JP2001502163A - Platelet activating factor acetylhydrolase - Google Patents

Abstract

  (57) [Summary] The present invention provides purified and isolated polynucleotide sequences encoding human plasma platelet activating factor acetylhydrolase. Further provided are materials and methods for the recombinant production of a platelet activating factor acetylhydrolase product, which are expected to be beneficial in modulating pathological inflammatory conditions.

Description

DETAILED DESCRIPTION OF THE INVENTION                   Platelet activating factor acetylhydrolase                                Field of the invention   The present invention relates generally to platelet-activating factor acetylhydrolase, and more particularly Contains a purified human platelet-activating factor acetylhydrolase-encoding enzyme Novel isolated polynucleotide, platelet activity encoded by the polynucleotide Activating factor acetylhydrolase product, platelet activating factor acetylhydrolase production AND METHOD FOR RECOMBINANT PRODUCTION OF PRODUCTS AND PLATELET-ACTIVATION FACTOR ACETYLHIDE It relates to an antibody substance specific to lorase.                                   background   Platelet activating factor (PAF) is synthesized by various cell types and is biologically active. It is a phospholipid having properties. in vjvo and 10^-Ten~Ten^-9At a normal concentration of M, PAF Is that specific G proteins bind to coupled cell surface receptors Activates target cells such as platelets and neutrophils (Venable et al. . Lipid Res., 34, 691-701, (1993)). PAF is 1-O-Alkyl-2-acetyl-s n -Has a glycero-3-phosphocholine structure. For optimal biological activity, P AF glycerol skeletonsn-1 position must form an ether bond with aliphatic alcohol Must besn-3 position has no phosphocholine head group I have to.   PAF functions in normal physiological processes (eg, inflammation, congestion, and labor) And a pathological inflammatory response (eg, asthma, Illness, septic shock and arthritis) (Benable et al.) Supra, and Lindsberg et al., Ann. Neurol., 30, 117-129, ( 1991)). Possibility of PAF involvement in pathological response may be due to attempts to modify PAF activity And the main focus of these efforts is on the cell surface of PAF Antagonists of the activity of PAF have been developed to inhibit binding to the receptor. example See, for example, Heuer et al., Clin. Exp. Allergy, Vol. 22, pp. 980-983, (1992) I want to be illuminated.   PAF synthesis and secretion, as well as its degradation and clearance, are tightly controlled. Seems to be. PAF's pathological inflammatory effects may lead to overproduction, improper production or PAF to the extent that it is caused by a failure of the PAF regulatory mechanism that increases the resolution of the solution Alternatives that modulate the activity of mimic natural processes that lead to resolution of inflammation Or increase it. Macrophages (Staffoli) Stafforini et al. Biol. Chem., 265, No. 17, pages 9682-9968, (1990)), Hepatocytes and the human hepatoma cell line HepG2 (Satoh et al., J. Clin. Invest., 87, 476-481, (1991) and Tarbet et al. Biol. Chem., 266, 25 , Pp. 16667-16673, (1991)) describes a PAF acetylhydrolase that inactivates PAF ( It has been reported to release the enzymatic activity of PAF-AH). Inactivating PAF In addition, PAF-AH is oxidative, such as a product of the arachidonic acid cascade that mediates inflammation. It also inactivates fragmented phospholipids. Stremler et al. Biol . Chem., 266, 17, 11095-11103, (1991). By PAF-AH PAF inactivation is mainly due to PAFsn-2 caused by hydrolysis of the acetyl group, PAF-AHsnBy removing the acyl group of -2, the oxidatively fragmented Metabolizes phospholipids. Two types of PAF-AH have been identified I have. That is, they are found in various cell types and tissues, such as endothelial cells and red blood cells. Cytoplasmic types, as well as extracellular types found in plasma and serum. Plasma PAF-AH Does not hydrolyze intact phospholipids except PAF, and Due to sex, this enzyme circulates in vivo in a completely active state without harmful effects can do. Excretion of PAF in human blood ex vivo by plasma PAF-AH All of the solutions seem to be explained (Staffolini et al., J. Biol. Chem., 262, No. 9, pp. 4223-4230, (1987)).   While cytoplasmic and plasma PAF-AH appear to have similar substrate specificities, plasma Differentiation of PAF-AH from cytoplasmic PAF-AH and other characterized lipases PAF-AH has biological characteristics. In particular, plasma PAF-AH is And is inhibited by diisopropylfluorophosphate, Unaffected by muons and relatively resistant to proteolytic enzymes And has an apparent molecular weight of 43,000 daltons. Staffolini et al. (1987), See above. In the same article by Staffolini et al., PAF-AH from human plasma For partial purification of amino acids and amino acids of plasma substances obtained by using the method The acid composition is described. Cytoplasmic PAF-AH has been described by Staffolini et al. Biol. Chem. 268, No. 6, pages 3857-3865, (1993). And 10 amino-terminal residues of cytoplasmic PAF-AH are also described in the literature. Has been described. Hattori et al. Biol. Chem., 268, 25, 18748 18718753, (1993) describes the purification of cytoplasmic PAF-AH from bovine brain. This case Followed by Hattori et al. Biol. Chem., 269, 237, 23150-23155 Page, (1994) Nucleotide sequence of bovine brain cytoplasmic PAF-AH Was published. On January 5, 1995 (three months after the filing date of the parent application), Protein-related phospholipase A_Two(Lp-PLA_Two) Is a nucleotite sequence Smithkline Beecham PLC Patent Cooperation Treaty (PCT) International Published in WO 95/00649 pamphlet. Lp-PLA_TwoNucleotides Sequence differs at one point when compared to the nucleotide sequence of PAF-AH of the invention . As a result of the nucleotide difference (corresponding to position 1297 of SEQ ID NO: 7), Amino acid differences occur between the enzymes encoded by the oligonucleotides. Arrangement Amino acid at position 379 of column number: 8 is valine, while Lp-PLA_TwoThe corresponding parts are Alanine. In addition, the nucleotide sequence of PAF-AH of the present invention is Lp-PLA_TwoTo Does not exist, contains 124 bases at the 5 'end and 20 bases at the 3' end. Three months later in 1995 On April 10, Lp-PLA_TwoThe sequence has been deposited with GenBank under accession number U24577, Compared to the nucleotide sequence of PAF-AH of the present invention, there are 11 differences. Nucleus Otides differ (Nos. 79, 81, 84, 85, 86, 121, 122, 904, 905, 91 of SEQ ID NO: 7). (Corresponding to positions 1, 983 and 1327), resulting in coding by both polynucleotides. There are four amino acid differences between the enzymes performed. SEQ ID NO: 8: 249, 250, Amino acids at positions 274 and 389 are lysine, aspartic acid, and phenylalanine, respectively. And leucine, while each amino acid at the corresponding position in the GenBank sequence Are isoleucine, arginine, leucine and serine.   Normal process of resolving inflammation in vivo by recombinant production of PAF-AH Will be able to utilize exogenous PAF-AH to mimic or augment U. Because PAF-AH is a product normally found in plasma, administration of PAF-AH Physiological benefits would be provided over administration of PAF receptor antagonists. Further In addition, PAF receptor antagonists that are structurally related to PAF inhibit the original PAF-AH activity. The desired metabolism of PAF and oxidatively fragmented phospholipids, thereby hindering Can be Thus, inhibition of PAF-AH activity by a PAF receptor antagonist Block the competitive inhibition of the PAF receptor. See Stromler et al., Supra. No. In addition, in areas of acute inflammation, for example, as a result of the release of oxidants, Inactivation of the PAF-AH enzyme occurs, and then, from outside to bind to the PAF receptor PAF and PAF-like will compete with any of the administered PAF receptor antagonists This results in elevated local levels of the compound. In contrast, using recombinant PAF-AH Treatment results in increased endogenous PAF-AH activity and inactivated endogenous enzyme Will be supplemented.   Thus, polynucleotides encoding human plasma PAF-AH in the art Identify and isolate peptide sequences and develop materials and methods useful for the recombinant production of PAF-AH. There is a need to create reagents for the detection of PAF-AH in plasma.                                Summary of the Invention   The present invention encodes human plasma PAF-AH or an enzymatically active fragment thereof , Purified and isolated novel polynucleotides (ie, both sense and Antisense strand, DNA and RNA). Preferred DNA arrangement of the present invention Rows include whole or partially chemically synthesized, as well as genomic and cDNA sequences DNA sequence is included. A DNA sequence encoding PAF-AH represented by SEQ ID NO: 7, and It hybridizes with non-coding strands of the sequence under standard stringency conditions. Hybridizes without the degeneracy of the soybean DNA sequence or genetic code DNA sequences that would be contemplated by the present invention. Further contemplated by the invention A biological copy of a DNA sequence of the present invention (ie, in vivo or in vitro) Produced copy of the isolated DNA sequence). Plastic with PAF-AH sequence Autonomously replicating recombinant constructs, such as sumid and viral DNA vectors; and In particular, the DNA encoding PAF-AH may contain an endogenous or exogenous expression control DNA sequence and transcription factor. A vector operably linked to the terminator is also provided.   In another aspect of the invention, allowing the desired DNA sequence to be expressed therein Prokaryotic or eukaryotic host cells can be stably transformed with the DNA sequences of the invention. Is replaced. Host cells expressing PAF-AH products serve a wide variety of useful purposes be able to. Such cells are specifically immunoreactive with PAF-AH. Make up a valuable source of antigens for the development of substances. The host cell of the present invention is a cell Is grown in a suitable culture medium and is from or from the cells. The desired polypeptide product is isolated, for example, by immunoaffinity purification. In particular, it is significantly useful in large-scale production of PAF-AH.   Non-immunological methods contemplated by the present invention for purifying PAF-AH from plasma (A) isolating low density lipoprotein particles, (b) isolating the low density protein particles Solubilize in a buffer containing 10 mM CHAPS to prepare a first PAF-AH enzyme solution, (c ) Applying the first PAF-AH enzyme solution to a DEAE anion exchange column, and (d) 1 mM CHAPS. Washing the DEAE anion exchange column with a buffer solution containing approximately pH 7.5, (e) Using a buffer of about pH 7.5 consisting of a concentration gradient of 0 to 0.5 M NaCl, (F) the DEAE anion exchange, Pool the fractions having PAF-AH enzyme activity eluted from the column, (g) the DEAE The pooled activity from the anion exchange column Fractions are adjusted to 10 mM CHAPS to make a second PAF-AH enzyme solution, (h) blue Applying the second PAF-AH enzyme solution to a diligand affinity column, (i) From the blue diligand affinity column, 10 mM CHAPS and chaotrope Eluting the PAF-AH enzyme using a buffer containing a black salt, (j) the blue dye ligand The eluate from the door affinity column is applied to the Cu ligand affinity column. (K) Using a buffer containing 10 mM CHAPS and imidazole, the Cu ligand Eluting PAF-AH enzyme from the affinity column, (1) the Cu ligand affinity The eluate from the column is subjected to SDS-PAGE and (m) SDS-polyacrylic acid. A step of isolating the approximately 44 kDa PAF-AH enzyme from the midgel was included. Good More preferably, the buffer in step (b) is 25 mM Tris-HCl, 10 mM CHAPS, pH 7.5. The buffer in step (d) is 25 mM Tris-HCl, 1 mM CHAPS, and the column in step (h) is blue. Sepharose fast flow column, buffer in step (i) was 25 mM Tris-HCl , 10 mM CHAPS, 0.5 M KSCN, pH 7.5, and the column in step (j) was Cu-chelating A Sepharose column, and the buffer of step (k) has a pH in the range of about pH 7.5 to 8.0. 25 mM Tris-HCl, 10 mM CHAPS, 0.5 M NaCl, 50 mM imidazole.   Enzymatically active from E. coli producing PAF-AH, as contemplated by the present invention The method for purifying PAF-AH is as follows: (a) lysed E. coli producing PAF-AH enzyme Prepare the centrifugal supernatant from (b) Blue Diligand Affinity Column. Add the centrifugal supernatant, (c) from the blue diligand affinity column, 10m Eluting the PAF-AH enzyme using a buffer containing M CHAPS and chaotropic salts, (d) The eluate from the Blue Dye ligand affinity column is Affinity column And (e) using a buffer solution containing 10 mM CHAPS and imidazole, Eluting the PAF-AH enzyme from the ligand affinity column. Good Preferably, the column in step (b) is a Blue Sepharose Fast Flow column The buffer of step (c) is 25 mM Tris-HCl, 10 mM CHAPS, 0.5 M KSCN, pH 7.5, The column of step (d) is a Cu-chelating Sepharose column, and the step (e) Buffer is 25 mM Tris-HCl, 10 mM CHAPS, 0.5 M NaCl, 100 mM imidazole, pH7 .5.   Enzymatically active PAF-AH from E. coli producing PAF-AH, contemplated by the present invention Other methods for purifying (a) from lysed E. coli that produce the PAF-AH enzyme Prepare the centrifugation supernatant. (B) Dilute the centrifugation supernatant with a low pH buffer containing 10 mM CHAPS. (C) washing the diluted centrifugal supernatant with a cation exchange column equilibrated at about pH 7.5. (D) Elution of PAF-AH enzyme from the cation exchange column using 1M salt (E) raising the pH of the eluate from the cation exchange column, and (F) Blue diligand affinity, adjusting the salt concentration of the effluent to about 0.5M salt Apply the prepared eluate from the cation exchange column to the column, (g) Buffer containing about 2 M to about 3 M salt from the blue diligand affinity column Eluting the PAF-AH enzyme using (a) and (h) the blue diligand affinity The eluate from the column is dialyzed against a buffer containing about 0.1% Tween. Including the step of Preferably, the buffer of step (b) is 25 mM MES, 10 mM CHAPS, 1 mM mM EDTA, pH 4.9, the column in step (c) was 25 mM MES, 10 mM CHAPS, 1 mM EDTA S-Sepharose column equilibrated with 50 mM NaCl, pH 5.5, PAF-AH In step (d), elution was carried out using 1 mM NaCl, The pH of the effluent was adjusted to pH 7.5 using a 2M Tris base, and the column in step (f) was used. Is a Sepharose column, the buffer in step (g) is 25 mM Tris, 10 mM CHAP S, 3 M NaCl, 1 mM EDTA, pH 7.5, and the buffer in step (h) was 25 mM 0.5 M NaCl, 0.1% Tween 80, pH 7.5.   A method contemplated by the present invention for purifying enzymatically active PAF-AH from E. coli. Still another method is (a) lysis in a buffer containing CHAPS followed by solubilized PAF- Prepare an E. coli extract that produces an AH supernatant. (B) Dilute the supernatant and dilute to about pH 8.0. (C) apply PAF-AH from the anion exchange column. Eluting the enzyme, (d) purify the prepared eluate from the anion exchange column -Use buffer containing 3.0M salt (e) for diligand affinity column To elute the blue diligand affinity column, (f) In a suitable buffer for performing roxyl apatite chromatography, (G) Buffer (with or without CHAPS) to dilute the eluate from the dye column Performing washing and elution by using a hydroxyapatite chromatograph (H) to the appropriate salt concentration for cation exchange chromatography. Dilute the eluate from the hydroxyapatite in (i) the diluted solution Eluate from the hydroxyapatite at a pH in the range of approximately between 6.0 and 7.0 And (j) using a buffer having a suitable composition. Elution of PAF-AH from the exchange column, (k) Cation exchange chromatography under cooling And (l) adjusting PAF-AH to a liquid or frozen state without CHAPS. Manufacturing process.   Preferably, in the step (a), the lysis buffer is 25 mM Tris, 100 mM NaCl. , 1 mM EDTA, 20 mM CHAPS, pH 8.0, For anion exchange chromatography in step (b), the supernatant was , 1mM EDTA, 10mM CHAPS, pH 8.0, diluted 3 to 4 times, column was 25mM Tris Q-Sepharose scalar equilibrated with 1 mM EDTA, 50 mM NaCl, 10 mM CHAPS, pH 8.0 In step (c), the anion exchange column contains 25 mM Tris, 1 mM EDTA, 3 mM Eluted using 50 mM NaCl, 10 mM CHAPS, pH 8.0, in step (d), step (c) The eluate from is directly applied to the blue diaffinity column and is used in step (e). The column was eluted with 3M NaCl, 10mM CHAPS, 25mM Tris, pH 8.0 buffer. In step (f), for hydroxylapatite chromatography, The eluate from the dye column was 10 mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS, Dilution is performed at pH 6.2, and in step (g), hydroxylapatite chromatog Raffy was incubated with 10 mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS. This was performed using a droxyl apatite column, and elution was performed using 50 mM sodium phosphate. Achieved with 100 mM NaCl, 10 mM CHAPS (with or without), pH 7.5, In step (h), the hydroxyl apa The dilution of the tight column eluate is performed with or without CHAPS, phosphate The reaction is carried out in a buffer having a pH in the range of approximately 6.0 to 7.0 containing sodium, and the step (i) ), 50 mM sodium phosphate with or without 10 mM CHAPS, p At H6.8, the S Sepharose was equilibrated and in step (j) contained 0.01% Tween 80. Having 50 mM potassium phosphate, 12.5 mM aspartic acid, 125 mM NaCl, pH 7.5, etc. Elution is carried out with a buffer of suitable composition and in step (k) cation exchange chromatography. The chromatography is performed at 2-8 ° C. Stabilize PAF-AH, used in step (l) Of buffers of suitable composition for Include 50 mM potassium phosphate, 12.5 mM aspartic acid, 125 mM NaCl, pH 7.4 (approximate value Add or add Tween 80 or Pluronic F68 No), or (at least) 125 mM NaCl, 25 mM arginine and 0.01% twee Containing about 0.1 and 0.5% of pluronic F68 or (Not included) 25 mM potassium phosphate buffer.   The present invention is intended to purify an enzymatically active rPAF-AH product from E. coli. Another further method illustrated is (a) a buffer containing Triton X-100. An E. coli extract that yields a solubilized rPAF-AH product supernatant after lysis in (B) diluting the supernatant and equilibrating the immobilized metal affinity to about pH 8.0 Attached to the column, (c) from the immobilized metal affinity exchange column, imidazo Eluting the rPAF-AH product with a buffer solution containing (d) the immobilized metal affinity Adjust the salt concentration of the eluate from the exchange column and apply it to the hydrophobic interaction column (HIC # 1). (E) reducing the salt concentration and / or increasing the surfactant concentration Elution, (f) titrating the HIC # 1 eluate to a pH of about 6.4, (g) the HIC # A cation exchange column (CEX # 1) equilibrated to about pH 6.4 (H) eluting the CEX # 1 at the sodium chloride concentration, (i) eluting the CEX # 1 Adjust the solution with sodium chloride to a concentration of about 2.0M, (j) about pH 8.0 and about 2.0M chloride The conditioned C was added to a hydrophobic interaction column (HIC # 2) equilibrated with sodium. Add EX # 1 eluate, (k) reduce salt concentration and / or increase detergent concentration. To elute the HIC # 2, (l) dilute the HIC # 2 eluate and adjust the pH to about 6.0 (M) The HIC # 2 eluate is applied to a cation exchange column (CEX # 2), (n) rPAF-AH product Eluting from the CEX # 2 with a buffer of a suitable composition.   Preferably, in the step (a), the lysis buffer is 90 mM Tris, 0.125% Iton X-100, 0.6 M NaCl, pH 8.0, and lysis is performed with a high pressure homogenizer. In step (b), the supernatant was washed with equilibration buffer (20 mM Tris, 0.5 M NaCl, 0.1% Dilute to Triton X-100, pH 8.0) and add a zinc chelate column (Chelating Sef Chelating Sepharose Fast Flow, Pharmacia macia), Uppsala, Sweden) and equilibrated with equilibration buffer And apply the diluted supernatant and add 20 mM Tris, 0.5 M NaCl, 4 M urea, 0.1% Wash with Ryton X-100, pH 8.0, then try 20 mM Tris, 0.5 M NaCl, 0.02% After washing with Ton X-100, pH 8.0, in step (c), elution was performed with 20 mM Tris and 50 mM Performed with midazole, 0.02% Triton X-100, pH 8.0, eluted in step (d) The solution was adjusted to 1 mM EDTA and 2 M NaCl, and Phenyl Sepharose 6 Fast Flow (Flu Pharmacia) in equilibration buffer (2.0 M NaCl, 25 mM Tris, 0.02% Triton X-1) 00, pH 8.0) and apply the adjusted eluate from step (c) at room temperature to equilibrate Wash with an activating buffer, then 25 mM sodium phosphate buffer, 0.02% Triton X-10 Wash at 0, pH 6.5 at a flow rate of 30 cm / hour, and in step (e), 25 mM sodium phosphate Elution was performed with a buffer solution, 3% Triton X-100, pH 6.5. Macro-Prep High S Column (Bio-Rad Laboratories (Bi o-Rad Labs, Inc., Richmond, CA) with equilibration buffer (20 mM phosphate) Equilibrate with sodium buffer, 0.02% Triton X-100, pH 6.4) and start from step (f) Apply adjusted eluate, wash with equilibration buffer, then add 25 mM Wash with 0.02% Triton X-100, pH 8.0, and 25 mM Tris, 0.0 Elution was performed with 2% Triton X-100, 1.3 M NaCl, pH 8.0, and in step (j), Carbonbond Wide Pore Hi-Propyl C_Three(Be To equilibrate Phillipsburg, NJ Equilibrate with buffer (2.0 M NaCl, 25 mM Tris, 0.02% Triton X-100, pH 8.0) Apply the adjusted eluate from step (i) at room temperature, wash with equilibration buffer, Wash with 25 mM Tris, 0.02% Triton X-100, pH 8.0 at a flow rate of 30 cm / hour in the step ( e) Elution with 10 mM Tris, 3.0% Triton X-100, pH 8.0, followed by step (l) Diluted with equilibration buffer (20 mM succinate, 0.1% Pluronic F68, pH 6.0) In step (m), SP Sepharose Fast Flow (Pharmacia) ) Equilibrate the column with the equilibration buffer of step (l) and apply the eluate from step (l); Then wash with equilibration buffer and in step (n) 50 mM sodium phosphate buffer Elution with buffer solution, 0.7M NaCl, 0.1% Pluronic F68, 0.02% Tween 80, pH 7.5 Will be   PAF-AH products can be obtained as isolates from natural cell sources or The prokaryotic or eukaryotic host cells of the present invention are preferably Produced by the recombinant techniques provided. Of the amino acid sequence represented by SEQ ID NO: 8 PAF-AH products having some or all are contemplated. Particularly contemplated are arrays No .: 8 to the first 12 N-terminal amino acids of the mature human PAF-AH amino acid sequence Fragment lacking, particularly the Met of SEQ ID NO: 8 as the starting N-terminal amino acid₄₆, Ala₄₇, Or Ala₄₈Is a fragment having Further contemplated is the SEQ ID NO: : Fragments lacking up to 30 C-terminal amino acids of the amino acid sequence of 8, especially Ile as C-terminal residue₄₂₉And Leu₄₃₁Is a fragment having Further contemplated , A derivative of PAF-AH or PAF-AH or S108A, S273A in the sequence of SEQ ID NO: 8 , D286A, D286N, D296A, D304A, D338A, H351A, H395A, H399A, C67S, C229S, C 291S, amino acids selected from the group consisting of C334S, C407S, D286A, D286N and D304A PAF-AH having acid substitution. As mentioned above, the fragment or derivative according to the invention In addition to providing polynucleotides (including DNA) encoding body fragments, By growing a host cell containing such DNA, such a fragment or derivative Is also provided by a recombinant method. Currently preferred PAF-AH products As the Met of SEQ ID NO: 8, named rPH.2.₄₆From Asn₄₄₁Up to amino acids The prokaryotic polypeptide expression product of the DNA encoding the residue and designated rPH.9 Met of SEQ ID NO: 8₄₆From Ile₄₂₉Prokaryotic DNA encoding up to amino acid residues Polypeptide expression products in organisms. Both rPH.2 and rPH.9 products are examples For example, the prokaryote of DNA encoding the full-length mature sequence of PAF-AH beginning with the translation initiation codon Less heterogeneity at the amino terminus than in the corresponding expression product in organisms (heterog eneity). Furthermore, the rPH.9 product has higher carboxy-terminal homogeneity ( Commonality). By using a mammalian host cell, the recombinant expression product of the present invention Post-transcriptional modifications that may be necessary to confer optimal biological activity to For example, militation, glycosylation, truncation, lipidite And tyrosine, serine or threonine phosphorylation) There is expected. The PAF-AH product of the invention can be a full-length polypeptide, fragment or derivative. It can be a body. A derivative is one or more specified (ie, naturally occurring Amino acids are deleted or substituted, or one or more non- It consists of a PAF-AH derivative to which a specific amino acid is added. (1) PAF-AH-specific 1 Without loss of the above enzyme activity or immunological properties, or (2) PAF-AH The specific biological activity may be specifically impaired. Protein that binds to PAF-AH Quality or other molecules may be used to modify its activity.   Further contemplated by the invention are antibody substances (eg, monoclonals). And polyclonal antibodies, single-chain antibodies, chimeric antibodies, CDR-grafted antibodies and other binding proteins with specificity for PAF-AH. In particular An illustrative binding protein was published on September 30, 1994, 20852 MD , Rockville, Parklawn Drive, 12301 Deposited with the American Type Culture Collection (ATCC), HB11724 each And hybridomas 90G11D and 90F2D, given accession numbers for HB11725 and HB11725. It is a monoclonal antibody produced by Further, a binding tamper illustrative of the invention The deposit was deposited with the ATCC on June 1, 1995 and was given the accession number HB11900. It is a monoclonal antibody produced by hybridoma 143A. Special for PAF-AH Differentially binding proteins or other molecules (eg, lipids or small molecules) PAF-AH, recombinant PAF-AH, PAF-AH derivative or such product isolated from plasma Can be identified using cells that express. Furthermore, the binding protein is It is useful not only for the purification of PAF-AH but also in compositions for immunization, Useful for the detection or quantification of PAF-AH in liquid and tissue samples by known immunological techniques is there. Anti-idiotypic antibodies specific for PAF-AH specific antibody substances are also contemplated .   The scientific value of the information contributed by the disclosure of the DNA and amino acid sequences of the present invention is clear. You. As a series of examples, cDNA sequence for PAF-AH DNA / DNA hybridization of genomic DNA sequence encoding PAF-AH Control of PAF-AH expression such as promoter, operator, etc. A column can be specified. Standard stringency in the art DNA / DNA hybridization performed using the DNA sequence of the present invention under the conditions described above. Depending on the method, allelic variants of PAF-AH, one or more PAF-AH Other structurally related proteins responsible for biochemical and / or immunological properties, And isolation of DNA encoding nonhuman species proteins homologous to PAF-AH. Is expected as well. According to the information of the DNA sequence provided by the present invention. Thus, homologous recombination or a rodent or PA that does not express a functional PAF-AH enzyme A “knockout” strategy for rodents expressing F-AH enzyme variants (eg, See Kapecchi, Science, 244, pp. 1288-1292, (1989)). Such development is also possible. When the polynucleotide of the present invention is suitably labeled , A hybridization assay to detect the ability of cells to synthesize PAF-AH enzyme It is useful in. The polynucleotides of the invention may have one or more disease states. To identify one or more genetic alterations in the underlying PAF-AH locus May be the basis for useful diagnostics. Further obtainable by the present invention The ability to control PAF-AH expression by cells that normally express PAF-AH There are also related antisense polynucleotides.   The present invention is intended for the improvement of pathological inflammatory conditions in mammals, especially human subjects. It is contemplated that a clear PAF-AH preparation will be administered. PAF in pathological inflammatory conditions Implicated in, for example, asthma (Miwa et al., J. Clin. Inv. est., 82, 1983-1991, (1988), Hsieh et al. Allergy Clin. Immunol., 91, 650-657, (1993), and Yamashita et al., Allergy. 49, 60-63, (1994)), anaphylaxis (Benable et al., Supra), (Benable et al., Supra), reperfusion injury and central nervous system ischemia (Lindberg et al. (1991) supra) Antigen-induced arthritis (Zarco et al., Clin. E). xp. Immunol., 88, 318-323, (1992)) Atheromatous formation (Handley et al.) Res., 7, 7, 361-375, (1986)), Crohn's disease (Denizot (Deniz ot) et al., Digestive Diseases and Sciences, Vol. 37, No. 3, pp. 432-437, (1992)) , Ischemic Bowel Necrosis / Necrotic Small Intestinal Colitis (Denizotto et al., Supra, and Caplan) ) Et al., Acta Paediatr., Supplement, 396, 11-17, (1994)), ulcerative colitis (deni). Zott et al., Supra), ischemic stroke (Satoh et al., Stroke, 23, 1090-1092). , (1992)), ischemic brain injury (Lindberg et al., Stroke, 21: 1452-1457, (1 990) and Lindberg et al. (1991) supra), systemic lupus erythematosus (Matsuzaki ) Et al., Clinica Chimica Acta, 210, 139-144, (1992)), acute pancreatitis (Cardo (Kald) et al., Pancreas, 8, 4, 440-442, (1993)), sepsis, Cardo et al., Supra. Source), acute acquired streptococcal glomerulonephritis (METZA) Mezzano et al. Am. Soc. Nephrol., 4, 235-242, (1993)), IL-2 therapy Edema caused by Rabinovici et al., J. Clin. Invest. 89, 166-1673, (1992)), allergic inflammation (Watanabe et al., Br. J. Pharmacol., 111, 123-130, (1994)), ischemic renal failure (Grin o) et al., Annals of Internal Medicine, 121, 5, 345-347, (1994)), early Preterm labor (Hoffman et al., Am. J. Obstet. Gynecol., 162). Vol. 2, No. 525-528, (1990) and Maki Proc. Natl. Acad. Sci. USA, 85, 728-732 (1988)), and Adult respiratory distress syndrome Rabinovich et al., J.A. ppl. Physiol., Vol. 74, No. 4, pp. 1791 to 1802, (1993), Matsumoto et al., Clin. Exp. P harmacol. Physiol. 19, 509-515, (1992) and Rodriguez-Louidine (Rod riguez-Roisin) et al. Clin. Invest., 93, 188-194, (1994)) Suggest that PAF-AH is administered. It is further contemplated that the human license Preparation of PAF-AH preparation for treating infection of the central nervous system of the epidemic deficiency virus (HIV) Use. The term “treatment” as used herein refers to both prophylactic and therapeutic treatments. The above treatment is included.   Many animal models of the aforementioned pathological conditions have been described in the art. You. For example, mouse models for asthma, rhinitis, and eczema are described in the examples herein. A rabbit model for arthritis is described in Zarco et al., Supra, Rat model for ischemic bowel necrosis / necrotizing small bowel colitis is Furukawa Et al., Ped. Res., 34, No. 2, pp. 237-241, (1993) and described in Kaplan et al., Supra. And a rabbit model for seizures is described in Lindberg et al. (1990), supra. A mouse model for lupus has been described in Matsuzaki et al., Supra, for treating acute pancreatitis. A rat model described in Cardo et al., Supra, was induced by IL-2 therapy. A rat model for pulmonary edema is described in Rabinovich et al. A rat model of lugigenic inflammation is described in Watanabe et al. Rabbit model is Watson et al., Transplantatjon, Vol. 56, No. 4, 1047-10 P. 49, (1993), and rats and guinea pigs with adult respiratory distress syndrome Models from Rabinovic et al., Supra, and Lellouch-Tubian a), Am.ReV. Respir. Djs., 137, 948-954 (1988).   Particularly contemplated by the invention are those that supplement endogenous PAF-AH activity in a mammal, Administer enough PAF-AH to mammals to inactivate the pathogenic PAF. Suspected or affected by a PAF-AH-mediated pathological condition consisting of It is a PAF-AH composition used in a method of treating a dairy animal.   Therapeutic / pharmaceutical compositions contemplated by the present invention include a PAF-AH product and a physiologically acceptable product. Other diluents (excipients) or carriers that may contain May contain medicine. The indicated doses supplement endogenous PAF-AH activity and It will be sufficient to inactivate the amount of PAF that results in the condition. General dosage considerations As a precaution, see Remmington's Pharmaceutical Sciences, 18th edition, Mack Publishin g Co., Easton, PA (1990). Dosage is about 0.1 Will vary between ~ 1000 Atg PAF-AH / kg body weight. The therapeutic composition of the present invention Can be administered by various routes, depending on the pathological condition to be treated. For example Administration may be by intravenous, subcutaneous, oral, suppository, and / or pulmonary routes. May be given.   Due to the pathological condition of the lung, administration of PAF-AH via the pulmonary route is Is shown. Contemplated for use in administration via the lung are, for example, Nebulizers, dose inhalers, and powders standard in the art. A wide range of delivery devices including powder inhalers. Aerozo Delivery of various proteins to the lungs and circulatory system by inhalation of pharmaceutical preparations ei) et al., Pharm. Res., Vol. 7, No. 6, pp. 565-569, (1990) (Leuprolide acetate (leuprolide acetate)), Braquet et al. Cardio.Pharm., Volume 13 Supplement 5): s. Pages 143 to 146, (1989) (endothelin-1), Hubba Hubbard et al., Annals of Internal Medicine, Volume III, Issue 3, Pages 206-212, (1 989) (α1-antitrypsin), Smith et al. Clin. Invest., 84, 1 Pp. 145-1146, (1989) (α-1-proteinase inhibitor), Debs et al. I mmunol., 140, 3482-3488, (1933) (Recombinant gamma interferon and tumor Tumor Necrosis Factor Alpha), published internationally on September 15, 1994, under the Patent Cooperation Treaty (PCT) No. WO 94/20069 (recombinant pegylated granulocyte colony-stimulating factor) Have been.                             BRIEF DESCRIPTION OF THE FIGURES   Numerous other aspects and advantages of the present invention are described in the following detailed description with reference to the following drawings. It will be clear from consideration of the description.   FIG. 1 is a photograph of a PVDF membrane containing PAF-AH purified from human plasma.   FIG. 2 is a graph showing the enzyme activity of recombinant human plasma PAF-AH.   FIG. 3 is a drawing showing recombinant PAF-AH fragments and their catalytic activities.   FIG. 4 shows the results of mass spectrometry for the recombinant PAF-AH product, rPH.2.   FIG. 5 shows the results of mass spectrometry for the recombinant PAF-AH product, rPH.9.   FIG. 6 shows PAF-induced rat paw floatation by topical administration of the recombinant PAF-AH of the present invention. 9 is a bar graph showing tumor inhibition.   FIG. 7 shows inhibition of PAF-induced rat paw edema by intravenous administration of PAF-AH. It is a bar graph.   FIG. 8 shows that PAF-AH inhibits edema induced by PAF, while zymosan (zymosa) n A) edema induced by bar does not stop It is a graph.   FIGS. 9A and 9B show the dose correlation of the anti-inflammatory activity of PAF-AH in rat paw edema. Indicates the result.   Figures 10A and 10B show the efficacy of a single dose of PAF-AH over time in vivo. Represents a result suggesting   FIG. 11 is a line graph showing the pharmacokinetics of PAF-AH in rat circulatory system. You. Also,   FIG. 12 shows the anti-inflammatory effect of PAF-AH on rat paw edema, PAF antagonis. 9 is a bar graph showing a comparison with the lower effect of the present invention.   FIG. 13 shows conditioned media derived from monocytes infected and activated with HIV-1. Results suggesting that PAF-AH neutralizes the apoptotic effect of potassium (CM). You.                             Detailed description of the invention   The following examples illustrate the invention. Example 1 demonstrates the production of PAF-AH from human plasma. 2 shows a novel purification method. Example 2 describes the amino acid microphone of purified human plasma PAF-AH. Describe sequencing. Cloning of full-length cDNA encoding human plasma PAF-AH Is described in Example 3. Putative splice variants of the human plasma PAF-AH gene Body identification is described in Example 4. Cloning of the genomic sequence encoding human plasma PAF-AH The working is described in Example 5. Example 6 shows homology to human plasma PAF-AH cDNA. The cloning of cDNA for dog, mouse, cow, chicken, rat and macaque. Put on. Example 7 demonstrates the enzymatic activity of recombinant PAF-AH transiently expressed in COS7 cells. Shows the results of the assay to be demonstrated. Example 8 shows that E. coli and yeast (S. cerevisiae) were used. And full-length, partially deleted and chimeric human PAF-AH DNA in mammalian cells Describe expression . Example 9 describes a protocol for the purification of recombinant PAF-AH from E. coli and its Figure 4 shows an assay confirming enzyme activity. Example 10 shows amino acid substitution derivatives and Recombinant PAF-AH products, including amino-terminal and carboxy-terminal deletion products And that native PAF-AH isolated from plasma is glycosylated. An experiment is described that establishes Human plasma PAF-AHRN in various tissues and cell lines The results of the Northern blot assay for the expression of A are shown in Example 11, while in The results of in situ hybridization are shown in Example 12. Example 13 includes human Describes the production of monoclonal and polyclonal antibodies specific for plasma PAF-AH . Examples 14, 15, 16, 17, 18, and 19 are each described in animal models. Inflammation, pleurisy, asthma, necrotizing enterocolitis, adult respiratory distress syndrome (ARDS) and Describes the in vivo therapeutic effect of administration of the recombinant PAF-AH product of the invention on pancreatitis . Example 20 describes the in vitro synthesis of recombinant PAF-AH product against neurotoxicity associated with HIV infection. Describe the effect of o. Example 21 shows the sera of human patients exhibiting PAF-AH activity deficiency. Shows the results of the immunoassay of, further considered to be the cause of the defect, The identification of the genetic injury in the patient is described.                                 Example 1   Purify PAF-AH from human plasma to provide material for amino acid sequencing did. A.Optimization of purification conditions   First, low-density lysate is removed from plasma using phosphotungstate. Poprotein (LDL) particles are precipitated and then solubilized in 0.1% Tween 20; And Stafforini and others (1987), supra, a DEAE column (Pharmacia, Uppsala, Su Chromatography), re-evaluation of the solubilization and subsequent Elution of PAF-AH activity from the DEAE column required for purification conditions is inconsistent. Was.   Tween 20, CHAPS (Pierce Chemical Co., (Rockford, Illinois) and octylglucoside to solubilize LDL particles Then, it was evaluated by centrifugation and Kell filtration chromatography. With CHAPS, Recovery of solubilized actives is 25% higher than Tween 20, and octylglucose 300% more than was recovered. Then, LDL precipitate solubilized with 10 mM CHAPS Use a DEAE Sepharose Fast Flow Column (anion exchange column, Pharma Fractionation using a buffer containing 1 mM CHAPS for the evaluation of the next column. A large pool of partially purified PAF-AH ("DEAE pool") was obtained.   The DEAE pool has various potential uses in the purification of additional PAF-AH activators. Used as starting material to test the chromatography column. Test Columns are Blue Sepharose Fast Flow (Pharmacia) Iligand affinity column), S-Sepharose Fast Flow (Pharma Shea) (cation exchange column), Cu chelating Sepharose (Pharmasi) A), (Metal ligand affinity column), Fractogel S (EM ・ Separations (EM Separations), Gibbstown, New York -Jersey) (cation exchange column) and Sephacryl-200 (Pharmacia) (gel filtration column). These chromatographs All methods are low and unsatisfactory when operated at 1 mM CHAPS. Purification. Continue gel filtration of Sephacryl S-200 in 1 mM CHAPS. After performing over-chromatography, the approximate size of the expected 44 kDa Rather, enzymatically active fractions are obtained that elute over a wide size range. Was. Taken together, these results indicate that LDL lipoproteins aggregate in solution. Had suggested.   Therefore, aggregation of the PAF-AH active substance was analyzed by analytical gel filtration chromatography. Different LDL samples were evaluated. From DEAE pool and freshly solubilized LDL precipitate Samples were prepared from Superose 12 (Pharose) equilibrated with buffer containing 1 mM CHAPS. (Lumasia). In all samples, most of the actives exceeded 150 kDa, Eluted over a very wide range of molecular weights. Then a buffer containing 10 mM CHAPS When the sample was analyzed using Sperose 12 equilibrated in step 2, most of the active substance was PAF-AH active. It eluted around the expected 44 kDa for the body. However, the sample contains The high molecular weight region corresponding to the product contained some PAF-AH activity.   Subsequently, when other samples were tested by gel filtration, the range was approximately 44 kDa. Only PAF-AH active was eluted. These samples were 10 mM CH in the presence of 0.5 M NaCl. LDL precipitate solubilized in APS and adjusted to 10 mM CHAPS after elution from DEAE column It was a new DEAE pool. These data show that non-aggregated PAF-AH This suggests that at least 10 mM CHAPS is required to maintain. DEAE After chromatography, but before the subsequent chromatography step, 1 m Increasing the CHAPS concentration from M to 10 mM caused a dramatic difference in purification. For example, S- Purification of PAF-AH on Sepharose Fast Flow increased from 2x to 10x Great. PAF-AH activator was isolated on Blue Sepharose Fast Flower in 1 mM CHAPS. Irreversibly coupled to the ram However, the highest level of purification was achieved with 10 mM CHAPS on this column. 10mM  Prior addition of CHAPS did not improve DEAE chromatography.   Cu chelating Sepharose after Blue Sepharose Fast Flow Column Chromatography revealed that the PAF-AH activity was 15-fold concentrated. Do not boil the sample As long as PAF-AH activity can be recovered from reduced SDS-polyacrylamide gels Was also determined. Eluted from Cu-chelating Sepharose column Quality of the gel was determined by subjecting the gel to silver staining when subjected to SDS-polyacrylamide gel electrophoresis. , Which corresponded to the major protein band seen when B.PAF-AH Purification protocol   Thus, a novel protocol used to purify PAF-AH for amino acid sequencing The col consisted of the following steps performed at 4 ° C. Human plasma Divide into 900ml aliquots in a bottle of Turtle Nalgene, pH 8.6 Was adjusted to Then 90 ml of 3.85% sodium phosphotungstate followed by 23 ml of 2M  MgCl_TwoWas added to precipitate LDL particles. Then, plasma at 3600 g Centrifuge for 15 minutes. The pellet was resuspended in 800 ml of 0.2% sodium citrate . 10 g NaCl and 24 ml 2M MgCl_TwoWas added to precipitate LDL again. 36 LDL particles were pelletized by centrifugation at 00 g for 15 minutes. Repeat this wash twice Repeated. The pellet was then frozen at -20 ° C. LDL particles from 5L of plasma Resuspended in 5 L buffer A (25 mM Tris-HCl, 10 mM CHAPS, pH 7.5) overnight Stirred. The solubilized LDL particles were centrifuged at 3600 g for 1.5 hours. Collect the supernatant and leave To remove all solid matter Was filtered using Whatman 113 filter paper. Remove the solubilized LDL supernatant DEAE Sepharose solution equilibrated with Buffer B (25 mM Tris-HCl, 1 mM CHAPS, pH 7.5) Loaded on an Astflow column (11 cm × 10 cm, IL resin volume, 80 ml / min). Absorbance The column was washed with buffer B until was returned to baseline. 8L, 0-0.5 The protein was eluted using a concentration gradient of M NaCl and 480 ml fractions were collected. This work Required for binding to the following Blue Sepharose Fast Flow columns Met. Acetyl hydration for each fraction was performed essentially as described in Example 4. Drolase activity was assayed.   Pool the active fractions and provide sufficient CHAPS to bring the pool to approximately 10 mM CHAPS. Was added. Blue Sepharose Fast equilibrated with Buffer A containing 0.5 M NaCl DEAE pool at 4ml / min overnight on a flow column (5cm x 10cm, 200ml bed capacity) Overload. Equilibration buffer at 16 ml / min until absorbance returns to baseline The column was washed with. PAF-AH activator is 0.5 ml KSCN (Kaoto) at 16 ml / min. The mixture was eluted stepwise using buffer A containing lipophilic salt), and 50 ml fractions were collected. This As a result, purification was performed over 1000 times. Pool active fractions, 1M Tris The pool was adjusted to pH 8.0 using hydrochloric acid, pH 8.0. Blue Sepharose Fas The active pool from flow chromatography was buffer C (25 mM Tris-HCl) , 10 mM CHAPS, 0.5 M NaCl, pH 8.0 (pH 7.5 was also effective)) Negative for rating Sepharose column (2.5cm x 2cm, 10ml bed capacity, 4ml / min) Loaded and the column was washed with 50 ml of buffer C. PAF-AH active was 50 mM imida Elution was carried out with 100 ml of buffer C containing sol, and 10 ml fractions were collected. PAF-AH activity Were pooled and dialyzed against buffer A. PAF-AH activity In addition to a 15-fold concentration of the body, a Cu-chelating Sepharose column Resulted in some purification. Cu chelating Sepharose spool to 37 ° C For 15 minutes in 50 mM DTT and load on a 0.75 mm, 7.5% polyacrylamide gel did. Cut slices of gel every 0.5 cm, 200 μl of 25 mM Tris-HCl, 10 mM CHAPS, Placed in a disposable microcentrifuge tube containing 150 mM NaCl. Crush the flakes to 4 ° C Allowed to incubate overnight. The supernatant of each gel slice was then analyzed for PAF-AH activity. Assay, any protein band on SDS-PAGE contains PAF-AH activity Was determined. PAF-AH activity was found in an approximately 44 kDa band. parallel The proteins from the two gels that were used for the experiments were subjected to PVDF membrane (Immobilon). ) -P, transferred to Millipore using electricity and stained with Coomassie Blue Was. A photograph of the PVDF film is shown in FIG.   As shown in Table 1 below, approximately 200 μg of PAF-AH from 5 L of human plasma was 2 × 10⁶ Double purified. In comparison, Staffolini et al. (1987), supra, include PAF-AH 3 × 10 of active form^FourA two-fold purification is described.   In summary, the following steps were performed: (1) Solubilization and chromatograph in 10 mM CHAPS. Chromatography, (2) Blue Sepharose Fast Flow, etc. Chromatography on affinity column, (3) Cu chelating Sepharose Chromatography on a Cu ligand affinity column such as ) Elution of PAF-AH from SDS-PAGE is unique, and amino Critical for the successful purification of plasma PAF-AH for acid sequencing.                                 Example 2   For amino acid sequencing, and from the PVDF membrane containing PAF-AH described in Example 1, Excision of the 44 kDa protein band Applied Biosystems 473A Protein Sequencer And sequenced. Approximately 44 kDa protein band corresponding to PAF-AH activity N-terminal sequence analysis showed that the band contained two major sequences and two minor sequences. It was suggested that it contained a unique sequence. The ratio of the two major arrays is 1: 1 Therefore, it was difficult to decode the sequence data.   To determine the sequence of the two major proteins separated on the SDS gel, Cut two PVDF membranes in parallel, including the 44kDa band, which were tested in parallel. The upper and lower portions were separately subjected to sequencing.   The N-terminal sequence obtained for the lower half of the membrane is     SEQ ID NO: 1     FKDLGEENFKALVLIAF Met. A search of the protein database showed that this sequence was Was found to be a fragment of the Sequence determination for the upper half of the same PVDF membrane And the determined N-terminal amino acid sequence is     SEQ ID NO: 2     IQVLMAAASFGQTKIP Met. This sequence is mapped to any protein in the searched database. And red blood cell cytoplasmic PAF- in Staffolini et al. (1993), supra. Reported about AH,     SEQ ID NO: 3     MKPLVVFVLGG Also differed from the N-terminal amino acid sequence. The new sequence (SEQ ID NO: 2) As described in Example 3, it was used for cDNA cloning of human plasma PAF-AH.Example 3   A full-length clone encoding human plasma PAF-AH was cloned into a macrophage cDNA library. Isolated from Lee. A.Construction of macrophage cDNA library   Poly A from macrophages derived from peripheral blood monocytes⁺RNA was collected. Invitroge Invitrogen Copy Kit (San Diego, CA) Was used to generate double-stranded, blunt-ended cDNA and expressed in mammalian cells. Before insertion into the vector, pRc / CMV (Invitrogen), the cDNA must contain a BstxI adapter. Putter was connected. The resulting plasmid is transferred to the large intestine by electroporation. Introduced into strain XL-1 blue. A total of 978 agarose sprays were transformed. The seeds were seeded at a density of about 3000 colonies per sheet. Prepare each plate separately The resulting plasmid DNAs are kept as individual pools and 300,000 We also collected into larger pools, representing loans. B.PCR Library screening   A degenerate antisense screen based on the novel N-terminal amino acid sequence described in Example 2. Polymerase chain reaction using oligonucleotide primers The lophage library was screened. The sequence of the primer is Described according to PAC nomenclature, where "I" is inosine.     SEQ ID NO: 4     5 ’ACATGAATTCGGIATCYTTIGTYTGICCRAA3’ To select the third nucleotide for each codon of the primer, Wada et al. Nuc. Acids Res., 19S, 1981-1986, (1991) codon selection table was used. Primers were used for macrophages of 300,000 clones. In order to screen the storage library pool, all clones of pRc / CMV Specific to either the SP6 or T7 promoter sequence located next to the Used in combination with the appropriate primers. For all PCR reactions, 100 ng of template cDNA, 1 μg of each primer, 0.125 mM of each dNTP, 10 mM of Tris-HCl, pH 8.4, 50 mM MgCl_Two And 2.5 units of Taq polymerase. First denaturation step at 94 ° C for 4 minutes And 30 cycles of amplification at 94 ° C for 1 minute, 60 ° C for 1 minute and 72 ° C for 2 minutes. Was. The resulting PCR product is pBluestarlipt SK^-(Stratagene (Stra tagene), La Jolla (California). The nucleotide sequence is determined by the dideoxy chain terminator method. Specified. The PCR product contains the sequence predicted by the novel peptide sequence and has the SEQ ID NO: : 7 corresponding to nucleotides 1-331.   The PCR primers described below are specific to the cloned PCR fragment described above. Yes, designed to identify full length clones.     Sense primer (SEQ ID NO: 5)     5’TATTTCTAGAAGTGTGGTGGAACTCGCTGG3 ’     Antisense primer (SEQ ID NO: 6)     5’CGATGAATTCAGCTTGCAGCAGCCATCAGTAC3 ’ A PCR reaction utilizing these primers was performed as described above and initially 300,000 The cDNA pool of the clones is then subdivided into the appropriate sub- The subset was screened. Then, a PCR product of the expected size Three pools of 3000 clones produced were used for bacterial transformation. C.Library screening by hybridization   DNA from the transformed bacteria is used as a probe with the original cloned PCR fragment Screening was continued by the hybridization used. Colony Was blotted onto nitrocellulose and 50% formamide, 0.75M sodium chloride System, 0.075 M sodium citrate, 0.05 M sodium phosphate, pH 6.5, 1% polyvinyl chloride Lupyrrolidone, 1% ficoll, 1% bovine serum albumin and 50 ng / ml sonication Prehybridization and hybridization in purified salmon sperm DNA Was done. The hybridization probe is a random hexamer primin Labeled by After overnight hybridization at 42 ° C, At 42 ° C., 0.03 M sodium chloride, 3 mM sodium citrate, 0.1% SDS Washed well in. Determine nucleotide sequence of 10 hybridizing clones did. One of the clones, clone sAH 406-3, is PAF purified from human plasma. -Contains the sequence predicted by the original peptide sequence of the AH activator. Human plasma PAF The DNA and deduced amino acid sequence of -AH are shown in SEQ ID NOs: 7 and 8, respectively.   Clone sAH 406-3 has a reading encoding a predicted 441 amino acid protein. Contains a 1.52 kb insert with a consensus frame. Relatively hydrophobic at the amino terminus Residue 41, an N-terminal region identified by protein microsequencing, Present before the amino acid (isoleucine at position 42 of SEQ ID NO: 8). Then, Protein is either a long signal sequence or truncated to function Have additional peptides in addition to the signal sequence that result in a mature protein Maybe. Shi The presence of a signal sequence is one feature of secreted proteins. In addition, oh Active parts of all known mammalian lipases, microbial lipases and serine proteases The consensus GxSxG motif, which is believed to contain the serine Included in the protein encoded by AH 406-3 (amino acid 271 of SEQ ID NO: 8) ~ 275). Chapus et al., Biochimie, 70, 1223-1224, (1988) and See Brenner, Nature, 334, 528-530, (1988).   Table 2 below shows the amino acids of the human plasma PAF-AH of the present invention predicted from SEQ ID NO: 8. The acid composition, as described by Staffolini et al. (1987), supra, is by definition 1 is a comparison of the amino acid composition of the products produced.Amino acid composition of the mature form of human plasma PAF-AH of the present invention, referred to as human plasma PAF-AH The amino acid composition of previously purified substances that had been identified was clearly different.   Nucleotides and deduced amino acids of the bovine brain cytoplasmic PAF-AH of Hattori et al. Acid sequence and nucleic acid of human plasma PAF-AH of the present invention Attempts to align with otide and amino acid sequences will reveal significant differences in sequence. No structural similarity was observed.Example 4   5 'untranslated region (nucleotides 31 to 52 of SEQ ID NO: 7) and 3' end of PAF-AH cDNA Over the translation stop codon (nucleotides 145-1487 of SEQ ID NO: 7) Macrophages and stimulated PBMC using primers that hybridize to  When PCR is performed on the cDNA, splice variability presumed to be the human PAF-AH gene One ant was detected. The PCR reaction resulted in two bands on the gel, One corresponds to the expected size of the PAF-AH cDNA of Example 3, and one is It was about 100bp shorter. By sequencing both bands, the larger band Is the PAF-AH cDNA of Example 3, while the shorter band is the signal of plasma PAF-AH. Exon 2 of the PAF-AH sequence encoding the putative putative and propeptide sequences (Example 5 below). Think of a catalytic triad Amino acids and all cysteines were present in the shorter clone The biochemical activity of the clone or the encoded protein depends on the activity of plasma enzymes. I think it might be comparable.   PAF-AH splice bars predicted to encode cytoplasmically active enzymes To begin assessing the biological relevance of lianto, macrophages derived from blood monocytes were The relative abundance of the two species in the germ was determined by the RNase protection method . No message (mRNA) was present in the freshly isolated monocytes However, both messages appear on the second day when monocytes differentiate into macrophages in vitro. (MRNA) was found and persisted until day 6 of culture. The two messages (mRNA) The amount of It was almost the same throughout. In contrast, a similar analysis in nerve tissue showed PAF-AH Only the full-length message (mRNA) predicted to encode the full-length extracellular form of It was clarified that only expressed.                                 Example 5   The genomic sequence of human plasma PAF-AH was also isolated. Under high stringency conditions Lambda and P1 fur containing human genomic DNA The structure of the PAF-AH gene was determined by isolating the diclones. Phage Subcloned fragments of the clone and cloned into cDNA clone sAH 406-3 And sequenced using primers designed to anneal at regular intervals. A new design designed to recombine further with the intron region flanking the exon Additional sequencing primers are used for exon-intron boundaries to confirm sequence. Used to resequencing across the world. The exon / intron boundary is The kenome sequence and the cDNA sequence were diverged. For these analyses, Thus, it was revealed that the human PAF-AH gene was composed of 12 exons.   Some of exons 1, 2, 3, 4, 5, 6, and 7 are lambda FIX (Strataji Was isolated from a library of male fetal placentas constructed in Nitro Blot phage plaques on cellulose, 50% formamide, 0.75M chloride Sodium, 75 mM sodium citrate, 50 mM sodium phosphate (pH 6.5), 1% poly Vinylpyrrolidone, 1% ficoll, 1% bovine serum albumin, and more than 50ng / ml Prehybridization and hybridization in sonicated salmon sperm DNA Was conducted. Phage clone containing part of exons 2-6 and 7 The hybridization probe used to identify is cDNA clone sA It consisted of H406-3 as a whole. A clone containing exon 1 is a cDNA clone. Identified using a fragment from the 5 'end of the loan (nucleotides 1-312 of SEQ ID NO: 7). Was. Both probes, by hexamer random priming,³²Label with P did. After overnight hybridization at 42 ° C, blots were incubated at 42 ° C. Washed well in 30 mM sodium chloride, 3 mM sodium citrate, 0.1% SDS. In addition to the exon 1, 2, 3, 4, 5, and 6 DNA sequences, The tron sequences are set forth in SEQ ID NOs: 9, 10, 11, 12, 13, and 14, respectively. .   The rest of exon 7 and exons 8, 9, 10, 11, and 12 are human P1 It was subcloned from a P1 clone isolated from a genomic library. Nitrose Blot P1 phage plaques on lulose, 0.75 M sodium chloride, 50 mM Sodium phosphate (pH 7.4), 5mM EDTA, 1% polyvinylpyrrolidone, 1% ficoll , 1% bovine serum albumin, 0.5% SDS, and 0.1 mg / ml total human DNA. Hybridization and hybridization were performed. Hexamer random By priming³²Hybridization probes labeled with P 2.6 kb EcoR of genomic DNA derived from the 3 'end of the lambda clone isolated as indicated It consisted of one fragment. This fragment contains exons present on the phage clone. 6 and part of exon 7. Hybridization at 65 ° C overnight After performing the blot, the blot was washed as described above. Exons 7, 8, 9, 10, 11 , And 12 plus a partial surrounding intron sequence, respectively. Column numbers: 15, 16, 17, 18, 19, and 20.Example 6   Full-length plasma PAF-AH cDNA clone was cloned into mouse, dog, bovine and chicken spleen cDNA A from the rat thymus cDNA library Clones were isolated. Clones are cloned into human cDNAs with low stringency. Identified by hybridization (hybridization conditions were 50% Example 5 except that 20% formamide was used instead of formamide. As described for exons 1-6). Human PAF-AH sAH 406-3 cDNA A 1 kb HindIII fragment of the clone (nucleotides 309 to 1322 of SEQ ID NO: 7) was probed. Used as In addition, a partial monkey clone was constructed using the nucleoside of SEQ ID NO: 7. Macaque brain cDN by PCR using primers based on Pide 285-303 and 851-867 Isolated from A. Mouse, dog, cow, chicken, rat, and macaque cDNA The nucleotide and deduced amino acid sequences of the clone are shown in SEQ ID NO: 2, respectively. 1, 22, 23, 24, 25 and 26.   Compare the deduced amino acid sequences of those cDNA clones with the human cDNA clone. As a result, the percentage values of amino acid identity shown in Table 3 below were obtained.  About 38% of the amino acid residues are completely conserved in all sequences. most The regions with diversity include the amino terminus (including the signal sequence) and the carboxy terminal. At the ends, these are indicated in Example 10 as not critical to enzyme activity. I'm going. Gly-Xaa- found in neutral lipase and other esterases The Ser-Xaa-Gly motif (SEQ ID NO: 27) is a bovine, dog, mouse, rat and It was stored in chicken PAF-AH. Serine at the center of this motif Acts as a nucleophilic active site for the enzyme. Active site components Spartic acid and histidine (Example 10A) were also preserved. The present invention G plasma PAF-AH therefore utilizes a catalytic triad And neutral if not exhibiting homology between neutral lipase and other sequences It can be assumed that the lipase has an α / β hydrolase conformation.   In addition, human plasma PAF-AH is Expected to have a region that mediates specific interactions with protein particles It is. Interaction with these particles is due to the large conserved size of amino acids between species. Has a stretch but does not contain the catalytic triad of the enzyme, It may be mediated by the N-terminal half of the molecule.                                 Example 7   Human plasma PAF-AH cDNA clone sAH 406-3 (Example 3) has PAF-AH activity To determine if it encodes a protein, the pRc / CMV expression construct was Expressed transiently in cells. Transfected by DEAE dextran method Three days later, COS cell media was assayed for PAF-AH activity.   Cells were seeded at a density of 300,000 cells per 60 mm tissue culture dish. next Days, 0.5 mg / ml DEAE dextran, 0.1 mM chloroquine and 5-10 μg of plasmid D Cells were incubated for 2 hours in DMEM containing NA. The cells are then washed with 10% DM Treat for 1 minute in phosphate buffered saline containing SO, wash with medium, and Pretreatment of endogenous bovine serum with propylfluorophosphate (DFP) -AH inactivated in DMEM containing 10% fetal calf serum did. After incubation for 3 days, the medium from the transfected cells was Assayed for F-AH activity. In the presence of either 10 mM EDTA or 1 mM DFP Or in the absence of the assay, as previously described by Staffolini et al. (1987), supra. The recombinant enzyme is calcium-independent as reported for plasma PAF-AH It was determined whether it was inhibited by the serine esterase inhibitor DFP. Negative pair Controls have pRc / CMV lacking inserts or sAH 406-3 inserts in the opposite direction Transfected with pRc / CMV Cells were included.   PAF-AH activity in transfected supernatants was (1990), supra. In summary, [acetyl-^ThreeH] PAF (New England Nuclear, Boston, Masachi From New York^ThreePAF-AH activity was measured by measuring H-acetate hydrolysis. The properties were measured. Aqueous release^ThreeH-acetate is an octadecyl silica gel cartridge. Judge (Baker Research Products, Phillips) Reversed-phase column chromatography using Phillips-burg, Pennsylvania) Separated from the labeled substrate by a fee. 0.1 M hepe in a 50 μl reaction volume The assay was performed using 10 μl of the transfectant supernatant in buffer, pH 7.2. went. Labeling: The ratio of unlabeled PAF was 1: 5. Substrate was used. Incubate the reaction at 37 ° C for 30 minutes and add 40 μl of 10 M acetic acid. Stopped by the addition. Through octadecyl silica gel cartridge The solution was washed, then the cartridge was rinsed with 0.1 M sodium acetate. Each sample The aqueous eluates were collected and counted for 1 minute in a liquid scintillation counter. Enzyme activity was expressed as counts per minute.   As shown in FIG. 2, medium from cells transfected with sAH 406-3 was It had PAF-AH activity at a level four times that of the background. This activity is ED It was not affected by the presence of TA, but was blocked by 1 mM DFP. these From the observation, it was found that clone sAH 406-3 It was proved that it was loaded.                                 Example 8   DNA of human plasma PAF-AH with full length and various deletions and mouse-human texture La PAF-AH DNA is expressed in Escherichia coli and yeast by recombinant methods, and It was stably expressed in milk cells. A.Expression in E. coli   Clone sAH40 for easy subcloning into E. coli expression vectors To generate a fragment encoding the protein of human plasma PAF-AH cDNA from 6-3 PCR was used. The subcloned segment is Ile₄₂(SEQ ID NO: 8, human Human gene with codon encoding N-terminal residue of enzyme purified from plasma) Began at the 5 'end of the The construct contains the gene up to the original stop codon. The rest was included. The 5 'sense PCR primer used was     SEQ ID NO: 28     5 'TATTCTAGAATTATGATACAAGTATTAATGGCTGCTGCAAG 3 ' It contained the XbaI cloning site as well as the dong (underlined). used The 3 'antisense primer is     SEQ ID NO: 29     5 'ATTGATATCCTAATTGTATTTCTCTATTCCTG 3' and the stop code of sAH406-3 And contained an EcoRV cloning site. PCR reactions are essential The procedure was as described in Example 3. The resulting PCR products were XbaI and Eco Digest with RV and Trp promoter upstream, close to cloning site PBR322 vector containing (DeBoer et al., PNAS, 80, 21-25, (1983)) Subcloned into E. coli strain XL-1 blue was transformed with the expression construct. And then 100 μg / ml Culture was performed in L broth containing carbelicillin. Overnight culture Pellet transformants from cultured cultures, 50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 10 mM CHAPS, 1 mM EDTA, 100 μg / ml lysosome, and 0.05 trypsin inhibitor Resuspended in lysis buffer containing harmful units (TIU) / ml of aprotinin . After incubation on ice for 1 hour and sonication for 2 minutes, Lysates were assayed for PAF-AH activity as described above. Expression construct (trp E. coli transformed with AH) produces a product with PAF-AH activity. I was See Table 6 in Example 9.   tacII promoter (Deboe, supra), Salmonella typhimurium Arabinose (ara) B promoter from Horwitz et al., Gene, 14 309-319, (1981)) and the bacteriophage T7 promoter. The construct containing the promoter was also used to express human PAF-AH sequences in E. coli. Used for Trp promoter (pUC trpAH), tacII promoter (pUC tac A H) and the construct consisting of the araB promoter (pUC ara AH) New England Biolabs, Mass. State, while the construct consisting of the T7 promoter (pET AH) is plasmid Partnered in pET15B (Novagen, Madison, Wis.) I stood up. AraB promoter fused to the ribosome binding site of the T7 promoter region The construct containing the hybrid promoter, pHAB / PH, also consists of pET15 Assembled in B. All E. coli constructs or 20-50 U / ml / OD₆₀₀PAF within the range -Produced AH activity. This activity indicates that more than 1% of total cellular protein is Indicates that it corresponds to Parkin.   Some of the E. coli expression constructs with extended amino termini also produce PAF-AH. The birth was examined. The N-terminus of native plasma PAF-AH is determined by amino acid sequencing ( According to Example 2), Ile₄₂Identified as However, Ile₄₂Upstream close to Does not match the amino acid found at the signal sequence cleavage site (see That is, lysine is not found at position -1, so it does not follow the "-3-1 rule", Von Heijne, Nuc. Acjds Res., Vol. 14, pp. 4683-4690, (1986) Please refer to). Possibly, the more classical signal sequence (M₁~ A₁₇Or M₁ ~ P_{twenty one}) Is recognized by the cell secretory system and is subsequently doproteolytic cleavage) is performed. For PAF-AH beginning with the starting methionine The entire coding sequence (nucleotides 162-1487 of SEQ ID NO: 7) in E. coli To do so, we made it using the trp promoter. As shown in Table 4, this construct Produced active PAF-AH, but Ile₄₂1 / 50th of the level of the original construct starting with Only expressed. Val₁₈Other expression constructs beginning with Tides 213-1487) produce active PAF-AH at about one-third the level of the original construct did. From these results, the activity of recombinant PAF-AH produced in E. coli Thus, it is suggested that extension of the amino terminus is not important or essential.   The partially-deleted recombinant human PAF-AH product further comprises a low copy number plasmid, Promoter that can be induced by adding arabinose to the culture solution It was also produced with E. coli using Such PAF-AH products with N-terminal deletion One is the polypeptide encoded by the full-length PAF-AH cDNA (SEQ ID NO: 8) Amino acid residue Met₄₆From Asn₄₄₁Set of DNA encoding up to amino acid residues It is a recombinant expression product and is named rPH.2. Production of rPH.2 in bacterial cells The plasmid used for this is pBAR2 / PH.2, which is (1) methionine at position 46. SEQ ID NO: 297-1487 encoding human PAF-AH starting at the codon (2) araB-C from the arabinose operon of Salmonella Promoter and araC gene, (3) transcription termination sequence from bacteriophage T7, And (4) a plasmid derived from pBR322 having a replication origin derived from bacteriophage f1. Mid.   In particular, pBAR2 / PH.2 contains the following segments of DNA: Was. That is, (1) the nucleotide at position 6274 from the destroyed AatII site at position 1994 The origin of replication from the bacterial plasmid pBR322 and the amp Contains genes encoding resistance to either cylin or tetracycline From the EcoRI site at position 6274 to the XbaI site at position 131, DNA from the arabinose operon of Monella (GenBank accession numbers M11045, M11046, M11047, J01797), (3) From the XbaI site at position 131 to the NcoI site at position 170, pET-2 1b (Novaken, Madison, Wis.) (4) From the NcoI site at position 170 to the XhoI site at position 1363, human PAF-AH cDNA Sequence, and (5) from the XhoI site at position 1363 to the disrupted AatII site at position 1993, Transcription termination sequence from bacteriophage T7 and replication from bacteriophage f1 A DNA fragment from pET-21b (Novagen) containing the origin of was included.   An additional PAF-AH product, designated rPH.9, is a full-length PAF-AH cDNA (SEQ ID NO: 8). Amino acid residue Met of the polypeptide encoded by₄₆From Ile₄₂₉Up to It is a recombinant expression product of DNA encoding amino acid residues. DN encoding rPH.9 A is inserted into the same vector used to produce rPH.2 in bacterial cells Was done. This plasmid was named pBAR2 / PH.9, which is specifically Segment. That is, (1) disruption at position 1958 of the vector sequence From the AatII site to the EcoRI site at nucleotide 6239, the bacterial plasmid Origin of replication from pBR322 and either ampicillin or tetracycline (2) from the EcoRI site at position 6239 to 131 Up to the XbaI site, DNA from the arabinose operon of Salmonella (GenBank Accession number M11045, M11046, M11047, J01797), (3) XbaI site at position 131 And pET-21b (Novagen, Madison, Wisconsin) State) DNA containing ribosome binding site, (4) NcoI site from position 170 to position 1328 Up to the XhoI site, human PAF-AH DNA sequence, (5) from the XhoI site at position 1328 to position 1958 By the disrupted AatII site, a transcription termination sequence from bacteriophage T7 and PET-21b containing the origin of replication from bacteriophage f1 (Novagen, Madison Inc., Wisconsin).   The expression of the PAF-AH product in pBAR2 / PH.2 and pBAR2 / PH.9 was determined in the presence of glucose and Strictly suppressed in the absence of arabinose, but depleted in glucose When L-arabinose is added to nutrients, it functions as a strong promoter. Under the control of the motor. Selection for cells containing the plasmid depends on the culture medium Either ampicillin (or related antibiotics) or tetracycline Can be achieved through the addition of PAF-AH products from various E. coli strains Can be used as a host for recombinant expression of W3110, D For arabinose metabolism of H5α, BL21, C600, JM101 and their derivatives Prototrophic strains, strains containing mutations with low protease activity such as CAG629 and KY1429 And strains lacking the ability to degrade arabinose, such as SB7219 and MC1061 Including, but not limited to. Can degrade arabinose The advantage of using a strain that does not work is that the inducer (arabinose) for PAF-AH production is It is not depleted from the medium during the induction period, so it can metabolize arabinose Significantly higher levels of PAF-AH compared to levels obtained with strains. You. Any suitable medium for expressing active PAF-AH products in various E. coli strains And culture conditions may be used. For example, L- Broth, EDM295 (M9 base with yeast extract and acid hydrolyzed casein Enriched media compositions, such as the minimum medium, or A675 (glycerol as a carbon source) A-based minimal medium used, supplemented with trace elements and vitamins and adjusted to pH 6.75 ) Allows for substantial production of rPAF-AH products Becomes Tetracycline is included in the medium to support plasmid selection Things.   Plasmid pBAR2 / PH.2 was transformed into E. coli strain MC1061 (ATCC53338). This strain has a deletion of the arabinose operon, which It is a strain that cannot metabolize water. MC1061 is also a leucine auxotrophy , Batch-supply using defined media containing casamino acids complementing leucine mutations Cultured by culture.   Escherichia coli MC1061 cells transformed with pBAR2 / PH.2 contain 2 gm / L glucose The cells were grown at 30 ° C. in a batch medium. Glucose is a carbon source for cell growth And the suppression of expression from the arabinose promoter. You. When glucose levels are depleted (below 50 mg / L) nutrient supply (300 g / L Containing glucose) was started. 16:00, at a rate that limits the formation of acid by-products The feed rate was increased linearly over time. At this point, glucose instead of glucose The nutrient supply was switched to a medium containing lyserol. At the same time, 500g / L L-arabi North was added to a final concentration of 5 g / L. Glycerol supply is constant Sustained at feed rate for 22 hours. Harvest cells by filtration through hollow fibers, approximately 10 times To a suspension. Cell paste was stored at -70 ° C. About 80g / L final fine Cell volume (OD₆₀₀= 50-60) and has PAF-AH activity of 65-70 units / OD / ml. , Which represented about 10% of total cellular protein . A final culture volume of about 75 liters contained 50-60 grams of PAF-AH.   When pBAR2 / PH.2 or PH.9 is expressed by strain SB7219 or MC1061, rPAF-AH High-level production of products can be achieved. Lack arabinose resolution Other strains are also suitable for high cell density production. Preferably, the cells are Cultured under the following conditions. Exponentially growing SB7219; pBAR2 / PH.2 and SB7219; pBAR 2 / PH.9 strain was inoculated into a fermenter containing a batch medium containing 2 g / L glucose. I do. Once glucose is consumed, tanning is needed to maintain healthy exponential growth. Glycero with trace elements, vitamins, magnesium and ammonium salts Supply the solution. Keep tank at 30 ° C and supply air to replenish oxygen And stir to maintain the dissolved oxygen level above about 15% saturation. Culture solution If the cell density exceeds 110 g / L (wet cell mass), a constant feed rate is imposed and the L-A Add rabinose to the culture (final concentration about 0.5%). Production of target substance is 16-2 Observed for 2 hours. Typically, the culture is performed up to 40-50 g / L (dry cell weight) . Harvest cells by centrifugation, store at -70 ° C, and use rPAF-AH product for analysis. Is purified. 150 units / ml / OD₆₀₀A specific productivity of more than is constantly obtained. B.Expression in yeast cells   Recombinant human PAF-AH was also expressed in yeast (Saccharomyces cerevisiae). rPAF -Use yeast ADH2 promoter to drive AH expression, 7U / ml / OD₆₀₀Produced ( See Table 5 below). C.Expression of PAF-AH in mammalian cells   1.Expression of human PAF-AH cDNA construct   With the exception of pSFN / PAFAH.1, plasmids constructed for expression of PAF-AH include: To allow increasing the copy number of the plasmid in COS cells, A strong viral promoter derived from cytomegalovirus, bovine growth hormone A polyadenylation site from the gene and the SV40 origin of replication are used. The plasmid is The cells were electroporated.   The first set of plasmids contains the 5 'flanking sequence of human PAF-AH cDNA (pDC1 / PA FAH.1) or both 5 ′ or 3 ′ flanking sequences (pDC1 / PAFAH.2) Sequences from other genes known to be expressed at high levels in animal cells Was constructed by replacing Transfer these plasmids into COS, CHO or 293 cells. By transfecting, in Example 7, COS cells were transiently transferred. Clone sAH 406-3 after the clone was cloned. Per ml or 2-4 times above background) produced PAF-AH . Friend spleen for cytomegalovirus promoter Another plasmid was constructed containing the cas-forming virus promoter. Human PAF-AH  The cDNA was prepared under the control of a friend spleen focus-forming virus promoter. The plasmid was inserted into the pmH-neo (Hanh et al., Gene, 127, 267 (1993)). pSFN / PA This plasmid, designated FAH.1, was used to transfer the myeloma cell line NSO. After screening hundreds of clones, 0.15-0.5 units / ml of PAF-AH Two transfectants exhibiting sex (4B11 and 1C11) were isolated. Specific activity is 50 00 units / mg, and the productivity of these two NSO transfectants was about 0.1 mg / mg. Applicable to L.   2.Expression of mouse-human chimeric PAF-AH gene construct   The mammalian expression vector pRc / CMV contains a cDNA encoding mouse PAF-AH. After transfection of COS cells with budding (pRc1 / MS9), 5-10 units / ml Secreted PAF-AH was produced at a level of . The specific activity of mouse PAF-AH was estimated to be almost similar to that of the human enzyme, and CDNA is expressed at levels 500-1000 times higher than human PAF-AH cDNA.   To examine the differences between human and mouse PAF-AH expression levels in COS cells Two mouse-human chimeric genes were constructed and tested for expression in COS cells. Was. The first of these, pRc / PH.MHC1, is a mouse PAF-AH polypeptide ( SEQ ID NO: 21 ) Is fused to the C-terminal 343 amino acids of human PAF-AH The amino acid-encoding sequence into the expression vector pRc / CMV (Invitrogen, Sande Included in Diego, California). Second in plasmid pRc / PH.MHC2 Of the mouse PAF-AH polypeptide in pRc / CMV Amino acid fused to the amino acid fused to 400 amino acid residues at the C-terminal side of human PAF-AH Contains the array to load. Transfection of COS cells using pRc / PH.MHC1 As a result, PAF-AH activity of 1-2 units / ml was accumulated in the medium. Transform with pRc / PH.MHC2 Conditioned medium from transfected cells is only 0.01 units / It was found to contain only ml of PAF-AH activity. From these experiments, mice and The difference between the expression levels of the PAF-AH gene in the Fragment or the corresponding RNA encoding this region of the PAF-AH protein Or at least partially attributed to a DNA segment .   3.PAF-AH Recoding of the first 290 bp of coding sequence   Low levels of human PAF-AH biosynthesized in transfected mammalian cells One hypothesis about being a bell is exploited by native genes That the codons are sub-optimal for full expression . However, optimization of codons generally results in at most a 10-fold increase in expression. 500-1000 fold between mouse and human gene expression levels, since only an effect is obtained Differences may not be likely due to codon usage . A second hypothesis explaining the difference between mouse and human PAF-AH expression levels is that human PAF-AH Does mRNA in the 5'-translated region of AH lead to relatively rapid degradation of mRNA? Or forming secondary structures that cause insufficient translation initiation or elongation It is.   To examine these hypotheses, an authentic human PAF-A A synthetic fragment encoding the amino acid sequence from the amino terminus to the 96th residue of the H protein; , But most of the codons are replaced with codons encoding the same amino acid ( "Recode" has been built. Changing the second codon from GTG to GTA As a result, an Asp718 site was created, which is present in the mouse cDNA. , One end of the synthetic fragment. The other end of the fragment is It contained the BamHI site normally found at don 97. Approximately 290 bp Asp718 / BamHI Fragments are described in Sandhu et al., Biotechniques, Vol. 12, pages 14-16 (1992). PCR fragments generated using double asymmetric PCR for construction of synthetic genes Was derived from The synthetic Asp718 / BamHI fragment was sequenced at position 453 of SEQ ID NO: 7. Ligation to a DNA fragment encoding the remainder of the human PAF-AH molecule starting with nucleotides Thus, the sequence encoding the authentic human PAF-AH enzyme is Product expression vector pRc / CMV (Invitrogen, San Diego) Sumid pRc / HPH.4 was created. The complete sequence of the recoded gene is No. 30. 5 'flanking the sequence encoding human PAF-AH in pRc / HPH.4 The flanking sequence was derived from the mouse cDNA sequence encoding PAF-AH in pRc / MS9. (Nucleotides 1 to 116 of SEQ ID NO: 21).   To determine the expression of human PAF-AH from pRc / HPH.4, pRc / HPH.4 (recoded Human gene), pRc / MS9 (mouse PAF-AH), or pRc / PH.MHC1 (mouse-human In hybrid 1), COS cells were transiently transfected. Transfer Cut Conditioned medium from the isolated cells was examined for PAF-AH activity and 5.7 Unit / ml (mouse gene), 0.9 unit / ml (mouse-human hybrid 1), and Was found to contain an activity of 2.6 units / ml (recoded human gene). This In the first 290 bp of the sequence encoding human PAF-AH. The Strategy was designed for transient transfection of COS cells with several nanograms. Successful by increasing the expression level of human PAF-AH from about 0.5 μg / ml to about 0.5 μg / ml. I did. The recoded PAF-AH gene from pRc / HPH.4 is a dihydrofolate reductor Inserted into a mammalian expression vector containing the DHFR gene, and Transfect DHFR-deficient Chinese hamster ovary cells Can be. Cells transfected in this way are high due to gene amplification. To obtain clones that produce low levels of PAF-AH, select methotrexate-resistant clones. Can be used for selection.                                 Example 9   Recombinant human plasma PAF-AH expressed in E. coli (Ile₄₂Starts with) Method to a single Coomassie blue stained SDS-PAGE band and The activity of the PAF-AH enzyme was assayed. A.Purification of recombinant PAF-AH   The first purification technique utilized was described in Example 1 for the original PAF-AH. Similar to the method. The following steps were performed at 4 ° C. Producing PAF-AH Cells from 50 ml of E. coli (transformed with the expression construct trp AH) were used in Example 8 Lysed as described. Remove the residue by centrifuging at 10,000g for 20 minutes. I left. Equilibrated with buffer D (25 mM Tris-HCl, 10 mM CHAPS, 0.5 M NaCl, pH 7.5) Blue Sepharose Fast Flow Column (2.5cm x 4cm, 20ml bed capacity) ) Was loaded with the supernatant at 0.8 ml / min. The column was washed with 100 ml of buffer D, Elution was performed at 3.2 ml / min with 100 ml of buffer A containing 0.5 M KSCN. Equilibrated with buffer D A 1 ml Cu-chelating Sepharose column was loaded with 15 ml of the active fraction. Kara The buffer was washed with 5 ml of buffer D, followed by 5 ml of buffer D containing 100 mM imidazole. And eluted at the rate of gravity. Fractions with PAF-AH activity are analyzed by SDS-PAGE did.   The results of the purification are as shown in Table 6, where the unit is PAF hydrolyzate per hour. Equal to μmol of degradation. The purified product obtained at 4 ° C is under the 43 kDa marker. As a single strong band, with diffusely stained parts directly above and below Originally, it appeared on SDS-PAGE. The recombinant material was PAF-AH from plasma as described in Example 1. Significantly purer and exhibits greater specific activity compared to the preparation. When the same purification protocol was performed at room temperature, it was added to the band below the 43 kDa marker. Instead, the group of bands below the 29 kDa marker was PAF-A in the assayed gel slice. Responding to H activity. These low molecular weight bands indicate that the P It may be a proteolytic fragment of AF-AH.   At room temperature, different purification procedures were also performed. E. coli producing PAF-AH (expression The cells (100 g) of the buried pUC trp AH were transformed with 200 ml of a lysis buffer (2 ml). 5 mM Tris, 20 mM CHAPS, 50 mM NaCl, 1 mM EDTA, 50 μg / ml Benzamide, pH 7. 5) and then resuspended in a microfluidizer at 15,000 psi. The cells were lysed by passing r) three times. Centrifuge at 14,300 xg for 1 hour The solids were removed. Dilution buffer (25 mM MES (2- [N-morpholino] ethanesul (Foic acid), 10 mM CHAPS, 1 mM EDTA, pH 4.9). 5mM MES, 10mM CHAPS, 1mM EDTA, 50mM S Sepharose Fast Flow Column (200 ml) equilibrated with NaCl (pH 5.5) On-exchange column) was loaded at 25 ml / min. Wash column with 1 liter of buffer E And elute with 1 M NaCl, then collect the eluate and add 0.5 ml 2 M Tris base A 50 ml fraction adjusted to pH 7.5 using was prepared. Pool fractions containing PAF-AH activity , Adjusted to 0.5M NaCl. The S pool was added to buffer F (25 mM Tris, 10 mM CHAPS, Blue Sepharose Fast Flow equilibrated to 0.5M NaCl, 1mM EDTA, pH7.5) The column (2.5 cm × 4 cm, 20 ml) was loaded at 1 ml / min. Fill the column with 100 ml buffer Washed with F and eluted at 4 ml / min with 100 ml of buffer F containing 3M NaCl. Next In order to reduce the endotoxin level in the sample, The fast flow chromatography step was repeated. Fractions containing PAF-AH activity Buffer G (25 mM Tris, pH 7.5, 0.5 M NaCl, 0.1% Tween 80, 1 mM EDT Dialysis was performed against A). The results of the purification are shown in Table 7, where the unit was 1 hour Equivalent to μmol of PAF hydrolysis. The resulting purified product is directly processed as a single strong band under the 43 kDa marker. Appeared on SDS-PAGE, with diffusely stained parts stained above and below. Recombinant The substance was significantly more significant when compared to the PAF-AH preparation from plasma described in Example 1. It is pure and exhibits greater specific activity.   Yet another purification technique contemplated by the present invention is lysis, clarification (cla rification), and a first column step. Cells are lysed in a lysis buffer (25 mM Solution, pH 7.5, 150 mM NaCl, 1% Tween 80, 2 mM EDTA). cooling Three passes of the material through a microfluidizer at 15,000-20,000 psi Lysis, resulting in more than 99% cell destruction. Lysis The material was diluted 1:20 in dilution buffer (25 mM Tris, pH 8.5, 1 mM EDTA) and then diluted And Q-Sepharose Big Beads Chromatography Media (Pharmacia ) And equilibrated with 25 mM Tris, pH 8.5, 1 mM EDTA, 0.015% Tween 80 Attach to ram. Eluate in 25 mM MES, pH 5.5, 1.2 M ammonium sulfate, 1 mM EDTA Butyl sepharose chromatograph diluted 1:10 to 1 and then equilibrated in the same buffer Attached to the photographic media (Pharmacia). 25mM MES, pH 5.5, 0.1% twee PAF-AH activity is eluted in 80 mM, 1 mM EDTA.   A method contemplated by the present invention for purifying enzymatically active PAF-AH from E. coli. Still another method comprises (a) lysis in a buffer containing CHAPS followed by solubilized PAF-AH Prepare supernatant, produce E. coli extract, (b) dilute the supernatant and equilibrate to about pH 8.0 (C) PAF-AH enzyme from the anion exchange column. (D) The prepared eluate from the anion exchange column is blue. For diligand affinity column (E) using a buffer containing 3.0 M salt to bind the blue diligand affinity. (F) Hydroxyapatite chromatography eluting from a tea column Dilute the eluate from the blue dye column with a suitable buffer to perform (g Perform washing and elution using a buffer (containing or not containing CHAPS). Perform (d) cation exchange chromatography on hydroxyl apatite chromatography. From the hydroxyapatite to the appropriate salt concentration for chromatography Diluting the eluate of (i) the eluate from the hydroxyapatite after dilution Is applied to a cation exchange column at a pH in the range of approximately 6.0 to 7.0, (j) Elution of PAF-AH from the cation exchange column using a buffer of Perform cation exchange chromatography on rejection, and (I) PAF-AH, CHAPS It includes the step of preparing a liquid or frozen state so as not to contain it.   Preferably, in the step (a), the lysis buffer is 25 mM Tris, 100 mM NaCl, 1 mM. mM EDTA, 20 mM CHAPS, pH 8.0, anion exchange chromatography in step (b). For luffy, the supernatant was 3- to 25 mM Tris, 1 mM EDTA, 10 mM CHAPS, pH 8.0. Diluted 4-fold, column was 25 mM Tris, 1 mM EDTA, 50 mM NaCl, 10 mM CHAPS, pH 8. Q-Sepharose column equilibrated at 0, anion exchange chromatography in step (c). The rum was dissolved using 25 mM Tris, 1 mM EDTA, 350 mM NaCl, 10 mM CHAPS, pH 8.0. Eluate from step (c) in step (d) Column, and in step (e) the column was 3M NaCl, 10 mM CHAPS, 25 mM Tris, Eluted with a pH 8.0 buffer and subjected to hydroxylapatite chromatography in step (f). For luffy, the eluate from the blue dye column was 10 mM sodium phosphate, Dilution with 100 mM NaCl, 10 mM CHAPS, pH 6.2 Performed and in step (g) hydroxylapatite chromatography was performed at 10 mM Hydroxyl aptamer equilibrated with sodium phosphate, 100 mM NaCl, 10 mM CHAPS Elution was performed using 50 mM sodium phosphate, 100 mM Na Cl, 10 mM CHAPS (containing or not), pH 7.5, and in step (h), For Cation Exchange Chromatography of Eluate of Roxyl Apatite Column Dilution is approximately 6 with sodium phosphate, with or without CHAPS. In a buffer having a pH in the range of 0.0 to 7.0, in step (i), 10 mM CHAPS is added. S-Sepharose with or without 50 mM sodium phosphate, pH 6.8 Equilibrate and in step (j) 50 mM potassium phosphate containing 0.01% Tween 80, 1 Elution is performed with a buffer of a suitable composition such as 2.5 mM aspartic acid, 125 mM NaCl, pH 7.5. And in step (k), cation exchange chromatography is performed at 2-8 ° C. It is. Example of a buffer that stabilizes PAF-AH and has a composition suitable for use in step (1) Include 50 mM potassium phosphate, 12.5 mM aspartic acid, 125 mM NaCl, pH 7.4 (approximate Add or add Tween 80 or Pluronic F68 No) or (at least) 125 mM NaCl, 25 mM arginine and 0.01% Containing 80% (may contain approximately 0.1 and 0.5% Pluronic F68 (Not containing) 25 mM potassium phosphate buffer. B.Activity of recombinant PAF-AH   The most prominent property of PAF acetylhydrolase is that it has a short residue at Remarkable specificity for one substrate. Due to this strict specificity, PAF acetyl Hydrolase is PLA_TwoDistinguished from other types. Thus, the recombinant PAF-AH is in the sn-2 position Long chain fatty acids 1-palmitoyl-2-arachid to determine whether to degrade phospholipids Uptake hydrolysis of noyl-sn-glycero-3-phosphocholine (arachidonoyl PC) Say. The reason is that this substance is a well-characterized PLA_TwoFor the type This is because it is a preferred substrate. Predicted from previous studies using the original PAF-AH When incubated with recombinant PAF-AH, this phospholipid Did not undergo decomposition. In additional experiments, arachidonoyl PC was added in the range of 0-125 μM. Concentration into a standard PAF hydrolysis assay, where the PAF is hydrolyzed by recombinant PAF-AH. It was determined whether degradation was inhibited. Highest concentration, 5 times greater than PAF concentration Even PAF-AH did not inhibit PAF hydrolysis in any way. As you can see, Recombinant PAF-AH exhibits the same substrate specificity as the original enzyme and does not recognize long-chain substrates Things. In addition, recombinant PAF-AH enzymes undergo oxidative cleavage of sn-2 fatty acids. Oxidized phospholipid (glutaroyl PC) was rapidly degraded. Original plasma PAF- AH is a calcium-independent, sulfhydryl group-modifying compound or Other phospholipases, including resistance to compounds that cleave sulfide It has various other properties that distinguish it from PAF-AH.   Both native and recombinant plasma PAF-AH enzymes are sensitive to DFP and This suggests that some of their active sites comprise serine. A rare feature of native plasma PAF acetylhydrolase is that it circulates It is tightly associated with the protein and its catalytic activity is linked to the lipoprotein. Be affected by the environment. The recombinant PAF-AH of the present invention can be used in human plasma (endogenous enzyme). Pretreated with DFP to remove elemental activity) Associated with low and high density lipoproteins as well as the original active. Low density reporter Impact Quality modification is essential for the cholesterol deposition observed in atheromas, And there is substantial evidence that lipid oxidation is the first factor in this process So this result is important. PAF-AH protects low density lipoproteins from modification under oxidizing conditions in vitro and And may play such a role in vivo. Therefore, inflammation Atherosclerotic plaque (atherosclerotic)  Inhibition of lipoprotein oxidation in plaques also requires administration of PAF-AH .   All of these results indicate that cDNA clone sAH 406-3 was This confirms that the protein encodes a protein having the activity of the enzyme.                                Example 10   Various other recombinant PAF-AH products were expressed in E. coli. Their products include: PAF-AH derivatives and PAF-AH fragments having a single amino acid mutation are included. A.PAF-AH Amino acid substitution products   PAF-AH is a lipase because it hydrolyzes PAF, which is a phospholipid. PAF-AH There is no apparent overall similarity between lipases and other characterized lipases On the other hand, the conserved found in the comparison of structurally characterized lipases There are residues. One serine has been identified as a member of the active site. So Serine, along with aspartic acid and histidine residues, activate its lipase. It forms a group of three catalytically active residues exhibiting a sex site. The three residues are the primary protein In the columns However, structural studies have shown that the three residues are close together in three-dimensional space. Has been proven. A comparison of the structures of mammalian lipases shows that Asp residues Suggests that the group is usually 24 amino acids C-terminal to the active site serine Have been. In addition, histidine is normally 109-111 relative to the active site serine. Only amino acids are C-terminal.   Individual codons of human PAF-AH coding sequence by site-directed mutagenesis and PCR Was changed to encode an alanine residue and expressed in E. coli. Table 8 below As shown in the above, for example, the abbreviation of "S108A" means that the serine residue at position 108 is alanine. It shows that it has been changed, but Ser₂₇₃, Asp₂₉₆Or His₃₅₁Suddenly The mutation completely impairs PAF-AH activity. The distance between the active site residues is PAF-AH ( 23 amino acids from Ser to Asp, 78 amino acids from Ser to His) and other lipases Similar. From these experiments, Ser₂₇₃, Asp₂₉₆, And His₃₅₁But activity Important residues, and therefore likely to be residues in the group of three catalytically active residues. It is proved that it is. Does cysteine form disulfide bonds? As such, it is often important to the functional integrity of the protein. Plasma PAF-AH yeast The element contains five cysteines. One of the five is important for enzyme activity Each cysteine was mutated individually to serine to determine The resulting mutation was expressed in E. coli. Produced by recombinant methods Preliminary activity results using partially purified preparations of these mutants are shown below. The results are shown in the second column of Table 8 below and using the further purified preparation. Shown in the third column of Table 8 below. Such data shows that all cysteine variants Have generally equivalent activity, and therefore both cysteines have PAF-AH activity. Necessary for It is shown that it is not necessary. Other point mutations also have a significant effect on PAF-AH catalytic activity. No or no effect. In Table 8, “++++” is about 40-60 U / ml / OD₆₀₀Represents wild-type PAF-AH activity, and `` +++ '' represents about 20 to 40 U / ml / OD.<sub>600</sub>Activity Represents `` ++ '' is about 10 to 20 U / ml / OD₆₀₀Represents activity, `` + '' indicates 1 to 10 U / ml / OD_{60 0} Indicates activity and "-" indicates <1 U / ml / OD₆₀₀Show activity.B.PAF-AH Fragment products   3 'end of PAF-AH coding sequence using exonuclease III for various times And then encodes a stop codon in all three open reading frames By connecting the shortened coding sequence to plasmid DNA, the C-terminal deletion Was prepared. Ten different deletion constructs were analyzed by DNA sequence analysis, protein expression, and P It was characterized by AF-AH activity. Removal of the 21-23 C-terminal amino acids results in catalytic activity The activity was greatly reduced, and removal of 52 residues completely abolished the activity. See FIG. I want to be.   Similar deletions were made in the amino-terminal region of PAF-AH. Escherichia coli thiored on the N-terminal side Prepare fusions with toxin-loaded PAF-AH to achieve consistently high levels of PAF-AH activity Easier expression of the body (LaVallie et al., Bio / technolo gy, 11, 187-193, (1993)). Naturally processed N-terminus (Ile_{Four Two} Removing 19 amino acids from) reduces the activity to 99%, while removing 26 amino acids. Upon removal, the enzymatic activity on the fusion protein was completely impaired. See FIG. I want to be. The deletion of 12 amino acids appeared to enhance the enzyme activity about 4-fold.   Similar method as described in Example 1 (Amicon instead of Cu column) From Blue Sepharose using Microcon 30 filter The following purification of PAF-AH from fresh human plasma by concentrating the eluate of e₄₂Plus two N-termini, Ser₃₅And Lys₅₅Was identified. Such heterogeneity is It may be the original state of the enzyme in the plasma, or it may have occurred during purification Not.   The purified material was also subjected to analysis for glycosylation. Refined An enzyme that removes N-linked hydrocarbons from glycoproteins from native PAF-AH In the presence of N-glycanase Or incubated in the absence. Treated PAF-AH sample is 12% SDS poly Electrophoresed on acrylamide gel, then rabbit polyclonal antiserum And visualized by Western blotting. Treated with N-glycanase The unreacted protein migrates as a diffuse band of 45-50 kDa, while the The protein treated with canase migrates as a distinct band of approximately 44 kDa, The type of PAF-AH was demonstrated to be glycosylated.   The heterogeneity of the N-terminus was determined by recombinant PAF-AH (Ile₄₂N-terminal) purified preparation Was observed. These preparations are₄₇, Ile₄₂Or Ile₄₂Artificial next to Start point Met_-1A mixture of polypeptides having an N-terminus starting with   1.PAF-AH Preliminary comparison between fragments and PAF-AH   Given the heterogeneity of recombinantly produced PAF-AH, Recombinant products were prepared and checked for homology after recombinant expression and purification. The composition of the recombinant expression products of pBAR2 / PH.2 and pBAR2 / PH.9 in E. coli strain MC1061 was cultured. Were analyzed at different times during the growth phase. 5 to 22 hours after inducing protein expression The partially purified recombinant pH.2 and PH.9 samples collected at Analysis was performed by a cyst type laser desorption ionization mass spectrometer (MALDI-MS).   If a PH.2 expression vector is used, the spectrum of the partially purified protein , Two peaks were observed in the expected mass values for the rPAF-AH protein . Two peaks were observed at all time points, however, Stress and / or oxygen depletion , Higher heterogeneity was observed. In this mass region The accuracy of the MALDI-MS technique was approximately ± 0.3% (corresponding to a mass of about 1 amino acid) . The higher mass peak observed is the expected full length translation for the PH.2 vector. Subtracted translation initiation methionine predicted to be removed post-translationally It matched the location of the thing. The lower mass peak is approximately 1200 atomic mass units. It was low.   If a PH.9 expression vector was used, it would not be predicted for rPAF-AH protein. A single peak in the spectrum of the partially purified protein Was there. This single peak was observed at all time points, Heterogeneity did not increase. The observed mass of this protein is The expected full-length translation product minus the starting methionine It matched the location.   2.PAF-AH Purification of fragments   RPH.2 (Met expressed by recombinant method)₄₆~ Asn₄₄₁Expression of DNA encoding Product) and rPH.9 (Met₄₆~ Ile₄₂₉Expression product of DNA encoding DNA) RPAF-AH (Ile₄₂~ Asn₄₄₁Expression product of DNA encoding For purification. rPH.9 was produced from E. coli strain SB7219 and RPH.2 was produced by E. coli strain MC1061; Purified as follows. The transformed cells were treated with a lysis buffer (100 mM Diluting the paste with 100 mM NaCl, 20 mM CHAPS, pH 6.0) Lysed. The slurries were mixed and lysed by high pressure crushing. Lysed The cells were centrifuged and the supernatant containing rPH.2 was stored. The clarified supernatant is 5 times with 25 mM sodium phosphate buffer containing 1 mM EDTA and 10 mM CHAPS, pH 7.0 Diluted to . The diluted supernatant was then applied to a Q Sepharose column. Column, column 25 mM sodium phosphate containing 3 times the volume of 1 mM EDTA, 50 mM NaCl, 10 mM CHAPS Buffer buffer, pH 7.0 (Wash 1), and then 10 times the column volume of 1 mM EDT. A, wash with 25 mM Tris buffer, pH 8.0 containing 10 mM CHAPS (Wash 2), and 25 mM Tris containing 10 column volumes of 1 mM EDTA, 100 mM NaCl, 10 mM CHAPS Washed with buffer, pH 8.0 (Wash 3). Elution was performed with 1 mM EDTA, 350 mM NaCl, 10 mM C Performed using 25 mM Tris buffer, pH 8.0, containing HAPS. Elution of Q Sepharose The solution was diluted 3 times with 25 mM Tris, 1 mM EDTA, 10 mM CHAPS, pH 8.0. And then Attached to a Lucepharose column. First, the column should be 10 mM column volume, 25 mM The squirrel was washed with 1 mM EDTA, 10 mM CHAPS, pH 8.0. The column is then filled with the column capacity Washed with 3 volumes of 25 mM Tris, 0.5 M NaCl, 10 mM CHAPS, pH 8.0. Elution is 25 This was performed using mM Tris, 3.0 M NaCl, 10 mM CHAPS, pH 8.0. Blue Sepharose The eluate of the solution was diluted 5-fold with 10 mM sodium phosphate, 10 mM CHAPS, pH 6.2. And applied to a chromatography column. The column is 10 mM, 10 times the column volume Washed with sodium phosphate, 100 mM NaCl, 0.1% Pluronic F68, pH 6.2. 120 rPH.2 using mM sodium phosphate, 100 mM NaCl, 0.1% Pluronic F-68, pH 7.5 Was eluted. The eluate of hydroxylapatite was 10 mM sodium phosphate, 0.1 mM It was diluted 6-fold with% Pluronic F68, pH 6.8. Diluted hydroxyl apata The eluate of the kit was adjusted to pH 6.8 using 0.5N succinic acid and then SP Sepharose Attached to a source column. SP Sepharose columns are 10 times the column volume of 50 mM phosphor Wash with sodium acid, 0.1% Pluronic F68, pH 6.8, then add 50 mM sodium phosphate Lium, 125 mM NaCl, 0.1% Elution was performed with Luronic F68, pH 7.5. The eluted rPH.2 is 50 mM sodium phosphate , 125 mM NaCl, 0.15% Pluronic F68, pH 7.5, dilute to a final concentration of 4 mg / ml Tween 80 to a final concentration of 0.02% Tween 80 Was added. The prepared product is filtered through a 0.2μ membrane and stored until use. Was.   3.Comparison of PAF-AH fragment and PAF-AH by sequencing   The purified rPH.2 and rPH.9 preparations were applied to Applied PioSystems model 47. 3A Protein Sequencer (Applied Biosystems, Foster City N-terminal sequencing using Hewlett-Packard (California, CA) Hewlett-Packard) Model G1009A C-terminal using C-terminal protein sequencer Sequencing compared to the purified rPAF-AH preparation. rPH.2 preparation is rPAF The heterogeneity of the N-terminus was smaller than that of -AH. N-terminal analysis of rPH.9 preparation Case, but with less C-terminal heterogeneity for rPH.9 than for rPH.2. terogeneity) was observed.   The purified rPH.2 preparation is₄₇N-terminal main sequence (about 86-89%) and Al a₄₈A small number of sequences (approximately 11-14%) with an N-terminus of Was quite consistent under different culture conditions. Purified rPH.9 The preparation is also Ala₄₇Main sequence (about 83-90%) with N-terminus and Ala₄₈Has the N-terminus of A small number of sequences (about 10-17%). In contrast, Ile₄₂Polype starting with Attempts to produce peptide (rPAF-AH) in bacteria resulted in Ala₄₇(20-53% ), Ile₄₂(8-10%) or Ile₄₂Artificial opening Met adjacent to_-1Methio Various mixtures of polypeptides with Nin (37-72%) as N-terminus Thing was obtained. For rPH.2 and rPH.9, after bacteria have synthesized the polypeptide, Leaving the alanine at position 47 (or alanine at position 48) as the N-terminal residue Of methionine is efficiently removed by the amino-terminal peptidase.   C-terminal sequencing was performed on one lot of rPH.2, which included the main sequence (approximately 8 (0%) was observed to have the C-terminal of HOOC-Asn-Tyr (the predicted sequence of the translation product). HOOC-ASn in a row₄₄₁-Tyr₄₄₀About 20% was HOOC-Leu . After fractionation of the rPH.2 preparation by SDS-PAGE, the first and second bands were further The second band of lower molecular weight (AH_L, Section B.5) The C-terminal sequence of HOOC-Leu-Met, which corresponds to a product 10 amino acids shorter than the long translation product, And low levels of HOOC-His. Further peptide mapping Indicates that other C-terminal variants are present in a lot of PH.2 protein. Have been. The C-terminus of rPH.9 is mainly based on HOOC-Ile-His ( About 78-91%, depending on the lot), which is the expected C-terminal arrangement of the translation product. HOOC-Ile is a column₄₂₉-His₄₂₈Was matched. This technology has some back There may be ground ("noise"), thus excluding other low-level arrays I couldn't do it.   4.MALDI-MS Between PAF-AH fragment and PAF-AH   MALDI-MS was performed on the purified rPH.2 and rPH.9 preparations. rPH.2 Vectors were observed for the partially purified protein in section B.1. The expected mass value for the rPAF-AH product (see Figure 4), similar to It showed two peaks of the cuttle. The second, lower molecular weight peak is typically About 20-30% of the total was present. The rPH.9 spectrum is Full-length translation product for PH.9 vector minus methionine for translation initiation A major peak was shown at a mass that was consistent with the predicted value (see FIG. 5). rPH.9 In contrast, a small, slightly lower molecular weight shoulder peak was also observed, About 5% of the total.   5.SDS-PAGE Of PAF-AH fragment and PAF-AH by HPLC   Perform sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) This was performed on the prepared rPAF-AH, rPH.2 and rPH.9 preparations. Protein molecule Predicted electrophoretic migration for rPAF-AH product based on quantity marker standards Near the range, a complex band formation pattern was observed for rPH.2. One Or, in some gels, two major bands were observed, With a second band easily observed above and below the metal. These, on The second, center first, and lower second bands are AH_U, AH_MAnd AH_LCalled Was. All these bands were anti-rPAF-AH monoclonal by Western blot. By reacting with rPAF-AH, it has been identified as an rPAF-AH-related product. Upper second bar Ah_UHave increased strength throughout the storage period of the protein, presumably It corresponds to the modified molecular species of the PAF-AH product. SDS-PAG of rPAF-AH preparation E is similar to rPH.2. Near the predicted molecular weight for rPAF-AH Two main bands to move, plus a minor band above and below the main band There is a light (shadow) band. On the other hand, in rPH.9, the main A single peak with no apparent resolution. Slightly lower molecular weight positions and die A faint band was also observed at the position predicted to be a mer. AH_UThe band looks like I wasn't.   The composition of the purified rPH.2 and rPH.9 preparations was 2D gel (isoelectric focusing in the presence of urea). It was also analyzed by electrophoresis (IEF) followed by 2D SDS-PAGE. About rPH.9 Showed five major spots separated in the IEF direction on the 2D gel. Different charge types Sex appeared to be consistent between rPH.9 lots. In contrast, rPH.2 The 2D gel pattern shows approximately 15 spots separated in the IEF and SDS-PAGE directions. It was more complicated because it included.   6.PAF-AH Comparison of fragment and PAF-AH activities   Purified rPH.2 and rPH.9 are enzyme activities of endogenous PAF-AH purified from serum It has an enzyme activity that is indistinguishable from rPH.2 and rPH.9 Binds lipoproteins in the same manner as endogenous PAF-AH.                                Example 11   Preliminary analysis of the expression pattern of human plasma PAF-AH mRNA in human tissues was performed in Northern Performed by blot hybridization.   RNA is RNA Stat (Stat) 60 (Tel-Test "B", Friends Wood (Friendswood, Texas) using human cerebral cortex, heart, kidney, placenta, Prepared from thymus and tonsils. In addition, the phorbol ester, phorbol Induced differentiation into macrophage-like phenotype using myristyl acetate (PMA) RNA was prepared from a human hematopoietic precursor-like cell line, THP-1 (ATCC TIB 202). Organization RNA and pre- and 1-3 days post-induction from promyelocytic THP-1 cell line. The prepared RNA was electrophoresed on a 1.2% agarose formaldehyde gel and subsequently Come Transferred to nitrocellulose membrane. SAH 406-3, a full-length human plasma PAF-AH cDNA, Labeling by random priming, And hybridized to the membrane under the same conditions as described in Example 3. Early results In the fruit, the 1.8 kb band in thymus, tonsils, and to a lesser extent placental RNA, PA It was suggested that the F-AH probe hybridized.   PAF is synthesized in the brain not only under normal physiological conditions but also under pathological conditions Have been. Given the known pro-inflammatory and potential neurotoxic properties of this molecule, Therefore, the mechanism for the localization of PAF synthesis or its rapid metabolism is important for nervous tissue health. Would be expected to be significant. PAF acetylhydrolase in neural tissue The existence of, according to it, plays such a protective role. Interest Deeply, PAF-AH in bovine heterotrimeric cells (this cloning J. et al. Biol. Chem., Vol. 269, No. 37, pages 23150-23155, (1994)) and the present invention. Both light PAF-AHs have been identified in the brain. The two enzymes are the same in the brain Of bovine brain to determine if it is expressed in Cloning the human homolog of the intracellular PAF-AH cDNA and its mRNA in the brain Expression pattern, the PAF-AH mRNA expression pattern of the present invention, described in the previous paragraph And Northern blotting by essentially the same method. Northern Blotte The areas of the brain examined by scanning were cerebellum, marrow, spinal cord, putamen, amygdala, caudate nucleus, visual The floor, as well as the occipital pole, frontal and temporal lobes of the cerebral cortex. Mesh of both enzymes Sage (mRNA) was detected in each of these tissues, but the heterotrimeric intracellular form Appeared in much larger amounts than the secreted form. Northern blot for additional tissue By analysis, the subcellular form of the heterotrimer is found in the thymus, prostate, testis, ovary, small intestine, and colon. Intestine, peripheral blood leukemia Diversified, including spheres, macrophages, brain, liver, skeletal muscle, kidney, pancreas and adrenal glands It was further clarified that it was expressed in a wide range of tissues and cells. like this It is expressed that heterotrimeric intracellular PAF-AH is It shows that it has a housekeeping function.   Expression of PAF-AH RNA in monocytes isolated from human blood and during culture The expression of PAF-AH RNA during spontaneous differentiation into macrophages was also examined. Fresh simple Little or no RNA was detected in spheres, but differentiated into macrophages In the meantime, expression was induced and maintained. In the culture medium of differentiating cells There was a concomitant accumulation of PAF-AH activity. Generation of human plasma PAF-AH transcript Currently, THP-1 cell RNA was also observed on the first day, but not on the third day after induction. Was. THP-1 cells did not express mRNA for PAF-AH in the basal state.                                Example 12   PAF-AH in human and mouse tissues by in situ hybridization Expression was examined.   Human tissues are from the National Disease Research Interchange and the Cooperative  Obtained from Human Tissue Network. Normal mouse brain and spinal cord, and EAE stage Spinal cords of three mice were collected from S / JLJ mice. The fetus of a normal S / JLJ mouse Collected 11-18 days later.   Tissue sections were prepared using small amounts of OCT compound (Miles, Inc., Elkhart). khart), Indiana) and Tissue Tek II Cryomo (Cryomold) (Miles Laboratories, Inc.,) (Naperville, Illinois). They are cryo-mo Center in the mold, fill the cryomold with OCT compound, then add 2-methyl Butane (C_TwoH_FiveCH (CH_Three)_TwoAldrich Chemical Co., Ltd. mpany, Inc.,), Milwaukee, Wisconsin). The container was then placed in liquid nitrogen. The structure and OCT compound in the cryomold Once frozen, the blocks were stored at -80 ° C until cut. Organization Cut the lock to a thickness of 6 μm and use Vectabond (Vector Laboratories). (Vector Laborator-ies, Inc., Birmingham, CA). Secured to overlaid slides, stored at -70 ° C, and warmed and allowed to set ( Leave at 50 ° C for about 5 minutes to remove condensation), then 20 ° C at 4 ° C Fix in 4% paraformaldehyde for 40 min, then add 70%, 95%, 100% ethanol Dehydrated at 4 ° C. for 1 minute per grade, then air dried at room temperature for 30 minutes. 70% Denature sections in formamide / 2 × SSC at 70 ° C. for 2 minutes and rinse twice in 2 × SSC After dehydration, air-dried for 30 minutes. In vitro RNA transcription³⁵S-UTP import (Ammer Siam), a 1 Kb HindIII fragment (SEQ ID NO: 7) inside the PAF-AH gene. From nucleotides 308-1323) or by Hattori et al. Radiolabeled single DNA generated from DNA derived from heterotrimeric intracellular PAF-AH cDNA Tissue was hybridized in situ using strand mRNA. Probe is 250-50 Different lengths of 0 bp were used. Hybridization at 50 ° C Overnight (12-16 hours),³⁵S-labeled riboprobe (6 × 10^Fivecpm / section), tRNA (0.5μ g / section) and water treated with diethylpyrocarbonate (depc). Solution, 50% formamide, 0.3 M NaCl, 20 mM Tris, pH 7.5, 10% dextran sulfate, 1x Denhardt's solution, 100 Final concentrations were made of mM dithiothreitol (DTT) and 5 mM EDTA. C After hybridization, 1 hour at room temperature with 4 × SSC / 10 mM DTT, then 50% Formamide / 1 × SSC / 10 mM DTT at 60 ° C. for 40 minutes, 2 × SSC at room temperature for 30 minutes, further The sections were washed with 0.1 × SSC at room temperature for 30 minutes. Dehydrate sections and air dry for 2 hours Cover with Kodak NTB2 photographic emulsion, air dry for 2 hours and develop (4 ° C in complete darkness) After storage) and counterstained with hematoxylin / eosin. A.brain   cerebellum. In both mouse and human brain, within the Purkinje cell layer of the cerebellum, Individuals in cage cells and in the dentate nucleus (one of the four deep nuclei in the cerebellum) Strong signals were seen on various neuronal cell bodies. For heterotrimeric intracellular PAF-AH A corresponding message (mRNA) was also observed in these cell types. In addition, granulocytes Plasma PAF-AH signals were found in individual cells within and within the molecular layer of gray matter.   Hippocampus. In human hippocampal sections, individual cells that span the entire section, likely to be neuronal cell bodies It showed a strong signal. These have been identified as polymorphic cell bodies and granule cells. A message (mRNA) for PAF-AH in heterotrimeric cells was also observed in the hippocampus.   Brainstem. On both human and mouse brainstem sections, individual cells within the gray matter are strongly stained. Gunnar was acknowledged.   cortex. (Large) on human cortical sections taken from brain, occipital, and temporal cortex, and On mouse whole brain sections, individual cells throughout the cortex showed strong signals. These cells have been identified as cone cells, stellate cells and polymorphic cell bodies. Cortical differences There appeared to be no difference in the expression pattern in the different layers. these In situ hybridization results were obtained by Northern blotting. Results differing from the (large) brain cortex. Northern blotting sensitivity This difference is due to the higher sensitivity of in situ hybridization compared to It seems that a difference occurs. As in the cerebellum and hippocampus, heterotrimeric intracellular PAF- A similar expression pattern of AH was observed.   Pituitary gland. A somewhat weaker signal on individual dispersed cells in the anterior pituitary gland of human tissue sections Nulls were seen. B.Human colon   In both healthy and Crohn's disease colons, lymph aggregates present in the mucosa of the sections (Lymphatic aggregation) and the level of the signal is Crohn's disease Sections from patients were slightly higher. In the colon of Crohn's disease patients, A strong signal was also seen. Similarly, high levels were observed in appendix sections of Crohn's disease patients. Signal was observed, while a lower but detectable signal was observed in the appendix of a healthy individual. Presented a null. Sections from patients with ulcerative colitis can be either lymph aggregates or lamina propria No obvious signal was shown. C.Human tonsils and thymus   Dispersed groups of individual cells in the germinal center of the tonsils and in the thymus, I was seen. D.Human lymph gland   A strong signal was observed on lymph gland sections taken from healthy donors. In sections of lymph nodes from donors of septic shock, some weak signal Was observed. E. FIG.Human small intestine   Both the small intestine of healthy individuals and patients with Crohn's disease can be found in Peyer's gland and Signal is weaker in the sections, and the signal is weaker in the tissues of Crohn's disease patients. Was expensive. F.Human spleen and lung   Either spleen (healthy and spleen abscess sections) or lung (healthy and emphysema sections) tissue In this case, no signal was observed. G. FIG.Mouse spinal cord   In both normal and EAE stage 3 spinal cords, strong spinal cord is present in the gray matter of the spinal cord. There was a signal and its expression was slightly higher in the EAE stage 3 spinal cord. EAE stay In the spinal cord of di3, possibly with infiltrating macrophages and / or other leukocytes It is likely that cells in white matter and cuffs around blood vessels show signals, It was not in the normal spinal cord. F.Mouse fetus   In the mouse fetus on day 11, a clear signal was observed in the central nervous system of the fourth ventricle. Over the fetal time course during development into the brain and brain stem It remained constant. As the fetus matures, the central nervous system in the spinal cord (day 12) Signals in early cortex and Gassell's crescent ganglia (day 14) and pituitary (day 16) Became clear. The peripheral nervous system of the nerves that leave the spinal cord (early on day 14 or 15) On the 17th day, a strong signal was observed around the fetal whiskers. Le appeared. On day 14, in the liver and lungs, in the intestine (early on day 15) and in the mouth / Expression was also seen in the posterior portion of the throat (early day 16). 1 By day 8, the expression pattern is cortical, hindbrain (cerebellum and brainstem), lumbar region of spinal cord Differentiates into nerves that leave behind, back of mouth / throat, liver, kidneys, lungs and intestines A rather weak signal was seen.   G. FIG.wrap up   In tonsils, thymus, lymph glands, Peyer's glands, appendix, and colonic lymph aggregates PAF-AH mRNA expression in these tissues exerts phagocytic and antigenic effects on these tissues. sing) Possible superiority due to the presence of tissue macrophages serving as cells Note that this is consistent with the conclusion that the source of PAF-AH in vivo is macrophages.   PAF-AH expression in inflammatory tissues indicates that monocyte-derived macrophages This would be consistent with the hypothesis that the disease should be resolved. PAF-AH is PAF and former Inactivate inflammatory phospholipids and thus initiate them with these mediators Expected to down-regulate the resulting inflammatory cascade Will.   PAF has been detected throughout brain tissue and is present in cultured rat brain granulocyte cells. Therefore it is secreted. In vitro and in vivo experiments have shown that PAF is Binds to a specific receptor for calcium and mobilizes calcium, Functional changes, such as regulation and differentiation of the neural progenitor cell line PC12 And has been shown to induce phenotypic changes. With these observations, Suggested a physiological role for PAF in the hippocampus Recent experiments using tissue section cultures and PAF derivatives and PAF antagonists Horse long term Significant retrograde messenger in long term potentiation It is shown that PAF is involved as a jar. Therefore, its inflammation In addition to its pathological effects, PAFs are involved in the usual neural signaling processes It is. In the brain Extracellular expression of PAF-AH controls the duration and intensity of PAF-mediated signal generation It may help you control it.                                Example 13   A monoclonal antibody specific to recombinant human plasma PAF-AH It was made using the produced PAF-AH.   Mice # 1342 was injected with recombinant PAF-AH on days 0, 19, and 40. Before fusion Mice were injected with antigen-containing PBS for booster challenge, and mice were sacrificed 4 days later. Upon sacrifice, the spleen was aseptically removed and placed in 10 ml of serum-free RPMI. 2mM L-G Lutamine, 1 mM sodium pyruvate, 100 units / ml penicillin, and 100 μg / ml Serum-free R supplemented with streptomycin (RPMI) (Gibco, Canada) The spleen between the frozen ends of two microscope slides submerged in PMI 1640 A single cell suspension was formed by crushing the gut. Cell suspension is sterile 70-mesh Nitex cell strainer (Becton Dickinson (Becton Dickinson), Parsippany, NJ Filter, centrifuge at 200 g for 5 minutes and resuspend the pellet in 20 ml serum-free RPMI The washing was performed twice. 3 Balb / c mice that have never received medication Thymocytes taken from the same source were similarly prepared. 11% fetal bovine serum (FBS) (Hike Hyclone Laboratories, Inc., Logan, Utah State) NS-1 myeloma cells maintained in logarithmic growth phase for 3 days before fusion in RPMI containing 200 g The pellet was washed twice as described in the previous paragraph.   1 × 10⁸2.0 × 10 spleen cells⁷Centrifuge, centrifuge, and aspirate supernatant. Was. The cell pellet was dislodged by tapping the tube, 37 PEG 1500 (50% in 75 mM Hepes, pH 8.0) at 50 ° C. (Boehringer Mannheim nger Mannheim) 1 ml with stirring over 1 minute, followed by 7 ml of serum-free RPMI was added over 7 minutes. Add an additional 8 ml of RPMI and allow the cells to Centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was washed with 15% FBS, 100 μM Poxanthin sodium, 0.4 μM aminopterin, 16 μM thymidine (HAT) Buco), 25 units / ml IL-6 (Boehringer Mannheim), and 1.5 × 10⁶Thymus Resuspended in 200 ml of RPMI containing cells / ml and 10 Corning flat bottom 96 wells. Seed into tissue culture plates (Corning, Corning, NY) did. On days 2, 4 and 6 after fusion, 100 μl of medium was removed from the wells of the fusion plate. And replaced with fresh medium. On day 8, screen fusions by ELISA And examined for the presence of mouse IgG binding to recombinant PAF-AH. Immu lon) 4 plates (Dynatech, Cambridge, Mass.) State) at 37 ° C. with 100 ng / well of recombinant PAF-AH, diluted in 25 mM Tris, pH 7.5. For 2 hours. Aspirate coating solution and add 200 μl / well blocking solution (0.5% fish skin gelatin diluted in CMF-PBS (Sigma)) Was added and incubated at 37 ° C. for 30 minutes. PBS containing 0.05% Tween 20 ( The plate was washed three times with PBST) and 50 μl of the culture supernatant was added. 30 minutes at 37 ° C Incubate and as above After washing, horseradish peroxidase complex diluted 1: 3500 in PBST Goat anti-mouse IgG (fc) (Jackson ImmunoResearch) , West Grove, PA) was added. Said Incubate the plate as described above, wash 4 times with PBST, add 100 mM citric acid, p 1 mg / ml o-phenylenediamine (Sigma) in H4.5 and 0.1 μl / ml of 30% H_TwoO_Two Was added. 50 μl of 15% H_TwoSO_FourAnd in 5 minutes The color reaction was stopped. A with a plate reader (Dynatech)₄₉₀Read Was.   Place selected fusion wells in a 96-well plate. Two colonies were removed by visual assessment of colony counts / well after 5 days. Made a loan. The cloned hybridomas were 90D1E, 90E3A, 90E6C, 9 0G11D (ATCC HB 11724) and 90F2D (ATCC HB 11725).   Monoclonal antibodies produced by hybridomas are strip) system (Boehringer Mannheim, Indianapolis, India (Na State) was used to determine the isotype (isotyped). As a result, high from fusion 90 All monoclonal antibodies produced by bridoma are IgG₁Shown to be Was.   All monoclonal antibodies produced by hybridomas from fusion 90 Performed well in ELISA assays but binds PAF-AH on Western blots I couldn't do it. An antibody that can recognize PAF-AH by Western To make, mouse # 1958 was immunized with the recombinant enzyme. Notes on Fusion 90 A hybridoma was prepared in the same manner as described above, but a clone that is a western element By western blotting rather than ELISA to identify Was done.   For Western analysis, recombinant PAF-AH was purified using 125 mM Tris, pH 6.8, 4% SDS , Containing 100 mM dithiothreitol and 0.05% bromophenol blue Mix with sample buffer and add 12% SDS polyacrylamide gel (Novec (Novex) before boiling for 5 minutes. Electrophoresis was performed at 40m ampere Thereafter, 125 V in 192 mM glycine, 25 mM Tris base, 20% methanol, and 0.01% SDS. Transfer protein to polyvinylidene fluoride membrane (Pierce) for 1 hour did. The membrane consisted of 20 mM Tris, 1%, containing 5% bovine serum albumin (BSA, Sigma). Incubated overnight at 4 ° C. in 00 mM NaCl (TBS). Blot membrane with 5% BSA At room temperature with rabbit polyclonal antiserum diluted 1/8000 in TBS containing Incubate for 1 hour, then wash with TBS, and in TBS containing 5% BSA Incubate with alkaline phosphatase-conjugated goat anti-mouse IgG for 1 hour at room temperature Let me go. The blot membrane was washed again with TBS, then 100 mM Tris-HCl, pH 9.5, 100 mM NaCl, and 5 mM MgCl_Two0.02% in 5-bromo-4-chloro-3-indolyl phosphate Plate and 0.03% nitroblue tetrazolium. The reaction is Stopped by repeated rinsing with water.   Selected fusion wells (on top of Western analysis) Positive) were treated as described above. Hybridoma 143A is Western It reacted with PAF-AH on the blot and was cloned (ATCC HB 11900).   A polyclonal antiserum specific for human plasma PAF-AH was Immunization with 100 μg of purified recombinant enzyme in bunt 3 times a month So I made them with rabbits.                                Example 14   Rat paw edema model (Henriques et al., Br. J. Pharmacol., 10 6, 579-582, (1992)) using the recombinant PAF-AH of the present invention for acute inflammation. An experimental study was performed to evaluate the in vivo therapeutic effects of. Of these studies The results demonstrate that PAF-AH blocks PAF-induced edema. Two commercially available To compare the efficacy of PAF antagonists with the efficacy of PAF-AH, An experiment was performed. A.PAF-AH Preparation of   E. coli transformed with the PAF-AH expression vector puc trp AH was Lyse cells in a sterilizer, remove solids by centrifugation, and remove the cell supernatant using an S-Sepharose column (Pharmacia). 50 mM NaCl, 10 mM CHAPS, 25 mM MES and 1 mM EDT The column was well washed with a buffer consisting of A, pH 5.5. Buffer NaCl concentration up to 1M PAF-AH was eluted by raising. Then, use a blue Sepharose column Affinity chromatography using an additional purification step Used as Before loading the PAF-AH preparation on the Blue Sepharose column, The mixture was diluted 1: 2, the NaCl concentration was reduced to 0.5 M, and the pH was adjusted to 7.5. 0.5M Bruce with a buffer consisting of NaCl, 25 mM Tris, 10 mM CHAPS and 1 mM EDTA, pH 7.5. After washing the Faroose column well, increase the NaCl concentration to 3.0 M to allow PAF-AH Was eluted.   The purity of PAF-AH isolated by this method is usually 95% as assessed by SDS-PAGE. And the activity was in the range of 5000-10,000 U / ml. For each PAF-AH preparation Additional quality controls include endotoxin levels and fresh The measurement of the hemolytic activity of the obtained rat erythrocytes was mentioned. 25mM Tris, Buffer containing 10 mM CHAPS, 0.5 M NaCl, pH 7.5 is only used as a storage medium for the enzyme. But served as a carrier for administration. The dose used in the experiment should be taken immediately before the experiment. Based on the enzyme activity assay described above. B.Induction of edema   180-200 gram weight, 6-8 week old female Long Evans rats ( Charles River, Wilmington, Massachusetts Sett.) Was used for all experiments. Prior to the experimental procedure, 1 rat 2.5 mg of Ketaset per dose (Fort Dodge Laborato Leeds (Fort Dodge Laboratories), Fort Dodge, Iowa, 1.6 mg Rompun (Miles, Schawnee Mission, Sens.), 0.2 mg Ace Promazine (Aveco, Inc. Anesthesia Ketaset, Rompane and Acespro at Autododge, Iowa Rats were anesthetized using subcutaneous administration of a mixture of mazines. PAF or Zymosa Edema was induced in the paws by administering one of the following as follows. PAF (Sigma # P-1402) is stored at -20 ° C in chloroform / methanol (9: 1). Freshly prepared for each experiment from a 19.1 mM stock solution. N_TwoNeed to dry under Volume containing 150 mM NaCl, 10 mM Tris, pH 7.5, and 0.25% BSA. Diluted 1: 1000 with the owning buffer and then sonicated for 5 minutes. Rats with hind paws 50 μl of PAF (final dose 0.96 nmol) was subcutaneously administered between the toes, and one hour later, Edema was also evaluated after 2 hours in some experiments. Zymosan A (Sigma # A-8800 ) Was freshly prepared for each experiment as a 10 mg / ml suspension in PBS. Rat On the hind legs 50 μl of zymosan (final dose 500 μg) was subcutaneously administered between the toes, and 2 hours later Edema was evaluated.   Shown immediately before PAF or zymosan administration and after PAF or zymosan stimulation At time points, edema was quantified by measuring paw volume. Edema Expressed as an increase in foot capacity in torr. Measure the volume of water displaced by feet soaked in water Anesthesia using a plethysmometer (UGO Basile, model # 7150) Volume displacement measurements were performed on rats that had been subjected. One point and the next point Does not disappear at the border of the hairline and heel of the hind foot to ensure that it can be compared with Marked with ink. Repeated measurements of the same foot using this technique will result in an accuracy of 5 %. C.PAF-AH Administration route and dosage   PAF-AH can be administered locally between the toes of the foot or by intravenous (IV) injection into the tail vein. The whole body was injected. In the case of local administration, 100 μl of PAF-AH (4000-6000 U / ml) was administered to the rats. The left foot is 100 μl of carrier (buffered) Saline) was used as a control. For systemic administration of PAF-AH And the PAF-AH containing the indicated number of units in 300 μl Were administered intravenously. In the control group, an appropriate volume of carrier was injected into the tail vein by intravenous injection. Gave. D.PAF-AH Topical administration of   Inject 100 μl of PAF-AH (4000-6000 U / ml) subcutaneously between right foot pads to rats (N = 4) Fired. The left paw was injected with 100 μl of carrier (buffered saline). The other four Rats were injected with vehicle only. Immediately via subcutaneous paw injection in all rats And in PAF Stimulation and paw volume was assessed 1 hour after stimulation. In FIG. 6, each treatment group Edema is expressed as the mean paw volume increase (ml) ± SEM, and PAF-induced paw 3 shows that edema of is inhibited by topical administration of PAF-AH. PAF-A before PAF stimulation Group receiving local treatment with H has reduced inflammation compared to control injected group It has been shown. The increase in foot volume was 0.63 ml ± 0.14 (SEM) in the vehicle treated control group. In contrast, 0.08 ml ± 0.08 (SEM) was observed in the PAF-AH group. Inject only carrier into feet Since the exposed rats did not show an increase in paw volume, the increase in paw volume was Is the direct result of the injection. E. FIG.PAF-AH Intravenous administration of   Rats (N = 4 per group) were given 15 minutes prior to PAF stimulation with PAF-AH (20 μl in 300 μl vehicle). 00U) or intravenous pretreatment with carrier alone. 1 hour after PAF stimulation and Two hours later, edema was assessed. In FIG. 7, the increase in volume for each treatment group Edema is expressed as mean (ml) ± SEM, and PAF-induced paw edema was 1 and 2 post-stimulation. Shows that by time, PAF-AH is blocked by intravenous administration. By intravenous route The group receiving 2000 U PAF-AH showed reduced inflammation over a 2 hour time course. Was shown. In the PAF-AH-treated group, the mean volume increase was 0.10 μl ± 0.08 (SEM). In contrast, 0.56 ml ± 0.11 (SEM) in the vehicle-treated control group . F.PAF Of protection by PAF-AH in edema induced by or zymosan   Rats (N = 4 per group), PAF-AH (2000U in 300μl carrier) or carrier alone Pretreatment was performed intravenously using. After pretreatment At 15 minutes, PAF or thymosan A was administered to the group for 1 hour and 2 hours, respectively. Later, paw volume was assessed. As shown in FIG. 8, the volume of each treatment group was Edema is expressed as mean increase (ml) ± SEM, and systemic administration of PAF-AH (2000 U) Effective in reducing F-induced paw edema, but induced with zymosan Edema could not be stopped. The mean increase in volume of 0.08 ± 0.02 was given to the PAF-AH treated group. In contrast, it was 0.49 ± 0.03 for the control group. G. FIG.PAF-AH Of Effective Dose for Protection by Antibiotic   In two separate experiments, groups of rats (N = 3-4 per group) were given prior to PAF stimulation. At 15 minutes, in a volume of 300 μl, using serial dilutions of PAF-AH or carrier controls Intravenous pretreatment was performed. Stimulate with PAF on both feet (as above), 1 hour later The edema was evaluated. In FIG. 9, the mean value of the increase in volume (ml) ± for each treatment group Edema is represented as SEM, and as the PAF-AH dose is increased and injected, Protection from PAF-induced edema in mice is shown to be increased. For experiments And PAF-AH ID given by intravenous route₅₀Means 40U and 80U per rat Was found to be between H.In vivo efficacy of PAF-AH as a function of time after administration     In two separate experiments, two groups of rats (N = 3-4 per group) were given PAF-AH (2000 U in 300 μl carrier) or the carrier alone was used to pre-treat intravenously. Throw After administration, groups of rats receive PAF at times ranging from 15 minutes to 47 hours after PAF-AH administration. Was administered. One hour after PAF stimulation, edema was assessed. As shown in FIG. The mean volume increase (ml) ± SEM for each treatment group Tumors were present and given 2000 U of PAF-AH, PAF-induced buoyancy for at least 24 hours The rat is protected from the tumor. I.PAF-AH Pharmacokinetics   Four rats received 2000 U of PAF-AH by intravenous injection in a volume of 300 μl. Was. Plasma was collected at various time points, stored at 4 ° C., and used for double mAb capture assays (double The plasma concentration of PAF-AH was measured by ELISA using Ab capture assay. That is, monoclonal antibody 90G11D (Example 13) was added to 50 mM carbonate buffer, pH 9.6. Diluted to 100 ng / ml and immobilized on Imlon 4 ELISA plate at 4 ° C. overnight. Was. After washing well with PBS containing 0.05% Tween 20, 0.5% fish skin Block the plate with PBS containing gelatin (Sigma) for 1 hour at room temperature did. A serum sample diluted with PBS containing 15 mM CHAPS is placed on a washed ELISA plate. Added in duplicate and incubated for 1 hour at room temperature. After washing, monochrome Biotin complex of the internal antibody 90F2D (Example 13) was diluted with PBS to a concentration of 5 μg / ml. And added to the wells and then incubated for 1 hour at room temperature. After cleaning, 1: 1000 dilution of StraAvidin (Sigma) in 50 μl wells In addition, it was incubated at room temperature for 1 hour. After washing, use OPD as substrate The well was developed and quantified. Thereafter, the enzyme activity was calculated from the standard curve. In FIG. , The data points represent the mean ± SEM, but 5 for rats weighing 180-200 grams. Plasma enzyme concentration to predicted concentration based on ~ 6 ml plasma, mean = 374 U / ml ± 58.2 It indicates that the level has been reached in one hour. After 1 hour, plasma levels Gradually attenuates, and in 24 hours the average value of the concentration in plasma reaches 19.3 U / ml ± 3.4, Nevertheless, the enzymatic assay shows that it is approximately 4 U / ml. Significantly higher than endogenous rat PAF-AH levels issued. J.PAF Efficacy of PAF-AH for antagonists   Intraperitoneal (IP) administration of the following three potential anti-inflammatory agents (in 200 μl EtOH, 2 mg) PAF antagonist CV3988 (Biomol # L-103), intraperitoneal injection (2 mg in 200 μl EtOH) of the PAF antagonist alprazolam (Alpraz olam) (Sigma # A-8800), or PAF-AH (2000U) administered intravenously One was used to pre-treat groups of rats (N = 4 per group). For control rats Was injected intravenously with a 300 μl volume of the carrier. PAF antagonist is soluble in ethanol It was administered intraperitoneally because it was understood. Injected CV3988 or alprazolam Rats are given a PAF antagonist to allow the PAF antagonist to enter the circulatory system. PAF stimulation was given 30 minutes after administration of the agonist, while rat treatment with PAF-AH and vehicle Were stimulated 15 minutes after administration of the enzyme. CV398, an established PAF antagonist 8 and PAF-induced edema far more than can be achieved with alprazolam Was shown to be reduced in rats injected with PAF-AH. In FIG. Edema is expressed as the mean increase in volume (ml) ± SEM for the control group.   In summary, rPAF-AH blocks PAF-mediated edema in vivo Is effective in PAF-AH products can be administered locally or systemically by intravenous injection It can be. In dose studies, intravenous injections ranging from 160-2000 U / rat Has been found to dramatically reduce PAF-mediated inflammation,₅₀Amount of Seems to be in the range of 40-80 U / rat. Blood for rats weighing 180-200 grams According to plasma volume calculations, PAF-induced concentrations in plasma range from 25 to 40 U / ml. Edema stopped It is expected to be done. This prediction was supported by preliminary pharmacokinetic studies. Be held. PAF-mediated edema for at least 24 hours at 2000 U PAF-AH dose Was found to be effective in preventing 24 hours after administration of PAF-AH, the enzyme Was found to be approximately 25 U / ml. PAF-AH has two Inhibits PAF-induced edema even more effectively than known PAF antagonists Was found.   Taken together, these results show that PAF-AH effectively blocks PAF-induced inflammation However, PAF-AH has therapeutic value in diseases where PAF is the primary mediator. Prove that you might                                Example 15   The recombinant PAF-AH of the present invention is used for PAF-induced pleurisy, a second in vivo model. The test was carried out. Vascular leakage when PAF is introduced into the pleural space It has been reported to trigger (Henryk et al., Supra). Female rat ( (Charles River, 180-200g), 200% of 1% Evansbu 300 µl of recombinant PAF-AH (1500 µmol / ml / hour, Example 1) 4) or an equal volume of control buffer was injected into the tail vein. Fifteen One minute later, the rats were injected with 100 μl of PAF (2.0 nmol) into the pleural space. 1 hour of PAF stimulation Shortly afterwards, the rats are sacrificed and the pleural cavity is excised with 3 ml of heparinized phosphate buffered saline. The pleural fluid was collected by washing. The degree of vascular leakage is determined by the absorbance at 620 nm. It was quantified by the amount of Evans blue staining solution in the measured pleural space. Pretreatment with PAF-AH Rats showed significantly less vascular leakage than control rats (80% or more). Reduction in inflammation was observed).   The above results indicate that the recombinant PAF-AH enzyme of the present invention is useful in treating subjects with pleurisy. It supports the effect.                                Example 16   The recombinant PAF-AH of the present invention was also tested for its efficacy in an antigen-induced eosinophil model. Test was carried out. Eosinophil accumulation in the respiratory tract is a late immune system that causes asthma, rhinitis and eczema. Characteristic of epidemic response. BALB / c mice (Charles River) run every 2 weeks 4 mg of aluminum hydroxide (Imject alum, pierced earrings) During Laboratories (Pierce Laboratories), Rockford, Illinois Sensitized by two intraperitoneal injections consisting of 1 μg ovalbumin (OVA) I let you. Fourteen days after the second immunization, sensitized mice were aerosolized with OV Stimulation was performed with either A or saline as a control.   Prior to stimulation, mice were arbitrarily divided into four groups, with four mice in each group. Was. Group 1 and 3 mice received 25 mM Tris, 0.5 M NaCl, 1 mM EDTA and 0.1% Twist. Pretreatment was carried out by intraperitoneal injection of 140 μl of a control buffer composed of PEG 80. 2 And four groups of mice had an activity of 750 units (140 μl of PAF-AH buffer administered). , 5500 units / ml). Administer PAF-AH or buffer After 30 minutes, mice in groups 1 and 2 were aerosolized as described below in PBS. Exposure, while mice in groups 3 and 4 were exposed to aerosolized OVA. 24 hours later In addition, 140 μl of buffer (groups 1 and 3) or 750 units of PAF-AH in 140 μl of buffer ( A second treatment was performed by intravenous injection of either one of groups 2 and 4). .   Eosinophil infiltration in the trachea exposes sensitized mice to aerosolized OVA Induced by Sensitized mouse with a cone Place in a 50 ml centrifuge tube (Corning), nebulizer (Model 646, de Using DeVilbiss Corp., Somerset, PA, 2 For 0 minutes, forcibly aerosolized OVA (50 mg / ml) dissolved in 0.9% saline Inhaled. Control mice were treated with 0.9% saline in a nebulizer. Outside was treated in the same manner as above. Aerosolized OVA or saline 48 hours after exposure, the mice were sacrificed and the trachea was removed. Removed from each group Trachea were embedded in OCT and stored at -70 C until tissue was cut.   To assess tracheal eosinophil infiltration, tissue sections from four groups of mice were Solution and hematoxylin-eosin solution or peroxidase did. Twelve 6 μm-thick tissue sections were cut from each group of mice and numbered sequentially. Injured. Odd-numbered sections were stained with Luna solution as follows. Sections were fixed in formal alcohol for 5 minutes at room temperature, and Wash with 3 changes of running water, then 2 changes of distilled water for 1 minute at room temperature. Was cleaned. Tissue sections can be stained with Luna stain (Luna stain is 90 ml Weigert iron hema 5 minutes at room temperature with toxillin and 10 ml of 1% Biebrich scarlet) Staining. Dip the stained section slides 6 times in 1% acidic alcohol and bring to room temperature. For 1 minute in tap water, soak 5 times in 0.5% lithium carbonate solution, and For 2 minutes with running tap water. Section slides, 70%, 95%, 100% Each was dehydrated with ethanol at room temperature for 1 minute, and then at room temperature for 1 minute. The sirens were changed twice and washed and placed on Cytoseal 60.   For staining with peroxidase, even-numbered sections were placed in acetone at 4 ° C. And fixed in air for 10 minutes and allowed to air dry. 200 μl of DAB solution was added to each section and left at room temperature for 5 minutes. Section slides Wash with tap water at room temperature for 5 minutes and add 2 drops of 1% osmic acid to each section For 3 to 5 seconds. Rinse section slides in tap water for 5 minutes at room temperature Cleaned and counterstained with Meyers' hematoxylin at room temperature of 25 ° C. Rinse section slides in running tap water for 5 minutes, 70%, 95%, 100% ethanol Each was dehydrated for 1 minute at room temperature. Slice slides at room temperature for 1 Washed with two changes of xylene for a minute and placed on sight seal 60.   The number of eosinophils in the submucosa of the trachea was evaluated. The trachea of mice in groups 1 and 2 Almost no eosinophils dispersed throughout the submucosa were found. Buffer Expected in trachea of three groups of mice pre-treated with fluid and exposed to nebulized OVA As described above, numerous eosinophils were observed throughout the submucosa. In contrast In the trachea of four groups of mice, pretreated with PAF-AH and exposed to nebulized OVA, And eosinophils in the submucosal tissue were comparable to the results seen in the two control groups. I could hardly see it.   Thus, eosinophil accumulation in the respiratory tract, as occurs in asthma, rhinitis and eczema. Patients with a late immune response, including product, are instructed to be treated with PAF-AH It is.                                Example 17   The PAF-AH product of the present invention is expressed in necrotizing enterocolitis (NEC, an infant with low birth weight). Treatment of acute hemorrhagic necrosis of the intestine, leading to considerable morbidity and mortality Was also examined in two different rat models. According to previous experiments, Lucicoid treatment reduces the incidence of NEC in animals and immature infants Glucocorticoid activity has been shown to decrease, increasing plasma PAF-AH It is suggested to occur through A. Activity of NEC induced by PAF stimulation in rats.   1.NEC Prevention   Recombinant PAF-AH product, rPH.2 (25,500 units in 0.3 ml, groups 2 and 4), or medium Body / buffer only (25 mM Tris, 0.5 M NaCl, 1 mM EDTA and 0.1% Tween 80) Groups 1 and 3) were treated with female Wistar rats (n) weighing 180-220 grams. = 3) was administered into the tail vein. Previously Furukawa et al. (J. Pediatr. Res., 34, 237 15 minutes after injection of rPH.2 or vehicle, as reported by BSA (0.25%)-saline suspended in saline (Groups 1 and 2) or BSA-saline PAF (0.2 μg / 100 g) (Groups 3 and 4) was applied to the position of superior mesenteric artery Was injected into the abdominal aorta. Two hours later, remove small intestine from Trietz ligament into cecum Then, it was thoroughly washed with a cooled physiological saline and visually examined. Samples are above and in the small intestine Obtained by microscopic observation from the middle and lower sites. Tissue is buffered formali Samples and stained with hematoxylin and eosin. And processed for observation in a microscope. The experiment was repeated three times.   Macroscopically, the group treated with the BSA saline vehicle showed a normal appearance of intestines. It was suggested that Similarly, injection of rPH.2 in the absence of PAF There was no effect on the look. In contrast, injection of PAF into the descending aorta quickly A rapid and severe discoloration and bleeding of the intestinal chorion surface was caused. Slice the small intestine section Examination of the membrane side shows similar bleeding and virtually intestinal necrosis It seemed. 15 minutes before administration of PAF to the aorta When rPH.2 was injected via the tail vein, the intestinal appearance was normal.   Upon microscopic observation, the intestines obtained from groups 1, 2 and 4 showed normal villous structures. Normal individuals of cells in the stroma and lamina propria were revealed. In contrast, treatment with PAF only The affected group showed well-thickened necrosis and bleeding throughout the mucosa.   Plasma PAF-AH activity was also quantified in the rats used in the above experiments. PAF-AH activity Was determined as follows. Blood samples were taken before injection into the tail vein. Continued Blood samples were collected from the vena cava just before PAF injection and at the time of sacrifice. Heparinization Approximately 50 μl of blood was collected in a capillary tube. Centrifugation (980 xg, 5 Min) to obtain plasma. Yasuda and Johnston, Endocr Enzyme was assayed as previously reported by Inology, 130, 708-716, (1992). Was.   The mean plasma PAF-AH activity of all rats before injection was 75.5 ± 2.5 units (1 unit equals 1 Nanomol x min^-1x ml^-1(Corresponding to plasma). Vehicle injection The mean plasma PAF-AH activity after 15 minutes was 75.2 ± 2.6 units for Group 1 and 3 For the group, it was 76.7 ± 3.5 units. Blood of rats injected with 25,500 units of rPH.2 Serum PAF-AH activity was 15 minutes later, 2249 ± 341 units for group 2 and 4 groups. The value was 2494 ± 623 units. The activities of Groups 2 and 4 were determined by sacrifice time (rPH.2 injection 2 hours and 15 minutes later) (2855 = 1771 ± 3) 08, group 4 = 1939 ± 478 units). As a result, rats injected with vehicle only ( It was suggested that the plasma PAF-AH activity of Groups 1 and 3) did not change during the experiment. You. All rats that received only PAF injection developed NEC, while rPH following PAF injection. All rats injected with .2 were completely protected.   2.NEC Dose-dependent prevention of   To determine whether protection against NEC in rats was dose-dependent, P Rats were treated with increasing amounts of rPH.2 15 minutes prior to AF administration. First, 25.5-25,500 A unit range of rPH.2 was administered to the tail vein of rats. Subsequently, 15 minutes after the administration of rPH.2 , PAF (0.4 μg in 0.2 ml BSA-saline) was injected into the abdominal aorta. PAF administration 2 At time, the small intestine was removed and examined for the development of NEC. Plasma PAF-AH activity Quantification was performed before exogenous administration and at 15 minutes and 2 hours and 15 minutes after administration of rPH.2. Results are the average of 2-5 rats in each group.   By gross findings, all rats receiving less than 2,000 units of enzyme received NEC. It was shown to develop. For rats given the lowest protected amount of enzyme (2040 units) Plasma PAF-AH activity after 15 minutes was 363 units / ml, which was higher than basal levels. This corresponds to a figure that has increased five times. If rPH.2 is administered in a total of less than 1,020 units, The average plasma enzyme activity is less than about 160, and all rats develop NEC. I was   3.NEC Period of protection against   How long exogenous PAF-AH products provide protection against the development of NEC Rats are injected with a fixed amount of enzyme via the tail vein to measure PAF was administered at the point. rPH.2 (8,500 units in 0.3 ml) or vehicle alone, rat tail Administered intravenously, and at various times after enzyme administration, PAF (0.2 ml BSA-saline, 0.36 μg) was injected into the abdominal aorta. To evaluate the onset of NEC, The small intestine was removed 2 hours after PAF injection for visual observation and histological experiments. Enzyme administration After various times , And 2 hours after PAF administration, plasma PAF-AH activity was quantified. Enzyme activity for each group Mean ± standard error for gender was quantified.   As a result, none of the rats developed NEC within the first 8 hours after the injection of rPH.2. Meanwhile, rats stimulated with PAF 24 and 48 hours after enzyme injection were 100% It was shown to develop.   4.NEC Recovery   Administration of the PAF-AH product can reverse the onset of NEC induced by PAF injection. Two minutes after administration of PAF (0.4 μg), injection into the vena cava And administered 25,500 units of enzyme. Neither rat develops NEC Was. However, if rPH.2 was administered via this route 15 minutes after PAF injection, In this case, all rats developed NEC, and this result was previously reported to Furukawa et al. A more rapid time course of the onset of NEC induced by PAF administration It was a match.   Summary of these observations suggests that a relatively slight (5-fold) increase in plasma PAF-AH activity Therefore, it is suggested that NEC can be protected. These observations are Egret (Maki et al., Proc. Natl. Acad. Sci (USA), 85, 728-732 (1988)) and adult Blood in premature infants (Kaplan et al., J. Pediatr., 116, 908-964 (1990)) At birth, along with earlier reports that serum PAF-AH activity was relatively low, Prophylactic administration of recombinant PAF-AH products to low-weight infants is useful for treating NEC It may indicate that B.NEC In a newborn baby model   Formulation and choking (two common risk factors for disease in humans) Newborn rats were stressed by NEC Dell evaluated the efficacy of the PAF-AH product, rPH.2, as follows. this In the model, approximately 70-80% of rats resemble neonatal NEC by the third day after birth Gross and microscopic bowel injury. Newborn rats are CO_TwoChoking with Pregnant Sprague-Dawley rats delivered by abdominal incision ( Harlan Spragg-Dawley, Indianapolis, Indiana) Was. Neonatal rats are collected, dried, and treated with neonatal infusion for the entire duration of the experiment. It was kept in the cuvette.   First, an independent group of animals was used to assess the dose and absorption characteristics of rPH.2. Used. Normal neonatal rat infants receive three different intestinal or intraperitoneal doses of rP. One of H.2 (3λ, 15λ or 75λ) is given at 0:00 and plasma PAF-AH activity Blood was collected after 1, 6, or 24 hours to assess gender. Substrate b Incubation assay (Gray et al., Nature, 374, 549, (1995)) And an anti-human rPAF-AH monoclonal antibody against each sample (9 PAF-AH activity was measured using an ELISA with 0F2D and 90G11D). Selected The two different monoclonals made against human rPAF-AH Immunohistochemical analysis using antibodies (90F2D and 90G11D as described in Example 13) Was carried out. For immunohistochemical analysis, dilute the antibody 1: 100 and incubate overnight. Performed with standard technology that adopted   After intraperitoneal administration of rPH.2 to normal newborn rats, substrate incubation Measurable plasma P at any time, using either Say or ELISA techniques No AF-AH activity was found. For intraperitoneal administration of rPH.2, use both methods By one hour later, significant circulating PAF-AH activity could be measured and this activity Peaked at 6 hours. Results of increasing the dose of rPH.2 (3 to 75λ, 10 to 25 0U), plasma PAF-AH activity was even higher. Immunohistochemical analysis revealed that RPAF-AH product found in intestinal mucosal epithelial cells after administration . Reactivity was most dense in intestinal villi with minimal staining in crypt cells. Sky Staining was observed in the ileum rather than in the intestine, and some rPAF-AH products Some were identified immunochemically. Administered in control samples or via the intraperitoneal route No obvious staining was observed in specimens collected from the affected rats. Then Enteral administration of the rPAF-AH product will result in measurable systemic absorption of the enzyme. The result is local accumulation in the mucosal epithelium, while rP Intraperitoneal administration of AF-AH product increases circulatory enzyme levels but local mucosa The result was that no accumulation occurred.   In the NEC model, NEC, Kaplan et al., Pediatr. Pathol. , Volume 14, 1017-1 It was induced in newborn rats according to page 028, (1994). Briefly, reconstituted from powder Newborn infant formula (Esbiliac, Borden Inc.) ) Was given to rats via lactation tubes every 3 hours. The amount of breastfeeding Starting with 0.1 ml per milk, 0.4 ml per lactation by day 4 of the protocol It was gradually increased because it did not get used to. All rats are closed plastic Breathe 100% nitrogen in the bar for 50 seconds, then expose to cold (4 ° C) for 10 minutes. The mice were challenged twice a day with anoxic injury. Gentle procedures each time after breastfeeding Stimulated intestinal and bladder function. Rats are 96 hours or until they show signs of distress. Reared. Affected rats have abdominal distention, bloody stool, respiratory distress, cyanosis, and He was lethargic and euthanized by decapitation. After sacrifice, the intestine of each rat was Grossly for signs of necrosis, and then for subsequent histological analysis Rumalin fixed. The specimen is embedded in paraffin, sectioned with a microtome, Stained with cylin and eosin and examined blindly by two observers. Intestine Injury to 1+ for epithelial cell lifting or segregation to mid-villus level 2+ for epithelial cell crusting, 3+ for whole villous necrosis, vs. transmural necrosis And scored as 4+.   To evaluate the efficacy of rPH.2, enteral administration to rats in three different groups, Treatment with the compound was administered via intracavitary administration or both. The rPH.2 preparation has 0.8 mg / ml protein, and has approximately 4000 units / mg PAF-AH activity. The toxin / protein ratio was below 0.5 EU / mg. For small intestinal rats The 25λ (80U) rPH.2 diluted in each lactation was delivered via an orogastric tube Given (every 3 hours). Intraperitoneal injections are given to rats twice daily. Gave 75λ. Control rats have the appropriate buffer without rPH.2. Liquid (20mM NaPO_Four, PH 7.4) and tested simultaneously for each experimental group. Mortality and N Signs of EC were evaluated for each treatment group and differences were assessed by Fisher's exact test (Fischer's s Exact test). Significant for p-values below 0.05 I thought it was. The results are shown in Table 9 below.Data are 4 different experiments for intraperitoneal administration and 4 for transintestinal administration Represents the cumulative results from three experiments, and three experiments for intraperitoneal and enteral administration .   Administration of rPH.2 via the small intestine resulted in both NEC and death compared to control rats. The survival rate was significantly reduced. From the results of four different experiments with enteral administration, rPH. Pretreatment with 2 showed that NEC was reduced from 19/26 (control) to 6/26 (p <0.001). Intestinal injury varied between treated and control rats, but was mostly In most cases, midvillous necrosis in one area, villi in other areas In areas of general necrosis, sporadic areas of transmural necrosis, and the remaining, histologically normal parts of the intestine The characteristics were shown more. With intestinal damage in treated and control rats , Worst degree of NEC was similar (2.8 in control rats vs. rPH.2 treated rats) With a median score of 2.4, p> 0.05).   Intraperitoneal administration with rPH.2 has been shown to reduce NEC or death in this model. No significant influence was shown. Onset of symptoms between this group and control (40 ± 5 hours for control vs. 36 ± 7 hours for rPH.2 treated rats). The degree of NEC in both groups was also similar (versus the median score of 2.6 in controls). , 2.5 in rPH.2 treated rats).   As a single treatment group, rats were given parallel administration both transrectally and intraperitoneally. RPH.2 (every 3 hours every lactation, in addition to 25λ rPH.2, Two further 75 λ intraperitoneal injections) were performed for further experiments. The results are shown in Table 9 above. Although there was no significant difference in mortality between the treatment and control groups, rPH.2 treatment did not. As a result, the incidence of NEC was significantly reduced (10/17 in control rats versus rPH.2 treated rats). 3/14, p = 0.04). It should be noted that 7 animals died in the rPH.2 treatment group Six of the rats showed positive blood culture results for E. coli (immediately before death). Obtained).   These results indicate that PAF- was not induced in PAF-induced neonatal models of NEC. The protective role of AH products is further supported. For small intestinal treatment using rPAF-AH product Therefore, NEC is prevented, and there is no apparent effect of intraperitoneal treatment at these doses. Not shown. Based on these findings, the danger to NEC given the formula Supplementing pregnant immature newborns with PAF-AH products reduces the incidence of this disease It is suggested that you may be twisted.                                Example 18   Efficacy of PAF-AH product in guinea pig model of acute respiratory distress syndrome (ARDS) Examined.   Platelet activating factor (PAF) injected intravenously into guinea pigs Deep pulmonary inflammation is created that is reminiscent of early ARDS in humans. Intravenous PAF Within minutes after the injection, the parenchyma of the lungs becomes congested and the bronchi and bronchioles With shrinkage (Reroucchi-Tubiana et al., Supra). Platelets and polymorphonuclear neutrophils are marginal Begins to develop and cell clumps are easily identified along the pulmonary arterioles (Rerowch-Zubi) Ana, Br. J. Exp. Path., 66, 345-355, (1985)). Airway by PAF injection Bronchial epithelial cells that dissociate from the wall and accumulate in the lumen of the airways are also damaged. This feeling Damage to tract epithelial cells is consistent with the formation of hyaline membranes in humans during ARDS progression Things. Immediately after marginalization of neutrophils and platelets, alveolar septum and alveolar space of lung Emigration of these cells into the cell occurs. With cell infiltrate induced by PAF Significant duct leakage occurs, causing airway edema (Kirsch, Exp . Lung Res., 18, pp. 447-459, (1992)). The overt edema was determined by in vitro experiments (perfusion In shed guinea pig lungs,¹²⁵Extravasation of fibrinogen labeled with I Is further supported by the dose-dependent (10-1000 ng / ml) induction of PAF) Basran, Br. J. Pharmacol., 77, 437 (1982)).   Based on the above observations, a model of ARDS in guinea pigs was developed. Anesthetize Male Hartly guinea pig (approximately 350-400 grams) Phosphate-buffered physiologic containing 0.25% bovine serum albumin with carrier Total administration of PAF diluted in a 500 μl saline solution (PBS-BSA) in the range of 100-400 ng / kg Inject in volume over 15 minutes. Guinea pigs are sacrificed at various intervals after PAF injection And harvest lung tissue. In guinea pigs injected with PAF, dose-dependent lung injury and Inflammation is clearly evident by 15 minutes and remains present for 60 minutes. Moles treated with PAF Mott Neutrophils and red blood cells are present in the alveolar cavity of It does not exist in Lumot. Evidence of epithelial cell damage is also apparent, and human ARDS patients Recalls the formation of a hyaline film in Collected from guinea pigs injected with PAF Protein inflammation was determined by bronchoalveolar lavage (BAL) Dramatic protein accumulation (clear evidence of vascular leakage) in the lungs is shown.   rPH.2 is a complete response to PAF-mediated lung injury in a guinea pig model of ARDS It has been shown to provide protection. rPH.2 (2000 units in 500 μl) or 500 μl PAF-A Groups of guinea pigs were pre-treated with either H buffer alone. 15 minutes later, these Guinea pigs were infused with 400 ng / kg PAF in a volume of 500 μl over 15 minutes. In addition, The sham group of Lumot was injected with 500 μl of PBS-BSA. At the completion of the PAF infusion, The cells were sacrificed and 10 ml of saline containing 2 μg / ml heparin to prevent coagulation. BAL fluid was collected by washing the lungs twice with l. Quantify protein concentration in BAL The sample with 1:10 saline to obtain an OD₂₈₀Was measured. Pseudo guinea pig BAL fluid from the kit was found to have a protein concentration of 2.10 ± 1.3 mg / ml. Was. In sharp contrast, BAL fluid from guinea pigs injected with PAF was 12.55. A protein concentration of ± 1.65 mg / ml was found. moles pretreated with rPH.2. In the mot, the BAL fluid was found to have a protein concentration of 1.13 ± 0.25 mg / ml. This is comparable to the sham control and the PAF-AH product completely eliminates PAF-responsive pulmonary edema. It proves to defend.                                Example 19   The efficacy of rPH.2, a PAF-AH product, was determined by two different types of acute pancreatitis. The model was evaluated. A.Activity in rat pancreatitis model   Male Wistar rats (200-250 g) are from Charles River Laboratories (C (purchased from harles River Laboratories, Wilmington, MA) Entered. Rats were exposed to light / dark for 12 hours at 23 ± 2 ° C in a controlled environment room. The animals were housed as crews and fed standard laboratory animal chow and water ad libitum. Rat Was arbitrarily assigned to either the control group or the experimental group. 50mg / kg pentoval Anesthetized by applying bital sodium intraperitoneally, a polyvinyl catheter ( Size V3, Biolab Products, Lake Havasu Hav-asu), Arizona) was placed in the jugular vein by phlebotomy. Catheter Subcutaneously infiltrated to be in the back and neck region, then the rat was revived from anesthesia . Rats had free access to water but were fasted overnight. Awakening La The experiment was conducted on the next day for the kit. For a while, physiological saline (0. The patency of the catheter was maintained by injection (2 ml / hour). On the day of the experiment, Rats are given an intravenous injection of rPH.2 or vehicle control and then one of the following: That is, (1) 5 μg / kg of cellulane per hour for 3.5 hours, or (2) 1 hour 10 μg / kg of cellulane per 5 hours (Research Plus, Bay Bayonne, NJ) was injected. Immediately after completing the injection, the rat Anesthetize with sodium pentobarbital, open the abdomen and 5 m for subsequent assays l of blood was drawn from the inferior vena cava. The rats were then sacrificed by whole blood draw . Serum amylase, serum lipase and serum bilirubin are measured and pancreas is collected. Received. Pancreatic fragments were reconstituted in 4% phosphoric acid for histological examination. Fix with buffered formaldehyde solution or use myeloperoxidase activity Immediately frozen at -80 ° C for sex determination. Additional fragments of the pancreas are: Were evaluated for pancreatic water content and pancreatic amylase and trypsin. Myeloperoxidase activity, a measure of neutrophil sequestration, Evaluation was performed on pancreas and lung as described. Lung vascular permeability was also assessed as follows: did. Statistical analysis of the data was performed using the unpaired Student's t-test. Reported data are expressed as mean ± S.E.M of at least three experiments. The difference between the results is p < A case of 0.05 was considered significant.   1.Pancreatic water content   The pancreas fragments were weighed by wicking (wet weight) and then at 120 ° C for 34 hours. Dry completely between and weigh again (dry weight). The water content of the pancreas depends on the wet weight and Calculated as the difference in dry weight and expressed as a percentage of the wet weight of the pancreas. Includes pancreatic water An increase in the amount was considered to indicate the development of edema.   2.Serum and pancreatic amylase   Amylase activity in serum was determined by Pierre et al., Clin. Chem., 22, 1219. According to (1976) 4,6-ethylidene (G₇) -p-Nitrophenyl (G₁) -α₁D-Martopura Sid (ET-G₇PNP) (Sigma Chemical Co., St. Louis, MO) as substrate And used to measure. Pancreas set homogenized to 10 mM phosphate buffer, pH 7.4 Amylase activity in the weave was measured using the same method.   3.Pancreatic trypsin   Trypsin activity by fluorometry using Boc-Gin-Ala-Arg-MCA as substrate The properties were measured. Briefly, 200 μl of sample, 150 mM NaCl, 1 mM CaCl_TwoAnd 0.1 2.7 ml of 50 mM Tris buffer (pH 8.0) containing 5% bovine serum albumin Mixed in. After 20 seconds of pre-incubation to start the reaction, 100 μl of substrate was added to the preparation. Read the fluorescence (excitation: 380 nm, emission: 440 n m), and expressed as a gradient. Allow for the collection of data from different experiments For this reason, the trypsin activity of the fractions was expressed as a percentage of the total trypsin activity.   4.Tissue and morphometry   Complete microscopic sections of the pancreas head, head and tail were taken for optical microscopy. % Neutral phosphate buffered formalin. 5 μm section embedded in paraffin Stained with hematoxylin-eosin (H & E) and blinded by an experienced morphologist I checked. Acinar cell injury / necrosis was determined by (a) the presence of acinar cell ghosts or (b) acinar cells. Vacuolation and swelling of the alveoli and destruction of the tissue structure of all or part of the acini (both , Involved in the inflammatory response). Acinar cell wound The amount of harm / necrosis and total area occupied by acinar tissue were analyzed by NIH-1200 image analysis Computerized area measurement image analysis video unit with software Using the (CCD-72, Dage-MT1, Michigan City, Indiana) Each was quantified morphometrically. 10 randomly selected microscope fields (125x) Each tissue sample was examined. The degree of acinar cell injury / necrosis depends on the injury / necrosis Expressed as a percentage of the total acinar tissue occupied by the areas falling into the category.   5.Pancreatic and lung myeloperoxidase (MPO) activity measurement   Neutrophil expulsion in pancreas and lung is measured by measuring tissue myeloperoxidase activity Was evaluated by. Tissue samples collected at the time of sacrifice are kept at -70 ° C until the time of the assay. Saved. Thaw the sample (50 mg) and add 1 ml of 20 mM phosphate buffer (pH 7.4) It was homogenized and centrifuged (10,000 × g, 10 minutes, 4 ° C.). The resulting pellet With 0.5% hexadecyltrimethylammonium bromide (Sigma, St. Louis, Resuspend in 50 mM phosphate buffer (pH 6.0) containing -4 cycles of thawing. The suspension is then sonicated for 40 seconds. It was further pulverized and centrifuged (10,000 × g, 4 ° C. for 5 minutes). Extracted enzyme , 1.6 mM tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) State), a reaction consisting of 80 mM sodium phosphate buffer (pH 5.4) and 0.3 mM hydrogen peroxide The mixture was incubated at 37 ° C for 110 seconds, and the CobasBio The absorbance was measured at 655 nm on an analyzer. The absorbance is then determined by drying the fraction of the tissue sample. Corrected for dry weight.   6.Measurement of pulmonary vascular permeability   Obstruction of the common biliary pancreatic duct is also quantifiable by pulmonary vascular permeability and histology, It is typically attributable to severe pancreatitis-related lung injury.   Two hours before sacrifice of the animals, 5 mg / kg of fluorescein isocyanate albumin (FITC-Albumin, Sigma Chemical Company, St. Louis, MO) Rapid injection was performed. Pulmonary microvascular permeability, FITC from the vascular compartment to the bronchoalveolar space -Assessed by quantification of albumin leakage. Briefly, use forceps immediately after slaughter. And obstructed the right bronchus, exposing the trachea. Then insert it into the trachea The right lung was flushed by using the inserted cannula. Three times in saline The washing solution (60 ml washing solution) was collected, and FITC fluorescence in the serum and washing solution was excited at 494 nm. Light: measured at 520 nm. Calculate the ratio of lavage fluid fluorescence to blood and calculate It was taken as a measure of microvascular permeability. Lungs stained with H & E and histological examination went.   7.Effects of administration of caerulein and rPH.2   Injection with caerulein alone for 3.5 hours at 5 μg / kg / hr, in rats, Typical mild secretagogue-induced pancreatitis is induced, which is hyperamylasemic , Pancreatic edema as measured by water content of the pancreas, and marked acinar cell vacuolization and Histologic changes, including splenic edema, are characteristic. Control rats Some of these biochemical or histological changes resulted from the injection of saline into It was not evoked. 30, 10 or 20m 30 minutes before the start of the Cerulein infusion Intravenous administration of rPH.2 at a dose of g / kg induced by infusion of caerulein alone. Can significantly alter the extent of changes in pancreatic edema (water content) and tissue structure There was no. Administration of rPH.2 was due to caerulein-induced pancreatic trypsinogenesis. Nor had any effect on the activation of the amylase or amylase content.   As a result of injecting a larger amount of caerulein into rats (10 μg / kg / h for 5 hours), More severe pancreatitis was caused, with more pronounced serum amylase activity and Pancreatic edema, markedly increased pancreatic MPO activity, and trypsinol in the pancreas Characterized by a significant increase in gen activation and amylase activity. Pancreas Pair Due to the woven structure, not only pancreatic edema and acinar cell vacuolization, but also some patchy destruction Death and some infiltrating cells were indicated.   Administer rPH.2 (5 or 10) 30 minutes before the start of infusion of caerulein (10 μg / kg / h). mg / kg, i.v.), changes in pancreas induced by infusion of caerulein alone The degree of many things was improved. The results are shown in Table 10 below. 5 mg / kg dose Treatment resulted in a decrease in serum amylase activity (10984 ± 1412). From 6763 ± 1256). Higher amounts of rPH.2 and higher doses of 10 mg / kg It did not lead to further improvement of the zemic. Use rPH.2 at 5 or 10 mg / kg As a result of the treatment, the effect of caerulein-induced pancreatic edema, Some decrease was also caused (90.61 ± 0.27 for cellulane alone, 88.21 ± 0.61 when 5mg / kgrPH.2 is used in addition to rain. rPH.2 5mg / The kg dose provided a significant improvement in pancreatic MPO activity (compared to controls). In the case of Cerulein alone, an increase of 2.92 ± 0.32 times, while that of Cerulein with rPH.2 1.19 ± 0.21, p <0.05). Even if the dose of rPH.2 is further increased, the MPO activity Did not improve. At any dose of rPH.2, trypsin in the pancreas It did not significantly alter the magnitude of the nogen activation or amylase content. Due to the morphology of the pancreas, after rPH.2 pretreatment, some degree of microscopic necrosis and infiltration was observed. An improvement was suggested.   Pulmonary injury associated with pancreatitis occurs both clinically and in some models of pancreatitis. It has been observed in. Injection of Cerulein for 3.5 hours at 5 μg / kg / hr resulted in Mild pancreatitis was caused, but no significant damage to the lungs occurred. But Et al., Injecting caerulein at 10 μg / kg / h for 5 hours caused more severe pancreatitis This also increases lung vascular permeability (0.31 ± 0.04 to 0.79 ± 0.09), lung MPO activity (Indicating neutrophil expulsion) and quantified by neutrophil infiltration based on histological examination Cause lung injury Was done.   When rPH.2 is administered at a dose of 5 mg / kg 30 minutes before infusion of caerulein, The elevation of pulmonary MPO activity induced by German injection was significantly improved (Cerulein 3.55 ± 0.93 for single and 1.51 ± 0.26 for Cerulein and rPH.2. rPH.2 Treatment significantly increased the severity of microscopic changes observed in lung tissue after caerulein injection Reduced to Cerulein-induced increase in pulmonary vascular permeability is not statistically significant However, it was reduced by rPH.2 treatment. High dose rPH.2 of 10mg / kg In the severity of lung injury induced by caerulein than at lower doses. And there was no further efficacy.B.Activity in Opossum pancreatitis model   A healthy, randomly caught American opossum of any sex (Didelphis vi rginiana) (from 2.0 kg to 4.0 kg) from Scott-Hass, Raised as a 12 hour light / dark cycle at 23 ± 2 ° C in a controlled environment room, A standard laboratory animal diet was provided and water was provided ad libitum. After an overnight fast, the animals 50 mg / kg sodium pentobarbital (Vetelynary Laboratories, Inc. rinary Laboratories Inc.), Lenexa, Kans. I took it. Under sterile conditions, a laparotomy was performed by midline incision, and all animals were The common bile pancreatic duct was ligated to induce acute necrotizing pancreatitis. In addition, bile storage The gallbladder duct was ligated to prevent the gallbladder from working in some places. Animals as control or They were randomly assigned to the experimental groups. Starting on day 2 after ligation of the pancreatic duct, the experimental group received 1 day 5mg / kg body weight rPH.2 (administered as 4mg / ml solution) intravenously via tail vein The control group, on the other hand, received an intravenous injection of the same volume of placebo vehicle alone. 1 of treatment Two days later (3 and 4 days after ligation of the pancreatic duct), a lethal dose of pentobarbital Animals were euthanized by um. Serum amylase, serum lipase and serum virus Blood samples were taken from the heart for measurement of rubin, and the pancreas was harvested. pancreas Fragments are fixed in 4% phosphate buffered formaldehyde solution for histological examination. Or freeze immediately at -80 ° C for determination of myeloperoxidase activity. Was. Additional fragments of the pancreas were obtained as described above in section A of this example, And pancreatic amylase. Neutrophil sequestration measure Extensive myeloperoxidase activity was assessed in the pancreas as described above. lung Was also evaluated as described above.   The reported results were obtained from multiple quantifications in three or more independent experiments, Mean ± standard error of the mean (S.E.M). If the data is only for two groups When the significance of the change was assessed using the Student's t-test, In the case of comparison, evaluation was made by the analysis of variance (ANOVA). ANOVA shows significant difference If indicated, Tukey's method is used as a subsequent test for differences between groups. Was used to analyze the data. A p-value less than 0.05 is considered significant. I got it.   Table 11 shows the results. Occlusion of the common bile pancreatic duct, hyperamylaseemia, hyperlipase Severe necrotizing pancreatitis characterized by bloodemia and extensive necrosis of the pancreas Was evoked. In addition, obstruction of the common biliary pancreatic duct results in a marked increase in serum bilirubin levels Was involved. Intravenous rPH.2 (5 mg / kg / day) started on day 2 after ligation of pancreatic duct ), The extent of many pancreatic changes induced only by duct obstruction and placebo treatment Improved. Serum amylase levels in one day of rPH.2 treatment compared to placebo-treated animals Decreased, but this difference was not statistically significant, and two days of rPH.2 treatment (pancreatic 4 days after tube ligation), serum amylase levels were significantly reduced compared to placebo . 1 or 2 days of rPH.2 treatment reduced serum lipase levels compared to controls However, this difference was not statistically significant. 2 days of rPH.2 treatment compared to control Pancreatic amylase content decreased, but daily treatment caused an increase in pancreatic amylase It was done. Serum bilirubin levels, pancreatic myeloperoxy No effect on the sidase activity or pancreatic water content was observed.   Significant major histological changes induced by obstruction of the biliary pancreatic duct Includes necrosis, infiltration of inflammatory cells, vacuolation of acinar cells, and marked expansion of acinar lumen Had been. Acinar cell injury By pancreatic morphometric examination, the pancreas at 1 and 2 days after rPH.2 treatment The main protective effect of PH.2 was shown. For placebo-treated animals, 48 A day after rPH.2 treatment, the damage of acinar cells was It was reduced to about 23% of the tuft cell tissue. Such a decrease in acinar cell injury is due to 2 days of treatment Later, it is even clearer, with about 60% injury for placebo-treated animals. Injured about 35% of total acinar cell tissue as a result of rPH.2 treatment as compared to Had occurred.   According to the pulmonary vascular permeability quantified by FITC injection, rPH. High significance was shown 1 and 2 days after the two treatments. Histological examination of the lungs All placebo-treated animals showed severe lung injury. Lung injury is mainly due to macropha Widespread with interstitial and intraalveolar infiltration of blood, lymphocytes and neutrophils Inflammatory response and patchy but significant interstitial edema and alveolar membrane thickening It was characterized. As a result of the administration of rPH.2, a marked decrease and Attenuation of the quality edema was always caused.   In summary, these results indicate that 5 mg / kg / kg started 48 hours after ligation of the pancreatic duct. Blood levels of amylase and lipase as a result of intravenous administration of rPH.2 at daily doses Acinar cell injury quantified by increased morphology and morphometric examination of sections stained with H & E Significant improvement in harm, and a significant reduction in the severity of lung injury induced by pancreatitis Was evoked. RPAF-AH production in such a clinically relevant model of pancreatitis Administration of the product has shown a beneficial effect in reducing the severity of pancreatitis. Example 20   To evaluate the effect of rPH.2, a PAF-AH product, on neurotoxicity associated with HIV infection An experiment was performed for Central nervous system induced by human immunodeficiency virus type 1 (HIV-1) Infection results in neuronal loss due to apoptosis. Includes contact with nerve cells HIV-1-infected monocytes, activated by various antigenic stimuli, contain PAF. Secretes high levels of neurotoxic pro-inflammatory cytokines. Infected with HIV RPH.2 against neurotoxicity of conditioned monocyte-derived conditioned medium The effect of was evaluated.   Monocytes were infected and activated with HIV as follows. Monocytes contribute to HIV and hepatitis B Peripheral bone marrow cells (PBMC) after leukocyte pheresis in donors who are seronegative with serum And Genis et al. Exp. Med., 176, 1703-1718, Purified (> 98%) by countercurrent centrifugation as described (1992). Recombination Human macrophage colony stimulating factor (MCSF) (Genetics Institute) Tute (Genetics Institute, Inc.), Cambridge, Mass. Cells as adherent monolayers in DMEM (Sigma, St. Louis, Mo.) containing Was cultured in a T-75 culture flask.^FourCells / ml). Under these conditions, monocytes Differentiate into macrophages. After 7-10 days of culture, 0.01 infectious virions / marker Macrophages at the multiplicity of infection (MOI) of target cells_ADA(Accession number M60472 ). Immunofluorescence and in situ hybridization techniques (Culter (Ka lter) et al. According to Immunol., 146, 298-306 (1991)), Under these conditions, 20-50% of the monocytes were infected 7 days after HIV-1 inoculation. From two Every three days, all cultures were replenished with fresh medium. 5-7 days after HIV-1 infection , And between the peaks of reverse transcriptase activity (10⁷cpm / ml) (Culter et al., supra) Was evaluated), cultures of HIV-1 infected monocytes and parallel insensitivity. Cultures of stained monocyte cells were stimulated with LPS (10 ng / ml) or vehicle for 30 minutes at 37 ° C. At -8O 0 C until use in a neurotoxicity assay.   Human cerebral cortical nerve cell cultures were established as follows. Human fetal brain tissue, Banker and Cowan, Brain Res. 126, 397-425, (19 According to the modification of 77), the second trimester (13-16 weeks of gestation) Obtained from the telencephalon of fetal brain tissue. Briefly, collect brain tissue and add 30 ml of cold Hanks (Hank's) BSS (Ca⁺²And Mg⁺²Plus 25mM HEPES and 5X Gentamicin Wash), separate from attached meninges and blood, 2mm^ThreeInto fragments. So Tissue was pushed through a 230 μM Nitex bag and polished with a flame (fla me-polish) Gently crushed 10-15 times through a Pasteur pipette. The organization is 5 Centrifuge at 50 rpm for 5 minutes at 4 ° C., then N1 component (Insulin, 5 mg / l; Transferrin, 5 mg / l; selenite, 5 μg / l; progesterone 20 nM; Syn, 100 μM), 10% fetal calf serum (FCS), PSN antibiotic mixture (PEN Syrin, 50 mg / l; streptomycin, 50 mg / l; neomycin, 100 mg / l), and -Hipp (D-glucose 5g / l; L-glutami) containing stomach and fungizone (2.5mg / l) 2 mM; HEPES, 10 mM; sodium pyruvate, 1 mM; KCl 20 mM) in 5-10 ml. The pellet was resuspended. Cell counts and viability were measured with a hank containing 0.4% trypan blue. By diluting with the BSS (1: 1 volume / volume) and counting using a hemocytometer. And quantified. Cells are carefully dislodged 5 times with a 10 ml pipette and Poly-L-lysine (70K-150K molecular weight, Sigma, Pre-coated in St. Louis, Missouri) 10 per 12mm cover glass^FiveSeed at cell density. Add 1 ml of culture medium to each culture Pipette into well. 5% CO while changing the medium every 3 days_Two/ 95% air supply Cells were cultured under moist conditions at 37 ° C. for 10-28 days. Culture under these conditions The homogeneity of an object's neurons exceeds 60-70%, with 20-30% of astrocytes, Contains less than 1% microglia, ~ 10% macrophages and microglia staining Was accompanied. After 14 to 28 days of culture, the culture of neurons is treated with N-methyl-D-aspal Tate (NMDA) or non-NMDA receptor, NMDA or alpha-amino-3-hydroxy Death after administration of irritating toxic dose of c-5-methyl-4 isoxazolepropionic acid (AMPA) It is expressed at a level sufficient to destroy it.   The neurotoxicity assay was performed as follows. The test sample was stimulated with (a) LPS. Conditioned medium from HIV-1 infected monocytes, (b) control Medium, (c) conditioned medium or rPH.2 added at 51 μg / ml (D) is a conditioned medium to which the medium for rPH.2 has been added. , 1:10 v / v concentration for 24 hours. Newly cut Terminal to bind digoxigenin-dUTP to the free 3'-OH end of the DNA A commercially available kit using oxynucleotide transferase (TdT) (Apop Tag (Apop  Tag); 4% parahol using ONCOR, Gaithersburg, MD Apoptosis in situ on coverslips of neurons fixed to mualdehyde Neurotoxicity was measured by identifying the nuclei that underwent TUNEL staining (TUNEL staining). Nothing TUNEL-stained neurons in more than 15 randomly selected microscopic fields Digitized images are converted into computerized form counters (MCID, imaging (Imaging Research, Inc., St. Catherine, Ontario, Canada) , [Stained with TUNEL per 50X field of view Number of nuclei performed / number of total neurons]. Data for TUNEL staining The nuclei (%) of positive neurons (%) ± SEM are shown in FIG. A test of statistical significance between controls and experimental treatments was performed by ANOVA or paired t-test. It was determined to be significant if the p-value was 0.05 or less. Determination of these cultures Depending on the amount, conditioned media derived from HIV-infected and activated monocytes Induces neuronal cell death in nearly 25% of the total population of cerebral cortical neurons, Can reduce the toxicity of rPH.2 to less than 5% of the total number of neurons confirmed. 50 μg / ml rPH.2 compared to cultures treated with control medium RPH.2 itself is not neurotoxic since it had no effect on death Was. Incubation with PAF-AH product, the enzyme responsible for PAF metabolism in the central nervous system Beating can almost completely eliminate neurotoxicity, The results of this experiment demonstrate the condition of HIV-1 infected, activated monocyte cells. The major component of neurotoxicity induced by the application of It clearly suggests that there must be no difference. From these findings, Potential therapeutic intervention in the treatment of CNS neurological disorders associated with HIV-1 infection It is.                                Example 21     Nearly 4% of Japanese have low or undetectable levels of PAF-AH in their plasma Have activity. This defect genetically inherits an autosomal recessive defect. Strictly correlates with respiratory symptoms in supposedly asthmatic children (Miwa et al., J. Clin. I) nvest., 82, 1983-1991, (1988)).   Enzyme is present but inactive, or PAF-AH biosynthesis To determine if this defect occurs from a functional state, PAF-AH activity Plasma from multiple patients was analyzed for PAF-AH activity (Example 1 for transformants). 0) and in the sandwich ELISA below. About the presence of PAF-AH using clonal antibodies 90G11D and 90F2D (Example 13) Assays were performed for both. Imron 4 flat bottom plate (Dynatech, Chantilly, VA), 100 ng / well of monoclonal antibody 90G1 Covered with 1D and left overnight. Place the plate in 0.5% Fishes diluted in CMF-PBS. Blocked with Kin Gelatin (Sigma) for 1 hour at room temperature and washed 3 times. patient's The plasma was diluted in PBS containing 15 mM CHAPS and added to each well of the plate (50 μl / well). Well). The plate was incubated for 1 hour at room temperature and washed 4 times . 5 μg / ml monoclonal antibody 9 biotinylated and diluted in PBST Add 50 μl of 0F2D to each well and incubate plate for 1 hour at room temperature And washed three times. Extra avidin (cysteine) diluted 1/1000 in CMF-PBST 50 μl was added to each well, and the ink was allowed to stand at room temperature for 1 hour before development. Was added.   A direct correlation between PAF-AH activity and enzyme levels was observed. In the patient's serum The lack of activity was reflected as a lack of detectable enzyme. Similarly, normal activities A plasma sample with half the sex activity has half the normal level of PAF-AH activity. Was. From these observations, PAF-AH activity deficiency indicates that enzyme synthesis is impossible or It was suggested that this was due to an inactive enzyme that did not recognize the monoclonal antibody .   Further experiments show that this deficiency could lead to genetic damage in the human plasma PAF-AH gene It was clear that this was the case. Isolate genomic DNA from PAF-AH-deficient individuals and use primers specific for the PAF-AH gene. Was used as a template for PCR. Each of the coding sequence exons It was first amplified and sequenced one by one. Single nucleotide change in exon 9 (From G to T at position 996 of SEQ ID NO: 7) was observed. This nucleotide change As a result, amino acid substitution of phenylalanine at position 279 of the PAF-AH sequence with valine (V 279F). Genomic DNA from 11 additional PAF-AH deficient patients , Exon 9 were amplified and found to have the same point mutation.   To test whether this mutation inactivates the enzyme, include this mutation. An E. coli expression construct was produced in the same manner as described in Example 10. Big When introduced into enterobacteria, the expression construct did not show PAF-AH activity, but this mutation The activity was sufficiently observed in the control expression construct without. This amino acid substitution is Possibly, the observed deficiency of the activity caused the immune reaction with the PAF-AH antibody of the present invention. It appears to result in a structural modification that lacks sex.   Therefore, the PAF-AH-specific antibody of the present invention provides an abnormal level of PAF-AH in serum (normal level). Bell detects about 1-5 units / ml) and treats the pathological condition with PAF-AH Can be used in diagnostic methods for the improvement of In addition, PAF-AH gene Genetic damage was identified by screening for PAF-AH-deficient gene screening in Japanese patients. Enable This mutation creates a restriction endonuclease site (Mae II). As it arises newly, it is necessary to distinguish between the active allele and the mutant allele. Enables a simple method of fragment length polymorphism (RFLP) analysis. Lewin ), Genes V, Oxford University Press ss) New York, New York, (1994) at pages 136-141.   Screening of genomic DNA from 12 PAF-AH deficient patients by digestion of DNA with MaeII , Southern blotting, and exon 9 probe (nucleotide of SEQ ID NO: 17) 1 to 396). For all patients And an RFLP consistent with the mutant allele was found.   Although the present invention has been described with respect to particular embodiments, various modifications will occur to those skilled in the art. And changes can be made. Accordingly, the limitations specified in the appended claims Only should be given to the present invention.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/19 C12N 1/21 1/21 9/12 5/10 C12N 5/00 B 9/12 A61K 37 / 02 // (C12N 1/21 C12R 1:19) (C12N 1/21 C12R 1: 865) (C12N 5/10 C12R 1:91) (81) Designated country EP (AT, BE, CH, DE, DK) , ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE) , SN, TD, TG), AP (GH, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL , AM, AT, AU, A Z, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, HU, IL, IS, JP, KE, KG, KP , KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, TJ, TM, TR, TT, UA, UG, UZ, VN (72) Inventor Gray, Patrick United States 98112 Washington Seattle 38th Place East 2244 (72) Inventor Toron, Hi, Les United States 98107 Washington Seattle AT. W. 5th Avenue 6241 (72) Inventor Toerker, Rally, AW. USA 98021 Washington Bousers. W. 216 Street 404 (72) Inventor Wilder, Sheryl, El. E. 98s Avenue 2526

Claims (1)

[Claims]   1. Purified and isolated human plasma platelet activating factor acetylhydrolase (PA F-AH) a polypeptide fragment which comprises the mature human PAF-AH PAF-AH polypeptide fragment lacking the first 1 to 12 amino acids from the N-terminus of the amino acid sequence.   2. The following groups:   (a) Met of SEQ ID NO: 8 as the starting N-terminal amino acid₄₆A polypeptide having ;   (b) Ala of SEQ ID NO: 8 as the starting N-terminal amino acid₄₇A polypeptide having ;   (c) as starting N-terminal amino acid, Ala of SEQ ID NO: 8₄₈Polypeptides having 2. The PAF-AH polypeptide fragment according to claim 1, which is selected from the group consisting of:   3. Claims lacking 1 to 30 amino acids from the C-terminus of the amino acid sequence of SEQ ID NO: 8. 3. A PAF-AH polypeptide fragment according to any of claims 1 or 2.   4. As the C-terminal residue, SEQ ID NO: 8   (a) Ile₄₂₉,   (b) Leu₄₃₁,as well as   (c) Asn₄₄₁ 3. The method according to claim 1, which has a residue selected from the group consisting of: The described PAF-AH polypeptide fragment.   5. In the sequence of SEQ ID NO: 8, the following group:   (a) S108A,   (b) S273A,   (c) D286A,   (d) D286N,   (e) D296A,   (f) D304A,   (g) D338A,   (h) H351A,   (i) H395A,   (j) H399A,   (k) C67S,   (l) C229S,   (m) C291S,   (n) C334S, and   (o) C407S 2. The PAF-AH of claim 1 having an amino acid substitution selected from the group consisting of: Derivatives of polypeptide fragments.   6. In the sequence of SEQ ID NO: 8, the following group:   (a) D286A,   (b) D286N,   (c) D304A Deriving a human PAF-AH polypeptide having an amino acid substitution selected from the group consisting of: body.   7. A PAF-AH polypeptide fragment according to any one of claims 1 to 6, wherein the derivative is Isolated, encoding a body or derivative fragment Polynucleotide.   8. Met of SEQ ID NO: 8 as N-terminal residue₄₆And Ile as the C-terminal residue₄₂₉Also Is Asn₄₄₁An isolated human PAF-AH fragment or derivative fragment encoding Polynucleotide.   9. 9. The polynucleotide according to claim 7, which is DNA. De. 10. A DNA vector comprising the DNA according to claim 9. 11. Expression of a PAF-AH polypeptide fragment, derivative or derivative fragment in a host cell Stably transform or transform with the DNA of claim 9 so that expression is permissible. Transfected host cells. 12. Method for producing PAF-AH polypeptide fragment, plasma PAF-AH derivative or derivative fragment Growing the host cell according to claim 11 in a suitable medium. The PAF-AH fragment, derivative or derivative fragment from the cells or the growth medium thereof. A method comprising the step of isolating. 13. A PAF-AH polypeptide produced by the method of claim 12. Fragments, derivatives or derivative fragments. 14． The PAF-AH fragment or derivative according to any one of claims 1, 6 and 13. Or a derivative fragment and a pharmaceutically acceptable excipient, adjuvant or carrier. Pharmaceutical composition. 15. Treat mammals susceptible or affected by PAF-mediated conditions A method of supplementing PAF-AH activity in said mammal, and providing a pathological effect of PAF. Administering the pharmaceutical composition of claim 14 in an amount sufficient to inactivate the fruit. A method comprising the steps of: 16. The condition is pleurisy, asthma, rhinitis, necrotizing enterocolitis, acute respiratory distress syndrome, The method according to claim 15, which is a nervous system disease associated with acute pancreatitis or HIV infection. Law.