Fast Flow column; the buffer of step c) is 25 mM Tris-HCl, 10 mM CHAPS, 0.5 M KSCN, pH 7.5; the column in step d) is a Cu Chelating Sepharose column and the buffer of step e) is 25 mM Tris-HCl, 10 mM CHAPS, 0.5 M NaCl, 50 mM imidazole, pH 7.5.

Another method of purifying enzymatically active PAF-AH from E. coli producing PAF-AH is contemplated in the invention. The method comprises the steps of: a) preparing a centrifugation supernatant from lysed E. coli producing PAF-AH enzyme; b) diluting said centrifugation supernatant in a low pH buffer containing 10 mM CHAPS; c) loading said diluted centrifugation supernatant on a cation-exchange column equilibrated to a pH of about 7.5; d) eluting the PAF-AH enzyme from said cation-exchange IM column with salt; e) raising the pH of said eluate from said cation-exchange column and adjusting the salt concentration of said eluate to a salt concentration of about 0.5M; f) loading said eluate from said cation-exchange column on a blue dye ligand affinity column; g) eluting the PAF-AH enzyme from said blue dye ligand affinity column with a buffer containing salts at a concentration of about 2M to 3M; h) dialyzing said eluate from said blue dye ligand affinity column using a buffer containing about 0.1% Tween. Preferably, the buffer in step b) is 25 mM MES, 10 mM CHAPS, 1 mM EDTA, pH 4.9; the column in step c) is a S Sepharose column equilibrated in 25 mM MES, 10 mM CHAPS, 1 mM EDTA, 50 mM NaCl, pH 5.5; PAF-AH is eluted in step d) with 1 mM NaCl; The pH of the eluate in step e) is adjusted to pH 7.5 using 2M Tris-base; the column in step f) is a sepharose column; the buffer in step g) is 25mM 1 ris, 10mM CHAPS, 3M NaCl, 1mM EDTA, pH7.5 and the buffer in step h) is 25mM Tris, 0.5M NaCl, 0.1% Tween 80, pH 7.5 .

Another method of purifying enzymatically active PAF AH from E. coli is contemplated in the invention. The method comprises the steps of: a) preparing an E. coli extract which, after lysis in a buffer containing CHAPS, results in a supernatant containing solubilized PAF-AH; b) diluting said supernatant and applying it to an anion exchange column equilibrated to a pH of about 8.0; c) eluting the PAF-Ah enzyme from said anion-exchange column; d) applying said adjusted eluate from said anion-exchange column to a blue dye ligand affinity column; d) eluting said blue dye ligand column with a buffer containing 3.0 M salt; f) diluting the eluate from the column containing the blue dye ligand to a buffer suitable for performing hydroxylapatite chromatography; g) performing hydroxylapatite chromatography, wherein the washing and elution is carried out with buffers (with or without CHAPS); h) diluting said hydroxylapatite eluate to a salt concentration suitable for a cation exchange resin; i) applying said diluted hydroxylapatite eluate to a cation-exchange column at a pH ranging from about 6.0 to 7.0; j) eluting PAF-AH from said cation-exchange column with a suitable buffer of a suitable composition; k) performing cation-exchange chromatography in the cold; and 1) the composition of a liquid or frozen form of PAF-AH in the absence of CHAPS.

Preferably, said step is: a) the lysis buffer has the composition: 25 mM Tris, 100 mM NaCl, 1 mM EDTA, 20 mM CHAPS, pH 8.0; in step b), the dilution of the supernatant for: anion-exchange chromatography is 3-4 times to 25 mM Tris, 1 mM EDTA. 10mM CHAPS, pH 8.0 and the column is a Q-Sepharose column equilibrated with 25mM Tris, 1mM EDTA, 50mM NaCl, 10mM CHAPS, pH 8.0; in step c), the anion-exchange column is eluted using 25 mM Tris, 1 mM EDTA, 350 mM NaCl, 10 mM CHAPS, pH 8.0; in step d), the eluate of step c) is applied directly to the blue dye ligand affinity column; in step e) the column is eluted with a buffer containing 3M NaCl, 10mM CHAPS, 25mM Tris, pH 8.0; in step f), the Blue dye eluate is diluted for hydroxylapatite chromatography. The eluate is diluted with 10 mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS, pH 6.2; in step g), hydroxylapatite chromatography is performed using a hydroxylapatite column equilibrated with 10 mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS. Elution is performed using 50 mM sodium phosphate, 100 mM NaCl (with or without 10 mM CHAPS), pH 7.5; in step h) diluting said hydroxylapatite eluate for cation-exchange chromatography using a buffer having a pH in the range of about 6.0 to 7.0 and containing sodium phosphate (with or without CHAPS); in step i) the column with S-Sepharose equilibrated with 50 mM sodium phosphate (with or without 10 mM CHAPS), pH 6.8; in step j) the elution is carried out with a buffer of a suitable composition such as 50 mM potassium phosphate, 12.5 mM acid. aspartic, 125 mM NaCl, pH 7.5 and containing 0.01% Tween 80; in step k) a cation 5 is performed

286 ion-exchange chromatography at 2-8 ° C. An example of a suitable buffer composition useful in step 1) that stabilizes PAF-AH is 50 mM potassium phosphate, 12.5 mM acid. aspartic, 125 mM NaCl, pH approximately 7.4 (with or without the addition of Tween 80 and / or Plurinic F68) or 25 mM phosphate (K +) buffer containing (at least) 125 mM NaCl, 25 mM arginine and 0.01% Tween-80 (with or without Pluronic F68 at approximately 0.1 and 0.5%).

Yet another method of purifying an enzymatically active rPAF-AH product of E. coli is contemplated in the invention. The method comprises the steps of: a) preparing an E. coli extract which, after lysis in a buffer containing Triton X-100, results in a solubilized supernatant of rPAF-AH; b) diluting said supernatant and loading it on an immobilized metal affinity exchange column equilibrated to a pH of about 8.0; c) eluting the rPAF AH product from said immobilized metal affinity exchange column with a buffer containing imidazole; d) adjusting the salt concentration and applying said eluate from the immobilized metal affinity exchange column to a hydrophobic mteraction column (HIC # 1), e) eluting said H1C # 1 by decreasing the salt concentration and / or increasing the detergent concentration; f) titrating said eluate from H1C # 1 to a pH of about 6.4; g) loading said treated eluate from H1C # 1 on a cation-exchange column (CEX # 1) equilibrated to a pH of about 6.4; h) eluting said CEX # 1 using sodium chloride concentration; i) adjusting said eluate from CEX # 1 with sodium chloride to a concentration of about 2.0M; j) depositing said eluate from CEX # 1 on a hydrophobic interaction column (H1C # 2) equilibrated to a pH of about 8.0 and a sodium chloride concentration of about 2.0M k) eluting said H1C # 2 by reducing the salt concentration and / or increasing the concentration of detergents; 1) diluting said eluate from H1C # 2 and adjusting the pH to about 6.0; m) loading said treated eluate from H1C # 2 onto a cation exchange column (CEX # 2) equilibrated to a pH of about 6.0; n) eluting the rPAF-AH product from said CEX # 2 buffer with a suitable composition.

Preferably, in step a), a lysis buffer of 90 mM TRIS, 0.125% Triton X-100, 0.6 M NaCl, pH 8.0 is used. Lysis is performed in a high-pressure homogenizer; in step b) the supernatant is diluted with equilibration buffer (20 mM TRIS, 0.5 M NaCl, 0.1% Triton X-100, pH 8.0), the zinc chelate column (Chelating Sepharose Fast Flow, Pharmacia, Uppsala, Sweden) is charged and equilibrated with equilibration buffer. Diluted supernatant is applied to the column and the column is washed with 20 mM TR1 S buffer, 0.5M NaCl, 4M urea, 0.1% Triton X-100, pH 8.0 and further washed with 20 mM TRIS, 0.5M NaCl, 0. 02% Triton X-100, pH 8.0; in step c) elution is accomplished with a 20 mM Tris solution, 50 mM imidazole, 0.02% Triton X-100, pH 8.0; in step d) the eluate is adjusted to 1mM EDTA and 2M NaCl, the Phenyl Sepharose 6 Fast Flow column (Pharmacia) is equilibrated with equilibration buffer (2.0M NaCl, 25mM Tris, 0.02% Triton X-100, pH 8.0) and the eluate of step c) is applied at room temperature. The column is washed with equilibration buffer and further washed with 25 mM NaPO ₄ , 0.20% Triton X-100, pH 6.5 at a rate of 30 cm / hr; in step e) elution is accomplished with 25 mM NaPO ₄ , 3% Triton X-100, pH 6.5; in step g), the Macroprep High S Column (Bio-Rad Labs, Richmond, CA, USA) is equilibrated with equilibration buffer (20 mM NaPO ₄ , 0.02% Triton X-100, pH 6.4). The treated eluate from step f) is applied to the column, washed with equilibration buffer and further washed with 25 mM NaPO ₄ buffer, 0.02% Triton X-100, pH 8.0; in step h) elution is accomplished with 25 mM NaPO ₄ , 0.02% Triton X-100, 1.3 M NaCl, pH 8.0; in step j), Bakerbond Wide Pore Hi-Propyl C ₃ (Baker, Philipsburg, NJ) is equilibrated with equilibration buffer (0.02% Triton X-100, 2M NaCl, 25mM Tris, pH 8.0). The conditioned eluate of step i) is applied to this column at room temperature, the column is washed with equilibration buffer and further washed with 0.20% Triton X-100, 25 mM Tris, pH 8.0 at a rate of 30 cm / hr; in step k), elution was accomplished using a 10 mM Tris solution, 3.0% Triton X-100, pH 8.0; in step 1) it is diluted into equilibration buffer (20 mM succinate, 0.1% PLURONIC F68 pH 6.0); in step m) the SP Sepharose Fast Flow column (Pharmacia) is equilibrated with the equilibration buffer of step 1) and the eluate from step 1) further loaded onto it is washed with equilibration buffer; and in step n) elution is accomplished with a solution of 50 mM NaPO ₄ , 0.7 M NaCl, 0.1% PLURONIC F68, 0.02% TWEEN 80, pH 7.5.

PAF-AH products may be obtained as isolates from natural cell sources or may be chemically synthesized.

Preferably, however, they are produced by recombinant methods involving the host eukaryotic and prokaryotic cells of the invention. PAF-AH products having part or all of the amino acid sequence described in SEQ ID NO: 8 are contemplated in the present invention. Particularly contemplated are fragments that lack up to the first twelve N-terminal amino acids of the human PAF-AH amino acid sequences described in SEQ ID NO: 8. Preferably those having the initiating N-terminal amino acid Met ₄₆ , Ala ₄₇ or Ala ₄₈ SEQ ID NO: 8. Also contemplated are fragments of this which lack up to thirty C-terminal amino acids of the amino acid sequence of SEQ ID NO: 8, particularly those having Ile ₄₂₉ and Leu ₄₃₁ as the C-terminal residue. Also contemplated are variants of PAF-AH or PAF-AH, or those having an amino group replaced in SEQ ID NO: 8 and selected from the group consisting of S108A, S273A, D286A, D286N, D 296 A, D 304 A, D 338 A, H 351 A, H 399 A, H 399 A, C 67 S, C 229 S, C 291 S, C 334 S, C 407 S, D 286 A, D 286 N and D 304 A. As noted, polynucleotides (including DNA) encoding such fragments or fragment variations are provided by the invention. Also provided by the invention are methods of recombinantly producing these fragments or variations by growing host cells containing such DNA. Currently preferred PAF-AH products include prokaryotic polypeptide expression products of DNA encoding Met amino acid residues ₄₆ to Asn _{441 of} SEQ ID NO: 8 referred to as rPH.2 and prokaryotic polypeptide expression products of DNA encoding Met amino acid residues ₄₆ to Ile _{429 of} SEQ ID NO: 8 referred to. as rPH.9. Both products (rPH.2 and rPH.9) exhibit lower amino terminal heterogeneity than, for example, the corresponding prokaryotic polypeptide expression products DNA encoding the entire PAF-AH sequence with the preceding translational initiation codon. In addition, rPH.9 exhibits higher carboxy-terminal homogeneity (consistency). The use of mammalian host cells is contemplated to provide for such post-translational modifications (e.g., myristolization, glycosylation, truncation, lipidation, and tyrosine-, serine- and threonine-phosphorylation) that may be required to confer optimal biological activity of the recombinant expression products of the invention. The PAF-AH products described in the invention may be full length, may be fragments or variations. Variations may include PAF-AH analogues where one or more specified (e.g., naturally encoded) amino acids are selected or replaced or where one or more unspecified amino acids are added 1) without losing one or more PAF-AH specific enzymatic activities or immunological characteristics or 2) with the specific inability of a particular PAF-AH biological activity. Proteins or other molecules that bind to PAF-AH can be used to modulate its activity.

Also contemplated by the present invention are "antibody" substances (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR grafted antibodies, and the like) and other PAF-AH specific binding proteins. In particular, the demonstrative binding proteins of the invention are monoclonal antibodies produced by 90G11D and 90F2D hybridomas, which were deposited in American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852, September 30, 1994 and assigned Accession Nos. HB 11724 and HB 11725. Another demonstrating binding protein of the invention is a monoclonal antibody produced by hybridoma 143A, deposited at the ATCC on June 1, 1995 and assigned to it by Accession No. HB. is HB 11900. Proteins or other molecules (e.g., lipids or small molecules) that specifically bind to PAF-AH can be identified using plasma-derived PAF-AH, recombinant PAF-AH, PAF-AH variations, or cells expressing such products. . The binding proteins are subsequently useful in compositions for immunization as well as for purification of PAF-AH. They are also useful for detecting or quantifying PAF-AH in fluids and tissue samples using known immunological techniques. Anti-idiotypic antibodies specific for PAF-AH specific antibody substances are also contemplated.

The scientific value of the information provided through the disclosure of the DNA and amino acid sequence of the present invention is apparent. One of a series of examples of knowledge of the cDNA sequence for PAF-AH allows the use of DNA / DNA hybridizations to isolate genomic DNA sequences encoding PAF-AH and to specify PAF-AH expression control regulatory sequences such as promoters, operators, and the like. DNA / DNA hybridization procedures performed with the DNA sequences of the invention under standard stringency conditions also seem to allow isolation of DNA encoding allelic variants of PAF-AH, other structurally related proteins that share one or more of the biochemical and / or immunological properties of PAF-AH, as well as protein homologues. PAF-AH from non-human sources. The DNA sequence information provided by the present invention also allows, through homologous recombination or knockout strategies (see, e.g., Kapecchi, Science. 244, 1288-1292 (1989)), the development of rodents that are unable to express a functional PAF-AH enzyme or to express a PAF- AH enzyme. The appropriately labeled polynucleotides described herein are useful in hybridization assays to detect the capacity of cells to synthesize PAF-AH. The polynucleotides described in the invention may also form the basis of diagnostic methods useful in the identification and genetic engineering at the PAF-AH center that underline the disease state (s). The invention also makes available antisense polynucleotides important in regulating the expression of PAF-AH by those cells that usually epximinate the same.

Administration of the PAF-AH preparations of the invention to mammalian subjects, particularly humans, for the purpose of ameliorating pathological inflammatory conditions is contemplated. Based on evidence of PAF involvement in pathological inflammatory conditions, administration of PAF-AH is indicated e.g. in the treatment of asthma (Miwa et al., J. Clin Invest., 82: 1983-1991 (1988); Hsieh et al., J. Allergy Clin. Immunol., 91: 650-657 (1993); and Yamashida et al. , Allergy, 49: 60-63 (1994)), anaphylaxis (Venable et al., Supra), shock (Venable: et al., Supra), reperfusion injury, and central nervous system ischemia (Lindsberg et al. ( 1991), see above), antigen-induced arthritis (Zarco et al., Clin. Exp. Immunol., 88: 318-323 (1992)), atherogenesis (Handley et al., Drug Dev. Res., 7: 361- 375 (1986)) Crohn's disease (Denizot et al., Digestive Diseases and Sciences, 37 (3): 432-437 (1982)), ischemic bowel necrosis / necrotizing enterocolitis (Denizot et al., Supra and Caplan et al. , Acta Paediatr., Suppl. 396, 11-17 (1994)), ulcerative colitis (Denizot et al., Supra), ischemic stroke (Saton et al., Strake 23: 1090-1092 (1992)), ischemic stroke. brain injuries (Lindsberg et al., Stroke, 21: 1452-1457 (1990) and Lindsber g et al. (1991), supra), systemic lupus erythematosus (Matsizaki et al., Clinica Chimica Acta, 210: 139-144 (1992)), acute pancreatitis (Kald et al.,

SK 286518-6

Pancreas, 8 (4): 440-442 (1993)), blood poisoning (Kald et al., Supra), acute post-streptococcal glomerulonephritis (Mezzano et al., J. Am. Soc. Nephrol., 4: 235-242 (1993), pulmonary edema in response to IL-2 treatment (Rabinovici et al., J. Clin. Invest., 89: 1669-1673 (1992)), allergic inflammation (Watanabe et al., Br. J. Pharmacol. , 111: 123-130 (1994)), ischemic renal failure (Grino ela., Annals oflntemal Medicine, 121 (5): 345-347 (1994)), premature labor (Hoffman et al., AM J. Obstet Gynecol., 162 (2): 525-528 (1990) and Maki et al., Proc. Natl. Acad. Sci. USA, 85: 728-732 (1988), adult respiratory insufficiency syndrome (Rabinovici et al. J. Appl. Physiol., 74 (4): 1791-1802 (1993), Matsumoto et al., Clin Exp, Pharmacol Physiol., 19: 509-515 (1992) and Rodriguez-Roisin et al. J. Clin Invest., 93: 188-194 (1994) The use of PAF-AH formulations for the treatment of HIV central nervous system infection is also contemplated in the invention. hedged. "Treatment" as used herein includes both prophylactic and therapeutic treatment.

For many of the aforementioned pathological conditions, an experimental animal model has been described. For example, a mouse model for asthma and rhinitis is described in Example 16 of this document; a rabbit model for arthritis is described in Zarco et al., supra; rat models for ischemic intestinal necrosis / necrotizing enterocolitis are described in Furukawa et al., Ped. Res., 34 (2): 237-241 (1993) and Caplan et al., Supra; the rabbit stroke model is described in Lindsberg et al., (1990), supra; the mouse model for lupus is described in Matsuzaki et al., supra; the rat model for acute pancreatitis is described in Kald et al., supra; a rat model for pulmonary edema as a result of IL-2 therapy is described in Rabinovici et al., supra; the rat allergic inflammatory model is described in Watanable et al., supra; a canine model for kidney allograft is described in Watson et al., Transplantation, 56 (4), 1047-1049 (1993) and rat and guinea pig models of adult respiratory distress syndrome are separately described in Rabinovici et al., supra and Lellouch-Tubiana . Am. Rev. Respir. Dis., 137: 948-954 (1988).

Particularly contemplated in the invention are PAF-AH compositions useful in a method of treating a mammal that is easily subject to or suffering from a pathological condition caused by PAF. Such treatment includes administration of: PAF-AH to mammals in amounts sufficient to complement the endogenous activity of PAF-AH and to inactivate pathological amounts of PAF in these mammals.

The therapeutic-pharmacological composition contemplated herein includes PAF-AH products and physiologically acceptable diluents or carriers. It may also include other substances having anti-inflammatory effects. The indicated dose amount would be sufficient to complement the endogenous activity of PAF-AH and to inactivate pathological amounts of PAF. For general consideration of dosages, see Remmington's Pharmaceutical Sciences, 18th Edition. Mack Publishing Co., Easton, PA (1990). Dosages will range between 0.1 to about 100 µg PAFAH / kg body weight. The therapeutic compositions of the invention may be administered by various routes depending on the pathological conditions to be treated. Administration can be, for example, intravenously, subcutaneously, orally, in the form of suppositories and / or via the pulmonary routes.

In the case of pathological lung conditions, administration of PAF-AH by the pulmonary route is preferably indicated. For pulmonary administration, a wide range of "delivery" devices common for these targets, e.g. nebulizers, measuring inhalers and powder inhalers. The "delivery" of various proteins and the circulatory system by inhalation of aerosol mixtures has been described in Adjei et al., Pharm. Res., 7 (6): 565-569 (1990) (leuprolide acetate); Braquet et al., J. Cardio. Pharm., 13 (Supp. 5): p. 143-146 (1989) (endothelin-1); Hubbard et al., Annals oflntemal Medicine, 111 (3), 206-212 (1989) (α-antitrypsin); Smith et al., J. Clin Invest., 84: 1145-1146 (1989) (α-1-proteinase inhibitor); Debs et al., J. Immunol., 140: 3482-3488 (1993) (recombinant gamainterferon and tumor necrosis factor alpha); Patent Cooperation Treaty (PCT) WO 94/20069 published September 15, 1994 (recombinant pegylated granuloezyte colony stimulating factor).

BRIEF DESCRIPTION OF THE DRAWINGS

A number of other aspects and advantages of the present invention will become apparent upon consideration of the following detailed explanations, referring to the drawings, where:

Fig. 1: Photo of PVDF membrane containing PAF-AH purified from human plasma.

Fig. 2: Graph showing the enzymatic activity of recombinant human plasma PAF-AH.

Fig. 3: Schematic drawing showing recombinant fragments of PAF-AH and their catalytic activities.

Fig. 4: Mass spectroscopy of rPH.2 recombinant PAF-AH product.

Fig. 5: Mass spectroscopy of rPH.9, a recombinant product of PAF-AH.

Fig. 6: Bar graph illustrating blockade of PAF-induced rat foot edema by locally administered recombinant PAF-AH of the invention.

Fig. 7: Bar graph illustrating blockade of PAF-induced rat foot edema by intravenous recombinant PAF-AH.

Fig. 8: Bar graph showing that PAF-AH blocks PAF-induced edema but not zymosan A-induced edema.

Fig. 9Λ and 9B: Anti-inflammatory activity of PAF-AH in rat foot edema - dose-dependent. Fig. 10A and 10B: In vivo time dependency of efficacy of a single dose of PAF-AH.

Fig. 11: Line graph showing the pharmacokinetics of PAF-AH in rat bloodstream.

Fig. 12: Bar graph showing the anti-inflammatory effects of PAF-AH compared to the lower effect of PAF antagonists in rat foot edema.

Fig. 13: Representation of results indicating that PAF-AH neutralizes the apoptotic effects of medium from HIV-1 infected and activated monocytes.

DETAILED DESCRIPTION OF THE INVENTION

The following examples serve to illustrate the invention. Example 1 presents a new method for purifying PAF-AH from human plasma. Example 2 describes the microsquencing of amino acid residues of PAF-AH purified from human plasma. Example 3 describes the cloning of a full lenth cDNA cDNA encoding human plasma PAF-AH. In Example 4, various variants of the composition of the gene encoding human plasma PAF-AH are described. Cloning of gene sequences encoding human plasma PAF-AH is described in Example 5. Example 6 describes cloning of cDNA homologs for human plasma PAF-AH for canine, mouse, bovine, chicken, rodent and cynomolgus cDNAs. Example 7 describes the results of an assay demonstrating the enzymatic activity of recombinant PAF-AH transiently expressed in COS 7 cells. Example 8 describes the expression of DNA representing full length DNA, truncated DNA and chimeric DNA for human PAF-AH in E. coli, S. cerevisiae and mammalian cells. Example 9 provides a protocol for purifying recombinant PAF-AH from E. coli and assays confirming its enzymatic activity. Example 10 describes various recombinant products for PAF-AH, including analogues resulting from amino acid residue substitution and products resulting from truncation at the amino and carboxy termini. Further, an experiment demonstrating that native PAF-AH isolated from plasma is glycosylated is described herein. The results of Northern blot analyzes to demonstrate the expression of human plasma PAF-AH RNA in various tissues and cell lines are presented in Example 11, while the results of in situ hybridization are shown in Example 12. Example 13 describes the development of monoclonal and polyclonal antibodies specific for human plasma PAF-AH. Examples 14, 15, 16, 17, 18 and 19 describe in vivo animal models the therapeutic effects of administration of recombinant PAF-AH products of the invention on acute inflammation; pleural inflammation, asthma, necrotizing enterocolitis (intestinal catarrh), adult respiratory distress syndrome, and pancreatitis. Example 20 describes the in vitro effect of recombinant PAF-AH product on neurotoxicity associated with HIV infection. Example 21 shows the results of an immunoassay of a serum of human patients deficient in PAF-AH activity and describes the identification of genetic disorders in patients that are obviously responsible for this deficiency.

Example 1

Purification was performed to obtain material for the amino acid sequence of human plasma PAF-AH.

A. Optimization of purification conditions

First, low density lipoprotein (LDL) lipoprotein particles were removed from the plasma by precipitation with plasma phosphate fraction and subsequent solubilization in 0.1% Tween 20. Then, DEAE column chromatography (Pharmacia, Oppsala, Sweden) was performed as described above. Stafforinim et al. (1987), supra, but the inconsistent elution of PAF-AH activity from the DEAE column required a reassessment of solubilization and subsequent purification conditions.

Tween 20, CHAPS (Pierce Chemical Co., Rockford, IL) and octyl glucoside were evaluated in centrifugation methods and gel filtration chromatography used for their ability to solubilize LDL particles. CHAPS showed a 25% greater activity recovery in the soluble fraction than Tween 20 and a 300% greater activity recovery than octylglucoside. The LDL precipitate solubilized with 10 mM CHAPS was then separated on a DEAE Sepharose Fast Flow column (an anion exchange column; Pharmacia) using a buffer containing 1 mM CHAPS. This yielded a large amount of partially purified PAF-AH ("DEAE pool"), which was used to evaluate additional columns.

The DEAE pool was used as a starting material to test other different chromatographic columns that were used to further purify the PAF-AH activity. Among the columns tested were: Blue Sepharose Fast Fleiw (Pharmacia), a color ligand affinity chromatography column; S-Sepharose Fast Flow (Pharmacia), cation exchange; Cu Chelating Sepharose (Pharmacia), affinity chromatography column using metal ligands; Fractogel S (EM Separations, Gibbstown, NJ), cation exchanger and Sephaacryl-200 (Pharmacia), gel filtration column. However, all these chromatographic procedures yielded only a low degree of purification when 1 mM CHAPS was used. Subsequent goal chromatography on Sephacryle S-200 in 1mM CHAPS yielded an enzymatically active fraction which, however, eluted from the column over a larger size range than expected size corresponding to approximately: 44 kDa. This finding suggests that LDL proteins are aggregated in solution.

Different LDL samples were therefore evaluated by analytical gel filtration when assessing the degree of aggregation and its effect on PAF-AH activity. DEAE pool samples and freshly dissolved LDL precipitates were analyzed on a Superose 12 (Pharmacia) column equilibrated with 1mM CHAPS buffer. Both samples eluted from the column over a wide range of molecular weights, the highest activity was found in the fraction with a molecular weight higher than 150 kDa. When samples were analyzed on a Superose 12 column equilibrated with 10mM CHAPS, the largest amount of activity was found in a fraction with a molecular weight of approximately 44 kDa, the area where activity was predicted. Samples that contained activity in the higher molecular weight fractions corresponded to the aggregates.

The activity of the other samples, after subsequent gel filtration testing, was found exclusively in the molecular weight range corresponding to 44 kDa. These samples were LDL precipitates dissolved in 10 mM CHAPS in the presence of 0.5 M NaCl and further samples from DEAE pool, which were treated after elution from the column with 10 mM CHAPS. The results obtained confirm that at least 10 mM CHAPS should be used to prevent aggregation of PAF-AH samples. Increasing the CHAPS concentration from 1 mM to 10 mM after chromatography on a DEAE cellulose column, but prior to the next steps of the purification procedure, caused dramatic changes in the purification procedure. For example, the degree of purification of PAF-AH on the S-Sepharose FAST Flow column was increased from 2X to 10X. PAF-AH activity binds in 1 mM CHAPS to a Blue Sepharose Fast Flow column irreversible, but when used with 10 mM CHAPS, a very high level of activity is eluted from the column. However, DEAE column chromatography did not improve by adding 10 mM CHAPS over previous chromatographies.

Cu Chelating Sepharose column chromatography, followed by Blue Sepharose Fast Flow chromatography, increased PAF-AH activity by 15-fold. It has also been found that PAF-AH activity can be restored after electrophoresis on a reducing SDS polyacrylamide gel, but the sample must not be cooked prior to electrophoresis. The activity of the material obtained by elution from the Cu Chelating Sepharose column, after electrophoresis on an SDS polyacrylamide gel and subsequent silver staining, occurred in the main band of the protein.

B. Protocol for Purification of PAF-AH

The new protocol for purifying PAF-AH for amino acid sequencing targets includes the following steps, which are performed at 4 ° C. Human plasma was dispensed in 900 ml aliquots into 1 liter Nalgene bottles and the pH was adjusted to 8.6. The LDL particles were then precipitated by the addition of 90 mL of 3.85% sodium phosphotungstate followed by the addition of 2M MgCl ₂ . The plasma was then centrifuged for 15 minutes at 3600 g. The pellet was resuspended in 800 ml of 0.2% sodium citrate. LDL particles were reprecipitated by the addition of 10 g NaCl and 24 ml 2N MgCl ₂ . LDL particles obtained from 5 L human plasma were dissolved in 5 L buffer A (25 mM Tris-HCl, 10 mM CHAPS, pH 7.5) and allowed to stir overnight. The dissolved LDL particles were centrifuged at 3600 g for 1.5 hours. The supernatant was collected, then filtered through Whatman 113 filter paper to remove any remaining solids. Solubilized LDL particles were seeded on a DEAE Sepharose Fast Flow column (11 x 10 cm; resin volume 1 L; 80 mL / min) which was equilibrated with buffer B (25 mM Tris-HCl, 1 mM CHAPS, pH 7.5). The column was washed with 8 L of a 0-0.5 M NaCl gradient and 480 mL fractions were collected. This step was necessary to bind the substances to the Blue Sepharose Fast Flow column as described below. Fractions were assayed for acetyl hydrolase activity by the method described in Example 4.

Fractions exhibiting activity were pooled and CHAPS was added to give a concentration of 10 mM throughout the volume of fractions. All fractions obtained after DEAE chromatography were loaded overnight at 4 ml / min. to a Blue Sepharose Fast Flow column (5 cm x 10 cm, 200 ml dead volume) equilibrated with 0.5 M NaCl buffer. The column was washed with equilibration buffer at a rate of 16 ml / min until the absorbance returned to the absorbance measured before sample application. PAF-AH activity was eluted from the column by step elution with buffer A containing 0.5 M KSCN (chaotropic salt) at a rate of 16 ml / min. 50 ml fractions were collected. This step resulted in more than a thousand fold purification of the enzyme preparation. The active fractions were collected, then adjusted to pH 8.0 over their entire collected volume using 1M Tris-HCl, pH 8.0. The active fraction obtained after chromatography on a Blue Sepharose Fast Flow column was loaded onto a Cu Chelatin Sepharose column (2.5 x 2 cm, dead volume 10 ml; flow rate 4 ml / min) which was equilibrated with buffer C (25mM Tris-HCl) 10 mM CHAPS, 0.5 M NaCl, pH 8.0, a buffer of pH 7.5 may also be used. The column was eluted with a volume of 50 ml of buffer C. PAF-AH activity was eluted from a 100 ml column of 50 mM imidazole in buffer C and 10-ml fractions were collected. The eluent with active PAF-AH was collected and dialyzed against buffer A. In addition to increasing the activity of the PAF-AH enzyme by a 15-fold step, Cu Chelating Sepharose column chromatography gave very little purification. The active eluent from the Cu Chelating Sepharose column was reduced in 50 mM DTT for 15 minutes at 37 ° C and then loaded onto a 0.75 mm 7.5% polyacrylamide gel. The gel plates were cut10

286 for strips of 0.5 cm width and placed in a disposable centrifuge micro-cuvette containing 20 μΐ 25 mM Tris-HCl, 10 mM CHAPS, 150 mM NaCl. The strips were then smeared and allowed to incubate in a cuvette overnight at 4 ° C. The supernatant produced by centrifugation of these crushed gel bands was then tested for PAF-AH activity to determine which band on the SDS-PAGE gel contained PAF-AH. PAF-AH activity was found in a band that corresponds to a molecular weight of approximately 44 kDa. Duplicate gel proteins were electrically transferred to a PVDF membrane (Immobilon-P, Millipore) and stained with Comassie Blue. A photograph of the PVDF membrane is shown in Figure 1.

As shown in Table 2, FIG. 1 below, approximately 200 µg of PAFAH purified 2 x 10 ⁶ were obtained from 5 L of human plasma. For comparison, Stafforini et al. (1987), supra, described in his procedure the purification of 3 x 10 ^{4 activity} .

Table 1

sample Volume (ml) Activity (cpmx 10 ⁶ ) Total activity (cpmx 10 ⁶ ) Horses, protein (mg / ml) Specific activity (cpmx 10 ⁶ ) % return on activity (cpmx 10 ⁶ ) Multiple cleanup step tot. step tot. plasma 5000 23 116 62 0.37 100 100 1 1 LOL 4500 22 97 1.76 12 84 84 33 33 DEAE 4200 49 207 1.08 46 212 178 3.7 124 Blue 165 881 14 0.02 54200 70 126 1190 1.5 x 10 ⁵ Cu 12 12700 152 0.15 82200 104 131 1.5 2.2 x 10 ⁵ SDS-PAGE - - - - - - - '10 2.2 x 10 ⁵

In summary, the following steps are unique and critical for successful purification of PAF-AH from plasma for micro sequencing: (1) dissolution and chromatography on 10 mM CHAPS, (2) affinity chromatography on a blue ligand column such as Blue Sepharose Fast Flow, (3) chromatography on a Cu ligand affinity carrier such as Cu Chelating Sepharose and (4) eluting PAF-AH from the gel after SDS-PAGE.

Example 2

A protein band of about 44 kDa was excised from a PVDF membrane containing PAF-AH (described in Example 1), the sequence of proteins present was determined using an Applied Biosystems 473A protein sequencer. Analysis of the N-terminal region sequences of proteins migrating in the region of about 44 kDa that exhibits PAF-AH activity indicated the presence of two major and two minor sequences. The ratio of the two major sequences was 1: 1, so it was difficult to interpret the sequence data.

In order to distinguish the sequences of the two major proteins separated on an SDS gel, a duplicate of a PVDF membrane with a band of about 44 kDa was split and the upper and lower parts sequenced separately.

The N-terminal sequence obtained from the lower half of the membrane is as follows:

SEQ ID NO: 1

FKDLGEEAFKALVLIAF

After searching the protein databases, this sequence was identified with a fragment of human serum albumin. The N-terminal sequence determined for material from the upper half of the same PVDF membrane is as follows:

SEQ ID NO: 2

IQ VLM AND ASFGQTKIP

This sequence had no counterpart in any protein from the databases examined and differed from the N-terminal amino acid sequence:

SEQ ID NO: 3

MKPLVVFVLGG described for erythrocyte cytoplasmic PAF-AH in Stafforini et al. (1993), supra. The novel sequence (SEQ ID NO: 2) was used to clone human plasma PAF-AH cDNA as described in Example 3 below.

SK 286518-6

Example 3

A clone encoding full human plasma PAF-AH was isolated from a macrophage cDNA library.

A. Construction of a macrophage cDNA library

Poly A + RNA was isolated from monocyte-derived peripheral blood macrophages. The double stranded, blunt-ended cDNA was obtained using the Invitrogen Copy Kit (San Oiego, CA), ligated with BstXI adapters, and then inserted into a mammalian expression vector pRc (CMV (Invitrogen)), and the resulting plasmid was electroporated into E. The transformed bacteria were seeded on 978 plates at a density of about 3000 colonies per plate, and plasmid DNA prepared separately from each plate was stored in individual pools, also pooled into larger pools representing 300,000 clones.

B. Library Testing by PCR

The macrophage library was tested by a polymerase chain reaction using degenerate "antisense" primers designed based on the new N-terminal amino acid sequence described in Example 2. The primer sequence is given in accordance with the IUPAC nomenclature, "I" means inosine.

SEQ ID NO: 4

5 'ACATGAATTCGGIATCYTTIGTYTGICCRAA 3 ’

The codon selection table (Wada et al., Muc. Acids Res., 19S: 1981-1986 (1991)) was used to determine the nucleotides at the third position of each codon of this primer. This primer was used in combination with a primer specific for either the SPG or T7 promoter sequence located on both sides of the cloning site of the pRc / CMV vector to test the macrophage library files with 300,000 clones. Each PCR reaction mixture was composed of 100 ng of tcmplate cDNA, 1 µg of each of the two primers, 0.125 mM of each of the four dNTPs, 10 mM Tris-HCl pH 8.4, 50 mM MgCl ₂ and 2.5 units of Taq peilymerase. An initial denaturation step of 4 minutes at 94 ° C was followed by 30 amplification cycles consisting of 1 minute at 94 ° C, 1 minute at 60 ° C and 2 minutes at 72 ° C. The resulting PCR product was cloned into the pBluescript SK- vector (Stratagene, La Jolla, CA) and its nucleotide sequence determined by the dideoxy method. This PCR product contained a sequence derivable from the new peptide sequence and corresponding to nucleotides 3 to 301 (SEQ ID NO: 7).

The following are PCR primers specific for the described cloned PCR fragment and designed to find a full-length clone.

HEART ID NO: 5)

5 'TATTTCTAGAAGTGTGGTGGAACTCGCTGG 3'

Antisense * 'primer C CUT TD NO: G)' CGATGAATTCAGCTTGCAGCAGCCATCAGTAC 3 '

PCR reactions using these primers were performed as described and served for the first testing of 300,000 clone cDNAs and then for the corresponding smaller 3000 clone pools. Three sets of 3000 clones that gave the PCR product of the expected size were used to transform the bacteria.

C. Testing the library by hybridization

DNA from these bacteria was tested by hybridization using the original cloned PCR fragment as a probe. Colonies were transferred to nitrocellulose, prehybridized and hybridized in 50% formamide, 0.75M sodium chloride, 0.075M sodium citrate, 0.05M sodium phosphate, pH 6.5, 1% polyvinylpyrrolidone, 1% ficola, 1% bovine serum albumin, and 50%. ng / ml sonicated DNA from salmon milk. The hybridization probe was labeled by random priming with hexamers. Hybridization was performed at 42 ° C overnight, membranes were extensively washed with 0.03 M sodium chloride, 3 mM sodium citrate, 0.1% SDS at 42 ° C. The nucleotide sequence was determined for 10 clones giving a positive signal. One of these clones, sAH 406-3, contained a sequence deductible based on the original peptide sequence of a protein with PAF-AH activity purified from human plasma. The DNA and amino acid sequences derived therefrom are shown in SEQ ID NO: 7 (DNA) and SEQ ID NO: 8 (amino acids).

The sAH 406-3 clone contains an 1.52 kb insert with an open reading frame that encodes a putative 441 amino acid protein. At the N-terminus is a relatively hydrophobic stretch of 41 amino12 in length

286 acids before the N-terminal amino acid as determined by protein micro-sequencing (isoleucine at position 42 in SEQ ID NO: 8). The encoded protein may have either a long signal sequence or a signal sequence plus an additional peptide that is cleaved to yield a mature functional enzyme. The presence of a signal sequence is one feature of the secreted proteins. In addition, there is a consensus motif GxSxG (amino acids 271-275 in SEQ ID NO: 8) in the protein encoded by the sAH 406-3 clone, which is believed to contain the active site serine for all known mammalian and microbial lipases and serine proteases. Chapus et al., Biochimie, 70: 1223-1224 (1988) and Brenner, Nature, 334: 528-530 (1988).

Table 2 presents a comparison of the amino acid composition of human plasma PAF-AH of the present invention based on the sequence of SEQ ID NO: 8 with the amino acid composition of the purified material described by Stafforini et al. (1987), supra.

Table 2

Kloň sAH 406-3 Stafforini et al. Ala 26 24 Asp & Asn 48 37 Cys 5 14 Glu & Gin 36 42 Phe 22 12 Gly 29 58 His 13 24 Ile 31 17 Lys 26 50 Leu 40 26 Met 10 7 for 15 11 Arg 18 16 Ser 27 36 Thr 20 15 wall 13 14 Trp 7 Not allocated Tyr 14 13

The amino acid composition of the mature form of human plasma PAF-AH, which is the subject of this patent, and the amino acid composition of a previously purified material, which has been designated human plasma PAF-AH, is distinctly different.

Comparison of the nucleotide and deduced amino acid sequence of bovine brain cytoplasmic PAF-AH (Hattori et al., Supra) with the human plasma PAF-AH nucleotide sequence of the present invention revealed no significant structural similarity to these sequences.

Example 4

PCR performed with cDNA from macrophages and stimulated PBMC using primers hybridizing to the 5 'untranslated region (nucleotides 31 to 52 in SEQ ID NO: 7) and regions containing a translation termination codon at the 3' end of the PAF-AH cDNA (nucleotides 1465 to 1487 in SEQ ID NO: 7) found the putative splice variant of the human PAF-AH gene. This PCR reaction resulted in two bands per gel, one corresponding to the expected size of the PAF-AH cDNA of Example 3 and the other shorter by about 100 bp. The larger band was identified by sequencing with the PAF-AH cDNA of Example 3, while the shorter band lacked exon 2 (see Example 5) of the PAF-AH sequence, which encodes the putative signal and propeptide sequence of plasma PAF-AH.

The predicted catalytic triad and all cysteine residues are present in the shorter clone, therefore the biochemical activity of the protein encoded by this clone is likely to be identical to that of the plasma enzyme.

To determine the biological significance of this splicing variant of PAF-AH, which is believed to encode a cytoplasmic active enzyme, the relative amount of both forms in monocyte-derived blood macrophages was examined by the RNase protection method. Neither of the two mRNAs was present in freshly isolated monocytes, but both mRNAs were found on Day 2 during in vitro differentiation of monocytes into macrophages and persisted for 6 days of culture. The number of mRNA admissions was approximately the same throughout the differentiation period. In contrast, a similar analysis of nerve tissue detected only full-length mRNA expression encoding the extracellular full-length form of PAF-AH.

SK 286518-6

Example 5

Human plasma PAF-AH genomic sequences were also isolated. The structure of the PAF-AH gene was determined by isolating lambda and 1 phage clones containing human genomic DNA by DNA hybridization under high stringency conditions. Phage clone fragments were further cloned and sequenced using primers added at regular intervals to the cDNA clone of the sAH 406-3. In addition, new sequencing primers were prepared homologous to the exon bordering intron regions and used for upstream sequencing across the exon-intron boundaries to confirm the sequence. The exon / intron boundaries were defined as points where the genomic sequence and cDNA begin to differ. This analysis revealed the composition of the human PAF-AH gene from 12 exons.

Exons 1, 2, 3, 4, 5, 6 and part of exon 7 were isolated from a male fetal placental library constructed in lambda FIX (Stratagene). Phage plaques were transferred to nitrocellulose, prehybridized and hybridized in 50% formamide, 0.75M sodium chloride, 75mM sodium citrate, 50mM sodium phosphate (pH 6.5), 1% polyvinylpyrrolidone, 1% ficola, 1% bovine serumalbumin, and 50 ng / ml sonicated DNA from salmon milk. The complete cDNA clone sAH 406-3 was used as a hybridization probe to identify phage clones containing exons 2-6 and part of exon 7. The clone containing exon 1 was identified by a fragment derived from the 5 'end of this cDNA clone (nucleotides 1 to 312 of SEQ ID NO). NO: 7). Both probes were labeled with 32P by random priming with hexamers. Hybridization was performed at 42 ° C overnight, membranes were extensively washed with 30 mM sodium chloride, 3 mM sodium citrate, 0.1% SDS at 42 ° C. The DNA sequences of exons 1, 2, 3, 4, 5 and 6, together with partial sequences of adjacent introns, are set forth in SEQ ID NOs: 9, 10, 11, 12, 13 and 14.

The remainder of exon 7 and exons 8, 9, 10, 11 and 12 were cloned from a P1 clone isolated from the human P1 genomic library. P1 phage plaques were transferred to nitrocellulose, prehybridized and hybridized in 0.75M sodium chloride, 50mM sodium phosphate (pH 7.4), 5mM EDTA, 1% polyvinylpyrrolidone, 1% ficol, 1% bovine serum albumin, 0.5% SDS and 0.1 mg / ml total human DNA. 2,6 kb

An EcoRI fragment of genomic DNA derived from the 3 'end of the lambda clone isolated previously was used as a probe and labeled with 32P by random priming with hexamers. This fragment contained exon 6 and part of exon 7 present in the phage clone. After overnight hybridization at 65 ° C, the membranes were washed as described. The DNA sequences of exons 7, 8, 9, 10, 11 and 12 together with partial sequences of adjacent introns are shown in SEQ ID NOs: 15, 16, 17, 18, 19 and 20.

Example 6

Complete plasma PAF-AH cDNA clones were isolated from mouse, canine, bovine and chicken spleen cDNA libraries, and an incomplete rodent clone was isolated from rat thymus cDNA library. These clones were identified by low stringency hybridization with human cDNA (hybridization conditions were the same as described for exons 1 to 6 in Example 5, but instead of 50% formamide 20% formamide was used). The 1 kb Hind III fragment of the human PAF-AH cDNA clone sAH 406-3 (nucleotides 309-1322 in SEQ ID NO: 7) was used as a probe. In addition, an incomplete monkey clone from cynomolgus brain cDNA was isolated by PCR and primers designed according to nucleotides 285 to 303 and 851 to 867 of SEQ ID NO: 7. Nucleotide and deduced amino acid sequences of cDNA clones from mouse, dog, cow, chicken, rat and cynomolgus monkey are shown in SEQ ID NOs: 21, 22, 23, 24, 25 and 26, respectively.

Comparison of the deduced amino acid sequences of the cDNA clones with the human cDNA clone yielded data on the percentage of identical amino acids that are shown in Table 1. Third

Table 3

Man The dog mouse cow hen The dog 80 100 64 82 50 mouse 66 64 100 64 47 monkey 92 82 69 80 52 rat 74 69 82 69 55 cow 82 82 64 100 50 hen 50 50 47 50 100

About 38% of the amino acid residues are completely conserved in all sequences. The most variable regions are located at the N-terminus (containing the signal sequence) and at the C-terminus, and are not significant for enzyme activity as shown in Example 10. Gly-Xaa-Ser-Xaa-Gly motif (SEQ ID NO: 27) found in neutral lipases and other esterases is conserved in bovine, canine, murine, rat and chicken PAF-AH. The serine, located in the middle of this motif, serves as an active nucleophilic site by these enzymes. The putative aspartame and histidine components of the active site (Example 10A) are also conserved. Thus, the human plasma PAF-AH that is the subject of this patent is likely to utilize a catalyzed lytic triad and may occupy the α / phydrolase conformation typical of neutral lipases, although it does not otherwise show sequence homology to lipases.

Human plasma PAF-AH should contain a region that specifically interacts with plasma lipoprotein particles (low density and high density). The N-terminal portion of the molecule containing the long stretches of highly interspecies conserved amino acids but not the catalytic triads of the enzyme could mediate these interactions.

Example 7

The pRC / CMV expression construct was briefly expressed in COS 7 cells to determine PAF-AH activity of the protein encoded by the sAH 406-3 human plasma PAF-AH cDNA clone (Example 3). PAF-AH activity in medium from COS cells was detected three days after transfection of these cells with DEAE dextran.

Cells were seeded at a density of 300,000 cells per 60 mm diameter culture dish. The following day, the cells were incubated for 2 hours in DMEM containing 0.5 mg / ml DEAE extract, 0.1 mM chloroquine and 5 - 1 µg of plasma DNA. The cells were then treated with 10% DMSO in PBS for 1 minute, washed with medium, and incubated in DMEM containing 10% fetal calf serum in which the endogenous PAF-AH activity was previously inactivated with diisopropyl fluorophosphate (DFP). After three days of incubation, PAF-AH activity was detected in transformed cell media. Measurements of this activity were performed in the presence and absence of either 10 mM EDTA or 1 mM DFP to determine whether the recombinant enzyme required calcium and whether DFP, a serine esterase inhibitor, was inhibited, as described in PAF-AH by Stafforini et al., (1987), supra. Negative controls included cells transformed with pRc / CMV with or without a sAH 406-3 insert in the opposite orientation.

PAF-AH activity in transformed cell supernatants was determined by the method of Stafforini et al., (1990), supra, with the following modifications. Briefly, PAF-AH activity was determined by measuring the hydrolysis of 3H acetate from [acetyl-3H] PAF (New England Nuclear, Boston, MA). Free 3H acetate in the aqueous phase was separated from the labeled substrate by reverse phase chromatography on octadecyl silicagel (Baker Research Products, Philipsburg, PA). Assays were performed with 10 μΐ of transformed cell supernatant in 0.1 M Hepes buffer, pH 7.2, in a reaction volume of 50 μΐ. A total of 50 pmol of substrate with a ratio of labeled: unlabeled PAF of 1: 5 was used in one reaction. The reaction mixtures were incubated for 30 minutes at 37 ° C and stopped by the addition of 40 μ 40 10M acetic acid. The solution was then washed on a column of octadecylsilka gel, rinsed with 0.1 M sodium acetate. The eluate of each sample was collected and measured on a scintillation counter for one minute.

As shown in FIG. 2, media from cells transformed with sAH 406-3 contained PAF-AH activity with values four times higher than background. This activity was not affected by the presence of EDTA but was inhibited by 1 mM DFP. These observations show that the sAH 406-3 clone encodes an enzyme which activity is consistent with the human plasma enzyme PAF-AH.

Example 8

DNA encoding full-length human plasma PAF-AH, its various truncated forms, and chimeric murine-human PAF-AH was expressed in recombinant methods in E. coli and yeast and stably expressed in mammalian cells.

A. Expression in E. coli

By PCR, a protein encoding a cDNA fragment of the sAH 406-3 clone for human plasma PAF-AH was generated, suitable for immediate further cloning in an expression vector in E. coli. This segment starts at the 5 'end of the human gene with a codon for Ue ₄₂ (SEQ ID NO: 8), an N-terminal amino acid residue of an enzyme purified from human plasma. The remainder of the gene, including the original termination codon, was included in the construct. The following 5 'sense primer was used:

SEQ ID NO: 213 'TATTCTAGAATTATGATACAAGTATTAATGGCTGCTGCAAG 3' which contained an XbaI cloning site translation initiation codon (underlined). The following 3 'antisense primer was used:

SEQ ID NO: 29 'ATTGATATCCTAATTGTATTTCTCTATTCCTG 3'

SK 286518-6

This primer included the termination codon sAH 406-3 and contained an EcoRV cloning site. PCR reactions were performed as described in Example 3. The resulting PCR product was digested with XbaI and EcoRN and further cloned in the pBR322 vector containing the Trp promoter (deBoer et al., PNAS, 80: 21-25 (1983)) tightly. before the cloning site. The E. coli XL-1 Blue strain was transformed with an expression construct and cultured in L medium containing carbenicillin at a concentration of 100 µg / ml. Transformants were grown overnight, centrifuged, and resuspended in lysis buffer composed of 50 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM CHAPS, 1 mM EDTA, 100 µg / ml lysosome and 0.05 trypsin inhibiting units (TIU) / ml Aprotmine. . After one hour incubation on ice and two minutes sonication, PAF-AH activity was determined in the lysates by the method described in Example 4. E. coli transformed with an expression construct (designated trp AH) produced a protein with PAF-AH activity. See tab. 6 in Example 9.

Constructs containing other promoters were also used to direct expression of human PAF-AH in the E. coli tac / promoter (deBoer, supra), the arabinose (ara 8) promoter from Salmonella typhimurium [Horwitz et al., Gene, 14: 309 319 (1981)] and the T7 bacteriophage promoter. Constructs containing the Trp promoter (pUC trp AH), the tacII promoter (pUC tac AH) and the araB promoter (pUC ara AH) were constructed based on the plasmid pUC19 (new Engalnd Biolabs, MA), whereas the construct with the T7 promoter (pET AH) was constructed from plasmid pET15B (Novagen, Madison, WI). The hybrid promoter (pHAB / PH) construct, consisting of araB attached to the ribosome binding site from the T7 promoter region, was also constructed from plasmid pET15B. All constructs produced proteins in E. coli with PAF-AH activity in the range of 20-50 U / ml / OD ₆₀ °. This activity corresponds to a total recombinant protein> 1% of all cellular proteins.

Several expression constructs that produce PAF-AH with extended N-termini in E. coli were also evaluated. The N-terminus of natural human PAF-AH was determined to be Ile42 based on amino acid sequencing (Example 2). However, the sequence immediately prior to Ι1ο ₄₂ does not correspond to the amino acids constituting the signal peptide cleavage target site (i.e., the "-3-1" rule is not met since lysine is not present at the -1 position (see von Heijne, Nuc. Acids Res., 14: 4683-4690 (1986)] It is possible that a more classical signal sequence (M1-A17 or M1-P21) is recognized by the cell's secretory system, followed by further endoproteolytic cleavage (Example 2) The entire PAF-AH coding sequence beginning with methionine (nucleotides 162 to 1487 of SEQ ID NO: 7) was engineered for expression in E. coli using the trp promoter, which construct was active PAF-AH but, as shown in Table 4, its expression reached about one-fifth the level expression of the original construct, beginning with Ile _42. These results indicate that the extension of the protein at its N-terminus is neither critical nor necessary for the activity of recombinant PAF-AH in E. coli.

Table 4

activity PAF-AH (U / ml / OD ₆ ) construct lysate medium pUC trp AH (N-terminal Ile ₄₂ ) 177.7 0,030 pUC trp AH Met] 3.1 0,003 pUC trp AH Val ₁₀ 54.6 0,033

Truncated recombinant forms of human PAF-AH can also be prepared in E. coli using a low copy-per-cell plasmid and a promoter that is induced by the addition of arabinose to the culture medium. One such N-terminally truncated form of PAF-A is the product of recombinant expression of DNA encoding the amino acid residues of the Met42 to Asn441 polypeptide encoded by the complete PAF-AH cDNA (SEQ ID NO: 8). It is designated as rPH, 2. For production of rPH, 2 in bacterial cells, plasmid pBAR2 / PH, 2 derived from pBR322 was used, which contains (1) nucleotides 297 to 1487 of SEQ ID NO: 7 which encodes human PAF-AH starting with a methionine codon at position 46 (2) the araB-C promoters and the araC gene from the arabinose operon of Salmonella typhimurium, (3) the transcriptional termination sequence from bacteriophage T7, and (4) the phage fl.

Specifically, pBAR / PH.2 comprises the following DNA regions: (1) a region from the deleted AatIII site at position 1994 to the EcoRI site at position 6274, i.e., a vector sequence containing a replication origin and genes responsible for resistance to apmicillin or tetracycline derived from a bacterial plasmid pBR322; (2) regions from the EcoRI site at position 6274 to the XbaI site at position 131, i.e. the DNA of the arabinose operon from Salmonella typhimurium (Genbank Accession number: M11045, M11046, M11047, J01797); (3) a region from an XbaI site at position 131 to an NcoI site at position 170, that is, a DNA comprising a ribosome binding site from pET-21b (Novagen, Madison, WI); (4) a region from the NcoI site at position 170 to the XhoI site at position 1363, that is, the sequence of the human PAF-AII cDNA; and (5) a region from the XhoI site at position 1363 to the deleted AatII site at position 1993; -21b (Novagen), containing the transcription termination sequence of bacteriophage T7 and the bacteriophage fl1 origin of replication.

SK 286518-6

Another form of PAF-AH, designated rPF.9, the recombinant expression product of DNA encoding amino acid residues Met46 Ilen4 ₂₆ polypeptide encoded by full length PAF-AH cDNA (SEQ ID NO: 8). The DNA encoding rPH.9 was inserted into the same vector that was used to produce rPH.2 in bacterial cells. This plasmid was named pBAR2 / PH.9, consisting of the following DNA regions: (1) a region from the deleted AatIII site at position 1958 to the EcoRI site at position 6239, i.e., a vector sequence containing an origin of replication and genes responsible for ampicillin resistance; tetracycline derived from the bacterial plasmid pBR322; (2) a region from the EcoRI site at position 6239 to the XbaI site at position 131, that is, the DNA of the arabinose operon from Salmonella typhimurium (Genbank accession number: M11045, M11046, M11047, J01797); (3) a region from the XbaI site at position 131 kNcoI site at position 170, i.e. DNA containing a ribosome binding site from pET-21b (Novagen, Madison, WI); (4) a region from the NcoI site at position 170 to the XhoI site at position 1363, that is, the sequence of the human PAF-AH cDNA, and (5) a region from the XhoI site at position 1328 to the deleted AatII site at position 1958, that is. -21b (Novagen), containing the transcription termination sequence of bacteriophage T7 and the bacteriophage fl1 origin of replication.

The expression of PAF-AH proteins in pBAR / PH.2 and pBAR / PH.9 is controlled by the araB promoter, which is perfectly repressed in the presence of glucose and in the absence of arabinose, but functions as a strong promoter when L-arabinose is added to glucose depleted medium. Selection of plasmid cells is achieved by adding ampicillin (or a related antibiotic) or tetracycline to the medium. Many E. coli strains can be used to express recombinant PAF-AH including, but not limited to, strains prototrephal in arabinose metabolism such as e.g. W3110, DH5oc, BL21, C600, JM101 and derivatives thereof, strains harboring proteolysis-reducing mutations such as e.g. CAGG29, KY1429 and strains unable to degrade arabinose such as e.g. SB7219 and MC1061. The advantage of using a strain that does not break down arabinose is that the inducer (arabinose) of PAF-AH expression is not drained from the medium during the induction period, resulting in higher levels of PAF-AH compared to the levels achieved with strains capable of metabolizing arabinose. . The active PAF-AH forms are expressed in various strains of E. coli in any suitable medium and under any suitable conditions. Rich media LB, EDM295 (minimum medium M9 supplemented with yeast extract and acid casein hydrolyzate), as well as “defined” media (A675, minimum medium A adjusted to pH 6.75, with glycerol as carbon source, supplemented with trace elements and vitamins ) allow considerable production of rPAF-AH forms. Tetracycline is added to the media to ensure the presence of the plasmid in the culture due to selection pressure.

The E. coli strain MC1061 (ATCC 53338) carrying arabinose operon deletion and thus unable to metabolize arabinose was transformed with plasmid pBAR2 / PH.2. Strain MC1061 is auxotrophic to leucine, was cultured by constant replenishment with media containing casein extract and complementing the leucine mutation. PBAR / PH.2 transformed E. coli cells were grown at 30 ° C in growth media containing 2g / L glucose. Glucose has a double meaning - it serves as a carbon source for cell growth and as a repressor for the arabinose promoter. When the glucose level dropped to <50 mg / L, nutrient replenishment with concentrate (glucose at 300g / L) started. Glucose replenishment increased linearly over 16 hours at a rate that limited the formation of acidic by-products. At this point, glucose replenishment was replaced by the addition of glycerol. At the same time, L-arabinose (500g / L) was added to a final concentration of 5g / L. Glycerol replenishment was kept constant for 22 hours. Cells were harvested by hollow fiber filtration while the cell suspension was concentrated approximately 10-fold. The cell sediment was stored at -70 ° C. The total cell mass was about 80g / L (OD ₆₀₀ = 50-60) with a PAF-AH activity of 65-70 units / OD / ml, representing about 10% of all cellular proteins. A bacterial culture with a final volume of about 75 liters contained 50-60 g PAF-AH.

High levels of production of rPAF-AH forms can be achieved by expression of pBAR2 / PH.2 or PH.9 in strains SB7219 and MC1061. Other strains incapable of degrading arabinose are also suitable for achieving a high density of bacterial culture. The following bacterial culture conditions are recommended. Fermentation tanks containing 2g / L glucose culture medium are inoculated with exponentially growing strains of SB7219; pBAR2 / PH: 2 and SB7219; pBAR2 / PH.9. When glucose is consumed, fermentation tanks are supplied with a glycerol solution containing trace elements, vitamins, magnesium and ammonium salts to maintain healthy exponential growth. The fermentor temperature is maintained at 30 ° C, the tanks are aerated and shaken so that the dissolved oxygen level is above 15% saturation. When the density of the bacterial culture is higher than HOg / L (wet weight), the nutrients are replenished at a constant rate, L-arabinose (final concentration about 0.5%) is added to the culture. Product formation is followed for 16-22 hours. The yield is usually 40-50 g / L (dry cell weight). Cells are harvested by centrifugation, stored at -70 ° C and rPAF-AH is purified for further analysis. Specific yields higher than 150 units / ml / OD ₆₀₀ are commonly achieved.

SK 286518-6

B. Yeast expression

Human recombinant PAF-AH was also expressed in Saccharomyces cerevisiae. The yeast ADH2 promoter was used to control the expression of rPAF-AH, producing 7 units / ml / OD ₆₀₀ (Table 5).

Table 5

construct promoter tribe Enzyme activity (U / ml / OD) pUC tac AH tac E. coli W3110 30 PUC trp AH trp E. coli W3110 40 pOC ara AH araB E. coli W3110 20 pET AH T7 E. coli BL2K (DE3) (Novagen) pHAB / PB ar 'B / T7 E. coli XL-1 34 PBAR2 / PH.2 araB MC1061 90 pYcp ADH2 AH ADH2 Yeast BJ2.28 7

C. Expression of PAF-AH in Mammalian Cells

1. Expression of the human PAF-AH cDNA construct

Plasmids engineered to express PAF-AH utilize, with the exception of pSNF / PAFAH.1, a strong viral promoter derived from cytomagalovirus, a polyadenylation site from the cow's growth hormone gene, and the SV4O virus replication origin to ensure high copy number of plasmid in COS cells. Plasmids were introduced into cells by clottroporation. First, a set of plasmids was prepared in which either the 5 'flanking sequence (pDCl / PAFAH.1), or both the 5' and 3 'flanking sequences of human PAF-AH cDNA (PDC1 / PAFAH.2) were replaced by flanking regions of other genes characterized by high levels of expression in mammalian cells. Transfection of these plasmids into COS, CHO, or 293 cells resulted in the production of PAF-AH at the same level (0.01 units / ml, 2-4 times higher than the background level) achieved with clone sAH406 after transient expression of COS cells ( Example 7). Another plasmid containing the Friend's spleen virus promoter was constructed instead of the cytomegalovirus promoter. The human PAF-AH cDNA was inserted into the pmH-neo plasmid (Hahn et al., Gene 127, 267 (1993)) under the control of the Friend's spleen virus promoter. After transfection of myeloma line NSO cells with plasmid pSFN / PAFAH.1 and testing several hundred clones, two transfectants (4B11 and ICH) were detected which gave 0.15-0.5 units / ml PAF-AH activity. The productivity of the two NSO transfectants corresponds to about 0.1 mg / liter, assuming a specific activity of about 5000 units / mg

2. Expression of PAF-AH chimeric constructs produced by the mouse and human gene

The pRC / MS9 construct containing the mouse PAF-AH cDNA in the mammalian oRc / CMV expression vector resulted in the production of a secreted form of PAF-AH of 5-10 units / ml (1000-fold above background level) after transfection into COS cells. Assuming that the specific activity of murine PAF-AH is approximately the same as that of the human enzyme, murine cDNA is expressed about 500 to 1000 times more than human cDNA for PAF-AH.

To investigate the difference between the level of expression of human and mouse PAF-AH in COS cells, two chimeric human-mouse genes were constructed and screened for expression in COS cells. The first construct, pRc / PH.HMCl, contains the coding sequence for the 97 N-terminal amino acids of the murine PAF-AH polypeptide (SEQ ID NO: 21) linked to the 343 C-terminal amino acids of human PAF-AH in the pRc / CMV expression vector (Invitrogen, San Diego, CA). The second chimeric gene pRc / PH.MHC2 contains the coding sequence for the 40 N-terminal amino acids of the murine PAF-AH polypeptide linked to the 400 C-terminal residues of human PAF-AH in pRc / CMV. After transfection of COS cells with the plasmid pRc / PH.MHCl, 1-2 units / ml of PAF-AH activity accumulated in the medium. Only 0.01 units / ml PAF-AH activity was detected in conditioned media from cell culture transformed with plasmid pRc / PH.MCH2. These experiments show that the difference in expression level of the murine and human PAF-AH gene is at least in part due to the properties of the polypeptide segment delimited by amino acid residues 40-97, or the corresponding region of RNA or DNA encoding this region of PA-AH protein.

3. Recoding the first 290 bp sequence of PAF-AH

One hypothesis explaining the low level of synthesis of human PAF-AH in transformed mammalian cells suggests that codon usage in the natural gene is not optimal for efficient expression. However, it does not seem likely that the type of codons used could be responsible for the 500-1000 fold difference in expression level between the human and mouse genes, since codon optimization only results in a 10 fold increase in expression. The second hypothesis explains the different levels of expression of the murine and human PAF-AH gene in the presence of a secondary structure in the 5 'coding region of human PAF-AH mRNA that results in relatively rapid degradation of mRNA, or causes ineffective translation initiation or elongation.

To verify these hypotheses, a synthetic fragment encoding the original human PAF-AH protein was constructed from the N-terminus to amino acid residue 96, in which most codons were replaced ("recoded") by codons for the same amino acid but having a different sequence. A change from GTA in the second codon resulted in the creation of an Asp718 site that is at one end of the synthetic fragment and also present in the mouse cDNA. The other end of the fragment contained a BamHI site found in codon 97 of the human gene. The Asp718 / BamHI fragment of about 290 bp was derived from a PCR fragment prepared by dual asymmetric PCR; the procedure for the construction of synthetic genes described by Sandh et al., Biotechnique, 12: 14-16 (1992). The synthetic Asp718 / BamHI fragment was ligated with DNA fragments encoding the remainder of the human PAF-AH molecule, starting at nucleotide 453 of SEQ ID NO: 7. Then, the sequence encoding the original human PAF-AH enzyme was inserted into a mammalian expression vector pRc / CMV (Invitrogen, San Diego) to create the plasmid pRc / HPH.4. The complete sequence of the recoded gene is set forth in SEQ ID NO: 30. The region in pRc / HPH.4 adjacent to the 5 'end of the sequence encoding human PAF-AH originates from the mouse cFNA for PAF-AH in pRc / MC9 (nucleotides 1 to 116 of SEQ. ID NO: 21).

COS cells were transiently transformed with plasmids pRc / HPH.4 (recoded human gene), pRc / MS9 (mouse PAF-AH) and pRc / PH.MHCl (mouse-human hybrid sequence # 1) to determine expression of human PAF-AH from pRc / HPH.4. PAF-AH activity was measured in conditioned media from transformed cell cultures at values of 5.7 units / ml (mouse gene), 0.9 units / ml (mouse-human hybrid sequence # 1) and 2.6 units / ml. ml (recoded human gene). Recoding the first 290 bp coding sequence for human PAF-AH proved to be a successful strategy and raised the level of human PAF-AH expression from several nanograms / ml to about 0.5 micrograms / ml during transient transformation of COS cells. The recoded PAF-AH gene from plasmid pRc / HPH.4 will be inserted into a mammalian expression vector containing the dihydrofolate reductase (DHFR) gene and transformed with the DHFR negative Chinese hamster ovary cell line by this vector. The transformed cells will be subjected to methotrexate selection, thus obtaining clones that generate a large amount of human PAF-AH due to gene amplification.

Example 9

Human recombinant plasma PAF-AH (beginning with Ile ₄₂ ) expressed in E. coli was purified to Coomassie blue stained band on SDS-PAGE using various methods. The activities exhibited by native PAF-AH enzyme were also determined.

A. Purification of Recombinant PAF-AH

The first purification procedure used is similar to that described in Example 1 for native PAF-AH. The following steps were performed at 4 ° C. A pellet from a 50 ml culture of E. coli that produces PAF-AH (transformed with the trp AH expression construct) was lysed as described in Example 8. Solid particles were removed by centrifugation at 10,000 g for 20 minutes. The supernatant was loaded at a rate of 0.8 ml / min. on a Blue sepharose Fast Flow column (2.5 cm x 4 cm; 20 ml packing volume)) which was equilibrated with buffer D (25 mM Tris-HCl, 10 mM CHAPS, 0.5 M NaCl, pH 7.5). The column was washed with 100 ml of buffer D and eluted at 3.2 ml / min. 100 ml of buffer A containing 0.5 M KSCN. 15 ml of the active fraction was loaded onto a 1 ml Cu chelating Sepharose column equilibrated with buffer D. This column was washed with 5 ml of buffer D, followed by elution of 5 ml of buffer D containing 100 mM imidazole by gravity flow. Fractions with PAF-AH activity were analyzed by SDS-PAGE.

The results of the purification are shown in Tab. 6, in which the unit equals the hydrolysis of μFι per hour PAF. The purification product obtained at 4 ° C appeared on SDS-PAGE as the only intensely stained band below the 43 kDa marker position, with a hint of diffuse staining just below and above each other. The recombinant material is significantly more purified and exhibits a higher specific activity compared to the PAF-AH preparation from plasma described in Example 1.

SK 286518-6

Table 6

sample Volume (ml) Activity (single tissue / ml) Total activity (unit / 10 ³ ) Horses, protein (mg / ml) Specific activity (unit / mg % return on activity Multiple cleanup step tot. step tot. lysate 4.5 989 4451 15.6 63 100 100 1 1 Blue 15 64 960 0.07 914 22 22 14.4 14.4 Cu 1 2128 2128 0.55 3869 220 48 4.2 61

When the same purification procedure was performed at room temperature, in addition to the 43 kDa marker band, a group of strips migrating below the 29 kDa marker position appeared, which coincided with PAF-AH activity measured in gel slices. These lower molecular weight bands may be proteolytic fragments of PAF-AH that have retained enzymatic activity.

An additional purification procedure was also used at room temperature. A palette (100 g) of E. coli producing PAF-AH (transformed with the pUC trp AH expression construct) was resuspended in 200 ml lysis buffer (25 mM Tris, 20 mm CHAPS, 50 mM NaCl, 1 mM EDTA, 50 µg / ml benzamide, pH 7, 5) and lysed by pressing three times through a microfluidizer at 15,000 psi. The solids were removed by centrifugation at 14300 x g for one hour. The supernatant was diluted 10x in dilution buffer (25mM MES (2 [N-morpholinoethanesulfonic acid), 10mM CHAPS, 1mM EDTA, pH 4.9) and loaded at 25ml per minute onto a Sepharose Fast Flow (200ml) column (cation-ion exchange) column), which is equilibrated in buffer E (25 mM MES, 10 mM CHAPS, 1 mM EDTA, 50 mM NaCl, pH 5.5). The column was washed with 1 liter of buffer E and eluted with 1M NaCl. The eluate was collected into a 50 ml fraction and the pH was adjusted to 7.5 with 0.5 ml of 2M Tris (base). Fractions containing PAF-AH activity were pooled and adjusted to contain 0.5M NaCl. Fractions so combined were loaded at a rate of 1 ml / min. on a Blue Sepharose Fast Flow column (2.5 cm x 4 cm; 20 mL) equilibrated in buffer F (25 mM Tris, 10 mM CHAPS, 0.5 M NaCl, 1 mM EDTA, pH 7.5). The column was washed with 100 ml of buffer F and eluted with buffer F containing 3M NaCl at a rate of 4 ml / min. This Blue Sepharose Fast Flow chromatography step was repeated to reduce the level of endotoxins in the sample. Fractions containing PAF-AH activity were pooled and dialyzed against buffer G (25 mM Tris, pH 7.5, 0.5 M NaCl, 0.1% Tween 80, 1 mM EDTA).

The results of the purification are shown in Table 7, in which the unit is equal to μ mol of PAF hydrolysis per hour.

Table 7

sample Volume (ml) Activity (unit / ml) Total activity (unit / 10) Horses, protein (mg / ml) Specific activity (units ka / mg) % return on activity step tot. Multiple cleanup step tot lysate 200 5640 1128 57.46 98 100 100 1 1 WITH 111 5742 637 3.69 1557 57 56 16 16 Blue 100 3944 394 0.84 4676 35 62 3 48

The obtained purification product appeared on SDS-PAGE as a single intense band under the 43 kDa label with some diffuse staining just below and above the band. The recombinant material is substantially purer and exhibits greater specific activity compared to plasma PAF-AH preparation as described in Example 1.

One further purification protocol is contemplated in the present invention. This includes cell lysis, purification and the first column step. Cells were diluted 1: 1 in lysis buffer (25m Tris pH 7.5, 150mM NaCl, 1% Tween 80, 2mM EDTA). Lysis was performed in a refrigerated microfluidizer at 15,000-20000 psi. Three times the material was passed through a microfluidizer to achieve> 99% cell breakage. The lysate was diluted 1:20 in dilution buffer (25 mM Tris, pH 8.5, 1 mM EDTA) and applied to a column packed with Q-Sepharosa Big Bead chromatography medium (Pharmacia). The column was equilibrated in 25mm Tris pH 8.5, 1mM EDTA, 0.015% Tween 80. The eluate was diluted 1:10 in 25mM MES pH 5.5, 1.2M ammonium sulfate, 1mM EDTA and loaded onto Butyl Sepharose chromatography medium ( Pharmacia) equilibrated with the same buffer. PAF-AH activity was eluted with 25 mM MES pH 5.5, 0.1% Tween 80, 1 mM EDTA.

In the present invention, a further method of purifying enzymatically active PAF-AII is contemplated. This method comprises the following steps: a) preparing an E. coli extract which results in lysis in the buffer

Containing CHAPS to a supernatant containing solubilized PAF-AH; b) diluting said supernatant and applying it to an anion exchange column equilibrated to a pH of about 8.0; c) eluting the enzyme PAF-AH from said anion-exchange column; d) applying said adjusted eluate from said anion-exchange column to a blue dye ligand affinity column; e) eluting said blue dye ligand column with a 3.0 M salt buffer; f) diluting the eluate from the column containing the blue dye ligand to a buffer suitable for performing hydroxylapatite chromatography; g) performing hydroxylapatite chromatography, wherein the washing and elution is performed with buffers (with or without CHAPS); h) diluting said hydroxylapatite eluate to a salt concentration suitable for a cation exchange column; i) loading said undiluted hydroxylapatite eluate on a cation-exchange column at a pH ranging from about 6.0 to 7.0; j) eluting PAF-AH from said cation-exchange column with a suitable buffer of a suitable composition; k) performing cation-exchange chromatography in the cold; and 1) the composition of a liquid or frozen form of PAF-AH in the absence of CHAPS.

It is best to use the following in said step: in step a) the lysis buffer is composed of: 25 mM Tris, 100 mM EDTA, 20 mM CHAPS, pH 8.0; in step b) the dilution of the anion-exchange chromatography supernatant is 3-4 times from 25 mM Tris, 1 mM EDTA, 10 mM CHAPS, pH 8.0 and the column is a Q-Sepharose column equilibrated with 25 mM Tris, 1 mM EDTA, 50 mM NaCl, 10 mM CHAPS, pH 8.0; in step c), the anion-exchange column is eluted using 25 mM Tris, 1 mM EDTA, 350 mM NaCl, 10 mM CHAPS, pH 8.0; in step d) the eluate of step

(e) applied directly to a blue dye ligand affinity column; in step e) the column is eluted with a buffer containing 3M NaCl, 10mM CHAPS, 25mM Tris, pH 8.0; in step f) the Blue dye eluate is diluted for hydroxylapatite chromatography. The eluate is diluted with 10 mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS, pH 6.2; in step g), hydroxylapatite chromatography is performed using a hydroxylapatite column equilibrated with 10 mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS. Elution is performed using 50 mM sodium phosphate, 100 mM NaCl (with or without 10 mM CHAPS), pH 7.5; in step h) diluting said hydroxylapatite eluate for cation-exchange chromatography using a buffer having a pH in the range of about 6.0 to 7.0 and containing sodium phosphate (with or without CHAPS); in step i) the S-Sepharose column is equilibrated with 50 mM sodium phosphate (with or without 10 mM CHAPS), pH 6.8; in step j) the elution is performed with a buffer of a suitable composition, such as 50 mM potassium phosphate, 12.5 mM acid. aspartic, 125 mM NaCl, pH 7.5 and containing 0.01% Tween 80; in step k), cation exchange chromatography is performed at 2-8 ° C. An example of a suitable buffer composition useful in step 1) that stabilizes PAF-AH is 50 mM potassium phosphate, 12.5 mM acid. aspartic, 125 mM NaCl, pH about 7.4 (with or without Tween 80 and / or Plurinic F68) or 25 mM phosphate (K +) buffer containing (at least) 125 mM NaCl, 25 mM arginine and 0.01% Tween 80 (with or without) Plurinic F68 at a concentration of about 0.1 to 0.5%).

Recombinant PAF-AH activity

The most prominent feature of PAF acetyl hydrolase is the distinctive specificity for substrates with short residues at the sn-2 position of the substrate. This strict specificity distinguishes PAF acetyl hydrolase from other forms of PLA2. Thus, in order to determine whether recombinant PAF-AH degrades long chain fatty acid phospholipids at the sn-2 position, hydrolysis of 1-palmltoyl-2-arachidonyl-1'-glycerol-3-phosphocholine (arachidonylPC) was tested. This substance is the preferred substrate for a well characterized form of PLA ₂ . As previously reported with native PAF-AH studies, this phospholipid was not hydrolyzed when incubated with recombinant PAF-AH. In other experiments, arachidonylPC at a concentration of 0 to 125μΜ was added to the standard hydrolysis test solution. The purpose of this was to determine whether this addition inhibited PAF hydrolysis by recombinant PAF-AH. Even at the highest concentration of PAF-AH (which was 5-fold higher than the concentration of PAF), no inhibition of PAF hydrolysis was found. Thus, recombinant PAF-AH exhibits the same substrate specificity as the native enzyme - long chain substrates are not recognized. In addition, the recombinant PAF-AH enzyme rapidly degrades oxidized phospholipid (gluraroylPC), which has undergone oxidative cleavage of sn-2 fatty acids. Native plasma PAF-AH has several other properties that distinguish it from other phospholipases, including calcium ion-independent phospholipases and phospholipases resistant to substances that modify SH groups or disulfide cleavage.

Native and recombinant plasma PAF-AH enzymes are sensitive to DFP, suggesting that serine forms part of their active serum. An unusual feature of native plasma PAF acetyl hydrolase is its close association with lipoproteins in the bloodstream and the fact that its catalytic efficiency is influenced by the lipoprotein environment. When recombinant PAF-AH, as described herein, is incubated with human plasma (and previously treated with DFP to remove endogenous enzymatic activity), it associates with low and high density lipoproteins in the same manner as native activity. This result is important because there is solid evidence that modification of low-density lipoproteins is necessary for the cholesterol deposition observed in atheroma and that lipid oxidation is an initiating factor in this process. PAF-AH protects low-density lipoproteins from modification under oxidative conditions in vitro and may play this role in vivo. Administration of PAF-AH is therefore recommended to reduce lipoprotein oxidation in case 21

And also in the treatment of inflammation. All these results confirm that the sAH 406-3 cDNA clone encodes a protein with human plasma PAF acetyl hydrolase activities.

Example 10

Other recombinant PAF-AH products were also expressed in E. coli. These products included PAF-AH analogs having a single amino acid mutation and fragments of PAF-AH.

A. PAF-AH products resulting from amino acid substitution

PAF-AH is a lipase because it hydrolyzes the phospholipid PAF. Although there is no general similarity between PAF-AH and other characterized lipases, conserved residues were found compared to structurally characterized lipases. Serine was identified in the active center. Serine, together with the remainder of aspartame and histidine, forms a catalytic triad that represents the active site of the lipases. These three residues are not adjacent to each other in the primary amino acid sequence, but from structural studies we know that these three are adjacent in three-dimensional space. By comparing the structures of mammalian lipases, we know that the aspartame residue is usually a 24 amino acid residue from the C terminus, towards the active site with serine.

Individual codons of human PAF-AH that encoded sequences for an alanine residue were modified by site-directed mutagenesis and PCR. These mutants were expressed in E. coli. As shown in Table 8, where, for example, the abbreviation "S108A" means that the serine residue at position 108 was changed to alanine, the point mutations Ser273, Asp ₂₉₆ or His351 completely destroyed PAF-AH activity. The distances between the individual amino acid residues in the active center are similar for PAF-AH and other lipases (from Ser to Asp 23 amino acids; from Ser to His 78 amino acids). These experiments have also shown that Ser ₂₇₃ , ASP296 or Hls351 are residues critical for activity and therefore also candidates for triad catalytic residues. Cysteine residues, by their very ability to form disulfide bridges, are very often critical to maintaining the functional integrity of the protein. The plasma PAF-AH enzyme contains five cysteine residues. To determine which of the cysteine residues is critical for maintaining enzyme activity, cysteines were individually replaced by mutation to serine, and the resulting mutants were expressed in E. coli. Preliminary results of activity measurement with partially purified preparations of these recombinant mutant forms of the enzyme are shown in the second column of Table 8, while the results obtained with multiple purified enzymes are summarized in the third column of Table 8. The data show that all mutant forms had nearly the same activities , we conclude that no cysticin residue is required for PAH-AH activity. Other mutants also had little or no effect on the catalytic activity of PAF-AH. In Table 8, ++++ represent an activity of naturally occurring type PAF-AH equal to 40 to 60 U / ml / OD ₆ of ₀ , +++ represent an activity of about 20 to 40 U / mlOD _{60 µ} , ++ 10 to 20 U / ml / OD ₆₀ o, + 1 to 10 U / ml / OD ₆₀₀ and the sign indicates activity less than 1 U / ml / OD ₆₀₀ .

Table 8

mutation PAF-AH activity Specific act. purification of PAF-AH Wild (naturally occurring) type ++++ 6.9 mmol / mg / point S1O8A ++++ S273 - D286 - D286 ++ D296 - D3O4A ++++ D338 ++++ H351 - H395A, H399A ++++ CG7S +++ 5.7 mmol / mg / point C229S -1- 6.5 mmol / mg / point C291S -U 5.9 mmol / mg / h C334S ++++ 6.8 mmol / mg / h C4O7S +++ 6.4 mmol / mg / h C67S, C334S, C4075S 6.8 mmol / mg / h

B. Fragmental PAF-AH products

Deletions at the C terminus were prepared by digestion with exonuclease III at the 3 'end of the PAF-AH coding sequence for various long periods of time. These truncated coding sequences were then ligated into plasmid DNA encoding stop codons in all three parts of the frame. Ten DNA deletion constructs were characterized using DNA sequence analysis, protein expression, and measurement of PAF-AH activity. Removal 21 to 30

The C-terminal amino acid residues greatly reduced catalytic activity, and removal of the 52 amino acid residues resulted in complete destruction of the activity. This is illustrated in Figure 3.

Similar deletions were performed at the amino terminus of PAF-AH. In E. coli, PAF-AH fusion proteins with thioredoxin at the N-terminus were prepared. This resulted in a consistently high level of expression of PAF-AH activity (LaVallie et al., Biotochnoloy, 11: 187-193 (1993)). Removal of the nineteen amino acid residues from the naturally occurring N-terminus of the protein (Ile42) reduced activity by up to 99%. While removal of the 26 amino acid residues completely destroyed the enzymatic activity of the fusion protein (see Figure 3). The deletion of the 12 amino acid residues increased enzyme activity four times.

In the following purification processes for PAF-AH starting from fresh human plasma using methods similar to those described in Example 1 (two concentrations of N-terminal N-terminal were used to concentrate the Blue Sepharose eluate instead of the Cu Microcon 30 Cu column). amino acids alongside Ile ₄₂ , namely Ser35 and Lys55. The heterogeneity may be naturally derived from the state of the enzyme in the plasma, whether it may result from a purification procedure.

The purified material described above was also subjected to glycosylation analysis. Purified native PAF-AH was incubated in the presence or absence of N-glycanase, an enzyme that removes carbohydrates bound to the N-terminus of glycoproteins. PAF-AH treated samples were then electrophoresed in a 12% SDS polyarkylamide gel and then labeled with rabbit polyclonal antisera in a Western blot. The protein that was not incubated with N-glycanase traveled in the gel as a diffusion band with a molecular weight of 45-50 kDa, while the glycanase-treated protein traveled as a sharply defined band corresponding to a molecular weight of 44 kDa. This demonstrates that native PAF-AH is glycosylated.

N-terminal heterogeneity was also observed in purified preparations of recombinant PAF-AH (Ile ₄₂ N-terminal). These enzyme preparations were a mixture of N-terminus polypeptides beginning with Ala47, Ue42, or an artificial Met-1 initiator residue adjacent to Ile42.

Preliminary comparison of PAF-AH fragments with PAF-AH

Because of the observed heterogeneity of recombinantly prepared PAF-AH, other recombinant products were prepared which were also tested for observed heterogeneity after expression and subsequent purification. The composition of recombinant expressed PBAR2 / PH.2 and pBAR2 / PH.2 products in E. coli MC1061 strain was analyzed at different time intervals during the cell cycle production phase. Partially purified samples of recombinant PH.2 and PH.9 taken at different time intervals between 5 and 22 hours after induction of protein expression were analyzed by laser desorption ionization mass spectrometry (MALDI-MS).

When a PH.2 expression vector was used, two peaks were observed in the spectrum of the partially purified protein that corresponded to the mass value predicted for the rPAF-AH protein. These two peaks were observed at all time intervals, greater heterogeneity was observed only at the time interval corresponding to the stress action caused by acetate accumulation or depletion of oxygen in the medium during fermentation of the cells. The measurement accuracy of the MALDI-MS technique lies within approximately ± 0.3% of the weight of one amino acid. The higher-weighted product observed, by its weight composition, corresponds to the expected total translation product of the vector PH.2 minus the weight of methionine, as a translation initiator, which is believed to have been post-translationally removed. The lower mass peak had approximately 1200 atomic mass units less.

If the expression vector PH.9 was used, preferably a protein that corresponded to its expected mass of the rPAF-AH protein was obtained in the partially purified protein spectrum. This single peak was observed at all times, nor did the protein heterogeneity increase over time. The observed mass of this protein was consistent with the presence of the expected translation product for the full-length PH.9 vector, again minus the initiating methionine.

2. Purification of PAF-AH fragments

Recombinantly expressed rPH.2 (the expression product of DNA encoding Met46-Asn441) and rPH.9 (the expression product of DNA encoding Met46-Ue ₄₂ 9) were purified for further comparative studies with the product of PAF-AH (expression product of DNA encoding Ile ₄₂ Asn441 ). RPH.9 was produced using an E. coli strain SB7219 and purified mostly by a Zn-like chelate purification process; as described, rPH.2 was produced in strain MC1061 in E. coli as described above and was purified as described below. The transformed cells were lysed by diluting the cells with lysis buffer (100mM succinate, 100mm NaCl, 20mM CHAPS, pH 6.00) The resulting mass was mixed and lysed by cracking the cells under high pressure, and the lysed cells were centrifuged and the supernatant containing rPH.2 left for further processing. The clarified supernatant was diluted 5 times with 25 mM phosphate buffer containing 1 mM EDTA, 10 mM CHAPS, pH 7.0 The diluted supernatant was then applied to a Sepharose Q column. The column was washed first with three times the column volume of 25 mM Na-phosphate buffer23.

6mL containing 1mM EDTA, 50mM NaCl, 10mM CHAPS, pH 7.0 (Wash 1), followed by washing with a 10-fold column volume of 25mM Tris buffer containing 1mM EDTA, 10mM CHAPS, pH 8.0 (Wash 2) followed by ten washes. column volumes of 25 mM Tris buffer containing 1 mM EDTA, 100 mM NaCl, 10 mM CHAPS, pH 8.0 (Wash 3). Elution was terminated with 25 mM Tris buffer containing 1 mM EDTA, 350 mM NaCl, 10 mM CHAPS, pH 8.0. The eluate from the Q Sepharose column was then diluted 3-fold with a volume of 25 mM Tris containing 1 mM EDTA, 10 mM CHAPS, pH 8.0 and was stacked on a Blue Sepharose column. The column was washed first with ten column volumes of 25 mM Tris containing 1 mM EDTA, 10 mM CHAPS, pH 8.0. This was followed by washing with three column volumes of 25 mM Tis, containing 0.5 M NaCl, 10 mM CHAPS, pH 8.0. The elution was terminated by washing with 25 mM Tris containing 3.0 M NaCl, 10 mM CHAPS, pH 8.0. The Blue Sepharose column eluate was diluted five times with 10 mM Na phosphate buffer containing 10 mM CHAPS, pH 6.2, and then applied to the chromatography column. The column was washed with 10-fold column volume with 10 mM Na-phosphate buffer containing 100 mM NaCl, 0.1% Pluronic FG8, pH 6.2. rPH.2 was eluted from the column with 120 mM Na-phosphate buffer containing 100 mM NaCl and 0.1% Pluronia: F-68m, pH 7.5. For the diluted eluate from the hydroxylapatite column, the pH was adjusted to pH 6.8 with 0.5 N-succinyl acid. This was followed by Sepharose SP column chromatography. The SP Sepharose column was washed ten times its volume with 50 mM sodium phosphate containing 125 mM NaCl, 0.1% Pluronic F68, pH 6.8. Elution was performed with 50 mM sodium phosphate with 125 mM NaCl and 0.1% Pluronic F68, pH 7.5. The eluted rPH.2 was finally adjusted by dilution to a final concentration of 4 mg / ml with 50 mM sodium phosphate containing 125 M NaCl, 0.15% Pluronic F68, pH 7.5. Tween 80 was added to a final concentration of 0.02%. The product formed was filtered through a 0.2 µm membrane and stored for further use.

3. Comparison of PAF-AH fragments with PAF-AH by sequencing

Purified preparations rPH.2 and rPH, 9 were compared to purified rPAF-AH mergers by N. terminal sequencing using an Applied Blosystems Model 473 Protein Sequencer (Applied Blosystems, Foster City, CA) and by C terminal sequencing performed using a Hewlett-Packard instrument. Model G1009A C-terminal Protein Sequencer. The prepared rPH.2 showed less N-terminal heterogeneity compared to rPAF-AH. The N-terminal analysis of the prepared rPH.9 was also very similar to that of rPH.2, but compared to rPH.2, lower C-terminal heterogeneity was observed for rPH.9.

Purified rPH.2 protein had most of the sequences containing the N-terminal Ala47 (approximately 86 to 89%) and a smaller proportion of the sequences having the N-terminal Ala48 (approximately 11 to 14%). This ratio was quite stable even under various cell fermentation conditions. Purified rPH.9 protein also contained in most sequences the N-terminal Ala47 (between 83-90%) and a minor proportion with the N-terminal amino acid Ala48 (approximately 10-17%). In contrast, efforts to prepare polypeptides in bacteria starting with Ile ₄₂ (rPAF-AH) resulted in a mixture of different polypeptides with N-terminal amino acids beginning with Ala47 (20-53%), Ile ₄₂ (8-10%) and artificially delivered methionine initiator Met -1 (37-72%) in the Ilc42 neighborhood. In the case of rPH.2 and rPH.9, the initiating methionine was effectively removed by aminoterminal peptidase after bacterial peptide synthesis while Ala remained at position 47 (or alanine at position 48) as the terminal residue.

Sequencing of the C-terminus was performed very frequently on rPH.2, where the C-terminus was discovered as the main occurring sequence of HOOC-Asn-tyr (approximately 80%), which is in good agreement with the predicted C-terminus of the translation product, which is HOOC-ASn _44? -Tyr ₄₄₀ , whereas the sequence of HOOC-Leu appeared only in 20%. After rPH.2 fractionation on SDS-PAGE, further sequencing of the primary and secondary bands was performed. Sequencing determined as the C-terminal sequence of HOOC-Leu-Met from the lower secondary band (AHL described below for section B.5), which corresponds to a translation product truncated by 10 amino acid residues. This product also exhibits a low level of HOOC-His. Further mapping of the peptides showed that, for some rPH.2 products, additional C-terminal sequences exist. By direct sequencing, the C-terminus for rPH.9 was primarily determined as HOOC-Ile-His (approximately 78-91%, depending on the lot). This result is in good agreement with the expected translation product of the end C of HOOC-Ile-His 9 ₄₂ 8 ₄₂ However, it appears that this technique has a specific background (noise), thus not underpinned by the low level of concentrations of other sequences.

4. Comparison of PAF-AH fragments with PAF-AH by MALDI-MS

The MALDI-MS method was applied to purified rPH.2 and rPH.9 products. The spectrum measured for rPH.AH showed two peaks which, by their weight, corresponded to the value expected for rPH.AH products (see Figure 4). This spectrum is similar to that obtained in the partially purified protein described in section B..1 herein. The second peak, corresponding to the lower molecular weight, was present in about 20 to 30% of the majority of measurements. The spectrum of rPH.9 showed that the dominant peak corresponds to the predicted mass for the complete translation product of the vector PH.9, from which the mass of the initiating methionine is subtracted (see Figure 5). For rPH.9, a lower molecular weight minor peak was also observed. It was represented in about 5% of the total number of samples.

Comparison of PAF-AH fragments with PAF-AH by SDS-PAGE

Polyalkrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) was applied to purified batches of rPAF-AH, rPH.2 and rPH.9. In the case of rPH.2, a very complex image of strips was obtained on the electrophorogram, distributed around a site corresponding to the migration range expected for the rPAF-AH product. This site was determined using the appropriate molecular standards. Two or more dominant strips were observed on one or more of the gels, each having its two secondary strips in close proximity which were positioned above and below the primary stripe. These upper secondary bands, middle primary bands and lower secondary bands were designated as AHU, AHM, and AHL. All of these strips reacted with a monoclonal antibody prepared against rPAF-AH in West blot and were thus identified as rPAF-AH-related products. The upper secondary band of AHU increased its intensity as a function of protein storage time and probably represented a modified form of the rPAF-AH product. The results obtained from SDS-PAGE for rPAF-AH products are similar to those obtained by the same method for rPH.2. There are two larger bands that migrate near the predicted molecular weight for rPAF-AH, two minor bands above and the shadow below the major bands. In contrast, rPH.9 gives one dominant band on SDS-PAGE without apparent cleavage. In addition, poorly recognizable bands corresponding to lower molecular weight and another band at a position corresponding to the weight of the dimer were also observed. However, no band corresponding to the AHU position was apparent.

The composition of the purified preparations of rPH.2 and rPH.9 was further analyzed by 20 gels and isoelectric focusing (IEF) in urea following SDS-PAGE in the second dimension. For rPH.9, five major spots distributed in the IEF direction are on two-dimensional electrophoresis. Heterogeneity in the number of charges appeared consistent across batches of rPH.9. In contrast to the above results, the 2D gel for rPH.2 appeared far more complicated as it contained about 15 spots distributed in IEF and SDS-PAGE.

6. Comparison of PAF-AH activity with that of PAF-AH fragments

Purified rPH.2 and rPH.9 products showed both enzymatic activity, which was the same as for serum purified endogenous PAF-AH, both products also bind lipoprotein in the same way as purified endogenous PAF-AH.

Example 11

Preliminary analysis of human plasma mRNA expression for PAF-AH in human tissue samples was determined by hybridization in North blot.

RNAs were prepared from human cortex, heart, kidney, placenta, thymus and tonsils using RNA Stat 60 (tel-Test "B", Friendswood, TX). Furthermore, RNA was also prepared from cells similar to human hematopoietic cell precursors of the THP-1 line (ATCC TIB 202), which were induced to differentiate into a macrophage-like phenotype using phorbol ester phorbolmyristylacetate (PMA). Tissue-derived RNA and RNA prepared from the premylocyte THF-1 cell line before and one to three days after induction were resolved by electrophoresis in a 1.2% agarose formaldehyde gel and then transferred to a nitrocellulose membrane. A full length PAF-AH cDNA, sAH406-3, prepared from human plasma, was labeled by random priming and hybridized to a membrane under conditions identical to those described in Example 3 for library browsing. The results obtained indicated that the PAF-AH probe hybridized to a band corresponding to 1.8 kb in thymus, tonsil, and, to a small extent, placental RNA samples.

PAF is synthesized in the brain under both normal and pathophysiological conditions. In view of the known inflammatory-inducing and potential neurotoxic properties of this molecule, it is believed that the mechanism of localization of PAF synthesis or its rapid catabolism is critical to maintaining the health of nerve tissue. The presence of PAF acetyl hydrolase in neural tissues indicates its protective role in these tissues. Interestingly, both PAF-AH, i.e. bovine (bovine) heterotrimaem intracellular PAF-AH (its cloning is described in Hattori et al. J. Biol. Chem., 269 (37): 23150-23155 (1994)) and PAF-AH of the present invention have been found in the brain.

In order to determine whether both enzymes expressed in the same or other parts of the brain, a human bovine cDNA homolog was cloned for intracellular PAF-AH and Northern blot samples of this brain-expressed mRNA were compared with the expressed mRNA for PAF-AH according to the invention, as described in the preceding paragraphs. In the brain, the following areas were examined by the Northem blot: small brain, medulla, spinal cord, basal nucleus, amygdala, pituitary, thalamus and tulle pole, frontal lobe and temporal lobe of the cerebral cortex. Traces of both enzymes were detected in each tissue. However, in a higher amount, the heterotrimeric intracellular form of the enzyme was detected rather than the secreted form. Northern blot analysis confirms 25

It has also been found for other tissues and cells that the heterotrimeric form of the intracellular enzyme occurred in these tissues very abundantly. The tissues where the enzyme was delegated are as follows: thymus, prostate, testes, ovaries, small intestine, colon, peripheral blood leukocytes, macrophages, brain, liver, skeletal muscles, kidney, pancreas and adrenal glands. This ubiquitous expression of this form of enzyme suggests that the heterotrimaem intracellular PAF-AH has a general maintenance function in cells.

Furthermore, the expression of PAF-AH RNA in monocytes isolated from human blood and during their spontaneous differentiation into macrophages was investigated in culture. In fresh monocytes little or no RNA was detected, but expression was induced and amplified during differentiation into macrophages. An accompanying phenomenon was an increase in PAF-AH activity in the culture medium of differentiating cells. Expression of the human plasma RNA transcript for PAF-AH was also observed in THP-1 cells on the first day but no longer on the third day following induction. Baseline stage THP-1 cells did not express PAF-AH mRNA.

Example 12

PAF-AH expression in human and mouse tissues was examined by in situ hybridization.

Human tissues were acquired by the National Disease Research Interchange and the Cooperative Human Tissue Network. Normal mouse brain and spinal cord, EAE spinal cord were obtained from S / JLJ mice. More normal mouse embryos were obtained from eleven to eighteen days after fertilization.

Parts of the tissues were placed in Tissue Tek II cryoform (Miles Laboratories, Inc., Naperville, IL) with a small amount of OCT compound (Miles, Inc. Elkhart, IN). In the mold, the samples were centered, the mold filled with the OCT compound, then placed in a 2-methylbutane (C2H5CH (CH3) 2 flask. ALdrich Chemical Company, Inc., Milwaukee, WI) and the flask was placed in liquid nitrogen. Once the tissue and the OCT compound are frozen in the cryoform, they are stored at -80 ° C until the block is cut. The tissue blocks were divided into 6 µm sections and attached to Vectabonds (Vector Laboratories, Inc., Burlingame, CA) coated slides and stored at -70 ° C and then placed at 50 ° C for approximately 5 minutes to obtain removal of condensation and then the samples are fixed in 4% paraformaldehyde for 20 minutes at 4 ° C, dehydrated (70%, 95%, 100% ethanol) for one minute for each stage, finally allowed to air dry for 30 minutes at room temperature . Tissues are hybridized in situ with radiolabeled single stranded mRNA generated from DNA derived from the internal 1 Kb HindIII fragment of the PAF-AH gene (nucleotides 308-1323 of SEQ ID NO: 7) by in vitro RNA transcription by incorporation of 35S-UTP (Amersham) or DNA derived from heterotrimeric intracellular PAF-AH cDNA identified by Hattori et al. The probes were used in various lengths from 250 to 500 bp. Hybridization was performed overnight (12-16 hours) at 50 ° C; 35S-labeled probe (6x10 5 cpm / inc), tRNA (0.5 pg / inc), diethylpyrocarbonate-treated water (depe) was added to the hybridization buffer to adjust the concentrations of its components to 50% formamide, 0.3M NaCl, 20mM Tris ph, 7, 5, 10% dextran sulfate, 1x Denhardt's solution, 100mM dithiothreitol (BTT) and 5mM EDTA. After hybridization, sections were washed for 1 hour at room temperature in 4x SSC / 10mM DTT, then 40 minutes at 60 ° C in 50% formamide / 1xSSC / 10mM DTT, 30 minutes at room temperature in 2 x SSC, 30 minutes at room temperature in 0.1 x SSC. The sections were then dehydrated, air dried for 2 hours and then developed (after storage at 4 ° C in complete darkness) and stained with the hematoxylin / eosin contrast dye.

A. Brain Brain

In both the human and mouse brain, a strong signal was observed in the small brain Purkinje cell layer, in the basket cells and in the central parts of the individual neurons in the nucleus dentate (one of the four nuclei in the small brain). Herterotrimaemic form of PAF-AH was also observed in these cells. Furthermore, a signal was also found for plasma PAF-AH in granular and molecular layers of gray brain matter.

Hippocapmus

A strong signal was detected in the hippocampus, especially in single cell cells that appear to be neuronal cells. These cells were identified as polymorphic portions of the middle portion of neurons and granule cells. Also in the hippocampus a signal was found for the heterotrimeric intracellular form of PAF-AH.

Brainstem

In both the human and mouse brainstem, a strong signal was recorded in individual cells of the gray matter.

crust

In the parts of the human cerebral cortex, which were obtained from the main cerebral, tulle temporal cortex and also in whole parts of the mouse brain, a strong signal was observed for individual cells. These cells were identified as pyramidal, star, and polymorphic cells. No differences were observed in the results obtained from different layers of bark. The results obtained by the in situ hybridization method were different from those obtained by examining the cerebral cortex by the Northem blot method. Probability differences result from the higher sensitivity of the in situ hybridization method compared to the Northem blot method. In both the cerebellum and hippocampus, similar results were obtained confirming the expression of the heterotrimeric form of intracellular PAF-AH.

hypophysis

A slightly weaker signal was recorded on individual scattered cells of the distal portion of these human tissues.

B. Human colon

In both normal and colonic patients with Crohn's disease, there was a signal in the lymphatic aggregates present in the mucosa portion, the signal was slightly higher in Crohn's disease patients. The samples from the colon of patients with Crohn's disease also showed a strong signal in lamina propria. Similarly, a higher signal level was observed in diseased caecum samples, although a healthy intestine showed a low but still detectable signal. Samples from patients suffering from ulcerative colitis showed no signal, either in lymphatic aggregates or in the intestinal mucosa.

C. Human almonds and thymus

A signal signal was recorded for scattered cells in the almond and thymus germinal centers.

D. Human lymph nodes

For normal donor lymph node specimens, a strong signal was observed, whereas in the sample taken from the lymph node of a patient in septic shock, the signal was very weak.

E. Human small intestine

Both the small intestine specimens from a healthy donor and the intestinal specimens from patients suffering from Crohn's disease provided only a weak signal in Peyer's plaques and intestinal mucosa. The signal was somewhat higher for the samples of the sick donors.

F. Human spleen and lungs

No signal was found in both spleen and lung specimens as well as spleen specimens of patients suffering from spleen abscess and lung patients.

G. Mouse spinal cord

For both spinal cord types, i.e. normal and AEE stage 3 spinal cord, a strong signal was recorded in the gray spinal cord mass. Expression was slightly higher in the EAE Stage 3 spinal cord. In the EAE Stage 3 spinal cord, cells in the cerebral white matter and perivascular connective tissue were likely to be infiltrated by macrophages or leukocytes and showed a signal that was not apparent in the normal spinal cord.

H. Mouse embryos

In the eleven-day embryo, the signal is evident in the central nervous system in the fourth ventricle, which holds constant during the development of small brain and embryonic brainstem. During embryo maturation, the signal becomes apparent in the central nervous system in the spinal cord (12 days), the primary cortex and the Gasseri node (14 days) and in the pituitary gland 16 days). In the peripheral nervous system, the signal becomes clear (beginning on days 14 and 15) in the nerves branching out of the spinal cord, and on day 17 a strong signal occurs around the bases of the embryonic olfactory organs. Expression is also evident from day 14 and the liver and lungs, in the intestine from 15 and in the posterior part of the mouth / throat from day 16. From day 18, the signal can be differentiated as a signal in the cortex, posterior brain (small brain and brainstem). nerves branching from the lumbar region of the spinal cord, as a signal at the back of the mouth / throat, liver, kidney, as well as a possible weak signal in the lungs and intestine.

sum

PAF-AH mRNA expression in tonsils, thymus, lymph nodes, Peyer's lungs, appendix and colon lymph nodes is in good agreement with the conclusion that the predominant

In vivo, the source of PAF-AH is in the macrophage because in all these tissues the macrophages are strongly represented, serving as phagocytic and antigen presenting cells.

The expression of PAF-AH in inflammatory tissues can be explained by the hypothesis that macrophage-derived monocytes play a major role in inflammatory processes. PAF-AH is believed to inactivate PAF and inflammatory-promoting phospholipids and thereby down-regulate the cascade of inflammatory processes initiated by these mediators.

PAF is delegated in all tissues in rats and is secreted in the culture of small brain granular cells. In vitro and in vivo experiments have shown that PAF binds to specific receptors in nerve tissues and induces functional and phenotypic changes such as calcium mobilization, regulation of transcription that activates genes, and differentiation of neural precursor cell lines, PC12. These observations clarify the role of PAF in the brain and accordingly, experiments have been utilized using tissue culture cultures of the hyppocampus and analogs of PAF and its antagonists that utilize PAF as an important backbone for long-lasting hypocampal enhancement. Therefore, in addition to the pathological role of PAF in inflammatory processes, PAF also appears to be involved in the routine neural signaling process. Thus, expression of extracellular PAF-AH in the brain can serve to regulate the duration and magnitude of PAF-mediated signaling.

Example 13

Using PAF-AH as the antigen produced in E. coli, monoclonal antibodies specific for human specific plasma PAF-AH were prepared.

The 1342 mouse was immunized for 0.19 and 40 days with recombinant PAF-AH. As the dose just prior to the fusion, the immunogen dose in PBS was used to immunize the mouse. Four days later, the mouse was sacrificed and its spleen sterile removed. This was then placed in a 10 ml dish with serum-free RPM1 1640 medium. A cell suspension was prepared by rubbing the spleens between two ends of frozen microscope slides immersed in serum-free RPMI 1640 medium supplied with 2 mM L-glutamine, 1 mM sodium pyruvate. 100 units / ml penicillin and 100 µg / ml streptomycin (RPMI) (GIBCO, Canada). The cell suspension was filtered through a sterile 70-mesh Nitex cell filter (Becton Dickinson, Parsippany, New Jersey) and then the cells were washed twice by centrifugation at 200 g for five minutes and the pellets were resuspended in 20 ml serum-free RPMI medium. Spleen cells from three native Balb / c mice were prepared in a similar manner. NS-1 myeloma cells were maintained in logarithmic phase: in RPMI with 11% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes and the pellet was washed twice in the same manner as described above.

Once 10 ⁸ spleen cells were combined with 2.0 x 10 ⁷ NS-1 cells, centrifuged and the supernatant was aspirated. The sediment in the cuvette was split by tapping two cuvettes and then 1 ml of 37 ° C warm PEG 1500 (50% in 75mM Hepes, pH 8.0) (Boehringer Manheim) was added over one minute, followed by the addition of 7 ml serum-free. media for 7 minutes. Following the addition of 8 ml RPMI, the cells were centrifuged at 200 g for 10 minutes. After removal of the supernatant, the pellet was resuspended in 200 ml RPMI containing 15% FBS. 100μΜ hypoxanthine sodium, 0.4μΜ aminopterin, 16μΜ thymidine (HAT) (Gibco), 25 units / ml IL-6 (Boehringer Mannheim) and 1.5 x 10 ⁶ thymocytes / ml and the cells were seeded in ten flat bottom Coming plates. with 96 wells (Coming, Corning New York).

On the second, fourth and sixth day following the fusion, 100 μΐ per well was exchanged for fresh. On day 8, the fusion was tested by ELISA, tested for the presence of mouse IgG binding recombinant PAF-AH. Immulon 4 microtiter plates (Dynatech, Cambridge, MA) were coated with recombinant PAF-AH at a concentration of 100ng / plate diluted in 25 mM TRIS, pH 7.5. Incubation was performed at 37 ° C for two hours. The coating solution was then aspirated and 200 µL of blocking solution (0.5% fish skin gelatin (Sigma) diluted with CMF-PBS) was added dropwise and the blocking solution was incubated at 37 ° C for 30 minutes. Plates were then washed three times with PBS containing 0.05% Tween 20 (PBST) and 50 µL of culture supernatant was added to each well. After an additional 30 min incubation at 37 ° C followed by triple washing, goat anti-mouse IgG (fc) with horseradish peroxidase (Jackson ImmunoResearch, West Grove, Pennsylvania) diluted in PBS 1: 3500 was added to the wells of the plate. as described above, they were washed four times with PBST, followed by incubation with the peroxidase substrate (100 μΐ / well) dissolved in the substrate buffer. The solution had the following composition: 1mg / ml o-phenylenediamine (Sigma) and 0.1 μΐ / ml 30% H ₂ O ₂ in 100mM citrate pH 4.5. After five minutes, the color reaction was stopped by adding 50 μ 50 15% H ₂ SO ₄ . The absorbance at 490 nm - A490 was read on a Dynatech reader.

Selected wells from the fusion were cloned twice by the limiting dilution method into a 96-well plate. After five days of incubation, the number of colonies per well was visually assessed. The hybridomas that were cloned were as follows: 90D1E, 90L3A, 90E6C, 90G1 ID (ATCC HB 11724) and 90F2D (ATCC HB 11725).

Isotypes of monoclonal antibodies produced by hybridomas were determined using the Isostrip system (Boehringer Mannheim, Indianapolis, IN). The results showed that the monoclonal antibodies produced by fusion 90 hybridomas were of the IgG1 type.

SK 286518-6

All monoclonal antibodies produced by hybridomas from fusion 90 could be used in ELISA assays but did not bind to PAF-AH in West blots. To prepare antibodies that could recognize PAF-AH in West blot, mice were immunized with recombinant enzyme. Hybridomas were prepared by the method described for fusion 90, but testing was by Western blot and not by ELISA. Thus, clones were selected that could be used for detection by this method.

For Westem analysis, recombinant PAF-AH was mixed with an equal volume of sample buffer containing 125 mM Tris, pH 6.8, 4% SDS, 100 mM dithiothreitol, and 0.05% brofenol blue. The sample was boiled for 5 minutes prior to electrophoresis. A 12% SDS polyacrylamide gel (Novex) was used. Electrophoresis was performed at 40mA, followed by electrotransfer of the protein onto a polyvinylidene fluoride membrane (Pierce). The transfer lasted 1 hour at 124 V in a solution of 192 mM glycine, 25 mM Tris base, 20% methanol and 0.01% SDS. The membrane was allowed to incubate overnight in a solution of 20 mM Tris, 100 mM NaCl (IBS) containing 5% bovine serum albumin (BSA, Sigma). The blot was further incubated for 1 hour at room temperature with rabbit polyclonal antiserum undiluted 1: 8000 with TBS buffer containing 5% BSA, followed by washing in TBS and incubation with alkaline phosphatase-conjugated goat anti-mouse IgG conjugated in TBS containing 5% BSA for 1 hour at room temperature. The blot was washed again with TBS followed by incubation with an alkaline phosphatase substrate, i.e. 5-bromo-4-chloro-3-indolyl phosphate at a concentration of 0.02% and 0.03% tetrazolium blue in Tris-HCl, pH 9.5 100 mM NaCl and 5 mM MgCl ₂ . The reaction was stopped by repeated washing with water.

Selected fusion wells whose supernatants were positive in Westem analysis were processed as described. Hybrid 143A reacting with PAF-AH in West blots was cloned (ATCC HB 11900).

Polyclonal antisera specific for human plasma PAF-AH were prepared during a three-month immunization of rabbits with 100 µg of purified recombinant enzyme in Freund's adjuvant.

Example 14

To assess the in vivo therapeutic effect of the recombinant PAF-AH prepared according to the invention, experimental studies were conducted in an acute inflammatory model in the case of rat swelling (Henriues et al., Br. J. Pharmacol., 106: 579-589 (1992)). showed that rPAF-AH blocks PAF-induced edema, and parallel studies have been conducted to compare the efficacy of PAF-AH with two commercially available PAF antagonists.

A. Preparation of PAF-AH

E. coli transformed with the PAF-AH expression vector puc trp AH were lysed in a microfluidizer, the solids were centrifuged, and cell supernatants were loaded onto a S-Sepharose column (Pharmacia). The column was washed extensively with a buffer containing 50 mM NaCl, 10 mM CHAPS, 25 mM MES and 1 mM EDTA. pH 5.5. PAF-AH was eluted with increasing NaCl concentration up to the IM value. Affinity chromatography on a Blue Sepharose column (Pharmacia) was used as the next step of the purification process. Prior to loading the PAF-AH on the Blue Sepharose column, the sample was diluted 1: 2, thereby reducing the salt concentration to 0.5 M and adjusting the pH to 7.5. After extensive washing of the Blue Sepharose column with buffer containing 0.5 M NaCl, 25 mM Tris, 10 mM CHAPS and 1 mM EDTA, pH 7.5. PAF-AH was eluted from the column with increasing NaCl concentration up to 3.0M.

The purity of PAF-AH isolated in this manner was usually 95% as determined by SDS-PAGE with an activity in the range of 5000 to 1000 U / ml. Additional quantitative controls performed with PAF-AH preparations included determination of endotoxin levels and haemolytic activity with freshly prepared rat erythrocytes. Buffer containing 25 mM Tris, 10 mM CHAPS, 0.5 M NaCl, pH 7.5 was used as both the preservation buffer and the carrier for administration of the formulation. The dosage used in the experiments was based on the determination of enzyme activity in assays directly prior to the experiments.

B. Edema induction (edema)

Long Evans rats (Charles River, Wilmington, MA) between 6-8 weeks of age, weighing between 180-200 g, were used in all experiments. Prior to the experiment, the animals were anesthetized with a mixture of Ketaset anesthetic preparations (Fort Dodge Laboratories, Fort Dodge, IA), Rompun (Miles, Shawnee Mission, KS) and AcePromazine (Aveco, Fort Dodge, IA). All anesthetics were administered subcutaneously at doses of approximately 2.5 mg Ktaset, 1.6 mg Rompun, 0.2 mg AcePromazine per dose administered to one animal. Swelling was induced in the foot by administration of either PAF or zymosan as described below. PAF (Sigma -1402) was freshly prepared for each experiment from a stock solution of 19 µM stored in chloroform / methanol (9: 1) at -20 ° C. Desired volumes were dried under a nitrogen atmosphere, diluted 1: 1000 in a buffer containing 150 mM NaCl, 10 mM Tris, pH 7.5 and 0.25% BSA and sonicated for five minutes. Animals were injected subcutaneously between the tummy on the back foot with 50 μΐ PAF (final dose 0.96 nmol). Swelling appeared in an hour, in some cases

286 after two hours. Zymozan A (Sigma A-8800) was prepared fresh for each experiment as a 10 mg / ml suspension in PS. The animals were injected subcutaneously between the tummy on the rear foot of 50 μΐ zymosan (final dose 500 μg) and swelling occurred after two hours.

Swelling was quantified by measuring the volume of the foot immediately prior to administration of PAF or zymosan and then at that time after administration of PAF and zymosan. Swelling was quantified by increasing the foot volume in milliliters. Volume measurement was performed on a plethysmometer (UGO Basile, model 7150), which can be used to measure the volume of water displaced by a submerged foot. In order to be comparable in size to the submerged part of the foot at the admiration of time intervals, the back of the foot was marked with washable ink at the point where the heeling ends. Repeated measurements of the same foot using this technique indicated measurement accuracy with an error of up to 5%.

C. Methods of Administration and Dosage of PAF-AH

PAF-AH was injected locally between the tummy on the foot or systemically by intravenous injection into the tail vein. When administered topically, the rats received 100 μΐ PAF-AH (4000-6000 U / ml) subcutaneously between the abdomen of the right hind node. The left leg served as a control, injected with a dose of 100 μΐ vehicle (buffered saline). For systemic administration of PAF-AH, rats were given the indicated amount of PAF-AH units in a 300 μΐ vehicle by injection into the tail vein. Control animals received the same volume of vehicle intravenously into the tail vein.

D. Topical Administration of PAF-AH

Rats (N = 4) were injected subcutaneously between the tummy on the right foot with a 100 µΐ injection dose of PAF-AH (4000-6000 U / ml). Only the vehicle (100 μΐ buffered saline) was injected into the left foot. Four other rats received only the dose of vehicle. All rats were immediately subjected to PAF by subcutaneous injection and the volume was measured one hour after administration. Figure 6, where swelling size is expressed by the increase in foot volume (ml) ± SEM for each treatment group, shows that PAF-induced swelling is blocked by local administration of PAF-AH. In the group of animals treated with PAF-AH prior to administration of PAF, there was a decrease in swelling compared to the control group of animals. In the PAF-AH treated group, an increase in foot volume of only 0.08 ml ± 0.008 (SEM) was observed. The increase in foot volume was due to injection of PAF into the foot. This increase in volume was not observed in the feet injected with the vehicle only.

E. Intravenous administration of PAF-AH

Rats (N = 4 per group) were treated by intravenous injection of PAF-AH (2000 U in 300 μΐ vehicle) 15 minutes prior to PAF administration. Swelling occurred 1-2 hours after PAF administration. Figure 7, in which the swelling size is expressed in volume increase in (ml) ± SEM for each study group, shows that intravenous application of PAF-AH blocks PAF-induced edema formation one to two hours after administration. The group treated with 2000U PAF-AH by the intravenous route showed a decrease in inflammation within two hours. The mean increase in the volume of liquid treated with PAF-AH was 0.10 ± 0.08 (SEM), compared to an increase of 0.56 ml ± 0.1 l in the vehicle-treated control group.

F. Comparison of PAF-AH Effect in Preventing PAF or Zymozan-induced Swelling

Rats (N = 4 per group) were treated by intravenous injection of PAF-AH (2000U in 300 μΐ vehicle) or vehicle alone. 15 minutes prior to this injection, the animals received PAF or zymozan A and the foot volume was measured after one or two hours. Figure 8 shows swelling size as the mean volume increase in (ml) ± SEM for all treatment groups. It can be seen from the figure that the administration of PAF-AH (2000 U) was effective in reducing PAF-induced foot edema, but is ineffective in blocking edema formation with zymosan administration. The mean increase in volume for the PAF-AH group was 0.08 ± 0.02 (SEM), compared to an increase of 0.49 ± 0.03 for the control group.

G. Administration of an effective dose as determined by titration of PAF-AH that induces protection

In two separate experiments, rats (N = 3 to 4 per group) were administered intravenously with PAF-AH in a series of dilutions or with vehicle only at 300 μΐ volumes, 15 minutes before the PAF dose. Both feet of animals were treated with PAF in the same manner as described, with swelling evaluated after one hour. Figure 9 shows swelling size as the mean volume increase in (ml) ± SEM for all treatment groups. It can be seen from the figure that administration of increasing doses of PAF-AH also prevents an increasing tendency to produce swelling induced by PAF injection in the rat. In the experiment, an ID50 was found for PAF-AH administered by injection between 40-80 U per rat.

SK 286518-6

H. Efficacy of PAF-AH in vivo as a function of time after administration

In two separate experiments, rats (N = 3 to 4 per group) were administered intravenously PAF-AH (200 0 in 300 μΐ vehicle) or vehicle only. After administration of PAF-AH, rats received a dose of PAF at intervals starting 15 minutes after PAF-AH administration up to 47 hours after PAF-AH administration. The swelling was then assessed one hour after PAF administration. Figure 10 shows swelling size as the mean volume increase in (ml) ± SEM for all treatment groups. It can be seen from the figure that administration of 200U PAF-Ah will protect rats from PAF-induced edema for at least 24 hours.

I. Pharmacokinetics of PAF-AH

Four rats received a dose of 2000 PAF-AH by intravenous injection in 300 μΐ volume. Plasma was harvested at various time points and stored at 4 ° C. Plasma concentration of PAF-AH was determined by ELISA, using a type of double binding assay using mAb. Briefly, this procedure is described as follows: monoclonal antibody 90G11D (Example 13) is diluted in 50 mM carbonate buffer pH 9.0 to a concentration of 100 ng / ml and allowed to bind to Immulon 4 microtiter plate overnight at +4 ° C. After extensive washing with PBS containing 0.05% Tween 20, the plates were blocked for 1 hour at room temperature with 0.5% fish skin gelatin (Sigma) diluted in PBS. Serum samples diluted in PBS containing 15 mM CHAPS were plated in duplicate on the washed plate and incubated for 1 hour at room temperature. After washing, the biotin 90F2D monoclonal antibody conjugate (Example 13) was added to each well at a concentration of 5 µg / ml diluted in PBS. The conjugate was allowed to incubate for one hour at room temperature. After washing, 50 µL of Extra Avidin (Sigma) was added to each well at a 1: 1000 dilution. Avidin was incubated for one hour at room temperature. After washing, the OPD substrate was added and allowed to develop staining, which was measured on a photometer. The enzyme activity was then read from the calibration curve according to the measured values. From Figure 11, where the dots represent mean ± SEM, it is evident that in the plasma taken an hour before the administration of PAF-AH levels, they are expected to reach concentrations in plasma samples of 5-6 ml in rats weighing 180-200 grams, average 374 U / ml ± 58.2. After one hour, the concentration levels steadily decrease until they reach an average value of 19.3 U / ml ± 3.4 after 24 hours, which is still appreciably higher than the concentration of endogenous PAF-AH, which in enzymatic assays reached approximately 4 U / ml. ml.

J. Efficacy of PAF-AH compared to PAF antagonists

Rats (N = 4 per group) were treated with one of three potential anti-inflammatory agents with CV3988 (Biomol L-103) antagonist administered IP (2mg in 200 μΐ EtOH), with PAF antagonist Alpazol (Sigma A-8800) administered IP (2mg) in 200 μΐ EtOH) or PAF-AH (2000 U) administered IV. A control group of rats received 300 μΐ of carrier IV. PAF antagonists have been administered IP because they are soluble in ethanol. Rats treated with either CV3988 or Alprazole were given PAF 30 minutes after the administration of these antagonists, in order to circulate the PAF antagonists, while PAF-AH and rat treated carriers were administered 15 minutes after administration of the enzyme. PAF-AH-treated rats showed a reduction in PAF-induced swelling until additional CV3988 and Aprazolam antagonists were placed behind them. This is shown in Figure 12, where swelling size is shown as the mean volume increase in (ml) ± SEM for all study groups.

Summarizing the results, it is clear that rPAF-AH effectively blocks in vivo PAF-induced edema. Administration of PAF-AH products can be either local or systemic by IV injection. In dosing studies, doses of IV injections ranged from 160 to 2000 U / rat. These doses dramatically reduced PAF-induced inflammation while the DI50 dose ranged from 40 to 80 U / rat. Calculations based on plasma volume for a rat weighing 180-200 grams provide a good presumption that plasma concentrations of 25-40 U / ml effectively prevented PAF-induced edema. These assumptions were supported by preliminary pharmacokinetic studies. A dose of 2000U of PAF-AH was found to be effective in blocking PAF-induced edema for at least 24 hours. Plasma PAF-AH concentrations of approximately 25 U / ml were detected 24 hours after administration. PAF-AH blocked PAF-induced edema formation more effectively than the two other PAF antagonists tested. Taken together, these results confirm that PAF-AH effectively blocks PAF-induced inflammation and could be of therapeutic importance in the treatment of diseases where PAF is the primary mediator.

Example 15

The recombinant PAF-AH of the invention was tested in vivo in a second model, pleural inflammation (pleuritis) induced by PAF. As previously shown, when applied to the pleural space, it induces vascular leakage. (Hebriques et al., Supra). Female rats (Charles River, 180-200 g) were injected into the tail vein with 200 μΐ of 1% Evans Blue dissolved in 300 μΐ of recombinant PAF-AH (1500 μ ml / ml / hour, prepared as described in Example 14), or with the same volume of control buffer. Fifteen minutes later, rats received a 100 μΐ injection of PAF (2nmol) into the rat

286 of the pleural space. After one hour of PAF treatment, the rats were sacrificed and aspirated by washing up the thoracic cavity with 3 ml of heparinized PBS. Vessel leakage was measured by the amount of Evans blue in the pleural space by measuring absorbance at 620 nm. In the rats initially given PAF-AH, the leakage of the vessels was much less than that of the control group of animals (representing more than 80% reduction in inflammation).

Previous results support the possibility of using the recombinant PAF-AH of the invention as a medicament for pleural inflammation.

Example 16

The efficacy of the recombinant PAF-AH enzyme of the invention was also tested in a model of antigen-induced eosinophil formation. The accumulation of eosinophils in the airways is a characteristic feature of the late phase of the immune response that occurs in asthma, rhinitis and eczema. BALB / c mice (Charles River) were sensitized by two intraperitoneal injections containing 1 µg of ovalbumin (OVA) in 4 mg aluminum hydroxide (Imject alum, Pierce Laboratories, Rockford, IL) given at two week intervals. On the fourteenth day following the second immunization, the sensitized mice were subjected to an immunoassay with aerosolized OVA or saline control.

Prior to the test, mice were randomly divided into four groups of four mice. Mice in Groups 1 and 3 were treated with 140 μΐ of control buffer containing 25 mM Tris, 0.5 M NaCl, 1 mM EDTA and 0.1% Tween 80 administered by intravenous injection. Mice in Groups 2 and 4 were treated with 750 units of PAF-AH (activity 55,000 / ml administered in 140 μΐ PAF-AH buffer). Thirty minutes after administration of PAF-AH or buffer, mice in groups 1 and 2 were exposed to aerosolized PBS as described below, while mice in groups 3 and 4 were exposed to aerosolized OVA, 24 hours thereafter, the mice were re-treated a second time either 140 μΐ buffer (groups 1 and 3) or 750 PAF-AH units in 140 μΐ buffer (groups 2 and 4). The compounds were injected intravenously.

Trachea eosifile infiltration was induced in sensitized mice by exposure of animals to aerolized OVA. Sensitized mice were placed in 50 ml conical centrifuge tubes (Cormimg) and forced to breathe aerolized OVA (50 mg / ml) dissolved in 0.9% saline for 20 minutes using a nebulizer (Model 646, DeVilbiss Corp., Somerset, PA). . Control mice were treated in the same manner except that only 0.9% saline was used in the nebulizer. 48 hours after exposure to aerolized OVA or saline, mice were sacrificed and trachea removed. Tracheas from each group were captured firmly in OCT and stored at -70 ° C until the slides were cut.

To evaluate eosinophilic trachea infiltration, tissue sections from four groups of mice were stained with either Luna solution and haematoxylin-eosin solution or peroxidase. Twelve six-micron sections were cut from each group and numbered accordingly. Sections numbered odd were stained with Luna according to the following procedure. Sections were fixed for 5 minutes at room temperature, rinsed with running water three times for 2 minutes at room temperature and then rinsed in two changes of distilled water (dH ₂ O) for one minute at room temperature. Tissue sections were stained with Luna color for 5 minutes at room temperature (Luna color is composed of 90 ml Weigert's iron hematoxylin) and 10 ml 1% Bierbrich Scarlet. The stained sections were immersed in 1% acidic alcohol 6 times, rinsed in running water for 1 minute at room temperature, immersed in 0.5% lithium carbonate solution, rinsed five times with running water for 2 min. at room temperature. Sections were dehydrated with ethanol at concentrations of 70% - 35% - 100%, kept at room temperature for 1 minute at each concentration, further cleaned twice with xylene for 1 minute at room temperature and attached to Cytoseal 60.

For peroxidase staining, the segments were fixed with acetone at 4 ° C for 10 minutes and air dried. 200 μ časti of DAB solution was added to each portion and left for 5 min. at room temperature. Sections were 5 min. rinsed with tap water at room temperature and then 2 drops of 1% osmium acid for 3 - 5 s were applied to each segment. The sections were rinsed with tap water for 5 min. at room temperature and counterstained with Mayer's hematoxylin at 25 ^° C at room temperature. Then the sections were 5 min. rinsed with running water and dehydrated with 70% - 95% - 100% ethanol row, 1 minute at each concentration, at room temperature. Sections were further cleaned twice with xylene for 1 minute at room temperature and mounted in Cytoseal 60.

The number of eosinophils in submucosal tracheal tissue was evaluated. The trachea of the mouse first and second groups contained very few eosinophils alone in submucosal tissue. Supposedly, the tracheas of the third group of mice pre-treated with buffer and exposed to OVA dust were a large number of eosinophils in submucosal tissue. In contrast, tracheas of the fourth group of mice that had been pre-treated with PAF-AH and exposed to OVA dust contained only a few eosinophils in submucosal tissue as compared to the control group and groups 1 and 2.

Therapeutic treatment with PAF-AH may therefore be indicated in cases of a late immune response in which eosinophils accumulate, as in the case of asthma and rhinitis.

Example 17

The patented PAF-AH product has been tested for two different rat models in the treatment of necrotic enterocolitis (NEC), acute hemorrhagic intestinal necrosis, which occurs in fetuses of low birth weight and causes significant morbidity and mortality. Previous experiments have shown that glucocorticoid treatment reduced the incidence of NEC in animals and premature infants, and glucocorticoid activity is believed to occur through elevated plasma PAF-AH temperature.

A. Activity in PAF Induced NOEC Rats

1. Prevention

Recombinant PAF-AH product, rPH.2 (25,000 units in 0.3 ml, Groups 2 and 4) or buffer alone (25 mM Tris, 0.5 M NaCl, 1 mM EDTA and 0.1% Tween 80) (Groups 1 and 3) ) were administered to the tail vein of female Wistar rats (n = 3) weighing 180-200 g. 15 minutes after administration of rPH.2 or buffer alone, the animals were injected as described by Furukawa, et al. (J. Pediatr. Res. 34: 237-241 (1993)), into the abdominal aorta at the level of the superiome mesenteric artery, either BSA alone (0.25%) - saline (groups 1 and 2) or PAF (0.2 gg) (100 mg) suspended in physiological saline containing BSA (groups 3 and 4). The small intestine was removed from the caecum after two hours by severing the Trietz ligament, thoroughly rinsed with cold saline, and evaluated. For microscopic observation, upper, middle and lower small intestine samples were obtained. The tissues were fixed in buffered formalin and samples prepared for microscopic evaluation by hematoxiline and eosin staining. The experiment was repeated three times.

A cursory examination of the intestines revealed normal findings in the BSA-treated saline groups. Similarly, injected rPH.2 in the absence of PAF had no effect on the gross findings. In contrast, injection of PAF into the descending aorta resulted in rapid and severe discoloration and haemorrhage of the serous intestinal surface. A similar hemorrhage was reported when the small intestine segments were tracked on the mucosal side and the small intestine was completely necrotic. When rPH.2 was injected into the tail vein for 15 min. before PAF was administered to the aorta, the intestinal findings were normal.

The microscopic observation of the intestines in groups 1, 2 and 4 revealed normal villous architecture and normal population of lamina propria cells. In contrast, in the group treated with PAF alone, severe necrosis and haemorrhage were found throughout the mucosa. Plasma PAF-AH activities were determined for the same rats as in the previous experiment. PAF-AH activity was determined as described later. Blood samples were taken before injection into the tail vein. In addition, samples were taken from the vena cava immediately prior to PAF injection and at the time of sacrifice. Blood was collected at about 50 µl into heparinized capillary tubes. Plasma was obtained by centrifugation (980xg for 5 minutes). The enzyme was determined according to Yasuda and Johnston, Endocrinology, 130: 708-716 (1992).

Plasma PAF-AH activity in all rats was 75 ± 2.5 units prior to injection (1 unit equals 1 nmol x min. ¹ x ml-1 plasma). PAF-AH activities measured in plasma were 75.2 ± 2.6 units in Group 1 and 76.7 ± 3.5 units in Group 3 at 15 minutes after injection of buffer alone. After 15 minutes, plasma PAF-AH activity was detected in plasma. animals injected with 25,000 rPH.2 units, 2249 ± 341 units in Group 2, and 2494 ± 623 units in Group 4. Activity in Groups 2 and 4 remained elevated (1855 ± 257 units) until sacrifice (2 L). (4 hours post rPH.2 injection) (Group 2 = 1771 ± 308; Group 4 = 1939 ± 478). These results indicate that PAF-Ah activity in the plasma of rats injected with the vehicle alone (groups 1 and 3) did not change during the experiment. In animals injected with PAF, NEC developed while all rats injected with rPH.2 and then injected with PAF were fully protected.

2. Dosage-dependent NEC prevention

In order to determine the dose-dependency of NEC protective activity in rats, the animals were treated with increasing doses of rPH.2 for 15 min. prior to PAF administration. The rPH.2 doses ranged from 25.5 to 25.500 units that were administered to the tail vein of rats. PAF (0.4 µg in 0.2 saline with BSA) was then injected for 15 min. after administration of rPH.2 to the abdominal aorta, 2 hours after PAF administration, the small intestine was removed and NEC was evaluated. Plasma PAF-AH activity was determined before exogenous enzyme administration and 15 minutes and 2 1/4 hours after rPH.2 administration. Results are the mean of 2-5 animals per group. All rats receiving less than 2,000 enzyme units developed an NEC. PAF-AH activity in the plasma of animals receiving the lowest protective doses of enzyme (2040 units) reached 363 units per ml of plasma after 15 minutes, representing a 5-fold increase from baseline. When rPH.2 was administered at a dose of less than 1020 total units, the average enzyme activity in the plasma was about 160 and lower, and NEC was found in all animals.

SK 286518-6

3. Duration of NEC protection

In order to determine the length of the exogenous action of the PAF-AH product required to protect against the formation of NEC, a fixed amount of enzyme was injected into the tail vein in a single dose and subsequently administered PAF at different time intervals. rPH.2 (8,500 units in 0.3 ml) or drug-free solution alone was administered to the rat from the tail vein and PAF (0.36 µg in 0.2 ml BSA in saline) injected into the abdominal aorta at various time intervals after administration of the enzyme. Small intestines were removed 2 hours after PAF injection and examined and histologically observed for NEC. Plasma PAF-AH activity was determined at various intervals after enzyme administration and two hours after PAF administration. The mean values of enzymatic activity ± standard deviation were determined in each group.

The results showed that no rat developed NEC within the first 8 hours after rPH.2 injection, whereas 100% of animals that were subsequently treated with PAF 24 and 48 hours after enzyme injection developed NEC.

4. Reversal of NEC

To determine whether administration of PAF-AH can reverse the development of NEC induced by PAF injection, 25,000 units of enzyme were injected into the vena cava two minutes after PAF administration (0.4 µg). NEC was not formed in any animal. However, when rPH.2 was administered in this manner 15 minutes after PAF injection, all animals developed NEC, which corresponds to a rapid course during PAF-induced NEC development as previously described by Furukav et al. (see above). Taken together, these results indicate that a relatively small increase (5-fold) in plasma PAF-AH activity is able to prevent NEC. These observations, together with previous reports that PAF-AH activity in rabbit fetal plasma [Maki et al., Proc. Natl. Acad. Sci. (USA) 85: 728-732 (1988)] and untreated children [Caplan et al., J. Pediatr. 116: 908-964 (1990)] was relatively low, suggesting that prophylactic administration of preparations containing the human recombinant PAF-AH product to low birth weight children can be used in the treatment of NEC.

B. Activity in neonatal NEC model

The efficacy of PAF-AH, rPH.2, was evaluated in the NEC model for neonatal stressed rats by the following procedure, by feeding with feed and asphyxia, two of the risk factors for human disease. In this model system, 70-80% of the animals had evident and microscopic bowel damage by day 3 of life, similar to neonatal NEC. The rat neonates were obtained from pregnant Sprague-Dawley rats (Harlan Sprague-Dawley, Indlanapolis, IN), under CO ₂ anesthesia, and delivered by abdominal incision. The newborn animals were collected, dried and placed in a newborn incubator for the duration of the experiment.

First, the dosage and absorption characteristics of rPH.2 were determined in each group. Normal neonatal rats were administered enteral or intraperitoneally at one time with three doses of rPH.2 (31 µg, 151 µg or 751 µg) and blood was then collected for determination of PAF-AH activity in plasma after 1h, 6h and 24h. PAF-AH activity was measured by substrate incubation method [Gray et al., Nature, 374: 549 (1995)] and ELISA using anti-human rPAF-AH monoclonal antibodies for each sample (90F2D and 90G1 ID, as described in Example 13). Immunohistological assays were performed using standard techniques using 1: 100 antibodies and incubated overnight.

In normal-born rat pups, no increase in plasma PAF-AH activity was detected in the gut after administration of rPH.2, either by the substrate incubation method or by ELISA. For intraperltoneal administration of rPH.2, circulating PAF-AH activity was measurable within one hour after dosing by both methods and peaked 6h after dosing. Higher doses of rPH.2 (from 3 to 75 µambda, 10 to 250 U) elicited higher PAF-AH activity in plasma. Following enteral administration, immunohistochemical analysis revealed the presence of rPAF-AH product in intestinal mucosal epithelial cells. Activity was concentrated predominantly in intestinal villas with minimal dye presence in cryptic cells. The ileum was stained more intensively than the jejunum, and a certain amount of rPAF-AH product was detected immunochemically in parts of the colon. No observable staining was found for the control samples and the samples obtained from animals treated intraperitoneally. Thus, enteral administration of rPAF-AH resulted in local accumulation in the mucosal epithelium, while intraperitoneal administration of rPAF-AH increased circulating enzyme levels, but not local accumulation in the mucosa.

In the NEC model, NEC was induced in newborn rats by Caplan et al., Pediatric. Pathol., 14: 1017-1028 (1994). In this procedure, the animals were fed every three hours with a tube of a soluble infant feed mix (Esbiliac, Borden Inc.). The initial feed dose of 0.1 ml / feed was later increased to 0.4 ml / feed until tolerance by day 4. For all animals, asphyxia was induced twice daily by inhaling 100% nitrogen for 50 seconds in a sealed plastic chamber and the animals were then exposed to cold (4 ° C) for 10 min. Intestinal and bladder function was stimulated by gentle manipulation after each feeding. The animals were fed for 96 hours or until they showed signs of anxiety. Diseased animals had abdominal distension, bloody stools, respiratory problems, cyanosis, letharia and were killed by decapitation. After sacrifice, the intestines of all rats were evaluated for the presence of necroses and fixed in formal for later histological analysis. Samples were paraffin-embedded, microtome-cut, stained with hematoxylin and eosin and evaluated by two independent observers. Intestinal damage was designated as 1+ for detached or detached epithelial cells, 2 for peeling epithelial cells into the middle villous layer, 3+ for whole-house necrosis and 4+ for transmural necrosis.

To determine the efficacy of rPH.2, three groups of rats were administered enterally, intraperitoneally, or both. The rPH.2 preparation contained 0.8 mg / ml protein and approximately 4000 units / mg PAF-AH with an endotoxin / protein ratio <0.5 EU / mg. For enteral use of rPH.2, animals were administered 251 µgda (80U) of the compound diluted in the ration by the orogastric tube (every three hours). For intraperitoneal use, animals were injected 75 µg by intraperitoneal injection twice daily. Control animals received an appropriate buffer volume (20 mM NaPO ₄ , pH 7.4) without rPH.2 and were monitored concurrently with each experimental group. Mortality and symptoms of NEC in each treatment group and differences were analyzed using Flscher's exact test. Values at p <0.05 were considered significant. The results are shown in Table 9.

Table 9

NEC dead control (i.p. administration) 7/10 8/10 rPH.2 (240 U i.p., twice daily) 6/11 8/11 control (enteral administration) 19/26 21/26 rPH.2 (80 U enteral, after 3h) 6/26 7/26 control (i.p. + enteral administration :) 10/17 12/17 rPH.2 (240 U i.p. twice daily and 80 U enteral for 3h) 3/14 7/14

The data represent the cumulative results of four independent i.p, application, four enteral and three i.p. + enteral administration.

Enteral administration of rPH.2 significantly reduced both NEC and animal mortality compared to controls. The results of four different experiments showed that pretreatment of rPH.2 animals reduced NEC from 19/26 (control) to 6/26 (p <0.001).

Intestinal damage to treated and control animals was variable, but in most cases it was midvillous necrosis in several segments, complete villus necrosis in other parts, or the same sites with transmutal necroses, the remaining parts had normal histological findings. The highest NEC grade for both treated and control animals with intestinal impairment was similar (mean 2.8 for controls and 2.4 for pretreated rPH.2. P> 0.05).

Intraperitoneal administration of rPH.2 had no significant effect on NEC production and animal mortality in this model system. The onset of symptoms in this group and the control was similar (40 ± 5 hours in the control, 36 ± 7 hours in the rPH.2-treated group) and the degree of NEC was also similar in both groups (mean 2.6 in the control and 2 rats). 5 in the group of rats treated with rPH.2).

Additional experiments were performed in which rats were administered rPH.2 both enterally and intraperitoneally at the same doses as when administered by either route (25 lambda rPH.2 at each 3-hour feeding and 751-ampda intraperitoneal injection twice daily) . The results are shown in Table 9. Although there was no significant difference in the number of animals killed between treatment and control, treatment with rPH.2 significantly reduced the incidence of NEC (10/17 for control and 3/14 for rPH.2-treated rats, p = 0.04). Six out of seven dead animals from the rPH.2-treated group were found to have a positive E. coli blood count just prior to death.

These results confirm the role of PAF-AH products in the neonatal model of NEC that is not induced by PAF. Enteral treatment of the rPAF-AH product prevented NEC, while intraperitoneal treatment at these doses had no apparent effect. These results suggest that the PAF-AH product added to the NEC compromised infant formula could reduce the incidence of the disease.

Example 18

The efficacy of PAF-AH product in acute respiratory distress syndrome (ARDS) was studied in guinea pigs.

Intravenously injected PAF induced severe lung inflammation in guinea pigs resembling initial ARDS in humans. Within minutes after intravenous administration of PAF, lung parenchyma was filled with constricted bronchi and bronchioles (Lellouch-Tubiana et al., Supra). Platelets and polymorphonuclear neutrophils began to marginalize and cell aggregates were readily detectable along the pulmonary arterioles [Lellouch-Tubiana Br.

SK 286518-6

J. Exp Path., 66: 345-355 (1985)]. PAF infusions also damaged bronchial epithelial cells that separated from the walls and accumulated in the airways. Such epithelial cell damage in the airways is consistent with the formation of hyaline membranes that occur in humans during ARDS. Marginalization of neutrophils and platelets is rapidly followed by diapedesis of these cells into alveolar septum and alveolar lung spaces. PAF-induced cell infiltrates are accompanied by significant vascular leakage and airway edema [Kirsch, Exp. Lung Res., 18: 447-459 (1992)]. The onset of edema was also confirmed in in vitro studies when PAF induced dose-dependent extravasation of 1251-labeled fibrinogen (10-1000 ng / ml) in washed guinea pig lungs [Basran. Br. J. Pharmacol., 77: 437 (1982)].

Based on these observations, an ARDS model in guinea pigs was developed. The cannula is placed under anesthesia in the cervical vein of male Hartly guinea pigs (approximately 300-400 g) and PAF diluted in a vehicle of 500 µg PBS with 0.25% bovine serum albumin (PBS-BSA) infused over 15 minutes at a total dose of 100-400 ng / kg. At various intervals after PAF infusion, the animals were sacrificed and lung tissue was harvested. In the case of guinea pigs injected with PAF, time-dependent lung damage and inflammation, which lasted up to 60 minutes, were clearly evident within 15 minutes. Neutrophils and red blood cells are present in the guinea pig alveolar compartments given PAF whereas their presence was not detected in control animals. Epithelial cell damage resembling hyalin membrane formation in human ARDS patients has also been demonstrated. Bronchoalveolar lavage (BAL) samples from guinea pigs infused with PAF showed strong protein accumulation in the inflamed lungs and proven vascular leakage.

In this model guinea pig ARDS system, rPH.2 was found to completely prevent PAF-induced lung damage. Groups of guinea pigs pre-treated with either rPH.2 (2000 units at 500 μΐ) or only PAF-AH buffer (500 μΐ) alone. After 15 minutes, guinea pigs were infused with PAF (400 ng / kg at 500 μΐ) and administered for 15 minutes. The guinea pig control group was infused with 500 μ 500 PBS-BSA. At the end of the PAF infusion, the animals were sacrificed and taken up with BAL fluid by lavage their lung X with 10 ml of saline containing 2 μ / ml heparin to prevent clotting. In order to determine the protein content of the BAL, samples were diluted 1:10 in saline and OD 280 was determined. A protein concentration of 2.10 ± 1.3 mg / ml was determined in the BAL fluid of guinea pigs treated with buffer alone. In contrast, BAL fluid from PAF infused animals contained 12.55 ± 1.65 mg / ml proteins. In guinea pigs pre-treated with rPH.2, a protein content of 1.13 ± 0.25 mg / ml was found in the BAL fluid, which is comparable to the control and demonstrates that the PAF-AH product completely prevents PAF-induced pulmonary edema.

Example 19

The efficacy of PAF-AH, rPH.2, was evaluated for two model systems of acute pancreatitis.

A. Activity in the rat pancreatitis model

Male Wistar rats (200-250 g) were purchased from Charles River Laboratories (Wilmington, MA). Rats were housed in a controlled climate room of 23 ± 2 ° C, a 12 hour light / dark cycle and fed standard laboratory feed and water ad libitum. Animals were randomized into control and experimental groups. The rats were anesthetized with 50 mg / kg sodium pentobarbital administered intraperltoneally and then a polyvinyl catheter (V3 size, Biolab products, Lake Havasu, AZ) was inserted into the jugular vein. The catheter was pulled subcutaneously and opened in the dorsal cervical region. The animals were allowed to be anesthetized. The rats had free access to water but were left without food overnight. The experiments were carried out on conscious animals the following day. Until the start of the experiment, the catheter was filled with a constant infusion of saline (0.2 ml / h). On the day of the experiment, animals were intravenously injected with rPH.2 or a portable control alone and subsequently infused with either (1) 5 µg / kg caerulein for an hour over 3.5 hours, or (2) 10 µg / kg caerulein after an hour for 5 hours, (Research Plus, Bayonne, NJ). Immediately after the end of the infusion, the animals were anesthetized with sodium pentobarbital, the abdominal cavities were opened, and 5 ml of blood was aspirated from the internal vein of the cava for further determination. The animals were then sacrificed by bleeding. Serum amylase serum lipase and serum bilirubin and collected pancreas were measured. Parts of the pancreas were either fixed in a 4% phosphate formaldehyde buffer solution for histological activities or immediately frozen at -80 ° C to measure myeloperoxidase activity. Other portions of the pancreas were used to determine the water content of the pancreas, pancreas amylase, and trypsin as described. Myeloperoxidase activity, which shows the degree of neutrophil staining, was determined in the pancreas and lungs as described below. Data were statistically evaluated using an unpaired Student's t-test. Values are mean + S.E.M. at least three different experiments. Results at p <0.05 are considered significant.

1. Water content in the pancreas

The pancreas segments were dried and weighed (fresh weight) and then dried for 34 hours at 120 ° C and weighed again (dry weight).

Pancreas water was calculated as the difference between fresh and dry weight and expressed as a percentage of fresh weight. An increased water content in the pancreas indicated edema.

2. Serum and pancreatic amylase

Serum amylase activity was measured using the 4,6-ethylene (G7) -p-nitrophenyl (Gl) -alD-maltoplastide (ET-G7PNP) substrate (Sigma Chemical Co., St. Louis, MO) according to Pierre et al. Clin. Chem., 22: 1219 (1976). Amylase activity in pancreatic tissues was measured by the same method after tissue homogenization in 10 mM phosphate buffer, pH 7.4.

3. Pancreatic trypsin

Trypsin activity was measured fluorimetrically using the substrate Boc-Gln-Ala-Arg-MCA. In the cuvette, 200 μΐ of sample and 2.7 ml of 50 mM Tris buffer (pH 8.0) containing 150 mM NaCl, 1 mM CaCl ₂ and 0.1% bovine serum albumin were mixed. 100 μΐ of substrate was added to the sample and a reaction was initiated after 20 seconds of preincubation. Fluorescence was measured at 380 nm excitation and 440 nm emission and expressed by the slope of the line. In order to evaluate different experiments together, trypsin activity in fractions was expressed as a percentage of total trypsin activity.

4. Histology and morphometry

For light microscopy, sections from the front, middle and back of the pancreas were randomly selected and fixed in 10% neutral phosphate formalin buffer. Paraffin-attached segments of 5 µm were stained with hematoxylin-eosin (H&E) and evaluated by the morphologist tested. Acinic cell damage or necrosis was determined by either (a) the presence of fuzzyness in the case of acinic cells or (b) the acolytic cell vacuolization and swelling and destruction of the whole or only part of the histo-architecture, both events associated with an inflammatory response. The amount of wounded or necrotic cells and the total area formed by acinine cells was quantified morphometrically by video and computerized planimetric image analysis (CCD-72 model. Dage-MT1, Michigan city, IN) equipped with NIH-1200 image analysis software. Ten randomly selected microscope fields were evaluated for each sample. The extent of damaged or necrotic cells was determined as a percentage of the total area of acin cells with areas meeting the criteria for damage or necrosis.

5. Measurement of myeloperoxidase activity (MPO) in pancreas and lungs

Neutrophil staining in the pancreas and lungs was determined based on tissue myeloperoxidase activity. Samples were collected at the time of sacrifice stored at -70 ° C until analysis. Samples (50 mg) were thawed and homogenized in 1 ml of 20 mM phosphate buffer (pH 7.4) and centrifuged (10,000 x g, 10 min, 4 ° C). The obtained pellet was resuspended in 50 mM phosphate buffer (pH 6.0) containing 0.5% hexadecyltrimethylammonium bromide (Sigma, St. Louis, MO) and frozen and thawed four times in a row. The suspensions were then disrupted by sonication for 40 seconds and centrifuged (10,000 x g, 5 min., 4 ° C). The reaction mixture containing the extracted enzyme, 1.6 mM tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO), 80 mM phosphate buffer (pH 5.4) and 0.3 mM hydrogen peroxide was incubated at 37 ° C for 110 seconds and the absorbance measured. at 655 nm with an CobasBio automatic analyzer. This absorbance was then recalculated according to the dry matter content of the tissue sample.

6. Measurement of pulmonary vascular permeability

Congestion of the common biliopancreatic canal usually results in severe pancreatitis associated with lung damage, which can be quantified by vascular lung permeability and histological evaluation.

The animals were injected intravenously with 5 mg / kg of fluorescein isothiocyanate albumin (FITC-albumin, Sigma Chemical Co., St. Louis, MO) intravenously two hours prior to sacrifice. Pulmonary microvascular permeability was evaluated by leaking FITC-albumin from vascular compartments into bronchoalveolar spaces. Brief description of the method: Right after sacrifice, the right bronchus was blocked with a clamp and the trachea opened. Then, the right lungs selected by cannula were inserted into the trachea. Three saline lavages (60 ml per lavage) were pooled and serum FITC fluorescence and lavage was measured at 494 nm excitation and 520 nm emission. The calculated ratio of lavage to blood fluorescence then expressed a measure of the microvascular permeability of the lungs. The lungs were also stained with H & E and histologically evaluated.

SK 286518-6

Effect of Caerulein and rPH.2 administration

Infusion of caerulein alone 5 pg / kg-h for 3.5 hours induced a typical mild induced pancreatitis, characterized by hyperamylase, pancreatic edema measured by pancreatic water content, and histological changes including marked vacuolization and pancreatic edema. Saline infusion did not induce any of these biochemical or histological changes in control animals. Intravenous administration: rPH.2 at doses of 5, 10 or 20 mg / kg for 30 min. before the start of the infusion of caerulein, it did not significantly affect the severity of the changes in pancreatic edema (water content) and the histological finding induced by infusion of caerulein alone. Also, administration of rPH.2 did not affect caerulein-induced pancreatic trypsinogen activation or amylase content.

Infusion of higher doses of caerulein, 10 pg / kg / h for 5 hours, induced severe pancreatitis in rats and characterized by a marked increase in serum amylase activity, pancreatic edema development, a strong increase in MPO pancreatic activity and a significant increase in trypsinogen activation and pancreatic amylase activity. Pancreas histology revealed not only pancreatic edema and vacuolization of alcinam cells, but also several necrotic spots and several infiltrated cells.

Administration of rPH.2 (5 or 10 mg / kg intravenously) 30 min. prior to the start of caerulein infusion (10 pg / kg / h), improved most of the pancreatic changes induced by caerulein infusion alone. The results are presented in Table 10 below. Treatment with rPH.2 at 5 mg / kg resulted in a decrease in serum amylase activity (from 1098 ± 1412 to 6763 ± 1256). Higher doses of 10 mg / kg rPH.2 no longer induced an improvement in hyperamylasia. Treatment with rPH.2 at 5 or 10 mg / kg also resulted in a reduction in the incidence of caerulein-induced pancreatic edema measured by water content (90.61 ± 0.27 for caerulein alone and 88.21 ± 0.61 for 5 mg caerulein) / kg rPH.2). rPH.2 at 5 mg / kg induced a strong improvement in pancreatic NPO activity (2.92 ± 0.32-fold for caerulein alone and 1.19 ± 0.21 for caerulein together with rPH.2, p <0.05) . Higher doses of rPH.2 did not elicit any further improvement in MPO activity. Also, the dose of rPH.2 did not significantly alter the extent of trypsinogen activation or amylase content in the pancreas. After rPH.2 pretreatment, histological analysis revealed an improvement in pancreatic microscopic necrosis and infiltration.

Pancreatitis-related lung injury has been observed both clinically and in several pancraetitis models. Infusion of caerulein at a dose of 5 µg / kg / h for 3.5 h, which induces a mild form of pancreatitis, did not result in significant lung involvement. However, infusion of caerulein at a dose of 10 pg / kg / h for 5 h, which induced severe pancreatitis, caused lung damage quantifiable by increased vascular lung permeability (0.31 ± 0.04 to 0.79 ± 0.09), MPO activity in the lungs (corresponding to neutrophil staining) and neutreifil infiltration.

Administration of rPH.2 at 5 mg / kg 30 min. prior to caerulein infusion, significantly improved MPO activity in the lung induced by infusion of caerulein alone (3.55 ± 0.93 for caerulein alone and 1.51 ± 0.26 for caerulein with rPH.2). Treatment with rPH.2 significantly reduced the severity of the microscopic changes observed in lung tissue after infusion of caerulein. The increased vascular permeability induced by infusion of caerulein was reduced by administration of rPH.2, but the difference was not statistically significant. A higher dose of rPH.2 (10 mg / kg) did not reduce caerulein-induced lung damage more than the lower doses.

Table 10

Control (no CER) caeruleininduced (CER) 10 µg / kg / hr CER + 5 mg / kg rPH.2 CER ± 10 mg / kg rPH.2 serum amylase (U / I) 961 ± 174 10984 ± 1412 6763 ± 1256 8576 ± 1024 water content in pancreas (% wet weight) 72.71 ± 0.64 90.61 ± 0.27 88.21 ± 0.61 89.00 ± 0.94 pancreatic MIT (multiples of control) 1.0 2.92 = 0.32 1.19 ± 0.21 1.42 ± 0.19 pancreatic trypsin activity (100x inclination / pg DNA) 0.12 ± 0.06 9.70 = 2.50 8.33 ± 1.75 9.15 ± 1.28 pancreatic amylase content (tl / µg DNA) 0.28 ± 0.06 0.42 ± 0.07 0.45 + 0.04 0.46 ± 0.044 vascular lung permeability (lavage / serum%) 0.31 ± 0.04 0.79 = 0.09 0.70 ± 0.09 0.70 ± 0.07 MPO of lungs (multiples of control) 1.0 3.55 ± 0.93 1.51 ± 0.26 1.64 ± 0.22

B. Activity in the opossum pancreatitis model

Healthy, randomly captured American Opossums (Didelphis virginiana) of both sexes (2.0 kg to 4.0 kg) were obtained from Scott-Haas and housed in a controlled atmosphere of 23 ± 2 ° C, a 12 hour light / dark cycle and fed standard laboratory feed and water ad libitum. After fasting overnight, the animals were anesthetized with 50 mg / kg sodium phenobarbital i.p. (Veterinary Laboratories Inc., Lenexa, KS). Celiotomy was performed by means of a central incision under sterile conditions and the channel common to the bile and pancreas was ligated to induce necrotic pancreatitis. In addition, the cystic duct was ligated so that the gallbladder could not function as a bile reservoir. Animals were randomly assigned to kon38

286 trolling and experimental groups. Beginning on the second day after pancreatic canal ligation, the experimental group received rPH.2 at 5 mg / kg body weight per day (4 mg / ml solution) intravenously into the tail vein, while the control group received intravenous placebo in the same volume. . After 1 and 2 days of treatment (days 3 and 4 after ligation of the pancreatic duct), the animals were sacrificed by an overdose of sodium phenobarbital. Blood samples were collected from the heart to determine serum amylase, serum lipase, and bilirubin serum, and pancreas were harvested. Portions of the pancreas were either fixed in 4% phosphate formaldehyde buffer for histological observation or immediately frozen at -80 ° C to determine myeloperoxidase activity. Other portions of the pancreas were used to determine the water content and pancreatic amylase content as described in section A of this example. Myeloperoxidase activity, a measure of neutrophil staining, was determined in the pancreas as described. Pulmonary vascular permeability was also determined by this method.

The results presented represent the mean ± mean error (SEM) obtained from three or more experiments. The significance of the changes was evaluated by Student's t-test for data arranged in two groups and Variance Analysis (ANOVA) when three groups or more were compared. If ANOVA indicated a significant difference, the data were analyzed by Turkey as a post hoc test for group differences. The difference was considered significant if p <0.05.

The results are shown in Table 11. Congestion of the common biliopancreatic duct resulted in severe necrotic pancreatitis, characterized by hyperamylase, hyperlipasemia, and extensive pancreatic necrosis. In addition, clogging of the common blolopancratic duct resulted in a strong increase in serum bilirubin values. Intravenous administration of rPH.2 (5 mg / kg / day) beginning the second day after pancreatic duct ligation, improved most of the pancreatic changes induced by duct clogging and compared to placebo-treated animals. One-day rPH.2 treatment reduced serum amylase levels compared to control animals, although the difference was not statistically significant and two-day application of rPH.2 (day 4 after pancreatic duct ligation) significantly reduced amylase levels compared to placebo. One-day and two-day rPH.2 treatment reduced serum lipase levels to the control level, but the difference was not statistically significant. A two-day application of rPH.2 reduced pancreatic amylase content to control levels, but a one-day application increased pancreatic amylase. Treatment with rPH.2 did not affect serum bilirubin levels, pancreatic myeloperoxidase activity, or pancreatic water content.

The main characteristic changes induced by obstruction of the biliopancreatic canal were necrosis, inflamed cell infiltration, acolytic cell vacuolization, and marked expansion of the acin lumens. Morphometric observation of damaged pancreatic acin cells showed a strong protective effect of rPH.2 on a day or two advance treatment. At rPH.2 day treatment, acinic cell damage was reduced to 23% of total acineal tissue, compared to 48% of placebo-injured animal tissue. This decrease in wounded cells was even more evident after two days of rPH.2 administration, when the damaged cells decreased to 35% compared to 60% in placebo-treated animals.

Vascular lung permeability, quantified by injection of FITC, in the rPH.2 treated group, was significantly different from the placebo group for one-day and two-day administration. Histological observations showed severe lung injury in all placebo-treated groups. Lung damage was characterized by an extensive inflammatory response with interstitial and intraalveolar infiltration primarily by macrophages, lymphocytes and neutrophils, and irregular but marked interstitial edema and thickening of alveolar membranes. Administration of rPH.2 significantly reduced inflammatory cell infiltration and decreased interstitial edema at both application times.

The summary of these results clearly shows that intravenous administration of 5 mg / kg / day rPH.2 starting 48 hours after pancreatic duct ligation resulted in a significant reduction in elevated amylase and lipase levels and acinoma cell damage quantified by morphometric analysis of H & E stained sections there was a significant decrease in the severity of pancreatitis-induced lung injury. In this clinically appropriate model of pancreatitis, the rPAF-AH product showed a beneficial effect in reducing the severity of pancreatitis.

Table 11

After one treatment (day 3) After two days of treatment (day 4 sacrifice) placebo rPH.2 5 mg / kg placebo rPH.2 5 mg / kg bilirubin serum (mg / dl) 5.49 ± 0.96 7.10 ± 0.60 6.54 ± 0.55 4.91 ± 0.79 serum amylase (U / l) 5618 ± 899 4288 ± 675 6538 ± 1355 3106 ± 467 serum lipase (U / l) 2226 ± 554 1241 ± 263 1424 ± 257 1023 ± 295 pancreas water content (%) 81.10 ± 0.56 i 81.52 ± 0.79 80.05 ± 1.07 79.32 ± 0.49 pancreatic MPO 1345 ± 286 1142 ± 83 1149 ± 232 1033 ± 130

SK 286518-6

After one treatment (day 3) After two days of treatment (day 4 sacrifice) placebo rPH.2 5 mg / kg placebo rPH.2 5 mg / kg (OD / dry matter fraction) panreactic amylase (U / pg DNA) 706 ± 92 1101 ± 105 950 ± 85 712 ± 131 vascular lung permeability (FITC lavage / serum%) 0.76 ± 0.09 0.21 ± 0.04 ** 0.57 ± 0.13 0.23 ± 0.04 * damaged acineal cells (% of total acineal tissue) 48 23 60 35

* p - 0.02 versus placebo ** p <0.001 versus placebo

Example 20

A study was conducted to evaluate the effect of PAF-AH product, rPH.2, on the neurotoxicity associated with HIV infection. Infection of the central nervous system HIV-1 (human immunodeficiency drugs irus, type 1) causes neuronal loss by apoptosis. When monocytes infected with HIV-1 are activated by various antigenic stimuli, including contact with nerve cells, they secrete high levels of neurotoxic cytokines, including inflammatory PAF.

The effect of rPH.2 on the neurotoxicity of conditioned media from HIV infected memocytes was studied.

Monocytes were infected with HIV and activated as described below. Monocytes were obtained from peripheral bone marrow cells (PBMCs) of HIV and hepatitis B seronegative donors after leukophoresis and purified (> 98%) by centrifugation (Countercurrent centrifugal eluriation) as described by Genis et al., J. Exp. Med., 176: 1703-1718 (1992). Cells were cultured (1 x 10 ⁴ cells / ml in T-75 flasks) in DMEM / Sigma. St. Louis, MO) with recombinant human macrophage colony stimulating factor (MSCF) (Genetic Institute, Inc. Cambridge, MA). Under these conditions, monocytes differentiated into macrophages. After 7-10 days of culture, macrophages were exposed to HIV-1ADA (under number M60472) in excess of an infectious agent of infection (MOI) of 0.01 infectious virions / target cell. Under these conditions, 20-50% of the monocytes were infected 7 days after HIV-1 inoculation, as confirmed by immunofluorescence methods and in situ hybridization [Kalter et al., J. Immunol., 146, 298-306 (1991)]. The cultures were supplemented with fresh nutrient medium every 2-3 days. Five to seven days after HIV infection, at the time of culmination of reverse transcriptase activity (10 ⁷ cpm / ml) determined by Kalter et al., See above, cultures of monocytes were both HIV-1 infected and parallel cultures of uninfected monocytes. stimulated with LPS (10 ng / ml) or the transfer agent alone for 30 min, at 37 ° C and then rapidly frozen to -80 ° C and stored until neurotoxicity testing.

Cultures of human cerebral cortical neuronal cells were derived according to the following procedure. Human fetal brain tissue was obtained from telencephalon in the second trimester (13-16 weeks of gestation) by the modified procedure of Banker and Cowan, Brain Res., 136: 397-425 (1977). Brief description of the method: brain tissue was collected, washed with 30 ml of cold Hank's BSS medium (containing Ca ²⁺ and Mg ²⁺ + 25 mM HEPES and 5X gentamicin), separated from adherent meninges and blood and cut into 2 mm 'pieces. The tissue was passed through a 230μΜ Nitex bag and gently passed through a flame-burnt Pasteur pipette 10-15 times. Next, the tissue was centrifuged at 550 rpm, 5 min, 4 ° C and the pellet was resuspended in 5-10 ml MEM-hipp (D-glucose, 5 g / L; L-glutamine, 2mM; HEPES, 10mM; AN pyruvate, 1mM; KCl, 20mM) containing N1 components (insulin, 5mg / ml; transferrin, 5mg / ml; selenite, 5µg / l, progesterone, 20nM; putrescln, 100µΜ) as well as 10% fetal serum (FCS) PSN mixture of antibiotics (penicillin, 50 mg / l; streptomycin 50 mg / l; neomycin 100 mg / l) and fungisone (2.5 g / l). Cell number and cell viability were determined by dilution with Hanks BSS containing 0.4% tryptophan blue (1: 1 v / v) and cells were counted using a hemocytometer. The cells were washed five times with a 10 ml pipette and seeded at a dilution equivalent to a density of 10 5 cells / 12 mm coverslips that had been pre-coated with poly-L-lysine (70K-150K MW, Sigma, St. Louis, MO) and placed in the cells. 24-well culture plates. 1 ml of medium was then added to each culture well. Cells were incubated and cultured for 10-28 days at 370 ° C in a humidified 5% CO ₂ /95% air incubator. Medium was changed every three days. Under these conditions, the cultures were> 60-70% homogeneous for neurons, further the culture contained 20-30% of star cells, <1% of microglia and about 10% of macrophages and stainable microglia. After 14 to 28 days of culture, the neuronal culture expressed a sufficient amount of N-methyl-D-aspartate (NMDA) or non-NMDA receptors were killed after administration of excitotoxic doses of NMDA or alphaamino-3-hydroxy-5-methyl-4-isoxazole propionic acid ( AMPA).

The neurotoxicity test was performed as follows. Test samples, including (a) conditioned media from LPS-stimulated H1V-1 infected monocytes, (b) control media, (c) conditioned media added with rPH.2 at a concentration of 51 pg / ml, or (d) conditioned media with added carrier for rPH.2, were applied to neuronal culture cells at 1: 10 v / v for 24 hours. Neurotoxicity was measured by identifying apoptotic nuclei in situ on neurons growing on coverslips that were fixed with 4% formaldehyde. For this assay, a commercial kit (Apop Tag; ONCOR, Gaithersburg, MO) was used that used terminal deoxynucleotidyltransferase (TdT) to bind digoxigenin-dUPT to the 3'-OH end of newly digested DNA (TUNEL staining). Digital processing of TUNEL-stained neuron images in more than 15 randomly selected microscopic fields was analyzed for the number of TUNEL-stained nuclei / total number of neurons detected in 50 microscopic fields using computer morphometry (MCID, Imaging Research, St. Catherine, Ontario, Canada) .

Data were expressed as% of TUNEL + SEM positive neuron nuclei and are shown in Figure 13. Statistical evidence tests between control and experimental treatment were performed by ANOVA or paired t-tests, with p <0.05. Quantification of these cultures confirmed that conditioned media from HIV-infected and activated monocytes induced neuronal cell death of 25% of the total cerebral coronary neuron population. rPH.2 was able to reduce this toxicity to less than 5% of the total number of neurons. rPH.2 itself was not neurotoxic because at a concentration of 50 µg / ml rPH.2 had no effect on neuronal cell death compared to culture treated with control medium. These results clearly demonstrated that PAF must be the major neurotoxicity-inducing component of HIV-1 infected infected monocyte-infected cells, since neurotoxicity can be almost completely suppressed by co-incubation with PAF-AH, the enzyme responsible for PAF metabolism in the central nervous system. These findings add to possible therapeutic use in the treatment of neurological CNS diseases that are associated with HIV-1 infection.

Example 21

Almost 4 percent of the Japanese population has low or even undetectable levels of PAF-AH activity in plasma. This deficiency correlates with severe respiratory symptoms in children with asthma. Miwa et al. (J. Clin. Invest., 82: 1983-1991 (1988)) have pointed out that these conditions may be due to deficiency inherited in an autosomal recessive manner.

To determine whether this deficiency originates from an inactive but present enzyme, whether it is due to the impossibility of PAF-AH synthesis, plasma was collected from many patients deficient in PAF-AH activity (using the method described in Example 10 for transfectants) and further tested presence of PAF-AH by monoclonal antibodies 90G11D (Example 13) by ELISA method described below: Immunolon 4 flat bottom microtiter plates (Dynatech, Chantilly, VA) were coated with monoclonal antibody 90G1 ID at 100 ng / well and allowed to incubate until morning. . The wells were then blocked for 1 hour at room temperature with 0.5% fish skin gelatin (Sigma) diluted in CMF-PBS. Next, the wells were washed four times. Patient plasma was diluted in PBS containing 15mM CHAPS and added to each well of the plate (50 pVwell). Plates were incubated for 1 hour at room temperature and then washed four times. This was followed by the addition of 5 μΐ of monoclonal antibody 90F2D at a concentration of 5 μg / ml, which was blotiny by standard method and diluted in PBST to each well. The plate was incubated for 1 hour at room temperature and then washed three times. This was followed by the addition of 50 μΐ of Extra Avidin (Sigma) diluted 1: 1000 in CMT-PBST to each well, and the plate was again incubated for 1 hour at room temperature. This was followed by induction of activity.

Direct correlations were found between PAF-AH activity and enzyme concentration. If there was no activity in the patient's serum, this was always accompanied by the inability to delegate the presence of the enzyme. Similarly, plasma samples exhibiting half the normal activity value contained half the normal level of PAF-AH. These findings confirm that the deficiency in PAF-AH activity is due to the inability to synthesize the enzyme or due to the fact that monoclonal antibodies do not recognize an inactive form of the enzyme.

Further attempts have been made to determine whether the deficiency is due to a genetic disorder in the human plasma PAF-AH gene. Genomic DNA from PAF-AH deficient individuals was isolated and used as a template for PCR reactions with primers specific for the PAF-AH gene. Each of the exon coding sequences was first amplified and sequenced from one individual. Exon 9 revealed a single nucleotide swap (G to T at position 996 of SEQ ID NO: 7). The nucleotide change resulted in the amino acid substitution of phenylalanine for valine at position 279 of the sequence PAF-AH (V279F). Exon 9 was amplified from genomic DNA by a further 11 PAF-AH deficient patients in whom the same point mutation was found.

To determine whether this mutation altered the enzyme, a construct with this mutation showing no PAF-AH activity was expressed in E. coli, whereas the control construct that did not contain the mutation was fully active. Replacement of this amino acid is likely to result in structural modifications that result in an observed activity deficiency as well as inability to immunoreactivity with PAF-AH antibodies generated according to the invention.

Thus, the PAF-AH specific antibodies of the invention can be used in diagnostic methods to detect abnormal serum levels of PAF-AH (normal concentrations are between 1 and 5 U / ml) and to monitor the pathological conditions associated with PAF-AH. What's more, the determination of genetic damage in the PAF-AH gene allows genetic research into PAF-AH deficiency in Japanese patients. The mutation yields a restriction endonuclease site (MAFII) and thus allows the application of a simple method, Restrition Fragment Lenght Polymorphism (RFLP), which is able to distinguish between normal and mutant alleles. (information on this application can be obtained from: Lewin, pages 136-141 in Genes V, Oxford University Press, New York (1994)).

Using the DNA II enzyme digestion method, genomic DNA was investigated from 12 patients deficient in PAF-AH, followed by a South blot and hybridization with a probe complementary to exon 9 (nucleotides 1 to 396, according to SEQ ID NO: 17). All patients were found to have RFLPs consistent with mutant alleles.

While the invention is described by terms specific to an embodiment, it will be understood, of course, that various variants and modifications may occur and will be apparent to those skilled in the art. Accordingly, only such limitations as appear in the appended claims can be considered to be within the scope of the invention.

List of sequences (1) General information:

(i) Applicant: ICOS CORPORATION (ii) Invention Name: Platelet-Activating Factor Acetylhydrolase (iii) Number of Sequences: 30 (iv) Correspondence Address:

(A) Address: Marshall, O'Toole, Gerstein, Murray & Borun (B) Street: 6300 Sears Tower, 233 South Wacker Drive (C) City: Chicago (D) Country: Illinois (E) Country: Onited States of America (F) Postcode (ZIP): 60606-6402 (v) Form suitable for computer processing:

(A) Media Type: Floppy Disk (B) Computer: IBM PC compatible (C) Operating System: PC-DOS / MS-DOS (D) Software: PatentIn Release # 1.0, Version # 1.25 (vi) Current Application Details:

(A) Application number:

(B) Registration date:

(C) Classification, (viii) Legal / Agent Information:

(A) Name: Rin-Laures, Li-Hsien (B) Registration number: 33,547 (C) References / number of court cases: 27866/34026 (ix) Telecommunication information:

(A) Telephone: (312) 474-6300 (B) Fax: (312) 474-0448 (C) Telefax: 25-3658 (2) INFORMATION ON SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULA TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu White Ala 15 10 15

Phe (2) INFORMATION ON SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULA TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEO ID NO, 2, clay Gin Val Leu Thr Lys White Pro 15 10 15 (2) INFORMATION ON SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULA TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

Met Lys For Leu Val Val Phe Val Leu Gly Gly 15 10 (2) INFORMATION ON SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (ix) CHARACTERISTICS:

(A) NAME / KEY: Modified-site (B) LOCATION: group (13, 21, 27) (C) ADDITIONAL INFORMATION: / note = "The nucleotide at each of these positions is inosine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

ACATGAATTC GGNATCYTTG NGTYTGNCCR AA 32 (2) INFORMATION ON SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

TATTTCTAGA AGTGTGGTGG AACTCGCTGG 30 (2) INFORMATION ON SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

CGATGAATTC AGCTTGCAGC AGCCATCAGT AC ³²

(2) INFORMATION ON SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1520 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: cDNA (ix) FEATURES:

(A) NAME / KEY: CDS (B) LOCATION: 162..1484 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

GCTGGTCGGA GGCTCGCAGT GCTGTCGGCG AGAAGCAGTC GGGTTTGGAG CGCTTGGGTC 60 GCGTTGGTGC GCGGTGGAAC GCGCCCAGGG ACCCCAGTTC CCGCGAGCAG CTCCGCGCCG 120 CGCCTGAGAG ACTAAGCTGA AACTGCTGCT CAGCTCCCAA ATG GTG CCA CCC 173

Met Val Pro Pro

AAA TTG CAT His GTG CTT Val Leu TTC TGC Phe Cys 10 CTC TGC GGC TGC 221 Lys 5 Leu Leu Cys Gly Cys 15 Leu Ala Val Val Tyr '20 CCT TTT GAC TGG CAA TAC ATA AAT CCT GTT GCC CAT ATG AAA TCA TCA 269 for Phe Asp Trp gin Tyr Ile same time for wall Ala His Met Lys Ser Ser 25 30 35 GCA TGG GTC AAC AAA ATA CAA GTA CTG ATG GCT GCT GCA AGC TTT GGC 317 Ala Trp wall Temporarily. Lys Ile gin wall Leu Met Ala Ala Ala Ser Phe Gly 40 45 50 CAA ACT AAA ATC CCC CGG GGA AAT GGG CCT TAT TCC GTT GGT TGT ACA 365 gin Thr Lys Ile for Arg Gly same time Gly for Tyr Ser wall Gly Cys Thr 55 60 65

GAC TTA ATG Met TTT GAT CAC ACT AAT AAG GGC ACC TTC TTG TTA Leu TAT Tyr 413 Asp Leu 70 Phe Asp His Thr 75 same time Lys Gly Thr Phe SO Leu Arg TAT CCA TCC CAA GAT AAT GAT CGC CTT GAC ACC CTT TGG ATC CCA AAT 461 Tyr for Ser gin Asp same time Asp Arg Leu Asp Thr Leu Trp Ile for same time 85 90 95 100 AAA GAA TAT TTT TGG GGT CTT AGC AAA TTT CTT GGA ACA CAC TGG CTT 509 Lys Glu Tyr Phe Trp Gly Leu Ser Lys Phe Leu Gly Thr His Trp Leu 105 110 115 ATG GGC AAC ATT TTG AGG TTA CTC TTT GGT TCA ATG ACA ACT CCT GCA 557 Met Gly same time Ile Leu Arg Leu Leu Phe Gly Ser Met Thr Thr for Ala 120 125 130 AAC TGG AAT TCC CCT CTG AGG CCT GGT GAA AAA TAT CCA CTT GTT GTT 605 same time Trp same time Ser for Leu Arg for Gly Glu Lys Tyr for Leu wall wall 135 140 145 TTT TCT CAT GGT CTT GGG GCA TTC AGG ACA CTT TAT TCT GCT ATT GGC 653 Phe Ser His Gly Leu Gly Ala Phe Arg Thr Leu Tyr Ser Ala Ile Gly 150 155 160 ATT GAC CTG GCA TCT CAT GGG TTT ATA GTT GCT GCT GTA GAA CAC AGA 701 Ile Asp Leu Ala Ser His Gly Phe Ile wall Ala Ala wall Glu His Arg 165 170 175 160

GAT AGA TCT GCA ACT TAC Tyr TAT Tyr TTC AAG GAC CAA TCT GCT GCA Ala 749 Asp Arg Ser Ala Ser 185 Ala Thr Phe 190 Lys Asp gin Ser Ala 195 GAA ATA GGG GAC AAG TCT TGG CTC TAC CTT AGA ACC CTG AAA CAA GAG 797 Glu Ile Gly Asp Lys Ser Trp Leu Tyr Leu Arg Thr Leu Lys gin Glu 200 205 210 GAG GAG ACA CAT ATA CGA AAT GAG CAG GTA CGG CAA AGA GCA AAA GAA 845 Glu Glu Thr His Ile Arg same time Glu gin wall Arg gin Arg Ala Lys Glu 215 220 225 TGT TCC CAA GCT CTC AGT CTG ATT CTT GAC ATT GAT CAT GGA AAG CCA 893 Cys Ser gin Ala Leu Ser Leu Ile Leu Asp Ile Asp His Gly Lys for 230 235 240 GTG AAG AAT GCA TTA GAT TTA AAG TTT GAT ATG GAA CAA CTG AAG GAC 941 wall Lys same time Ala Leu Asp Leu Lys Phe Asp Met Glu gin Leu Lys Asp 245 250 255 260 TCT ATT GAT AGG GAA AAA ATA GCA GTA ATT GGA CAT TCT TTT GGT GGA 989 Ser Ile Asp Arg Glu Lys Ile Ala wall Ile Gly His Ser Phe Gly Gly 265 270 275 GCA ACG GTT ATT CAG ACT CTT AGT GAA GAT CAG AGA TTC AGA TGT GGT 1037

Ala Thr Val White Gin Thr Leu Ser Glu Asp Gin Arg Phe Arg Cys Gly

280 285 290

ATT GCC CTG GAT GCA TGG ATG TTT Phe 300 CCA CTG GGT GAT TAT Tyr TCC Ser 1085 Ile Ala Leu 295 Asp Ala Trp Met for Leu Gly Asp Glu 305 wall AGA ATT CCT CAG CCC CTC TTT TTT ATC AAC TCT GAA TAT TTC CAA TAT 1133 Arg Ile for gin for Leu Phe Phe Ile same time Ser Glu Tyr Phe gin Tyr 310 315 320 CCT GCT AAT ATC ATA AAA ATG AAA AAA TGC TAC TCA CCT GAT AAA GAA 1181 for Ala same time Ile Ile Lys Met Lys Lys Cys Tyr Ser for Asp Lys Glu 325 330 335 340 AGA AAG ATG ATT ACA ATC AGG GGT TCA GTC CAC CAG AAT TTT GCT GAC 1229 Arg Lys Met Ile Thr Ile Arg Gly Ser wall His gin same time Phe Ala ' Asp 345 350 355 TTC ACT TTT GCA ACT GGC AAA ATA ATT GGA CAC ATG CTC AAA TTA AAG 1277 Phe Thr Phe Ala Thr Gly Lys Ile Ile Gly His Met Leu Lys Leu Lys 360 365 370 GGA GAC ATA GAT TCA AAT GTA GCT ATT GAT CTT AGC AAC AAA GCT TCA 1325 Gly Asp Ile Asp Ser same time wall Ala Ile Asp Leu Ser same time Lys Ala Ser 375 380 385 TTA GCA TTC TTA CAA AAG CAT TTA GGA CTT CAT AAA GAT TTT GAT CAG 1373 Leu Ala Phe Leu gin Lys His Leu Gly Leu His Lys Asp Phe Asp gin 390 395 400 TGG GAC TGC TTG ATT GAA GGA GAT GAT GAG AAT CTT ATT CCA GGG ACC 1421 Trp Asp Cys Leu Ile Glu Gly Asp Asp Glu same time Leu Ile for Gly Thr 405 410 415 420 AAC ATT AAC ACA ACC AAT CAA CAC ATC ATG TTA CAG AAC TCT TCA GGA 1469 same time Ile same time Thr Thr same time gin His Ile Met Leu gin same time Ser Ser Gly 425 430 435

ATA GAG AAA TAC AAT TAGGATTAAA ATAGGTTTTT TAAAAAAAAA ΑΑΑΑΆΑ ile Glu Lys Tyr

440

1520

(2) INFORMATION ON SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 441 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULA TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

Met Val Pro Pro Lys Leu His wall Leu Phe Cys Leu 1 5 10 15 Ala wall wall Tyr for Phe Asp Trp gin Tyr Ile same time for wall Ala His 20 25 30 Met Lys Ser Ser Ala Trp wall same time Lys Ile gin wall Leu Met Ala Ala 35 40 45 Ala Ser Phe Gly gin Thr Lys Ile for Arg Gly same time Gly for Tyr Ser 50 55 60 wall Gly Cys Thr Asp Leu Met Phe Asp His Thr same time Lys Gly Thr Phe 65 70 75 80

Leu Arg Leu Tyr Tyr for Ser Gin Asp Asn Asp Arg 90 Leu Asp Thr 95 Leu 85 Trp Ile for same time Lys Glu Tyr Phe Trp Gly Leu Ser Lys Phe Leu Gly 100 105 110 Thr His Trp Leu Met Gly same time Ile Leu Arg Leu Leu Phe Gly Ser Met 115 120 125 Thr Thr for Ala same time Trp same time Ser for Leu Arg for Gly Glu Lys Tyr 130 135 140 for Leu wall wall Phe Ser His Gly Leu Gly Ala Phe Arg Thr Leu Tyr 145 150 155 160 Ser Ala Ile Gly Ile Asp Leu Ala Ser His Gly Phe Ile wall Ala Ala 165 170 17 5 wall Glu His Arg Asp Arg Ser Ala Ser Ala Thr Tyr Tyr Phe Lys Asp 180 185 190 gin Ser Ala Ala Glu Ile Gly Asp Lys Ser Trp Leu Tyr Leu Arg Thr 195 200 205 Leu Lys gin Glu Glu Glu Thr His Ile Arg same time Glu gin wall Arg gin 210 215 220 Arg Ala Lys Glu Cys Ser gin Ala Leu Ser Leu Ile Leu Asp Ile Asp 225 230 235 240 His Gly Lys for wall Lys same time Ala Leu Asp Leu Lys Phe Asp Met Glu 245 250 255 gin Leu Lys Asp Ser Ile Asp Arg Glu Lys Ile Ala wall Ile Gly His 260 265 270

Ser Phe Gly 275 Gly Ala Thr Val Gin Thr Leu Ser Glu Asp gin Arg 280 285 Phe Arg Cys Gly Ile Ala Leu Asp Ala Trp Met Phe for Leu Gly Asp 290 295 300 Glu wall Tyr Ser Arg Ile for gin for Leu Phe Phe Ile same time sera Glu 305 310 315 320 Tyr Phe gin Tyr for Ala same time Ile Ile Lys Met Lys Lys Cys Tyr Ser 325 330 335 for Asp Lys Glu Arg Lys Met Ile Thr Ile Arg Gly Ser wall His gin 340 345 350 same time Phe Ala Asp Phe Thr Phe Ala Thr Gly Lys Ile Ile Gly His Met 355 360 365 Leu Lys Leu Lys Gly Asp Ile Asp Ser same time wall Ala Ile Asp Leu Ser 370 375 380 same time Lys Ala Ser Leu Ala Phe Leu gin Lys His Leu Gly Leu His Lys 385 390 395 400

Asp Phe Asp gin Trp Asp Cys Leu Ile Glu Gly Asp Asp Glu same time Leu 405 410 415 Ile for Gly Thr same time Ile same time Thr Thr same time Gin His White Met Leu gin 420 425 430 same time Ser Ser Gly Ile Glu Lys Tyr same time 435 440

(2) INFORMATION ON SEQ ID NO: 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1123 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: Not determined (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

AAATATAAAT TTTAATAACA CCACACATAA ATTTCAAACT ACTTTCCCTA AGTTTCTAGC 60 TGAAGTTTTA ÄATGAGTGTG TTTTTAATTT ATTAGAAAGT GGATTGAAGA GAAAACATTG 120 GAAGATGAAG GAAGGCGTTT CAGTTAAACC CCAAATAACT CTGTGTTACA CTGAGCTATG 180 AAACGGCTCC TTCTAGCTCC ATTTCTCCTC AGACCTAAGT GCTATTCCTG ATTGTCCTTC 240 ATTGTCATTT CCAGGGAGAA ATGACACCAG CACAGTGGCA GGCCTTCCAA TCTGGAGCAC 300 GGTCCACACA ACTTCCGAAT TGGTGTTCAG TGTAAAGTGT ATCGGAGTGC GGAAAATGCG 360 CAGGGCATTG CCAACTATAG ATGCTCGGAG TAATTCAGTG TATTCAGAGA ACACGGTGAA 420

ACAAGGAAAA CCGGCCTGAC TGGGGGGTGA ATTCAGCAGG GAGTAAATCT GATCGGCATC 480 AGGTCTGCGG AAAGGAGCTG GTGAGCACGA CACCACCAGG CATTGCCTGG CTCTCTCCGC 540 GGCGGGCTAA GTTAACCTCG GGTCCAGGTG CGGGCCATGG TCTTGGGGAG GGTGCTGGGT 600 GCGCTCGAGC AGGCTACGTC GGGAGCCGCC GCTGCTAGTG AGAGCCGGGC CACACACGCT. 660 CCTCCCCGGT ACCTCCTCCA GCATCACCAG GGGAGGAGAG GGTCGGGCAC AAGGCGCGCT 720 AGGCGGACCC AGACACAGCC GCGCGCAGCC CACCCGCCCG CCGCCTGCCA GAGCTGCTCG 780 GCCCGCAGCC AGGGGGACAG CGGCTGGTCG GAGGCTCGCA GTGCTGTCGG CGAGAAGCAG 840 TCGGGTTTGG AGCGCTTGGG TCGCGTTGGT GCGCGGTGGA ACCCCCCAGG GACCCCAGTT 900 CCCGCGAGCA GCTCCGCGCC GCGCCTGAGT GAGGAGGGGC CCCGGGGGCG AGGCGGGAGT 960 GGGAGGAAGG GCACGGTCGC CGCGCTGGAG GTCGGGACCC CGGAGCGGCG ACCGGCCGGG 1020 GTGGGCTCGC TGAGTCGCAC CCGCTCTGCT GGCCGGTCCT GGGCTCACAG TCCCTGCAGC 1080 CCTCGGAAAC AGCGCTAGGA TCCTTCGGGA GAGGAGAGAT GAC 1123

(2) INFORMATION ON SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 417 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 145..287 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

GTACCAATCT AAAACCCAGC ACAGAAAAAT ACATGTTTTA TTTTTTCCAA GTGTTACTAG 60 TACCTCAGCC TTTCTTGATT TGTCAGCTTA TTTAAGGCCT CTTCATTGCA TACTTCTTTT 120 TTCTTTTAAT CATCTGCTTC GAAGGAGACT AAGCTGAAAC TGCTGCTCAG CTCCCAAGAT 180 GGTGCCACCC AAATTGCATG TGCTTTTCTG CCTCTGCGGC TGCCTGGCTG TGGTTTATCC 240 TTTTGACTGG CAATACATAA ATCCTGTTGC CCATATGAAA TCATCAGGTA AGAGGTGTAT 300 TTGTTCAAGG TCTTGAGCAA CTGATCTGTC GCCATACTTC AAGTGGGCCC CAAGAAGTTG 360 CACATCTGCA CATCTAAACA AGTCCTATTT AAAGGCTTAT GGAGATCCTG TATTCTC 417

(2) INFORMATION ON SEQ ID NO: 11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 498 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 251..372 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

CATTAGGAGG TAACAGTCCA AGGCAGCTGA GAGAAAGGCT ATGTCTACTT TCATCTCTTT60

ACCCTCCAAA ACCCCTACAC AGTGTTTCAA ACAGAGAGAC CCTCAATAAT TGCATATCTT120

ACTTGTTAGG TTGAGAAAGA AAGAAGGCCA GAAACTATGG GAAGTAACTT GATTCCGTTG180

GAATTCTTTT GCATAATAAA ATCTGATATG TAATGGATGA CAAATGAGAT AATATTTACC240

TGTTTTTCAG CATGGGTCAA CAAAATACAA GTACTGATGG CTGCTGCAAC GTTTGGCCAA300

ACTAAAATCC CCCGGGGAAA TGGGCCTTAT TCCGTTGGTT GTACAGACTT AATGTTTGAT360

CACACTAATA AGGTAATGCT TTGATTTATA CAACTTATCC TGATACTCTA ATATTGTCTG420

TCGCTATGGA CCACTAGAAG GTGTTCAAAT GTGACCTTGC CCTCACCTGA GAATGACTCA480

TTTTCGAATT TGTATTGT498 (2) INFORMATION ON SEQ ID NO: 12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 433 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 130..274 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

CAGCAGCCTA AAGTCTTAGA CTTTGTGAAC ACAGAGGTAT TGAGTCCCAC ΤΆΆΤΤΑΑΤΑΤ 60 CGAAAATAGC TGCTGGAATA TGTTTGAGAC ACAACTTCTC TAAAAGTGCA TTAATTTCTT 120 TCTTAACAGG GCACCTTCTT GCGTTTATAT TATCCATCCC AAGATAATGA TCACCTTGAC 180 ACCCTTTGGA TCCCAAATAA AGAATATTTT TGGGGTCTTA GCAAATTTCT TGGAACACAC 240 TGGCTTATGG GCAACATTTT GAGGTTACTC TTTGGTAAGA TTTCTGTTGA TCCTTCTTTG 300 TAGGCTCTTG CATGTATGAA AACCTTGAAA ACAACAAGAA CTTCAAGTAG TTAAGACCAA 360 AGTAGATTTT TCTTCAGTCC AAATAGCTCC TAAAATGATA AGGAAAGTAT TTCTTTAAAG 420 CCCAGGCAAC TAC 433

(2) INFORMATION ON SEQ ID NO: 13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 486 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 164..257 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

TTGGTGGGTA TCTAGTAGCA GTCTTTTTAA TGAATCTACT ATTCATCCAT AAAAAAGTAG

ATATAAATCA GATGGGTCTG CATTTTATGC TAATGAGATA TGAATTAAAT TCACTAGCAA

120

SK 286518-6

CACTCAGAGA AAACCTTAAC TATAACCTTC CATTGTTGTC TAGGTTCAAT GACAACTCCT 18 0 GCAAACTGGA ATTCCCCTCT GAGGCCTGGT GAAAAATATC CACTTGTTGT TTTTTCTCAT 240 GGTCTTGGGG CATTCAGGTA ATGTTTGAGA GGTTGAACAA TTTTGGCTTC CAGGAATAAA 300 TGACAATTTT TTTATTCAAG AAAGAAATAG CAGAGTTTGG AATGTCATGC AGGCCCTTGT 360 CTGGAGGAGT TGGGGTTCCT CAATAATTGG CTGTGGGTCT ATTGATCAGT CCTAGACCTG 420 TCTGGTCAAG TAGTTTTTTC CCTACTATCA GCTCATTGGG ATTAGCCTCA CAGCAGAGAA 480 GAAAGG 4 86 (2) INFORMATION About SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 363 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) 10 (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 113..181 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

CCCCAGGCTC TACTACAGGG TGTAATGGCC TCCATGTTCC CAGTTTTATT AGTGACTCAG 60 CCTTGTAATT CATGACTGGT AGTTGTAATT CTTCCCTCTT TTTGTTTTGA AGGACACTTT 120 ATTCTGCTAT TGGCATTGAC CTGGCATCTC ATGGGTTTAT AGTTGCTGCT GTAGAACACA 180 GGTATGTTAC CTGATATAAT TGGGCTCTTT GGCCAACTAC AGGGAATGTC AATGCTCATA 240 ACTATGTTTC TAATTTTCAT AAAAGTTTAT TTAAAATGTT GATGGAACTT TCAAGTATGG 300 TAACATCATG AGCAAAAAAG GAGATTGAGT TTTATCGACT TAAAAGACTT AAAAGCACCT 360 AAC 363 (2) INFORMATION ABOUT SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 441 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 68..191 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

GAACTGAGAA ACATGGTCAG ATGAGGAAGG GAAGGAGCAT

GCATAAATAA TTTTGCTTGT

ATTATAGAGA TAGATCTGCA TCTGCAACTT ACTATTTCAA GGACCAATCT

GCTGCAGAAA

120

TAGGGGACAA GTCTTGGCTC TACCTTAGAA

CCCTGAAACA AGAGGAGGAG ACACATATAC

180

GAAATGAGCA GGTACATTGC AGTGAAAGGA

GAGGTGGTTG GTGACCTAAA AGCATGTACA

240

AAAGGATGAC ATTTGTTAAT TTAATTTTAC ACCTGGCAAG TTATGCTCCT AGCTCTCCTA 300 TTTCCCATTC CCAAAAGATC TGTCAATAGA TTCCTGGAGC AGTAAAATTC CCTTAATGGA 360 ATATCTAGTT CATAGTAAAA ACAAAGGCAA ATACAAAAAT TTGGGAGATG ACAGTGAATA 420 TTCAGAATTC CTCGAGCCGG G 441

(2) INFORMATION ON SEQ ID NO: 16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 577 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (genomic) (ix) FEATURES: _ (A) NAME / KEY : exon (B) LOCATION: 245..358 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:

GGTTAAGTAA ATCGTCTGAA GTCACATAGT AGGTAAGGCA AAACAGAGCC AGGATTTGGA 60 CTAAGGCTAT ACCTATGTGC AÄAGCTGGGG CCTGTGTCAT TATGGTAGCA AGTAATAGTC 120 ACTAATCAGA TTTCCAGTTT ATAACTGACC AACGATTTTT CCCAAATACA GCTTCTACCT 180 AAACTTTAAA ATAAGTGTTA TAACTTTTTA CTTTGTCATT TCCTTCTTCT AATAATTATA 240 TTAGGTACGG CAAAGAGCAA AAGAATGTTC CCAAGCTCTC AGTCTGATTC TTGACATTGA 300 TCATGGAAAG CCAGTGAAGA ATGCATTAGA TTTAAAGTTT gatatggaac AACTGAAGGT 360 AAGCTATAAA AAGTAATTTT TCTCTTGTCC TACAGTTCTT TATTGTTTTT TGTCATTTAA 420 TTTTCTGCCT ATATTGCAAG GTACAATATG ATAAAGGGCT GCAACCAGCC CCTCCCCAAT 480 gcgcacacac AGACACACAA AGCAGTACAG GTAAAGTATT GCAGCAATGA AGAATGCATT 540 ATCTTGGACT AGATATGAAT GCAAAGTTAG TCAGTTT 577

(2) INFORMATION ON SEQ ID NO: 17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 396 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION, 108..199 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:

ATCAATGTAT TTACCATCCC CATGAAATGA ACAATTATAT GATTGACAAA TCATTTCTTC 60 TAACACCACG AAATAGCTAT AAATTTATAT CATGCTTTTT CAAATAGGAC TCTATTGATA 120 GGGAAAAAAT AGCAGTAATT GGACATTCTT TTGGTGGAGC AACGGTTATT CAGACTCTTA 1B0 GTGAAGATCA GAGATTCAGG TAAGAAAATA AGATAGTAAA GCAAGAGAAT AGTAÄATTAT 240 TGGAAGAAAT TATATTGTGA GATATAATTT TTATTCAAAT TCTTAGTGAA GGAAGGGGAT 300

SK 286518-6

CTCTTGGAGT TTATAAGGCT ATTCTTTTGC CCCCATAAAA TACTCTATAT ACATTTTCCT

AGGCTAAAAC ATCTCCTCTC CTGCTATTAA AATCTC

360

396 (2) INFORMATION ON SEQ ID NO: 18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 519 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 181..351 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:

CTTACAAAGT TAATCATATC CCTTTCCCAC ATTGAAGTAT GATACCTCTT TATTCCAATC 60 AGATAACCCA TAATAAACTG GTATGGTGCG TGTCCACCAA TCCTAGCATT ATTAGGATGT 120 CCTCAATGTT GGCTAGTATG TAACCAGTTT aatttcatca TTGTCAACAA ATATCTACAG 180 ATGTGGTATT GCCCTGGATG CATGGATGTT TCCACTGGGT GATGAAGTAT ATTCCAGAAT 240 TCCTCAGCCC CTCTTTTTTA TCAACTCTGA ATATTTCCÄA TATCCTGCTA ATATCATAAA 300 AATGAÄÄAAA TGCTACTCAC CTGATAÄAGA AAGAAAGATG ATTACÄATCA GGTAAGTATT 360 AGTGACTTAT TTCATTATGT GAAACAAACT TGAAGCTTGG GTAAATATCA ATCGATATCA 420 TTTGGTAACT ATTAAAGAAT TGCTGAATTG GTTGTTTAGA CTTTCAATAA GGAGAGAATT 480 AGATAATCTC AGTTTCTAAG TACATTTAGT CTACTCTTT 519

(2) INFORMATION ON SEQ ID NO: 19.

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 569 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 156..304 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:

TGAAACACAT CTAAGTAGAT CAAATTACAA GTTTTATTTC TTCTTTGGTT TTCAGTAAAC 60 AGACCAACAA GACCAGTACC TTTCCTTACA CTCTAACTÄA ΆΆΑΑΑΤΑΑΤΆ ATTTTATCAA 120 ACAATGTGAC TTTTAAATGT CTTGTTCTCT TTTAGGGGTT CAGTCCACCA GAATTTTGCT 180 GACTTCACTT TTGCAACTGG CAAAATAATT GGACACATGC TCAAATTAAA GGGAGACÄTA 240 GATTCAAATG TAGCTATTGA TCTTAGCAAC AAAGCTTCAT TAGCATTCTT ACAAAAGCAT 300 TTAGGTAAGA AACTATTTTT TTCATGACCT AAACCGAGAT GAATCTCGAG GACAAAGCTG 360 TCTATCTTAA TACAGCTTTA GTACTATTTA AACTATTTCC AGTTGGTTTA CAATGGAACA 420

SK 286518-6

AAGCAGTATA TCAATTTGAA AACAGAAATT TGAGAAAGTC AATTTTGCTG CTTTACATCT 480 CTATATCATA GAAAGCAAAT CAACTGTTAA AGGTAATATT CTTTGTATGA GCTAGAGTGA 540 CTCATGTGAG GATATCGAAC GACGGTGCT 569

(2) INFORMATION ON SEQ ID NO: 20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 469 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (genomic) (ix) FEATURES:

(A) NAME / KEY: exon (B) LOCATION: 137..253 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

GATACAGAGG CACATCGTCT

CTACCATCCT AACGGAACTT GTGTAATTTG TAAATCTTTA

TTGCCACCTA GGGGCATCCA AACTGTTTAA TGCTCTCAAA AGTTTAATAT

GTTGATTAAC

120

ACTTTATATT

TTATAGGACT TCATAAAGAT TTTGATCAGT GGGACTGCTT GATTGAAGGA

180

GATGATGAGA ATCTTATTCC AGGGACCAAC ATTAACACAA CCAATCAACA

CATCATGTTA

240

CAGAACTCTT CAGGAATAGA GAAATACAAT GTTTCAAAAC TATGTGTGTG AGAGAGAGAG AGAGAGAATT TTAATGTATT

TAGGATTAAA ATAGGTTTTT TAAAAGTCTT300

TGTGTGTGTG TGTGTGTGTG AGAGAGAGAG360

TTCCCAAAGG ACTCATATTT TAAAATGTAG420

CTAAGAATTT TTTCCCTTT469 (2) INFORMATION ON SEQ ID NO: 21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1494 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: cDNA (ix) CHARACTERISTICS:

(A) NAME / KEY: CDS (B) LOCATION: 117..1436 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:

GGCACGAGCT AGGATCTGAC TCGCTCTGGT GGCATTGCTG CGCTCAGGGT TCTGGGTATC

CGGGAGTCAG TGCAGTGACC AGAACATCAA ACTGAAGCCA CTGCTCAGCT CCTAAG

116

ATG GTA CCA CTC AAA CTG CAG GCG Gin Ala CTT TTC TGC CTC Leu CTC TGC TGC Cys 15 CTC Leu 164 Met 1 wall for Leu Lys 5 Leu Leu Phe 10 Cys Leu Cys CCA TGG GTC CAT CCT TTT CAC TGG CAA GAC ACA TCT TCT TTT GAC TTC 212 for Trp wall His for Phe His Trp gin Asp Thr Ser Ser Phe Asp Phe 20 25 30 AGG CCG TCA GTA ATG TTT CAC AAG CTC CAA TCG GTG ATG TCT GCT GCC 260 Arg for Ser wall Met Phe His Lys Leu gin Ser wall Met Ser Ala Ala 35 40 45

GGC TCT GGC Gly CAT AGT AAA ATC CCC AAA GGA AAT GGA TCG TAC CCC GTC Val 308 Gly Ser 50 His Ser Lys Ile 55 for Lys Gly same time Gly 60 Ser Tyr for GGT TGT ACA GAT CTG ATG TTC GGT TAT GGG AAT GAG AGC GTC TTC GTG 356 Gly Cys Thr Asp Leu Met Phe Gly Tyr Gly same time Glu Ser wall Phe wall 65 70 75 80 CGT TTG TAC TAC CCA GCT CAA GAT CAA GGT CGC CTC GAC ACT GTT TGG 404 Arg Leu Tyr Tyr for Ala gin Asp gin Gly Arg Leu Asp Thr wall Trp 85 90 95 ATC CCA AAC AAA GAA TAT TTT TTG GGT CTT AGT ATA TTT CTT GGA ACA 452 Ile for same time Lys Glu Tyr Phe Leu Gly Leu Ser Ile Phe Leu Gly Thr 100 105 110 CCC AGT ATT GTA GGC AAT ATT TTA CAC CTC TTA TAT GGT TCT CTG ACA 500 for Ser Ile wall Gly same time Ile Leu His Leu Leu Tyr Gly Ser Leu Thr 115 120 125

ACT Thr CCT GCA AGC TGG Trp AAT same time TCT AGG ACT GGA GAA AAA TAC CCG Pro 548 for 130 Ala Ser Ser 135 for Leu Arg Thr Gly 140 Glu Lys Tyr CTC ATT GTC TTT TCT CAT GGT CTC GGA GCC TTC AGG ACG ATT TAT TCT 596 Leu Ile wall Phe Ser His Gly Leu Gly Ala Phe Arg Thr Ile Tyr Ser 145 150 155 160 GCT ATT GGC ATT GGC TTG GCA TCT AAT GGG TTT ATA GTG GCC ACT GTC 644 Ala Ile Gly Ile Gly Leu Ala Ser same time Gly Phe Ile wall Ala Thr wall 165 170 175 GAA CAC AGA GAC AGA TCT GCA TCG GCA ACT TAC TTT TTT GAA GAC CAG 692 Glu His Arg Asp Arg Ser Ala Ser Ala Thr Tyr Phe Phe Glu Asp gin 180 185 190 GTG GCT GCA AAA GTG GAA AAC AGG TCT TGG CTT TAC CTG AGA AAA GTA 740 wall Ala Ala Lys wall Glu same time Arg Ser Trp Leu Tyr Leu Arg Lys wall 195 200 205 AAA C? A GAG GAG TCG GAA AGT GTC CGG AAA GAA CAG GTT CAG CAA AGA 788 Lys gin Glu Glu Ser Glu Ser wall Arg Lys Glu gin wall gin gin Arg 210 215 220 GCA ATA GAA TGT TCC CGG GCT CTC AGT GCG ATT CTT GAC ATT GAA CAT 836 Ala Ile Glu Cys Ser Arg Ala Leu Ser Ala Ile Leu Asp Ile Glu His 225 230 235 240 GGA GAC CCA AAA GAG AAT GTA CTA GGT TCA GCT TTT GAC ATG AAA CAG 884 Gly Asp for Lys Glu same time wall Leu Gly Ser Ala Phe Asp Met Lys gin 245 250 255 CTG AAG GAT GCT ATT GAT GAG ACT AAA ATA GCT TTG ATG GGA CAT TCT 932 Leu Lys Asp Ala Ile Asp Glu Thr Lys Ile Ala Leu Met Gly His Ser 260 265 270 TTT GGA GGA GCA ACA GTT CTT CAA GCC CTT AGT GAG GAC CAG AGA TTC 980 Phe Gly Gly Ala Thr wall Leu gin Ala Leu Ser Glu Asp gin Arg Phe 275 280 285 AGA TGT GGA GTT GCT CTT GAT CCA TGG ATG TAT CCG GTG AAC GAA GAG 1028 Arg Cys Gly wall Ala Leu Asp for Trp Met Tyr for wall same time Glu Glu 290 295 300

SK 286518-6

CTG TAC TCC AGA CTC Leu CTC TTT ATC AAC TCT GCC AAA 1076 Leu Tyr Ser Thr Leu Gin for Leu Phe 315 Asn Ser Ala Lys 320 305 310 TTC CAG ACT CCA AAG GAC ATC GCA AAA ATG AAA AAG TTC TAC CAG CCT 1124 Phe gin Thr for Lys Asp Ile Ala Lys Met Lys Lys Phe Tyr gin for 325 330 335 GAC AAG GAA AGG AAA AAT GAT TAC AAT CAA GGG CTC AGG CAC CAG AAC 1172 Asp Lys Glu Arg Lys same time Asp Tyr same time gin Gly Leu Arg His gin same time 340 345 350 TTT GAC GAC TTT ACT TTT GTA ACT GGC AAA ATA ATT GGA AAC AAG CTG 1220 Phe Asp Asp Phe Thr Phe wall Thr Gly Lys Ile Ile Gly same time Lys Leu 355 360 365 ACA CTG AAA GGA GAA ATC GAT TCC AGA GTA GCC ATC GAC CTC ACC AAC 1268 Thr Leu Lys Gly Glu Ile Asp Ser Arg wall Ala Ile Asp Leu Thr same time 370 375 380 AAA GCT TCG ATG GCT TTC TTA CAA AAG CAT TTA GGG CTT CAG AAA GAC 1316 Lys Ala Ser Met Ala Phe Leu gin Lys His Leu Gly Leu gin Lys Asp 385 390 395 400 TTT GAT CAG TGG GAC CCT CTG GTG GAA GGA GAT GAT GAG AAC CTG ATT 1364 Phe Asp gin Trp Asp for Leu wall Glu Gly Asp Asp Glu same time Leu Ile 405 410 415 CCT GGG TCA CCC TTT GAC GCA GTC ACC CAG GCC CCG GCT CAG CAA CAC 1412 for Gly Ser for Phe Asp Ala wall Thr gin Ala for Ala gin gin His 420 425 430 TCT CCA GGA TCA CAG ACC CAG AAT TAGAAGAACT ' TGCTTGTTAC ACAGTTGCCT 1466 Ser for Gly Ser gin Thr gin same time

435 440

TTTAAAAGTA GAGTGACATG AGAGAGAG (2) INFORMATION ON SEQ ID NO: 22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2191 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: cDNA (ix) CHARACTERISTICS:

(A) NAME / KEY: CDS (B) LOCATION: 92..1423 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:

CCGCGCGCTC CGGCCGGGGG ACCCTGGTTC CGGCGAGCGG CTCAGCGCGG CGCCCGGAAG

1494

TTTAAGCTGA AACCACTGCT CAGCTTCCAA G ATG

Met Leu Pro Lys Leu His

5

GCG CTT TTC TGC CTC TGC AGC TGC Ser Cys 15 CTC ACA CTG GTT CAT CCT ATT GAC 160 Ala Leu Phe 10 Cys Leu Cys Leu Thr Leu Val His 20 For the ile Asp TGG CAA GAC CTA AAT CCT GTT GCC CAT ATT AGA TCA TCA GCA TGG GCC 208 Trp gin Asp Leu same time for wall Ala His Ile Arg Ser Ser Ala Trp Ala

30 35

SK 286518-6

AAT AAA ATA CAA gin GCT Ala CTG Leu 45 ATG Met GCT Ala GCT Ala GCA Ala AGT ATT AGG CAA Gin AGT AGA Ser Arg 55 same time 40 Lys Ile Ser 50 Ile Arg ATT CCC AAA GGA AAT GGA TCT TAT TCT GTC GGT TGT ACA GAT TTG ATG Ile for Lys Gly same time Gly Ser Tyr Ser wall Gly Cys Thr Asp Leu Met

65 70

TTAT GAT TAT ACT AAT AAG GGC ACC TTT TTG CGT CCA Pro TCG Ser 352 Phe Asp Tyr Thr Asn 75 Lys Gly Thr Phe 80 Leu Arg Leu Tyr Tyr 85 CAA GAG GAT GAC CAC TCT GAC ACG CTT TGG ATC CCA AAC AAA GAA TAT 400 gin Glu Asp Asp His Ser Asp Thr Leu Trp Ile for same time Lys Glu Tyr 90 95 100 TTT TTT GGT CTT AGT AAA TAT CTT GGA ACA CCC TGG CTT ATG GGC AAA 448 Phe Phe Gly Leu Ser Lys Tyr Leu Gly Thr for Trp Leu Met Gly Lys 105 110 115 ATA TTG AGC TTC TTT TTT GGT TCA GTG ACA ACT CCT GCG AAC TGG AAT 496 Ile Leu Ser Phe Phe Phe Gly Ser wall Thr Thr for Ala same time Trp same time 120 125 130 135 TCC CCT CTG AGG ACT GGT GAA AAA TAT CCA CTG ATT GTT TTT TCT CAT 544 Ser for Leu Arg Thr Gly Glu Lys Tyr for Leu Ile wall Phe Ser His 140 145 150 GGT CTT GGA GCA TTC CGG ACA ATT TAT TCT GCT ATT GGC ATT GAT CTA 592 Gly Leu Gly Ala Phe Arg Thr Ile Tyr Ser Ala Ile Gly Ile Asp Leu 155 160 165

GCA Ala TCA Ser CAT His 170 GGG TTC ATC GTC GCT GCT GGA Gly TCC Ser 640 Gly Phe Val Ala 175 Ala Ile Glu His Arg 180 Asp GCC TCT GCG ACT TAC TAT TTC AAG GAC CAG TCT GCT GCA GAA ATA GGG 688 Ala Ser Ala Thr Tyr Tyr Phe Lys Asp gin Ser Ala Ala Glu Ile Gly 185 190 195 AAC AAA TCT TGG TCT TAT CTT CAA GAA CTA AAA CCA GGG GAT GAG GAG 736 same time Lys Ser Trp Ser Tyr Leu gin Glu Leu Lys for Gly Asp Glu Glu 200 205 210 215 ATA CAT GTT CGA AAT GAG CAG GTA CAG AAA AGG GCA AAG GAG TGC TCC 784 Ile His wall Arg same time Glu gin wall gin Lys Arg Ala Lys Glu Cys Ser 220 225 230 CAA GCT CTC AAC TTG ATT CTG GAC ATT GAT CAT GGA AGG CCA ATT AAG 832 gin Ala Leu same time Leu Ile Leu Asp Ile Asp His Gly Arg for Ile Lys 235 240 245 AAT GTA CTA GAC TTA GAG TTT GAT GTG GAA CAA CTG AAG GAC TCT ATT 880 same time wall Leu Asp Leu Glu Phe Asp wall Glu gin Leu Lys Asp Ser Ile 250 255 260 GAC AGG GAT AAA ATA GCA GTA ATT GGA CAT TCT TTT GGT GGA GCC ACA 928 Asp Arg Asp Lys Ile Ala wall Ile Gly His Ser Phe Gly Gly Ala Thr 265 27 0 275 GTT CTT CAG GCT CTT AGT GAA GAC CAG AGA TTT AGG TGC GGG ATT GCC 976 wall Leu gin Ala Leu Ser Glu Asp gin Arg Phe Arg Cys Gly Ile Ala 280 285 290 295 TTG GAT GCA TGG ATG CTT CCA CTG GAT GAT GCA ATA TAT TCC AGA ATC 1024 Leu Asp Ala Trp Met Leu for Leu Asp Asp Ala Ile Tyr Ser Arg Ile 300 305 310

CCT Pro CAG CCC CTC TTT TTT ATT AAC TCG GAA CCT Pro GAG Glu 1072 gin for Leu Phe 315 Phe ile same time Ser Glu 320 Arg Phe gin Phe 325 AAT ATC AAA AAA ATG AAA AAA TGC TAC TCA CCT GAC AAA GAA AGA AAA 1120 same time Ile Lys Lys Met Lys Lys Cys Tyr Ser for Asp Lys Glu Arg Lys 330 335 340 ATG ATT ACA ATC AGG GGT TCA GTC CAT CAG AAC TTT GCT GAT TTC ACT 1168 Met Ile Thr Ile Arg Gly Ser wall His gin same time Phe Ala Asp Phe Thr 345 350 355 TTT ACA ACT GGC AAA ATA GTT GGA TAC ATA TTC ACA TTA AAA GGA GAT 1216 Phe Thr Thr Gly Lys Ile wall Gly Tyr Ile Phe Thr Leu Lys Gly Asp 360 365 370 375 ATA GAT TCA AAT GTA GCA ATT GAT CTT TGC AAC AAA GCT TCA TTG GCA 1264 Ile Asp Ser same time wall Ala Ile Asp Leu Cys same time Lys Ala Ser Leu Ala 380 385 390 TTT TTA CAA AAG CAT TTA GGA CTG CGG AAA GAT TTT GAT CAG TGG GAT 1312 Phe Leu gin Lys His Leu Gly Leu Arg Lys Asp Phe Asp gin Trp Asp 395 400 405 TCT TTG ATT GAA GGA AAA GAC GAA AAT CTT ATG CCA GGG ACC AAC ATT 1360 Ser Leu Ile Glu Gly Lys Asp Glu same time Leu Met for Gly Thr same time Ile 410 415 420 AAC ATC ACC AAC GAA CAT GAC ACT CTA CAG AAC TCT CCA GAA GCA GAG 1408 same time Ile Thr same time Glu His Asp Thr Leu gin same time Ser for Glu Ala Glu 425 430 435

AAA TCG AAT TTA GAT TAAAAGCACT TTTTTAAAGA TCTTGTTTAA

Lys Ser Asn Leu Asp

440

AAAATGTGTG TATGACTTTT AATATATTTT CTCAAATAAC TCATATTGGA AAATGTAGGC 1523 TATCCCATAA AAGTGATTGA AGCTTGGACT AGGAGGTTTT TTTCTTTAAA GAAAGATTGG 1583 TGTCTATCGA AATCATGCCA GCCTAAATTT TAATTTTACT AAAATGATGC TGTGTCAAAA 1643 TTAATAACTA CTTTTACATT CTTTAATGGA CAAGTATAAC AGGCACAAGG CTAATGAAAA 1703 CGTGTTGCAA TGACATAACA ATCCCTAAAA ATACAGATGT TCTTGCCTCT TTTTTCTATT 1763 ATAATTGAGT TTTAGCAACA TGTTATGCTA GGTAGAATTT GGAAGCACTT CCCTTTGACT 1823 TTTGGTCATG ATAAGAAAAA TTAGATCAAG CAAATGATAA AAGCAGTGTT TTACCAAGGA 1883 TTAGGGATAC TGAACAATTT CACTATGGTA ACTGAATGGG GAGTGACCAA GGGTAAAAAT 1943 ATTAAAGCCA AGGCAAAGGC AGCAGATTAG AATGGATTAA AGAGAGTTTA TAATTTGTTT 2003 GCATTTACTT GATGGTTTAT CTCATGGATT CATGAGTCAA GAAAGGTGCG TAGGACAGGC 2063 CAGGGATTCC AGTTATAACA CATTATTCAC CCAAAGGGTT CTTTAATTCT GTATGAGTAT 2123 TGGGAGTGGA TTAGCACAAT AGAGGCATAT GTTGCTTTAA ΑΑΑΑΆΑΑΑΆΑ ΑΑΑΑΑΑΑΑΑΑ 2183 AAAAAAAA 2191

(2) INFORMATION ON SEQ ID NO: 23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1533 base pairs (B) TYPE: nucleic acid

SK 286518 Β6 (C) NUMBER OF CHAINS: one (D) TOPOLOGY: linear (n) MOLECULA TYPE: protein (ix) CHARACTERISTICS:

(A) NAME / KEY: CDS (B) LOCATION: 62..1394 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:

CCGCGAGCAG TTCACCGCGG CGTCCGGAAG GTTAAGCTGA AACGGCAGCT CAGCTTCGGA

G ATG TTA CCG TCC AAA TTG CAT

Met Leu Pro Lys Leu His Ala Leu Phe Cys Leu Cys Thr Cys 15 10 15

106

CTT GCA CTG GTT TAT CCT for TTT GAC TGG AAT Asn CCA Pro GTT Val 30 GCC Ala 154 Leu Ala Leu wall Tyr 20 Phe Asp Trp Gin 25 Asp Leu TAT ATT GAA TCA CCA GCA TGG GTC AGT AAG ATA CAA GCT CTG ATG GCT 202 Tyr Ile Glu Ser for Ala Trp wall Ser Lys Ile gin Ala Leu Met Ala 35 40 45 GCT GCA AAC ATT GGT CAA TCT AAA ATC CCC AGA GGA AAT GGA TCT TAT 250 Ala Ala same time Ile Gly gin Ser Lys Ile for Arg Gly same time Gly Ser Tyr 50 55 60 TCC GTC GGT TGT ACA GAC TTG ATG TTT GAT TAC ACT AAT AAG GGC ACC 29B Ser wall Gly Cys Thr Asp Leu Met Phe Asp Tyr Thr same time Lys Gly Thr 65 70 75 TTC TTG CGT TTG TAT TAT CCA TCT CAA GAT GAT GAT CAC TCC GAC ACC 346 Phe Leu Arg Leu Tyr Tyr for Ser gin Asp Asp Asp His Ser Asp Thr 80 85 90 95 CTT TGG ATC CCA AAC AAA GAA TAT TTT TTG GGT CTT AGT AAA TTT CTT 394 Leu Trp Ile for same time Lys Glu Tyr Phe Leu Gly Leu Ser Lys Phe Leu 100 105 110 GGA ACA CAC TGG CTT GTG GGC AAA ATT ATG GGC TTA TTC TTC GGT TCA 442 Gly Thr His Trp Leu wall Gly Lys Ile Met Gly Leu Phe Phe Gly Ser 115 120 125 ATG ACA ACT CCT GCA GCC TGG AAT GCA CAT CTG AGG ACT GGG GAA AAA 490 Met Thr Thr for Ala Ala Trp same time Ala His Leu Arg Thr Gly Glu Lys 130 135 140 TAC CCA CTA ATT ATT TTT TCT CAT GGT CTT GGA GCA TTC AGG ACG ATT 538 Tyr for Leu Ile Ile Phe Ser His Gly Leu Gly Ala Phe Arg Thr Ile

145 150 155 TAT TCT GCT ATT GGC ATT GAT CTG GCA TCC CAC GGG TTT ATA GTT GCT Tyr Ser Ala Ile Gly Ile Asp Leu Ala Ser His Gly Phe Ile wall Ala 160 165 170 175 GCT GTA GAA CAC AGG GAT GGC TCT GCA TCC TCG ACA TAC TAT TTC AAG Ala wall Glu His Arg Asp Gly Ser Ala Ser Ser Thr Tyr Tyr Phe Lys 180 185 190th GAC CAG TCT GCT GTA GAA ATA GGC AAC AAG TCT TGG CTC TAT CTC AGA Asp gin Ser Ala wall Glu Ile Gly same time Lys Ser Trp Leu Tyr Leu Arg 195 200 205

586

634

682

ACC CTG AAG CGA GAG GAG TTT CCT ATA GAG CAG 730 Thr Lys Arg Gly 210 Glu Glu Glu 215 Phe Pro Leu Arg same time 220 Glu gin Leu CGG CAA CGA GCA AAG GAA TGT TCT CAA GCT CTC AGT TTG ATT CTG GAC 778 Arg gin Arg Ala Lys Glu Cys Ser gin Ala Leu Ser Leu Ile Leu Asp 225 230 235 ATT GAT CAC GGG AGG CCA GTG ACG AAT GTA CTA GAT TTA GAG TTT GAT 826 Ile Asp His Gly Arg for wall Thr same time wall Leu Asp Leu Glu Phe Asp 240 245 250 255 GTG GAA CAG CTG AAG GAC TCT ATT GAT AGG GAT AAA ATA GCC ATT ATT Θ74 wall Glu gin Leu Lys Asp Ser Ile Asp Arg Asp Lys Ile Ala Ile Ile 260 265 270 GGA CAT TCT TTT GGT GGA GCC ACA GTT ATT CAG ACT CTT AGT GAA GAC 922 Gly His Ser Phe Gly Gly Ala Thr wall Ile gin Thr Leu Ser Glu Asp 275 2Θ0 285 CAG AGA TTC AGG TGT GGC ATT GCT CTG GAT GCA TGG ATG TTT CCC GTG 970 gin Arg Phe Arg Cys Gly Ile Ala Leu Asp Ala Trp Met Phe for wall 290 295 300 GGT GAT GAA GTA TAT TCC AGA ATT CCT CAA CCC CTC TTT TTT ATC AAC 1018 Gly Asp Glu wall Tyr Ser Arg Ile for gin for Leu Phe Phe Ile same time 305 310 315 TCG GAA CGA TTC CAA TAC CCT TCT AAT ATC ATA AGA ATG AAA AAA TGC 1066 Ser Glu Arg Phe gin Tyr for Ser same time Ile Ile Arg Met Lys Lys Cys 320 325 330 335 TTC TTA CCT GAT AGA GAA CGA AAA ATG ATT ACA ATC AGG GGT TCG GTC 1114 Phe Leu for Asp Arg Glu Arg Lys Met Ile Thr Ile Arg Gly Ser wall 340 345 350 CAT CAG AAT TTT GTT GAC TTC ACT TTT GCC ACT AGC AAA ATA ATT GGC 1162 His gin same time Phe wall Asp Phe Thr Phe Ala Thr Ser Lys Ile Ile Gly 355 360 365 TAC CTA TTC ACA CTG AAA GGA GAC ATC GAT TCC AAT GTA GCC ATC AGC 1210 Tyr Leu Phe Thr Leu Lys Gly Asp Ile Asp Ser same time wall Ala Ile Ser 370 375 380 CTT AGC AAC AAA GCT TCC TTA GCG TTC TTA CAA AAA CAT TTA GGA CTT 1258 Leu Ser same time Lys Ala Ser Leu Ala Phe Leu gin Lys His Leu Gly Leu 385 390 395 CAG AAA GAT TTT GAT CAG TGG GAT TCT TTA GTT GAA GGC GAA GAT CAC 1306 gin Lys Asp Phe Asp gin Trp Asp Ser Leu wall Glu Gly Glu Asp His 400 405 410 415 AAT CTT ATT CCA GGG ACC AAC ATT AAC ACA ACC AAC CAC CAA GCC ATT 1354 same time Leu Ile for Gly Thr same time Ile same time Thr Thr same time His gin Ala Ile 420 425 430 CTG CAG AAC TCC ACA GGA ATA GAG AGA CCA AAT TTA GAT T AAAAGAGCTT 1404 Leu gin same time Ser Thr Gly Ile Glu Arg for same time Leu Asp 435 440

TTTAAAAAGT TTTGTTTACG AACTTGTCTA AAAGTGTGTG TGTGTATGAT TTAAATGTAT 14 64

TTTCTCAAAT AGCTCATATT AAAAAATGTA GGCTATAGCA CAAAAAAAAAAAAAAAAAAAA 1524 AAAAAAAAA 1533

(2) INFORMATION ON SEQ ID NO: 24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1876 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: protein (ix) FEATURES:

(A) NAME / KEY: CDS (B) LOCATION: 468..1734 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:

CGGCGGGCTG CTGGCCCTTC CCGGCTGTTC GTAGAGCCGG ATCCTGCAGC GCCCCTGAGA60

CGAACCGCCC CGATGCGGTG CTCCTCAGCG CCACGGGACG CAGCCGGGGC CGGCCGTGTT120

GGCGCAGCTC CCACGACGTA CGCTTCCTTT CCAGGCTCGA GGAAAGCCTC TCCCACAAAC180

ACCGTCCCAG CTGGGAAGTG AGGCGGAGTT TTGGTCCCTC CCCTCCGGCA GCGCCCGGCA240

TTCCGTCCGT CCGTCCGTCC GTCCGTGCGG CGCACGGCGC CCTGCAGAGC CGGGACACCG300

CAGCAGGGTA GGAGGACCCG GAGGTGGTGT GCAGCCACAG GTTTCCATCC TGCCCCCACC360

TCCCGGGGAG CAGCCCTGTG CTATACCCAA CCCCCCGCAC AGAGCACTGA GCCGGCTGCT420

GCCTGCCTGC ACCCCGCCGT GGGACCTTCT GCTCTTCCCA ACAAGTG ATG GCA TCG476

Met. Ala Ser

AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG AGG

Leu Trp Val Arg

1015

TTC TCG GCG AAG GCG GCG ACG GAG ATG GGG AGC GGC GGC GCG GAG AAG572

Phe Ser Ala Lys Ala Ala Thr Glu Met Gly Ser Gly Gly Ala GluLys

25 3035

GGC TAT CGG ATG CCC GCC GGG AAG GGC CCG CAC GCC GTG

Gly Tyr Arg Ala Pro Gly Lys Gly Pro His Ala Val Gly CysThr

4550

GAT CTG ATG ACC GGC GAC GC GCC GAG

Asp Leu Met Thr Gly Ala G Ala Ala Ala Glu Gly Ser Phe Leu Arg LeuTyr

6065

TAC CTA TCG TGT GAC GAC ACA GAT ACT GAA GAG ACA CCC TGG ATT CCA716

Tyr Leu Ser Cys Asp Asp Thr Asp Thr Glu Glu Thr Pro

7580

GAT AAA GAC TAC TAC CAG GGG CTG TCT GAC TTC

Asp Lys Glu Tyr Gin Leu Ser Asp Phe Leu Asn Val TyrArg

9095

GCC CTG GGA GAA AGG CTT TTC CAG TAC TAC GTT

Ala Leu Gly Glu Arg

100 105 110115

CCT GCA AAA TCA AAC GCT GCT TTT AAG

Pro Ala Lys Ser Asn Ala Ala Phe Lys Pro Gly Glu Lys Tyr ProLeu

120 125130

CTC GTT TTT TCC GGA CTT GGA GCT TTT GCT ACC ATC TAT GCT 908 Leu Val Phe Ser 135 His Gly Leu Gly Ala 140 Phe Arg Thr ile Tyr 145 Ser Ala ATC TGC ATA GAG ATG GCT TCT CAA GGC TTT CTA GTG GCA GCT GTG GAG 956 Ile Cys Ile Glu Met Ala Ser gin Gly Phe Leu wall Ala Ala wall Glu 150 155 160 CAC AGA GAT GAA TCG GCT TCA GCA ACG TAT TTC TGT AAA AAG AAG GCT 1004 His Arg Asp Glu Ser Ala Ser Ala Thr Tyr Phe Cys Lys Lys Lys Ala 165 170 175 GAT TCT GAG CCA GAG GAG GAT CAA ACA TCA GGC GTG GAG AAG GAG TGG 1052 Asp Ser Glu for Glu Glu Asp gin Thr Ser Gly wall Glu Lys Glu Trp 180 185 190 195 ATC TAC TAC AGG AAG CTC AGA GCA GGA GAG GAG GAG CGC TGT CTG CGT 1100 Ile Tyr Tyr Arg Lys Leu Arg Ala Gly Glu Glu Glu Arg Cys Leu Arg 200 205 210 CAC AAG CAG GTA CAG CAG AGA GCA CAG GAG TGC ATC AAA GCG CTC AAC 1148 His Lys gin wall gin gin Arg Ala gin Glu Cys Ile Lys Ala Leu same time 215 220 225 CTC ATT CTT AAG ATC AGT TCA GGA GAG GAA GTG ATG AAT GTG CTG AAC 1196 Leu Ile Leu Lys Ile Ser Ser Gly Glu Glu wall Met same time wall Leu same time 230 235 240 TCA GAC TTT GAC TGG AAC CAC CTG AAG GAT TCT GTT GAT ACT AGC AGA 1244 Ser Asp Phe Asp Trp same time His Leu Lys Asp Ser wall Asp Thr Ser Arg 245 250 255 ATA GCT GTG ATG GGA CAC TCT TTT GGT GGT GCT ACA . GTT ATT ¹ GAG AGC 1292 Ile Ala wall Met Gly His Ser Phe Gly Gly Ala Thr wall Ile : Glu Ser 260 265 270 275 CTC AGC AAA GAA ATT AGA TTT AGG TGT GGC. ATT GCC CTT GAT ‘ GCG TGG 1340 Leu Ser Lys Glu Ile Arg Phe Arg Cys Gly ile. Ala Leu. Asp Ala Trp 280 285 290 ATG CTC CCG GTA GGC GAT GAC ACT TAC CAA AGC AGT GTG CAG ’ CAA CCA 1388 Met Leu for wall Gly Asp Asp Thr Tyr gin Ser Ser wall gin Gin Pro 295 300 305 CTG CTC TTT ATT AAT TCC GAA AAA TTC CAG TGG GCT GCC AAT. ATC TTA 1436 Leu Leu Phe Ile same time Ser Glu Lys Phe gin Trp Ala Ala same time Leu 310 315 320 AAG ATG AAG AAG CTT AGC TCC AAT GAT ACC AAC AAG AAA ATG ATC ACC 1484 Lys Met Lys Lys Leu Ser Ser same time Asp Thr same time Lys Lys Met ile Thr 325 330 335 ATC AAA GGA TCG GTA CAT CAG AGC TTT CCT GAT TTT ACT TTT GTG AGT 1532 Ile Lys Gly Ser wall His gin Ser Phe for Asp Phe Thr Phe Val Ser 340 345 350 355 GGA GAA ATC ATT GGA AAG TTT TTC AAG TTA AAA GGA GAA ATA GAC CCA 1580 Gly Glu Ile Ile Gly Lys Phe Phe Lys Leu Lys Gly Glu Ile Asp Pro 360 365 370 AAT GAA GCT ATT GAT ATA TGC AAC CAC GCT TCA TTG GCC TTC CTG CAG 1628 same time Glu Ala Ile Asp Ile Cys same time His Ala Ser Leu Ala Phe Leu Gin

375 380 385

SK 286518-6

AAA Lys CAT CTG AGT CTT AAG AGA GAT TTT GAT AAG TGG GAT TCA CTC GTG wall 1676 His Leu 390 Ser Leu Lys Arg Asp 395 Phe Asp Lys Trp Asp 400 Ser Leu GAT GGC ATA GGA CCC AAT GTT ATT TCT GGT ACC AAT ATC GAC TTA TCT 1724 Asp Gly Ile Gly for same time wall Ile Ser Gly Thr same time Ile Asp Leu Ser 405 410 415

CCA ACT GAG T AAGGAGTACA AGAAGTACTG CAAAGGCCAC CAGCAGCAGG 1774

For Thr Glu

420

ACACCAACGT TGGCCACACA TTGCTTGGAG CTGAGATAGC ACTGGCCTCC CACACAGCTT 1-34

TTGGAGTGTG AAACAACAAA AAAAAAAATC ACAGGGGAGC CG (2) INFORMATION ON SEQ ID NO: 25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 517 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: cDNA (ix) CHARACTERISTICS:

(A) NAME / KEY: CDS (B) LOCATION: 2..514 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25:

G GGG CAT TCT TTT GGA GGA GCA

Gly His Ser Phe Gly Gly Ala Thr

1876

GAC CAG AGA TGT Cys GTG ATT GCC CTT GAT CCG TGG Trp ATG Met TTT · Phe 30 CCC for Asp gin Arg Phe Arg 20 Gly Ile Ala Leu Asp 25 for GTG AGT GAG GAG CTG TAC TCC AGA GTT CCT CAG CCT CTC TTC TTT ATC wall Ser Glu Glu Leu Tyr Ser Arg wall for gin for Leu Phe Phe Ile 35 40 45 AAC TCT GCC GAA TTC CAG ACT CCA AAG GAC ATT GCA AAA ATG AAA AAC same time Ser Ala Glu Phe gin Thr for Lys Asp Ile Ala Lys Met Lys same time 50 55 60 TTC TAC CAG CCT GAC AAG GAA AGG AAA ATG ATT ACG ATC AAG GGC TCA Phe Tyr gin for Asp Lys Glu Arg Lys Met Ile Thr Ile Lys Gly Ser 65 70 75 GTG CAC CAG AAT TTT GCT GAC GGG ACT TTT GTA ACT GGC AAA ATA ATT wall His gin same time Phe Ala Asp Gly Thr Phe wall Thr Gly Lys Ile Ile 80 85 90 95 GGA AAC AAG CTG TCA CTG AAA GGA GAC ATA GAC TCC AGA GTT GCC ATA Gly same time Lys Leu Ser Leu Lys Gly Asp Ile Asp Ser Arg wall Ala Ile 100 105 110 GAC CTC ACC AAC AAG GCT TCC TTG GCT TTC TTA CAA AAA CAT TTA GGA Asp Leu Thr same time Lys Ala Ser Leu Ala Phe Leu gin Lys His Leu Gly 115 120 125 CTT CAT AAA GAC TTT GAT CAG TGG GAC TGT CTG GTG GAG GGA GAG AAC Leu His Lys Asp Phe Asp gin Trp Asp Cys Leu wall Glu Gly Glu same time 130 135 140

142

190

238

286

334

382

430

SK 286518-6

GAG AAC CTC ATC CCG GGG TCA CCC TTT GAT 478 Glu Asn Leu 145 Ile Pro Gly Ser Pro 150 Phe Asp Val Val 155 Thr gin Ser for GCT CTG CAG AGT TCT CCC GGA TCA CAC AAC CAG AAT TAG 517 Ala Leu gin Ser Ser for Gly Ser His same time gin same time 160 165 170

(2) INFORMATION ON SEQ ID NO: 26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 580 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: cDNA (ix) FEATURES:

(A) NAME / KEY: CDS (B) LOCATION: 1..580 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26:

CAA GTA CTG ATG GCT GCT GCA AGC TTT GGC GAA CGT AAA ATC CCT AAG 48 gin wall Leu Met Ala Ala Ala Ser Phe Gly Glu Arg Lys Ile for Lys 1 5 10 15

GGA Gly AAT GGG CCT TAT Pro Tyr 20 TCC GTT GGT TGT ACA GAC TTA ATG TTT GAT TAC Tyr 96 same time Gly Ser wall Gly Cys 25 Thr Asp Leu Met Phe 30 Asp ACT AAA AAG GGC ACC TTC TTG CGT TTA TAT TAT CCA TCC CAA GAT GAT 144 Thr Lys Lys Gly Thr Phe Leu Arg Leu Tyr Tyr for Ser gin Asp Asp 35 40 45 GAT CGC CTT GAC ACC CTT TGG ATC CCA AAT AAG GAG TAT TTT TGG GGT 192 Asp Arg Leu Asp Thr Leu Trp Ile for same time Lys Glu Tyr Phe Trp Gly 50 55 60 CTT AGC AAG TAT CTT GGA AAA CAC TGG CTT ATG GGC AAC ATT TTG AGT 240 Leu Ser Lys Tyr Leu Gly Lys His Trp Leu Met Gly same time Ile Leu Ser 65 70 75 80 TTA CTC TTT GGT TCA GTG ACA ACT CCT GCA AAC TGG AAT TCC CCT CTG 288 Leu Leu Phe Gly Ser wall Thr Thr for Ala same time Trp same time Ser for Leu 85 90 95 AGG CCT GGT GAA AAA TAC CCA CTT GTT GTT TTT TCT CAT GGT CTT GGA 336 Arg for Gly Glu Lys Tyr for Leu wall wall Phe Ser His Gly Leu Gly 100 105 110 GCA TTC AGG ACA ATT TAT TCT GCT ATT GGC ATT GAC CTG GCA TCT CAT 384 Ala Phe Arg Thr Ile Tyr Ser Ala Ile Gly Ile Asp Leu Ala Ser His 115 120 125 GGG TTT ATA GTT GCT GCT GTA GAA CAC AGA GAT AGA TCT GCA TCT GCA 432 Gly Phe Ile wall Ala Ala wall Glu His Arg Asp Arg Ser Ala Ser Ala 130 135 140 ACT TAC TAT TTC AAG AAC CAA TCT GCT GCA GAA ATA GGG AAA AAG TCT 480 Thr Tyr Tyr Phe Lys same time gin Ser Ala Ala Glu Ile Gly Lys Lys Ser

145 150 155 160

TGG CTC TAC CTT AGA ACC ATA CAT ATA CGA 528 Trp Leu Tyr Leu Arg Thr 165 Leu Lys Glu Glu 170 Glu Glu Ile His Ile 175 Arg AAT AAG CAG GTA CGA CAA AGA GCA AAA GAA TGT TCC CAA GCT CTC AGT 576 same time Lys gin wall Arg gin Arg Ala Lys Glu Cys Ser gin Ala Leu Ser 180 185 190

CTG A

580

Leu (2) INFORMATION ON SEQ ID NO: 27:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULA TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27:

Gly Xaa Gly Xaa Ser

5 (2) INFORMATION ON SEQ ID NO: 28:

(1) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear MOLECULAR TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28:

TATTCTAGAA TTATGATACA AGTATTAATG GCTGCTGCAA G ⁴¹ (2) INFORMATION ON SEQ ID NO: 29:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29:

ATTGATATCC TAATTGTATT TCTCTATTCC TG 32 (2) INFORMATION ON SEQ ID NO: 30:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1335 base pairs (B) TYPE: nucleic acid (C) NUMBER OF STRINGS: one (D) TOPOLOGY: linear (ii) MOLECULA TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30:

ATGGTACCCC CAAAGCTGCA CGTCCTGTTT TGTCTGTGTG GATGTCTCGC CGTCGTGTAC

CCCTTCGATT GGCAGTATAT CAACCCCGTG GCTCACATGA AGAGCAGCGC

CTGGGTGAAT

120

AAGATCCAGG TGCTCATGGC CGCACCAAGC TTCGGTCAGA CCAAGATTCC

TAGAGGCAAC

180

CACCGATCTG ATGTTCGACC ATACCAACAA AGGAACTTTT

GGCCCCTACA GCGTGGGCTG

240

CTGAGACTGT ACTACCCCAG CCAGGACAAC GACAGACTGG ATACTCTGTG GATCCCAAAT 300 AAAGAATATT TTTGGGGTCT TAGCAAATTT CTTGGAACAC ACTGGCTTAT GGGCAACATT 360 TTGAGGTTAC TCTTTGGTTC AATGACAACT CCTGCAAACT GGAATTCCCC TCTGAGGCCT 420 GGTGAAAAAT ATCCACTTGT TGTTTTTTCT CATGGTCTTG GGGCATTCAG GACACTTTAT 480 TCTGCTATTG GCATTGACCT GGCATCTCAT GGGTTTATAG TTGCTGCTGT AGAACACAGA 540 GATAGATCTG CATCTGCAAC TTACTATTTC AAGGACCAAT CTGCTGCAGA AATAGGGGAC 600 AAGTCTTGGC TCTACCTTAG AACCCTGAAA CAAGAGGAGG AGACACATAT ACGAAATGAG 660 CAGGTACGGC AAAGAGCAAA AGAATGTTCC CAAGCTCTCA GTCTGATTCT TGACATTGAT 720 CATGGAAAGC CAGTGAAGAA TGCATTAGAT TTAAAGTTTG ATATGGAACA ACTGAAGGAC 780 TCTATTGATA GGGAAAAAAT AGCAGTAATT GGACATTCTT TTGGTGGAGC AACGGTTATT 840 CAGACTCTTA GTGAAGATCA GAGATTCAGA TGTGGTATTG CCCTGGATGC ATGGATGTTT 900 CCACTGGGTG ATGAAGTATA TTCCAGAATT CCTCAGCCCC TCTTTTTTAT CAACTCTGAA 960 TATTTCCAAT ATCCTGCTAA TATCATAAAA ATGAAAAAAT GCTACTCACC TGATAAAGAA 1020 AGAAAGATGA TTACAATCAG GGGTTCAGTC CACCAGAATT TTGCTGACTT CACTTTTGCA 1080 ACTGGCAAAA TAATTGGACA CATGCTCAAA TTAAAGGGAG ACATAGATTC AAATGTAGCT 1140 ATTGATCTTA GCAACAAAGC TTCATTAGCA TTCTTACAAA AGCATTTAGG ACTTCATAAA 1200 GATTTTGATC AGTGGGACTG CTTGATTGAA GGAGATGATG AGAATCTTAT TCCAGGGACC 1260 AACATTAACA CAACCAATCA ACACATCATG TTACAGAACT CTTCAGGAAT AGAGAAATAC 1320 AATTAGGATT CTAG 1335

PATENT CLAIMS

Claims (19)

A purified and isolated human plasma acetyl hydrolase polypeptide fragment of platelet activating factor (PAF-AH) lacking the first twelve N-terminal amino acids of the mature human PAF-AH amino acid sequence set forth in SEQ ID NO: 8. 10 A PAF-AH polypeptide fragment according to claim 1, selected from the group consisting of a) a polypeptide having Mct _4; , SEQ ID NO: 8 as the starting N-terminal amino acid, b) a polypeptide having Ala _{47 of} SEQ ID NO: 8 as the starting N-terminal amino acid, c) a polypeptide having Ala _{48 of} SEQ ID NO; 8 as the starting N-terminal amino acid. The PAF-AH polypeptide fragment of claim 1 or 2, which lacks up to 30 C-terminal amino15 amino acids of SEQ ID NO: 8. The PAF-AH polypeptide fragment of claim 1 or 2, having as its C-terminal residue, a residue of SEQ ID NO: 8 selected from the group consisting of: (a) Ile ₄₂₉ b) Li _43] a (c) Asumi. A human PAF-AH polypeptide fragment comprising Met _{46 of} SEQ ID NO: 8 as the N-terminal residue and Ile ₄₂₉ or Asuhi as the C-terminal residue. A variant PAF-AH polypeptide fragment according to claim 1, which has an amino acid substitution selected from the group consisting of SEQ ID NO: 8. (a) S 108 A (b) S 273 A (c) D 286 A (d) D 286 N (e) D 296 A (f) D 304 A (g) D 338 A (h) H 351 A (i) H 395 (j) H 399 A (k) C 67 S (l) OJ C 229 S (m) C 291 S (n) C 334 S; (o) C 407 S. 7. A variant human PAF-AH polypeptide having an amino acid substitution selected from the group consisting of SEQ ID NO: 8. (a) D 286 (b) D 286 N. (c) D 304 A. An isolated polynucleotide encoding a PAF-AH polypeptide fragment, variant thereof, or variant fragment thereof according to any one of claims 1 to 4, 6 or 7. An isolated polynucleotide encoding a human PAF-AH fragment or variant fragment showing Met46 in SEQ ID NO: 8 as the N-terminal residue, and Ile429 or Asn441 as the C-terminal residue. The polynucleotide of claim 8 or 9, which is DNA. A DNA vector comprising the DNA of claim 10. A host cell stably transformed or transfected with DNA according to claim 10 in a manner that allows expression of the PAF-AH polypeptide fragment, variant or variant fragment thereof in said host cell. A method for producing a PAF-AH polypeptide fragment, variant thereof, or variant plasma PAF-AH fragment according to any one of claims 1 to 7, characterized in that the host cell of claim 12 is grown in a suitable nutrient medium and the PAF-AH fragment is isolated. , a variant thereof, or a variant fragment thereof from cells or their growth medium. The PAF-AH polypeptide fragment, variant thereof, or variant fragment produced by the method of claim 13. A pharmaceutical composition comprising a PAF-AH fragment, variant thereof or variant fragment thereof according to any one of claims 1 to 7 or 14 and a pharmaceutically acceptable diluent, adjuvant or carrier. The PAF-AH polypeptide fragment, variant or variant fragment thereof according to any one of claims 1 to 7 or 14 and the pharmaceutical composition of claim 15 for use in treating a mammal susceptible to or afflicted with a PAF-mediated pathological condition, wherein the amount of PAF-AH the product or pharmaceutical composition is sufficient to complement PAF-AH activity and inactivate the pathological effects of PAF in the mammal. The PAF-AH polypeptide fragment, variant or variant fragment thereof, or pharmaceutical composition according to claim 16, wherein the pathological condition is pleurisia, asthma, rhinitis, necrotizing enterocolitis, acute respiratory distress syndrome, acute pancreatitis, reperfusion injury or neurological postpartum, pre-septicemia, a disease associated with HIV infection. Use of a PAF-AH polypeptide fragment, variant or variant fragment thereof according to any one of claims 1 to 7 or 14 or a pharmaceutical composition according to claim 15 for the manufacture of a medicament for treating a mammal susceptible to or afflicted with a PAF-mediated pathological condition. it is sufficient to complement PAF-AH activity and inactivate the pathological effects of PAF in a mammal. SK 286518-6 The use of claim 18, wherein the medicament is for treating a mammal susceptible to pleurisy, asthma, rhinitis, necrotizing enterocolitis, acute respiratory distress syndrome, acute pancreatitis, reperfusion injury, septicemia, premature birth or neurological disease or neurological disease any of these conditions.