JPS6196998A - Production of human apolipoprotein a-1-like protein - Google Patents

Abstract

PURPOSE:A specific DNA fragment is introduced into the cloning site in the downstream of the promotor gene in the expression vector and the resultant vector is introduced into the host to enable high-efficiency production of a protein like human apolipoprotein. CONSTITUTION:A DNA fragment containing DNA coding for apolipoprotein or a substance having a similar physiological activity to human apolipoprotein is prepared. The resultant DNA fragment is introduced into the expression vector at the cloning site in the downstream of the promotor gene. Then, the vector including the DNA fragment is introduced into the host, the host is cultured to collect the protein produced. Some of the promotors are controllable by 1acI. The resultant protein is used as an antigen to produce an antiserum according to usual manner and the antiserum is used to detect apolipoprotein A-1.

Description

[Detailed description of the invention] (Industrial application field) Concerning a method for microbiological production of proteins.

(Prior Art) ``Major lipids present in plasma include cholesterol, phospholipids, triglycerides, and free fatty acids, of which the first three exist in combination with proteins.Water This lipid-protein complex, in which insoluble lipids are solubilized, is called riboprotein, and forms compounds of various weights depending on the ratio of lipid and protein. The structure is triglyceride with no polarity in the core,
It is believed that the presence of cholesterol esters, polar phospholipids, and free cholesterol together with proteins form the surface layer.

The protein contained in this riboprotein is called apoliboprotein, and more than 10 types are currently known. Apoliborotiine is not only necessary for the construction of riboproteins, but also plays an important role in riboprotein metabolism. Apoliboprotein A-1 is known as one of these apoliboproteins. This apoliboprotein A- has the function of activating I,C!AT (lecithin cholesterol acyl transferase), an enzyme that transports fatty acids at the β-position of lecithin to free cholesterol and converts it into cholesterol ester. It is known that it tends to fall.

When there is an abnormality in this apoliboprotein A-I, various abnormalities in riboprotein metabolism occur, such as hyperlipidemia and arteriosclerosis in many cases.

In such cases, the normal function of apoliboprotein A-■ can be restored by administering normal A-1 to the patient.

In order to obtain this apoliboprotein β-■ by recombinant DNA technology, the present inventors obtained a full-length cDNA fragment and have now used it to produce apoliboprotein A-1. reached the method.

That is, the gist of the present invention is that human apoliboprotein A
-7 or a D containing DNA encoding a human apoliboprotein A-1-like substance having similar physiological activity.
The method is characterized by introducing an NA fragment into a cloning site located downstream of the promoter of an expression vector, then introducing the vector into which the DNA fragment has been introduced into a host microorganism, culturing the host, and obtaining the protein to be produced. The present invention provides a method for producing human apoliboprotein A--like protein.

(Structure of the invention) The present invention will be explained in detail below.

First, the DNA fragment used in the present invention is prepared by the following method. i.e. human liver sections,
Homogenize small intestinal epithelial cells, macrophages in blood, kidney sections, etc. with guadinyl thiocyanate,
Separate total RNA by Ca1l equilibrium density gradient ultracentrifugation (Chirgwin et al., BiOCh8mi
8tr7. /I, 12 Rihiro-! Kotata.

/ri7ri).

This was then purified by oligo(aT) cellulose column chromatography in a conventional manner, and
ar ana Ce1lular B10l0g7.2
．． /lr/-/70. /912) by CD
Get the NA library. That is, a vector primer and an oligo(aG) tail linker are obtained using pBR322 and 5vtAO/N hybrid plasmid.

Reverse transcriptase is allowed to act in the coexistence of this vector primer and the above mRNA to synthesize cDNA, and then restriction enzyme H
Digested with 1M [[ and then cyclized using the linker described above. Then, the mRNA part is replaced with DNA to create cD
Obtain a plasmid containing an NA fragment.

This is then used to transform Escherichia coli or the like into ampicillin-resistant cells by a conventional method. Thereafter, the amino acid sequence 101-1 of apoliboprotein A-1 was used as a probe.
112th position T r p-G1. n-G l u-G 1u-M e
A synthetic oligonucleotide corresponding to t is used to select a clone containing a sequence complementary to this. The clones thus obtained are digested with appropriate restriction enzymes to select the clone containing the plasmid containing the longest cDNA.

The CIINA fragment obtained from the clone was obtained from Maxa
Methods in E
nzy-mology, &j, KotaterjtO,/
The base sequence is determined by

In the method of the present invention, the DNA fragment introduced into the cloning site of the expression vector is apoliboprotein, A
-1 or apoliboprotein A-1, which has the same physiological activity as apoliboprotein A-■
It is a DNA fragment containing NA. An example thereof is shown in FIG. 2, but the DMA fragment according to the present invention is not necessarily required to have the same base sequence as this, and the substance encoded by the DNA contained in the DNA fragment is apoliboprotein. As long as it is an apoliboprotein A-1-like substance that has the same physiological activity as A-1, it may be a base sequence in which part of the base sequence is substituted or deleted, or a base is added.

In the method of the present invention, the above-mentioned DNA fragment is introduced into a cloning site located downstream of an expression vector, and by translation using this as a template, a siaboriboprotein A-■ or an apoliboprotein A-i-like substance, Alternatively, a fusion protein containing this can be obtained.

Cloning sites include restriction enzyme recognition sites that enable direct expression of a target heterologous gene. Specifically, when the BarnH site immediately before the translation initiation codon is closed, and the BamH site located downstream of the promoter is not transmitted.

is preferable, and such a promoter is preferably “tr
p 7' o mo1 and hit trp 7' lomota,! :
ta, a fusion type promoter with the 1ac 7' promoter.
c promoter
onal Academy 8cienceto r
t (tyii) and special features 1. q Shoj7-7944
No. 790) is preferred. As a host, Escherichia coli, such as HB10/, 7M104, etc. can be used, and the transformed strain can be cultured and the protein obtained by conventional methods.

(Effects of the Invention) According to the method of the present invention, human apoliboprotein A-1-like protein can be efficiently expressed, and the resulting protein (
Apoliboprotein A-T) is used as an antigen, and an antiserum obtained by a conventional method can be used to detect the presence of apoliboprotein AT.

Furthermore, the obtained apoliboprotein A-1 can also be used as an antihyperlipidemic agent and an antiarteriosclerotic agent.

(Example) Hereinafter, the present invention will be explained in more detail with reference to Examples.
The present invention is not limited by the following examples unless it exceeds the gist thereof.

Example 1 A Preparation of raw material DNA fragment (1) A human liver section was crushed with liquid nitrogen, and then a guanidinium thiocyanate aqueous solution was added and homogenized. The obtained homogenate was subjected to the method of Chirgwin et al. (Biochemistry, /♂).

Total RNA was isolated by cesium chloride equilibrium density gradient ultracentrifugation according to J2 Ex-J Kotata, 127.

Next, this was purified by oligo(aT) cellulose column chromatography using a conventional method, and Bo! J (A) Containing R
NA was isolated and used as an mRNA source.

(2) On the other hand, Okayama and Berg's method (Mo1ecula
ranti (elular Biology 2.
/l/-/70. /#J) A vector primer and an oligo(dG) tail linker were obtained using pBRJ22 and the original plasmid of Nippon V.H.

That is, pBRj, 22 and 5veO (-v tube unit 0.7/-OJ Otsu) hybrid Grasmid Hiro QOμg was digested with the restriction enzyme Kpnl at 37°C for μ hours in a buffer containing bovine serum albumin. .

Next, the DNA was recovered by jetanol precipitation using a conventional method, dissolved in a buffer containing dTTP, terminal deoxynucleotidyl trans7-elase was added, and the reaction was carried out at 37°C for 30 minutes to dissolve the restriction enzyme Kpnl.
After about 40 dT details were added to the digestion site, JDNA was recovered by ethanol precipitation. Next, this D
The NA was digested with the restriction enzyme kl in a buffer containing bovine serum albumin (3.7°C, J' waiting time. The larger DNA fragment was purified by agarose gel electrophoresis and separated into glass powder. method (Vogelstein et al., Pro
c, Natl, Acad, 8ci, U, 8. A
,, 7A, 61! -tit', #7). After that, this DNAt? Oligo (aA
) The primer was applied to a cellulose column, eluted with water, and then recovered with ethanol to obtain a vector primer with an oligo(dT) tail.

On the other hand, 700 μg of a hybrid plasmid of pBRJ2J and 71'V San〇 (map unit 0./9-0.32) was digested with the restriction enzyme YU in a buffer containing comb serum albumin. , (77°C, 1.5 hours). Then, the DNA was collected, dissolved in a buffer containing dGTP, terminal deoxynucleotidyl trans7-erase was added, and reacted at 37°C for 20 minutes.
Approximately 10~/! dG detail was added. Recovered DN
A1. Digested with restriction enzyme H1nd Ill in a buffer containing bovine serum albumin (37°C, 1 hour).
, then subjected to agarose gel (t, r%) electrophoresis,
Small oligo(dG) tail linker-DNA was extracted and recovered.

0r11u:Lar Biology 2. I
ll-/70. /ri12), c
A DNA library was obtained.

That is, Tris-HCjl (pH♂, 3), MgC
l2, KOl, dithiothreitol, dATP, dT
T Pld G T P and (sap) a OT
The nine mRNAJ (
7℃g and the vector primer obtained in (2) above/θ
μg was added and incubated at 37°C for 20 minutes in the presence of reverse transcriptase.
The mixture was reacted for 1 minute to synthesize plasmid-cDNA:mRNA, which was precipitated with ethanol and collected in the form of a pellet.

This pellet was dissolved in a buffer containing 0oC12, diteothreitol, poly(A), (32p) dcTp, and terminal deoxynucleotedyl transferase, and reacted at 37°C for 10 minutes, resulting in a total of 9 L per end.
OMP's io~/! residue was added. Then, the recovered oligo(aa) tail plasmid-cDNA:mR
9. The pellet containing NA was dissolved in a buffer containing bovine serum albumin, digested with the restriction enzyme H1ndl for 7 hours at 37°C, and precipitated with ethanol.9. The utnd■ digested oligo(ac) tail cDNA:mRNA plasmid was recovered. This was dissolved in a buffer containing the oligo(aC) tail linker-DNA obtained in (2) above, and incubated at 4j℃, J
Incubate for 30 minutes, hold for 30 minutes, and cool to 0°C. Then, in the presence of β-NAD and cotin adenine dinucleotide), Escherichia coli (L coli)
DNA ligase was added and incubated overnight. Then dATP.

dTTP, dGTP% dC! TP, β-MAD.

E, coli DNA ligase, B, co
li DNA polymerase and E. coli RN
Ase H was added and the mixture was heated for 1 hour at °C.
After incubation at room temperature for 7 hours, the reaction was stopped and the desired cDNA fragment-containing plasmid was obtained.

(4) This plasmid was then used to transform Escherichia coli (Fi, 0O11) HB/0/ by a conventional method.

Then, as a ptarp, the amino acid sequence 10♂-// of apoliboprotein A-1, Z position T r p-G 1n
-G 1u-G 1u-M e t has complementarity l
≠mer synthetic oligonucleotide j'-0AT-CTC@CTC-CTCk-CC-J'
using the method of Hanahan et al. (Gene, 10
゜tj −J7. /910), and clones containing sequences complementary to this were selected. In transformants of about kooo, ooo, about r
Two clones were selected and treated with several restriction enzymes, and two of them were found to have a common restriction enzyme recognition site. The biggest loan among them is phA knee An! Optionally, the nucleotide sequence of this clone was determined by the method of Maxam and GilMrt.

Figure 1 shows a restriction enzyme cleavage map prepared for determining the base sequence of the above clone (ATG: translation initiation codon, T
GA: translation stop codon). Furthermore, FIG. 2 shows the base sequence and the assumed amino acid sequence of the above DNA fragment.

B. Production of human apoliboprotein A-(like protein a) Construction of expression plasmid 1) Construction of plasmid phA engineering (Figure 3) Plasmid phA neat obtained in above A was digested with restriction enzyme Ba.
n [partially digested with 37°C for 2 hours), further digested with restriction enzyme Hpal [37°C for 2 hours], 74L2b
Obtain a fragment of p.

On the other hand, transform plasmid pBRJco2 into restriction enzyme Δ11H
(2 hours at 37°C) to obtain a large fragment (approximately tiooθbp). Then these two fragments are combined GTAI:t...GGGGT
C ligated in the presence of T≠DNA polymerase (11°C
, l≠waiting time, obtain plasmid phA engineering l1l-/ (
Figure 3).

Next, this grasmid was treated with restriction enzyme EcoR, Bam
Digest with H-engine to obtain a fragment of about 1000 bp.

On the other hand, plasmid pDRjhiro0 (P, -LB4io
(available from chemicalLs) and the restriction enzyme Eco
R engineering, Bam H engineering at 37℃ for 1 hour), including the nibro motor area! Obtain a 00bp fragment.

Next, plasmid pBRJ λ was transformed into Ec.

R1 digestion (37°C, 2 hours), BAP treatment (37°C, 1 hour)
Time) Shi, this and the λ fragments are TFDNA! Ligate with J gauze to obtain a temperature of 11°C, tr waiting time, and plasmid phA processing time.

11) Production of protein The above-mentioned plasmid phA-E-/ was used to transform Inuyo bacterium HB10/, and the resulting transformant was cultured in MP-OA medium to produce protein. Production of human apoliboprotein A-1-like protein was confirmed by electrophoresis.

[Brief explanation of drawings]

FIG. 1 shows a restriction enzyme cleavage map of a clone having a plasmid into which the DNA fragment according to the present invention has been inserted, and FIG. 2 (a, b) shows the base sequence of the DNA fragment according to the present invention and its sequence. The assumed amino acid sequence is shown. FIG. 3 is a schematic diagram of the construction steps for the plasmid phA construct according to the present invention. Figure 2 (
λ) G'GAGTCCCCCACGGCCCTTCAGG
ATG AAA GCT GCG GTG CTG A
CCCTG GCCGTG CTCTTCMat Ly
s Ala Ala Val Leu Thr Leu
Ala Val Leu PheGACGAA CC
CCCCAG AGCCCCTG GAT CGA
GTG AAG GACCTG GCCACT GT
G TACAsp Glu Pro Pro
Gln Ser Pro Trp Asp
Arg Val Lys Asp Lsu
Ala Thr Vat Tyr CCCAG
TTT GAA GGCTCCGCCTTCGGA
AAIII CAG CTA AACCTA A
AG CTCCTT GAC6et Gln Ph
e Glu Gly Sir Ala Leu Gly
Lys Glr+ Leu Asn Leu Lys
Leu Leu aspCGCGAA CAG CT
CGGCCCT GTG ACCCAG GAG TT
CTGG GAT AACCTG GAA AAG G
AGArg Glu Gln Leu Gly
Pro Vat Dinghr Gln Glu
Phe Trp Asp Asn Leu
Glu Lys GluGAG GAG GT
G AAG GCCAAG GTG CAG CCCT
ACCTG GACGACTTCCAG AAG AA
G TGGGlu Glu Vol Lys Ala
Lys Val Gln Pro Tyr Lau A
sp Asp Phs Gln Lys Lys Tr
p・ ・ ・ ・ AGACTGCGAGGA
ACTG ACG GGG AGCCAG G
CT CGG CAT TTCTGG CAG
CAALeu Thr Gly Ssr Gln
Ala Arg His PheTrp Gln Gl
n-IGTG GAT GTG CTCAAA
GACAGCGGCAGA GACTAT GTGVa
l Asp Vat Leu Lys Asp S
er Gly Arg Asp Tyr Vat
30AACTGG GACAGCGTG ACC
TCCACCnCAGCAAG CτGASn Tr
p Asp S@r Val Thr Ser Thr
Phe Sir Lys Leu 60ACA
GAG GGCCTG AGG CAG GAG AT
G AGCAAG GAT CTGThr Glu G
ly Lau Arg Gln Glu Mat Ss
r Lys Asp Leu 90CAG GAG
GAG ATG GAG CTCTACCGCCAG
AAG GTG GAGGln Glu Glu M
at Glu Leu Tyr Arg Gln Ly
s Val Glu 120 Figure 3 (z) -1?1 Procedural name (proper writing) February 1985/and date

Claims (6)

[Claims] (1) Introducing a DNA fragment containing DNA encoding human apolipoprotein A-I or a human apolipoprotein A-I-like substance with similar physiological activity into the cloning site located downstream of the promoter of the expression vector. A method for producing a human apolipoprotein A-I-like protein, which comprises the steps of: introducing the vector into which the DNA fragment has been introduced into a host microorganism; culturing the host; and obtaining the protein produced. (2) The method according to claim 1, characterized in that the promoter is regulated by lac I . (3) The method according to claim 2, wherein the promoter is a \tac\ promoter. (4) The method according to claim 1, wherein the promoter is a β-lactamase gene promoter. (5) The method according to claim 1, wherein the cloning site is a \Bam\H I site that is present immediately before a translation initiation site. (6) The method according to claim 1, wherein the host microorganism is Escherichia coli.