AU753798B2

AU753798B2 - Plant grab proteins

Info

Publication number: AU753798B2
Application number: AU82160/98A
Authority: AU
Inventors: Crisanto Gutierrez-Armenta; Xie Qi; Andres Sanz-Burgos
Original assignee: Consejo Superior de Investigaciones Cientificas CSIC
Current assignee: Consejo Superior de Investigaciones Cientificas CSIC
Priority date: 1997-06-12
Filing date: 1998-06-09
Publication date: 2002-10-31
Anticipated expiration: 2018-06-09
Also published as: ES2132025A1; AU8216098A; WO1998056811B1; ES2132025B1; JP2002506345A; WO1998056811A3; CA2289863A1; NZ500529A; ZA985135B; CN1260837A; WO1998056811A2; WO1998056811A8; EP0989997A2; BR9809447A

Description

WO 98/56811 PCT/EP98/03662 PLANT GRAB PROTEINS.

The present invention relates to methods of controlling plant cell cycle, particularly for the purpose of controlling plant cell and plant virus growth and/or replication, differentiation, development and/or scenescence; to use of previously unidentified and/or unisolated proteins and/or nucleic acids in such methods; to use of known proteins and nucleic acids of previously unknown native function in such methods; to the unidentified and/or unisolated proteins and nucleic acids per se and in enriched, isolated, cell free and/or recombinant form; and to plants comprising such recombinant nucleic acids.

It has been well documented that successful completion of viral replication cycles within the infected cell usually requires the participation of cellular factors. This is particularly evident in the case of viruses with small genomes that encode just a few proteins. For example, animal DNA tumor viruses use the cellular machinery for their transcriptional and DNA replication processes. In addition one or more virally-encoded proteins have evolved that directly impinge on the infected cell physiology to create a cellular environment appropriate for viral replication. One typical example is that of the oncoproteins encoded by animal DNA tumor viruses, i. SV40 T antigen, adenovirus ElA or human papilloma virus E7 proteins, which activate cell cycle in the infected cell by interfering with the retinoblastoma pathway (26, 28, A similar strategy seems to have evolved in plant geminiviruses, a unique group of plant DNA viruses. The geminivirus genome consists of 1 or 2 small (2.6-3.0 kb) circular single-stranded DNA molecules, depending on the subgroups (11, 24). Wheat dwarf geminivirus (WDV) belongs to subgroup I whose members have the smallest genome, a single ssDNA molecule, 2750 nucleotides in length, which encodes only a few proteins. Among them, RepA (also called Cl) and Rep (also called CI:C2) are the only WDV proteins required for viral transcription and replication RepA is translated from the single transcript produced under the control of the complementarysense promoter. After a splicing event of this mRNA, the Rep protein is produced (37).

WDV Rep, absolutely required for viral DNA replication and this is homologous to the Rep proteins of all geminiviruses. Geminivirus Rep has been shown to have DNA nicking-joining activity in vitro, origin-recognition ability and ATPase activity.

However, RepA protein is unique to the WDV geminivirus subgroup and has been WO 98/56811 PCT/EP98/03662 implicated in modulation of Rep activity, binding to plant retinoblastoma (Rb) protein 46) and stimulation of virion-sense gene expression. In addition, we have recently shown that in WDV, the Rb-binding protein (RepA) and the initiator protein (Rep) seem to play coordinate roles during viral DNA replication.

Geminivirus DNA replication occurs in the nucleus of the infected cells and, due to the lack of replicative enzymes encoded by the viral genome, it requires S-phase functions. Consistent with this is the accumulation of replicative intermediates in Sphase nuclei Geminiviruses normally infect non-proliferating cells but, interestingly, they induce the appearance of cellular proteins typical of S-phase, such as proliferating cell nuclear antigen (PCNA) (29) which is otherwise undetectable in nonproliferating cells. Subgroup I geminiviruses such as WDV encode proteins containing a LXCXE motif in the RepA protein, which mediates its ability to interact with Rb, involved in the mechanism by which geminiviruses impinge on the cell cycle activation circuit These observations served the basis to isolate a full-length cDNA encoding ZmRbl, a plant Rb protein, which could act in plant cells as a regulator of the Gl/S transit Consistent with this function, overexpression of plant Rb (as well as human Rb) in cultured plant cells significantly inhibits WDV DNA replication (45, 46).

Therefore, it seems that at least one of the mechanisms used by geminiviruses to favour DNA replication is the triggering of an S-phase in the infected cell by sequestering Rb and, consequently, by interfering with its negative cell growth activity.

Regulation of cell cycle, growth and differentiation in plants is the result of a complex interplay of regulators whose activity is the response to a wide variety of signals such as hormones, nutrient availability or environmental conditions (20, 39).

For example, a rapid increase in the levels of D-type cyclin mRNAs occurs in response to sucrose or cytokinin treatment (41) while those of the cyclin-dependent kinase (cdc2) mRNAs depends on the presence of auxin. The molecular nature of other plant cell cycle regulators as well as their function in connection to cell growth and differentiation remains largely unknown. Therefore, it is important to identify the cellular factors involved in these control pathways to elucidate the molecular mechanisms governing the response of plant cells to growth signals.

Due to the absolute requirement for cellular factors to complete geminivirus replication, the present inventors postulated that geminiviruses might modulate cell 3 physiology by mechanisms other that the interference with the Rb pathway and that such effect might be the consequence of the targeting of, so far, unknown cellular factors by the geminivirus proteins. They have used an experimental strategy to identify proteins that interact functionally with RepA, the Rb-binding protein of WDV, and now have provided several cDNA clones encoding previously unidentified proteins and determined their function.

Based on amino acid sequence analysis, these proteins have been determined'to share a common N-terminal domain, required for interaction with the viral RepA protein, while their C-terminal domains are unique to each of them.

They may represent members, likely with transcriptional regulatory activity, of a much larger family of proteins related to regulators of hormone and nutrient response, meristem development and plant senescence.

Thus in a first aspect of the present invention there is provided a method of controlling plant cell cycle by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA characterised in that the protein or peptide comprises an amino acid sequence of homology of at least 70% to that of SEQ ID No. 6 or SEQ ID No. 8 and the method comprises incorporating a nucleic acid into the plant cell which encodes for the protein or peptide, is antisense to nucleic acid (a) 20 encoding the protein or peptide or downregulates expression of native nucleic acid encoding the protein or peptide by gene silencing coexpression. Such control, inter alia, allows control of plant cell growth and/or replication, plant virus growth within cells, plant cell differentiation, development and/or scenescence. It will be understood that such proteins and peptides are other than Rb (Retinoblastoma) proteins, being particularly those described herein below with regard to the sequence listing and their functional variants.

Increasing or decreasing the levels of GRAB proteins peptides may be achieved by overproducing or underproducing the protein or peptide in a plant cell, that is, as compared to the normal level of production of the protein or peptide in the cell. Decrease of native GRAB binding activity may be achieved

,P

e.g. by application of a GRAB protein or peptide binding agent, e.g. such as WDV RepA or a functional part of variant thereof.

Particularly the GRAB proteins or peptides for use in this method are those comprising an amino acid sequence SEQ ID No. 2 or 4 as shown herein or a functional variant thereof that is capable of binding Geminivirus RepA. Preferred proteins or peptides have amino acid sequence homology of at least 70% with that of SEQ ID NO. 2 or 4, more preferably at least 90% and most preferably at least 95%. Particularly the ee e e* e *ego ooo *o *eoe WO 98/56811 PCT/EP98/03662 GRAB proteins are those in which the first 200 N-terminal amino acids are capable of binding to viral RepA protein; more preferably the first 170 N-terminal. amino acids are so capable and most preferably the first 150 amino acids.

These methods may comprise the direct application of such GRAB proteins or peptides to plant cells or whole plants, but more conveniently will comprise use of the corresponding GRAB protein or peptide encoding or antisense nucleotides, ie.nucleic acids placed within the cells, particularly by use of recombinant nucleic acid, eg.

recombinant DNA comprising a GRAB protein or peptide encoding sequence, positioned in the cell behind a promotor capable of supporting GRAB protein or peptide expression or production of antisense RNA. GRAB protein encoding nucleic acids can be used to produce GRAB where required, eg. ectopically in a tissue where it is not normally expressed, eg. vegetative tissue or stem tissue such as xylem or phloem. An alternative strategy might comprise expressing a GRAB protein binding peptide, eg.

Geminivirus RepA, a functional variant thereof or a GRAB protein binding portion thereof, such as the C-terminal portion. Such a peptide would bind to native GRAB proteins and inhibit their activity. It will be realised that any expression of RepA, and particularly only a GRAB protein binding part thereof such as a RepA with a truncated N-terminal, in a transgenic plant other than that produce by a whole intact genimivirus would be novel. A RepA encoding cDNA in functional relationship with a promoter or other regulatory sequence in a DNA or RNA vector or DNA construct would be particularly useful for such purpose.

It will be realised that a most effective method of delivering proteins and peptides of the invention to plant cells is by expressing nucleic acid encoding them in situ. Such method is conventionally carried out by incorporating oligonucleotides or polynucleotides,having sequences encoding the peptide or protein, into the plant cell DNA. Such nucleotides can also be used to downregulate native GRAB expression by gene silencing coexpression or through antisense strategy. By use of mutagenesis techniques, eg. such as SDM, the nucleotides of the invention may be designed and produced to encode proteins and peptides which are functional variants or otherwise overactivated or inactivated, eg. with respect to binding, of the invention It will be realised by those skilled in the art that suitable promotors may be active continuously or may be inducible. It will be appreciated by those skilled in the art WO 98/56811 PCT/EP98/03662 that inducible promotors will have advantage in so far as they are capable of providing alteration of the aforesaid GRAB protein activity only when required, eg. when viral infection is threatened, or when the plant would otherwise be particularly vulnerable, or at a particular stage of cell development. Such promoters may for example be induced by environmental conditions such as stress inducing conditions, eg. reduced water availability caused by drought or freezing, or by complex entities such as plant hormones, eg. plant to plant signalling stress hormones, or by simpler entities such as particular cations or anions eg. metal cations. No particular limitation on the type of promoter to be used is envisoned.

Numerous specific examples of methods used to produce transgenic plants by the insertion of cDNA in conjunction with suitable regulatory sequences will be known to those skilled in the art. For example, plant transformation vectors have been described by Denecke et al (1992) EMBO J. 11, 2345-2355 and their further use to produce transgenic plants producing trehalose described in US Patent Application Serial No. 08/290,301. EP 0339009 BI and US 5250515 describe strategies for inserting heterologous genes into plants (see columns 8 to 26 of US 5250515). Electroporation of pollen to produce both transgenic monocotyledonous and dicotyledonous plants is described in US 5629183, US 7530485 and US 7350356. Further details may be found in reference works such as Recombinant Gene Expression Protocols. (1997) Edit Rocky S. Tuan. Humana Press. ISBN 0-89603-333-3, 0-89603-480-1. It will be realised that no particular limitation on the type of transgenic plant to be provided is envisaged, all classes of plant, monocot or dicot, may be produced in transgenic form incorporating the nucleic acid of the invention such that GRAB activity in the plant is altered, constituitively, ectopically or temporally.

A preferred embodiment of the first aspect of the invention provides a method of producing or inhibiting senescence in a plant cell comprising increasing or decreasing the levels or activity of a GRAB protein or peptide, particularly a GRAB protein of SEQ ID No 10 or a functional variant therof capable of inducing senescence in N.beniamiana plants, in a plant cell. Again such increase or decrease is most effectively achieved through incorporation of nucleic acid, in this case of SEQ ID No 9, or a functional variant thereof, or may be achieved by use of RepA encoding DNA WO 98/56811 PCT/EP98/03662 A second aspect of the present invention provides novel GRAB proteins or peptides per se and in enriched, isolated, cell free and/or recombinantly produced form.

Such proteins or peptides may be naturally occurring or may be conservatively substituted homologues thereof as referred to below. Preferred proteins and peptides have an N-terminal sequence having 90% or more homology to the N-terminal 200 (more preferably to the first 170 and most preferably the first 150) amino acids of GRAB I or GRAB2 described herein, more preferably 95% or more and most preferably 98% or more. Preferred peptides comprise the sequence of the first 150 to 200 amino acids of either of these sequences or conservatively substituted variants thereof.

Preferred peptides comprise such a sequence without the C-terminal sequence of SENU, NAM, ATAFI or ATAF 2 shown in Figure 4 attached hereto.

Particularly the GRAB proteins and peptides are those comprising an amino acid sequence SEQ ID No 3 or 4 as shown herein or a functional variant thereof that is capable of binding Geminivirus RepA and have amino acid sequence homology of at least 70% with that of SEQ ID No 3 or 4, more preferably at least 90% and most preferably at least 98%. More preferably they comprise SEQ ID No 6 or 8 or such homology limited functional variant thereof and most preferably SEQ ID No 10 or 12 or such homology limited functional variant thereof Where the protein or peptide comprises SEQ ID No 3 or 4 it is not of SENU, NAM, ATAFI or ATAF2.

Proteins or peptides may be derived from native protein or peptide encoding DNA that has been altered by mutagenic techniques eg. using chemical mutatgenesis or mutagenic PCR.

A third aspect of the present invention provides GRAB protein or peptide encoding and antisense nucleic acid per se and in enriched, isolated, cell free and/or recombinant form. Particularly provided is consense and antisense DNA in the form of individual oligonucleotides and polynucleotides, provided that said DNA does not encode the full amino acid sequence of SENU, NAM, ATAFI or ATAF2 as shown in Figure 4.

Specifically provided is nucleic acid, eg. in the form of a nucleotides, but preferably in the form of recombinant DNA or cRNA (mRNA), that codes for the expression of the GRAB protein having an N-terminal sequence with at least homology with the first 200 N-terminal amino acids ofGRABI or GRAB2 as described WO 98/56811 PCT/EP98/03662 herein ie. its first 200 codons having such homology. Preferably the homology is at least 75% and most preferably at least Preferred nucleic acid is DNA or RNA comprising of SEQ ID No 1, 2, 5, 7, 9 or 11 or a functional variant thereof having the homology limtations referred to above.

More preferred is DNA of SEQ ID No 9 or I 1 or a functional variant thereof With respect to the present specification and claims, the following technical terms are used in accordance with the definitions below unless otherwise specified.

A "functional variant" of a peptide, protein, nucleotide or polynucleotide is a peptide, protein, nucleotide or polynucleotide the amino acid or base sequence of which can be derived from the amino acid or base sequence of the original peptide, protein, nucleotide or polynucleotide by the substitution, deletion and/or addition of one or more amino acid residues or bases in a way that, in spite of the change in the amino acid or base sequence, the functional variant retains at least a part of at least one of the biological activities of the original peptide, protein, nucelotide or polynucleotide in that is detectable for a person skilled in the art. A functional variant is generally at least homologous the amino acid or base sequence of it is 50% identical), but advantageously at least 70% homologous and even more advantageously at least homologous to the native or synthetic sequence from which it can be derived. Any functional part of a protein or a variant thereof is also termed functional variant.

The term "overproducing" is used herein in the most general sense possible. A special type of molecule (usually a protein, polypeptide or oligopeptide or an RNA) is said to be "overproduced" in a cell if it is produced at a level significantly and detectably higher 20% higher) than natural level. Overproduction of a molecule in a cell can be achieved via both traditional mutation and selection techniques and genetic manipulation methods.

The term "ectopic expression" is used herein to designate a special realisation of overproduction in the sense that, for example, an ectopically expressed protein is produced at a spatial point of a plant where it is naturally not at all (or not detectably) expressed, that is, said protein or peptide is overproduced at said point.

The term 'underproducing' is intended to cover production of peptide, polypeptide, protein or mRNA at a level significantly lower than the natural level (eg.

or more lower), particularly to undetectable levels.

WO 98/56811 PCT/EP98/03662 The DNA or RNA of the invention may have a sequence containing degenerate substitutions in the nucleotides of the codons in the sequences encoding for GRAB proteins or peptides, eg. GRAB I or GRAB2 and in which the RNA U's replace the T's of DNA. Preferred per se DNAs or RNAs are capable of hybridising with the polynucleotides encoding for GRAB I or GRAB2 in conditions of low stringency, being preferably also capable of such hybridisation in conditions of high stringency.

The terms "conditions of low stringency" and "conditions of high stringency" are of course understood fully by those skilled in the art, but are conveniently exemplified in US 5202257, columns 9 and 10. Where modifications are made they should lead to the expression of a protein with different amino acids in the same class as the corresponding amino acids to these GRAB protein sequences, that is to say, they are conservative substitutions. Such substitutions are known to those skilled in the art (see, for example, US 5380712), and are considered only when the protein is active as a GRAB protein.

In a fourth aspect of the present invention there is provided a protein or peptide expressed by the recombinant DNA or RNA referred to in the second aspect above, new proteins or peptides derived from that DNA or RNA and protein or peptide that is produced from native DNA or RNA that has been altered by mutagenic means such as the use of mutagenic polymerase chain reaction primers. Methods of producing the proteins or peptides of the invention characterised in that they comprise use of the DNA or RNA of the invention to express them from cells are also provided in this aspect.

A fifth aspect of the present invention provides nucleic acid probes and primers complementary to any 15 or more contiguous bases of the DNA sequences identified herein below as SEQ ID No 5, 7, 9 or 11 or complemetary sequences or RNA sequences corresponding thereto; particularly of the first 150 N-terminal coding DNA bases of such sequences. These probes and primers in the form of oligonucleotides and polynucleotides may also be used to identify further naturally occuring or synthetically produced GRAB peptides or proteins using eg. southern or northern blotting' Oligonucleotides for use as probes conveniently comprise at least 18 consecutive bases of the sequences SEQ ID No 5, 7, 9 or 11 herein, preferably being of to 100 bases long, but may be of any length up to the complete sequence or even longer. For use as PCR or LCR primers the oligonucleotide preferably is of 10 to WO 98/56811 PCT/EP98/03662 bases long but may be longer. Primers should be single stranded but probes may be double stranded ie. including complementary sequences.

A sixth aspect of the present invention provides vectors comprising DNA or RNA of the third aspect of the invention.

A seventh aspect of the present invention provides a method for producing transformed cells comprising nucleic acid of the invention comprising introducing said nucleic acid into the cell in vector form.

A eighth aspect of the present invention provides a method for producing transformed cells comprising nucleic acid of the invention comprising introducing said nucleic acid into the cell directly, eg. by electroporation.or particle bombardment.

Particularly provided is the electroporation of pollen cells.

An ninth aspect of the present invention provides cells, particularly plant cells, eg. including pollen and seed cells, comprising the recombinant nucleic acid of the invention, particularly the DNA or RNA of the invention, and plants comprising such cells.

Plasmids containing a DNA coding for expression of the GRAB proteins GRAB 1 and GRAB 2 described herein have been deposited under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms of 1977; these being deposited on 11 June 1997 at the Coleccion Espanola de Cultivos Tipo, with the accession numbers CECT 4889 (this containing GRAB 1 sequence) and CECT 4890 (this containing GRAB 2 sequence).

SEQUENCE LISTING SEQ ID No 1 and 2 show the nucleotide sequences of GRAB1 and GRAB 2 respectively which encode for conserved domains NI to N5 with intervening bases marked as N.

SEQ ID No 3 and 4 show the respective amino acid sequences corresponding to SEQ ID No I and 2.

SEQ ID No 5 and 7 show the full nucleotide sequences spanning NI to N5 of GRAB I and GRAB2 respectively.

SEQ ID No 6 and 8 show the corresponding amino acid sequences to SEQ ID No 5 and 7.

WO 98/56811 PCT/EP98/03662 SEQ ID No 9 and I I show the full length sequences of isolated cDNA including coding regions for GRAB I and GRAB2 respectively.

SEQ ID No 10 and 12 show the corresponding amino acid sequences of proteins GRAB1 and GRAB2.

BRIEF DESCRIPTION OF THE FIGURES Figure I shows the results of northern analysis for transcripts of GRAB I and GRAB 2.

Figure 2 shows the results of studies carried out to to identify the region of GRAB I and GRAB 2 which are involved in the binding to WDV Rep A.

Figure 3 shows the results of studies carried out to identify the region of WDV Rep A involved in the binding with GRAB proteins.

Figure 5 shows the alignment of various protein sequences, previously known and unknown, having the GRAB protein domains N I to N5, for use in the method of the invention.

Figure 6 shows the charge distribution of these proteins.

The present invention will now be described further by way of illustration only by reference to the following non-limiting Examples. Further embodiments falling within the scope of the claims will occur to those skilled in the art in the light of these.

In the Examples below the following methods were used.

MATERIALS AND METHODS DNA manipulations Proteinase K, restriction endonucleases and other enzymes for DNA manipulations were from Merck, Boehringer Mannheim, New England Biolabs and Promega. Standard DNA manipulation techniques were applied as described in DNA sequencing was carried using an Applied Biosystem automatic sequencing device. Oligonucleotides were from Isogen Bioscience BV (Maarsen, The Netherlands).

DNA and RNA purification WO 98/56811 PCT/EP98/03662 Genomic DNA and total RNA were isolated from wheat leaves, roots and suspension cultured cells by grinding the material, previously frozen in liquid nitrogen, essentially as described The powder was mixed with extraction buffer (50 mM Tris-HCl, pH 6.0, 10 mM EDTA, 2% SDS, 100 mM LiCI), and after heating at with phenol 65 0 vortexed for 20 sec and centrifuged at 4 0 C for 15 min at 12000 rpm. The supernatant was extracted twice with the same volume of phenol:chloroform and precipitated with one volume of 4M LiCI. After centrifugation, the RNA pellet was resuspended in TE buffer and two volumes of ethanol were added to the liquid phase to precipitate genomic DNA. Purification of poly(A)+ mRNA was carried out as described [47].

Construction of the yeast two-hybrid cDNA library from wheat cultured cells Five micrograms of poly(A)+ mRNA isolated from wheat suspension cultured cells were used as a substrate for cDNA synthesis using a cDNA synthesis kit (Stratagene), according to the manufacturer's instructions. The resulting double-stranded DNA, containing EcoRl and Xhol ends, had an average size of 1.3 Kb. A sample (500 ng) of this cDNA was ligated to 750 ng of the EcoRI/Xhol-digested pGAD-GH vector (Clontech) for 48 hr at 8 0 C. Following ligation, the library was dialyzed against distilled water and electroporated into E. co/i DHIOB (Gibco). For convenience, the cDNA library was separated into five sub-libraries each containing -6x105 primary transformants. Total library DNA was obtained by plating primary transformants on fifty 150-mm LB plates plus ampicillin. Colonies were scrapped off into LB (+Amp) medium, and plasmid DNA was prepared as described [34].

Yeast two-hybrid screening The yeast strain HF7c (MA7a 'ura3-52 his.3-200 ade2-101 lys2-801 lrpl- 9 01 leu2- 3,112 gal/4-542 gal80-538 LYS2::GALI(AS-,ALI 7A TA-HIS3 URA3::GAL4 17meirv(x3)-('I,('lA7'A-LIacZ which contains the two reporter genes LacZ and -11- WO 98/56811 PCT/EP98/03662 HIS3, was used in the two-hybrid screening 16]. Yeasts were first transformed, as described with pBWRepA, a plasmid containing the entire WDV RepA open reading frame fused to the Gal4 DNA-binding domain RPI marker) in the pGBT8 vector Then, they were transformed with the pGAD-GH (AD; LE112 marker) wheat cDNA library. The transformation mixture was plated on yeast drop-out selection media lacking tryptophan, leucine and histidine and supplemented with 5 mM and mM 3-amino-1,2,4,triazole (3-AT; to reduce the appearance of false positive growing colonies. Transformants were routinely recovered during a 3 to 8 days period and were checked for growth in the presence of up to 20 mM 3-AT. To corroborate the interaction between the two fusion proteins, 13-galactosidase activity was assayed by a replica filter assay as described Plasmid DNA was recovered from positive colonies by transforming into E. coli MH4, since this strain is leuB-, and its defect can be complemented by the LEU2 gene present in the pGAD-GH plasmid. Deletions of GRAB] were constructed using the Apal (1-253), Sail (1-208), Sacl (1-52) and SacII (80-287) restriction sites and deletions of GRAB2 using the Xhol (1-149), Bglll (1-108), Sall (1-55) and Smal (66-351) restriction sites.

Production of GST-fusion proteins and in vitro binding experiments To produce the GST-GRAB fusion proteins, the oligonucleotide GRAB1-ATG (5'GGATCCATGGTGATGGCAGCGG) and T7 primer, and the oligonucleotides GRAB2-ATG (5'GGATCCATGGCGGACGTGACGGCGGTG) and T7 primer, were used to amplify the coding regions of GRAB I and GRAB2, respectively by PCR. The products were then cloned in frame into the pGEX-KG vector. The GST-RepA was produced by cloning the WDV RepA ORF in frame into the pGEX-KG vector. E. coli BL21(DE3) transformants were grown to an OD600 of 0.6 to 0.9 and then induced to express the fusion protein at 37 °C for 30 min by the addition of IPTG to 1 mM. GST fusion proteins were purified using glutathione-Sepharose beads (Pharmacia). Labeled -12- WO 98/56811 PCT/EP98/03662 RepA protein was obtained by in vitro transcription and translation (IVT) using wheat germ extract (Promega), in the presence of 3 5 S-methionine, according to the manufacturer's conditions. Labeled GRAB I and GRAB2 were produced by using TNT reticulocyte lysate (Promega) after cloning the same PCR products from GRAB1 and GRAB2 genes in plasmid pBluescriptKS and transcription using T7 RNA polymerase.

Plant cell culture The Triticum monococciml suspension culture was obtained from P. Mullineaux (John Innes Center, UK) and maintained as described [46].

Inoculation of N. benthamiana plants The PVX-derived pP2C2S vector [10] was used for transient expression of GRAB proteins in N. henthamiana plants. For GRABI constructions, a 1.1 Kb Smal-Xhol fragment containing the complete GRABI cDNA was cloned into Nrul/SalIl digested pP2C2S vector to produce plasmid pP2-GRABI. To construct a frame-shift GRABI mutant (GRABlFs), plasmid pP2-GRABI was partially digested with Sacll and, then, religated after treatment with T4 DNA polymerase. For GRAB2 constructions, a 1.35 Kb Smal-XhoI fragment containing the complete GRAB2 cDNA was cloned into Nrul/Sall digested pP2C2S vector to produce plasmid pP2-GRAB2. To construct the frame-shift mutation (GRAB2Fs), plasmid pP2-GRAB2 was digested with BstEIl and religated after treatment with Klenow. Infectious RNA was obtained by in vitro transcription of plasmid DNA digested with Spel, using the T7 Cap Scribe kit (Boeringher Mannheim). RNA transcripts were diluted in 5 mM Na3PO4 (pH 7.0) and used to inoculate 3-week-old N. benlhamiana plants (four in each case) using carborundum, as described [10, 17].

Transfection of wheat cultured cells by particle bombardment -13- WO 98/56811 PCT/EP98/03662 Cells were pelleted by centrifugation at 1000 rpm for 3 minutes and the supernatant was removed. Approximately 0.20-0.25 ml of packed cells were spread with a spatula onto a Whatman #1 filter paper, which was placed on CHS medium supplemented with 0.25 M mannitol [30] and solidified with 0.8% agar (bombardment medium). Conditions for DNA adsorption and particle bombardment were as described [43, 46]. Overexpression of GRAB proteins in wheat cultured cells was carried out by cloning the coding regions in a plasmid [47] under the control of the CaMV promoter. The 1. 1 Kb EcoRI-Xhol fragment of GRAB 1 and the 1.3 Kb EcoRI-Apall fragment of GRAB2 were cloned into EcoRl/Ndel digested plasmid p35S.ZmRbl [47] to produce p35S.GRABI and p35S.GRAB2. These plasmids contain the 3'-untranslated region of ZmRbl. Each experimental time point corresponds to a cell plate independently transfected. Experiments were repeated at least twice.

Analysis of WDV DNA replication WDV DNA replication was analyzed essentially as described [43, 46]. Cells were ground in liquid nitrogen and DNA was isolated essentially as described [41] (Soni et al., 1994). After electrophoresis in 0.7% agarose gels, DNA was transferred to nylon membranes (Biodyne A) and detected by hybridization to probes labeled with digoxigenin-11-dUTP according to the conditions recommended by the manufacturer (DIG DNA labeling and detection kit, Boehringer Mannheim).

EXAMPLE I Isolation of cDNAs encoding GRAB proteins Making use of the yeast two-hybrid approach (Fields and Song, 1989, Fields, 1993) a cDNA library was constructed from mRNA prepared from an actively growing wheat cell suspension culture. Screening was carried out using WDV RepA fused to the Gal4 DNA-binding domain. A significantly large number of cDNA clones allowed growth of co-tansformants in selective (-his, +3AT) medium. Among those appeared during the first 6 days after transformation, those co-transformants showing a stronger WO 98/56811 PCT/EP98/03662 interaction, based on their ability to grow in the presence of >20 mM 3AT, and to produce an intense 3-gal signal. Partial DNA sequence analysis revealed the existence of a group of 7 cDNA clones whose 5'-sequence was significantly related although they represented different clones as deduced by restriction analysis. Based on their ability to interact with WDV RepA, the proteins encoded by this group of cDNA clones were named GRAB proteins (Geminivirus RepA Binding). Two GRAB proteins, GRAB1 and GRAB2, are described herein.

Each cloned cDNA encoded protein which bound strongly to WDV RepA in yeasts .GRAB-i and GRAB-2 cDNA clones were -1.1 kbp long and each contained a single open reading frame, including a putative ATG translation initiation site. The complete cDNA sequence and deduced amino acid sequence for the two GRAB proteins are shown in the sequence listing as SEQ ID Nos 9 to 12. The isolated clones contain the full-length coding region with the sequence around the first putative methionine showing a good consensus translation initiation sequence.

Amino acid analysis of GRAB] and GRAB2 proteins revealed some striking features. First, the two proteins are totally unrelated in their C-terminal moieties although they appear to be highly related over a region spanning their -170 N-terminal residues, where a significant degree of homology can be detected. Interestingly, the distribution of charged residues is not random. The unique C-terminal domain of GRABI and GRAB2 contains 19% and 15%, respectively, of negatively charged residues E) while their related N-terminal domain, which contains a high proportion of charged. residues (30% and 33%, respectively), show a small bias in favour of positively charged amino acids K, H, 18% and 20%, respectively WO 98/56811 PCT/EP98/03662 In addition, northern analysis revealed the existence of mRNAs of the expected sizes each with the potential to encode GRAB I and GRAB2, respectively. Both mRNAs were present in small amounts in wheat cultured cells and were even less abundant in differentiated cell types, i. roots and leaves Example 2.

N-terminus of GRAB proteins mediates binding to WDV RepA To identify the region in the GRAB proteins involved in complex formation with WDV RepA, a series of deletions were constructed and analyzed for their ability to interact with the viral RepA protein in yeasts. Deletion of most (in GRAB1) or all (in GRAB2) the C-terminal domain did not reduce GRAB-RepA binding (Fig. Even a truncated GRAB2 protein containing only its N-terminal 149 residues still retained a significant RepA binding ability (Fig. On the contrary, a relatively small N-terminal deletion of GRAB i (80 amino acids) or of GRAB2 (66 amino acids) totally abolished interaction (Fig. Therefore, it is concluded that the N-terminal domain present in both proteins confers the capacity to form complexes with WDV RepA. Furthermore, the most N-terminal region of GRAB proteins appears to have the largest contribution to complex formation with WDV RepA.

Example 3.

C-terminal domain of WDV RepA mediates interaction with GRAB proteins A similar deletion study was carried out to identify the sequences in the WDV RebA protein responsible for binding to GRAB proteins. As shown in Fig. 3, deletion of most of the N-terminal half of RepA 150 residues) did not decrease its ability to -16- WO 98/56811 PCT/EP98/03662 interact with GRAB proteins. However, elimination of just the C-terminal 37 amino acid residues of RepA completely destroyed binding to both GRAB and GRAB2 (Fig.

indicating that this small domain of RepA contains residues critical for binding.

Interaction of GRAB with WDV Rep protein was also analysed, the other WDV early protein which is produced from the same mRNA encoding RepA but after a splicing event (Schalk et al., 1989). Thus, the 210 N-terminal residues of both RepA and Rep are identical, but the two viral proteins have distinct C-terminal domains. In agreement with the idea that the C-terminus of WDV RepA mediates binding to GRAB, WDV Rep was unable to form complexes with GRAB. These results together with data on the differential binding of WDV RepA and Rep to ZmRbl (Xie et al., 1997) strongly suggest that RepA is a unique WDV protein likely involved in interfering with cellular physiology to create a cellular environment favorable to viral replication.

To confirm and extend the yeast two-hybrid interaction results, pull-down experiments were carrried out to evaluate the interaction using purified proteins. After incubation of equal amounts of purified GST-RepA (0.2J.g) with in vitro translated (IVT) GST-GRAB I or GST-GRAB2, a fraction of the input 3 5 S-labeled GRAB proteins was recovered bound to gluthation-agarose beads (Fig. Similar results were obtained using GST-GRABI and GST-GRAB2 and IVT WDV RepA protein (Fig. 4).

Therefore, it was concluded that interaction between GRAB proteins and the geminiviral RepA can occur in the absence of other cellular proteins.

Example 4 Expression of GRAB mRNAs is restricted to a small number of cells in roots and embryos WO 98/56811 PCT/EP98/03662 To obtain some insight on the function that GRAB proteins may have in the cell, their expression pattern was analyzed by in situ hybridization. Northern analysis indicated that GRAB transcripts are not very abundant (see Fig. The occurrence of GRAB mRNAs in root meristems appears to be restricted to a small number of cells A similar patchy pattern was also observed of the histone H4 transcript, characteristic of S-phase cells. In particular, GRAB I expression was restricted to some cells within the central cylinder and was virtually absent from cortical or epidermal cells. GRABI mRNA was also detected in some root cap initial cells A comparable situation was found in developing embryos Altogether our analysis of the GRAB expression pattern under different growth conditions led us to conclude that both GRAB I and GRAB2 mRNA levels increased as a response to changes in growth signals of, perhaps, a subset of cells within the culture and that they are largely dependent on nutrient availability. Furthermore, they reinforce the idea that GRAB proteins may serve different roles as part of an immediate early response, which may be a part of the transduction pathway connecting external signals to the regulation of cellular growth and/or differentiation.

A group of plant proteins is thus identified on the basis of their ability to form complexes with the RepA, the Rb-binding protein of WDV, a member of the plant geminiviridae family. Based on a database searching, we conclude that both GRAB1 and GRAB2 are not homologs to any known protein and, therefore, the cDNAs isolated encode previously unidentified proteins. However, this study revealed that they are related, in terms of primary sequence, throughout their N-terminal region. Using the amino acid sequence of GRAB I or GRAB2. the output showed that these proteins possess a significant homology to several plant proteins of unknown function.

WO 98/56811 PCT/EP98/03662 Interestingly, the homology was also restricted to the N-terminal first 150-170 residues, as initially observed for the group of GRAB proteins itself (Fig. 10A). Those shown in Fig. 10A correspond to otherwise apparently unrelated proteins. First, two Arabidopsis cDNA clones, ATAFI and ATAF2, isolated by their ability to activate the cauliflower mosaic virus (CAMV) promoter in yeasts Hirt, personal communication). Second, the SENU5 CDNA, isolated in studies of leaf senescence in tomato (Genbank Acc. No. Third, the NAM protein, the product of the Petunia No Apical MAeristem (nam) gene, required for proper development of shoot apical meristems, which has been proposed to determine meristem location (Souer et al., 1996).

Example Expression of GRAB I induces a necrotic phenotype As a first step towards getting insight into the cellular roles of GRAB proteins we determined the effect of expressing either GRAB1 or GRAB2 in N. benthamiana plants.

For this purpose, we made use of a potato virus X (PVX)-based expression vector, which ensures high levels of systemic expression at a given time and in the absence of chromosomal effects This system has been successfully used to analyze the effects of transiently expressed foreign proteins [18, 31, 32].

When N. benlhamiana plants were inoculated with in vitro transcribed PVX RNA, the appearance of typical symptoms, clearly apparent at 10 days post inoculation (dpi), was indicative of efficient amplification of the PVX expression vector as compared with the mock-inoculated plants Plants inoculated with the PVX-GRABI construct were already systemically infected by 12 dpi due to high level amplification of the GRAB1expressing vector. This is confirmed by the level of PVX-GRABI RNA in the leaves, comparable to that of the wild type PVX-infected plants Interestingly, all plants WO 98/56811 PCT/EP98/03662 expressing high levels of GRAB 1 showed a tendency to develop, already at 12 dpi, a degenerative process, as revealed by the morphology of their older leaves. Furthermore, a prominent necrotic area appeared near the base of the aerial parts of the plant, especially at 28 dpi At this stage, a significant reduction in the development of leaves and roots was also apparent. To determine whether the effects observed in whole plants were dependent on the expression of a full-length GRAB I protein, we inoculated plants with a PVX construct that expressed GRAB I mRNA carrying a frame-shift mutation close to the N-terminus. Thus, PVX-GRABI Fs bears a cDNA insert with a frame-shift mutation at amino acid position 78, which maintains the two most N-terminal conserved blocks (N 1 and N2), and can produce a truncated protein of 159 residues. Expression of GRABI Fs did not produce any of the effects observed in plants expressing the fulllength GRAB I protein.

A similar study was carried out with the GRAB2 constructs. Plants infected with the PVX-GRAB2 construct showed delayed kinetics in the PVX vector amplification.

This precluded high levels of GRAB2 expression at 12 dpi and plants had a morphology similar to that mock-inoculated plants. However, later after inoculation, the PVX vector accumulated at high levels. Interestingly, these GRAB2-expressing plants showed milder symptoms than plants infected with wild type PVX. None of them developed the degenerative process observed in GRAB -expressing plants. We also tested the effect of expressing a truncated form of GRAB2. In this case, PVX-GRAB2 F s produces a GRAB2 cDNA carrying a frame-shift mutation at amino acid position 33, thus producing a 50 amino acid-long truncated GRAB2 protein which conserved only the most Nterminal (N1) homology block. Plants inoculated with the PVX-GRAB2Fs construct contain high levels of PVX and of GRAB F s RNAs. Taken together, the results of expressing the truncated forms of GRAB proteins, indicate that the induction of necrotic areas by GRAB I and the delay in symptom appearance by GRAB2 are dependent upon WO 98/56811 PCT/EP98/03662 the expression of full-length proteins and strongly suggest that these specific effects may be mediated by the unique C-terminal domains of each GRAB and GRAB2 proteins.

The alignment shown in Fig. 4 revealed the existence of several amino acid motifs highly conserved among these related proteins. Thus, we noted the occurrence of five motifs in the N-terminal domain (NI to N5) which could correspond to blocks critical for their activity. Among them, the two most N-terminal motifs (NI and N2) exhibit a net negative charge while the rest are positively charged. Based on our deletion analysis, all these motifs are required for efficient interaction with WDV RepA although N5 is not absolutely required and NI seems to have a strong contribution (Fig.

The C-terminal domain, although unique in primary sequence to each protein in the family, shares the property of having a high net negative charge (15-20% of the residues are either D or This is particularly evident in both the GRAB proteins and the two ATAF members. The two GRAB proteins reported here, but in particular GRAB2, have a Q-rich domain in their C-terminal domains which could be involved in transcriptional regulation as has been shown to be the case for other examples. In addition, a number of partial cDNA sequences derived from randomly sequenced EST from Arabidopsis and rice were also retrieved using the N-terminus of GRAB proteins as a query (not shown). Surprisingly, protein sequences from yeast or animal origins were not retrieved in this search.

One striking feature of this group of proteins is the large number of members with a related N-terminal domain that appears to be present in each species. For example, at least 5 members related to NAM (Souer et al., 1996) and 7 members related to GRAB (this work). Such an abundance poses the question of whether they actually have different functions. One possibility, already proposed for some NAM-related proteins is WO 98/56811 PCT/EP98/03662 that thay have redundant functions in different locations of the plant during postembryonic development (Souer et al., 1996).

Regarding the consequences of GRAB overexpression on symptom appearance in PVX-infected plants, it is possible that both WDV and PVX share a, so far, unknown pathway affected by GRAB, although very different replication strategies are employed by these virus families. An alternative possibility is that GRAB overexpression may directly or indirectly trigger a general defense pathway or, simply, lead to a cellular environment which protect cells against different types of infection.

Example 6.

Overexpression of GRAB proteins in wheat cultured cells inhibits WDV DNA replication To further investigate the possible function of the GRAB proteins isolated on the basis of their interaction with WDV RepA protein, we determined the effect of expressing GRAB proteins on geminiviral DNA replication. This assay has proven to be useful to evaluate the effect of plant Rb (ZmRbl) in viral DNA replication Thus, using a similar strategy, we co-transfected wheat cultured cells with combinations of the following plasmids: one plasmid expressing either GRAB 1 or GRAB2 under the control of the 35S CaMV promoter, which is active in the wheat cells used (ii) a second plasmid expressing the WDV proteins required for efficient viral DNA replication (RepA and Rep) also under the control of the 35S CaMV promoter, and (iii) a third plasmid (pWoriAA), a derivative of pWori [43, 46], used to monitor WDV DNA replication, which can replicate efficiently when the viral proteins are provided in trans 47]. Expression of either GRABi or GRAB2 severely inhibited WDV DNA replication in cultured wheat cells, with GRAB2 exhibiting a stronger effect. These results indicate that WDV DNA replication is affected by GRAB proteins under cell culture conditions.

WO 98/56811 PCT/EP98/03662

REFERENCES

1. Accotto, G-P, Mullineaux, PM, Brown, SC, Marie, D: Digitaria streak geminivirus replicative forms are abundant in S-phase nuclei of infected cells. Virology 195: 257-259 (1993).

2. Aida, M, Ishida, T, Fukaki, H, Fujisawa, H, Tasaka, Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9: 841-857 (1997).

3. Angell, SM, Baulcombe, DC: Consistent gene silencing in transgenic plants expressing a replicating potato virus X RNA. EMBO J. 16: 3675-3684 (1997).

4. Bartel, PL, Chien, C-T, Sternglanz, R, Fields, S Using the two-hybrid system to detect protein-protein interactions. In Hartley, D. A. Cellular Interactions in Development: a practical approach. Oxford University Press, Oxford, UK, pp. 153- 179 (1993a).

Bartel, PL, Chien, C-T, Sternglanz, R, Fields, S: Elimination of false positives that arise in using the two-hybrid system. BioTechniques 14: 920-924 (1993b).

6. Baulcombe, DC., Chapman, S, Santa Cruz, S: Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 7: 1045-1053 (1995).

7. Breeden, L, Nasmyth, K: Regulation of the yeast HO gene. Cold Spring Harbor Symp. Quant. Biol. 50: 643-650 (1985).

8. Coen, ES., Meyerowitz, EM: The war of whorls: genetic interactions controlling flower developmen. Nature 353: 31-37 (1991).

9. Courey, AJ, Tjian, R: Analysis of Spl in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif Cell 55: 887-898 (1988).

Chapman, S, Kavanagh, TA, Baulcombe, DC: Potato virus X as a vector for gene expression in plants. Plant J. 2: 549-557 (1992).

11. Davies, JW, Stanley, J: Geminivirus genes and vectors. Trends Genet. 5: 77-81 (1989).

WO 98/56811 PCT/EP98/03662 12. Doerner, P, Jorgensen, J, You, R, Steppuhn, J, Lamb, C: Control of root growth and development by cyclin expression. Nature 380: 520-523 (1996).

13. Eagle, PA, Orozco, BM, Hanley-Bowdoin, L: A DNA sequence required for geminivirus replication also mediates transcriptional regulation. Plant Cell 6: 1157- 1170 (1994).

14. Fanning, E, and Knippers, R: Structure and function of simian virus 40 large tumor antigen. Annu. Rev. Biochem. 61: 55-85 (1992).

Feilotter, HE, Hannon, GJ, Ruddell, CJ, Beach, D: Construction of an improved host strain for two-hybrid screening. Nucleic Acids Res. 22: 1502-1503 (1994).

16. Fields, S, Song, O: A novel genetic system to detect protein-protein interactions.

Nature 340: 245-246 (1989).

17. Guo, HS, Garcia, JA: Delayed resistance to plum pox potyvirus mediated by a mutated RNA replicase gene: involvement of a gene-silencing mechanism. Mol.

Plant-Microbe Inter. 10: 160-170 (1997).

18. Hammond-Kosack, KE, Staskawicz, BJ, Jones, JDG, Baulcombe, DC: Functional expression of a fungal avirulence gene from a modified potato virus X genome. Mol.

Plant-Microbe Interact. 8: 181-185 (1995).

19. Hassel, JA, Brinton, BT: SV40 and polyomavirus DNA replication. In DePamphilis, M. L. DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press, New York, pp. 639-677 (1996).

Jacobs, T: Control of the cell cycle. Dev. Biol. 153: 1-15 (1992).

21. Jansen-Durr, P: How viral oncogenes make the cell cycle. Trends Genet. 12: 270- 275 (1996).

22. John, 1, Hackett, R, Cooper, W, Drake, R, Farrell, A, Grierson, Cloning and characterization of tomato leaf senescence-related cDNAs. Plant Mol. Biol. 33: 641- 651 (1997).

WO 98/56811 PCT/EP98/03662 23. Kozak, M: At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196: 947-950 (1987).

24. Lazarowitz, S: Geminiviruses: genome structure and gene function. Crit. Rev. Plant Sci. 11: 327-349 (1992).

25. Long, JA, Moan, El, Medford, JI, Barton, MK: A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379: 66-69 (1996).

26. Ludlow, JW: Interactions between SV40 large-tumor antigen and the growth suppressor proteins pRB and p53. FASEB J. 7: 866-871 (1993).

27. Martin, C, Paz-Ares, J: MYB transcription factors in plants. Trends Genet. 13: 67- 73(1997).

28. Moran, E: Interaction of adenoviral proteins with pRB and p53. FASEB J. 7: 880- 885 (1993).

29. Nagar, S, Pedersen, TJ, Carrick, KM, Hanley-Bowdoin, L, Robertson, D: A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells. Plant Cell 7: 705-719 (1995).

Perl, A, Kless, H, Blumenthal, A, Galili, G, Galun, E: Improvement of plant regeneration and GUS expression in scutellar wheat calli by optimization of culture conditions and DNA-microprojectile delivery procedures. Mol. Gen. Genet. 235: 279-284 (1992).

31. Ratcliff, F, Harrison, BD, Baulcombe, DC: A similarity between viral defense and gene silencing in plants. Science 276: 1558-1560 (1997).

32. Rommens, CMT, Salmeron, JM, Baulcombe, DC, Staskawicz, BJ: Use of a gene expression system based on potato virus X to rapidly identify and characterize a tomato pto homolog that controls fenthion sensitivity. Plant Cell 7: 249-257 (1995).

WO 98/56811 PCT/EP98/03662 33. Sablowski, RWM, Meyerowitz, EM: A homolog of NO APICAL MA41IISTI-AM is an immediate target of the floral homeotic genes APETALA 3/PIISTILLA 7A. Cell 92: 93- 103 (1998).

34. Sambrook, J, Fritsch, EF, Maniatis, T: Molecular cloning: A laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, (1989).

Sanz-Burgos, AP, Gutierrez, C: Organization of the cis-acting element required for wheat dwarf geminivirus DNA replication and visualization of a Rep protein-DNA complex. Virology (1998, in press).

36. Saraste, M, Sibbald, PR, Wittinghofer, A: The P-loop a common motif in ATPand GTP-binding proteins. Trends Biochem. Sci. 15: 430-434 (1990).

37. Schalk, H-J, Matzeit, V, Schiller, B, Schell., J, Gronenborn, B: Wheat dwarf virus, a geminivirus of graminaceous plants needs splicing for replication. EMBO J. 8: 359- 364 (1989).

38. Schiestl, RH, Gietz, D: High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16: 339-346 (1989).

39. Shaul, 0, van Montagu, M, Inze, D: Regulation of cell division in Arabidopsis. Crit.

Rev. Plant. Sci. 15: 97-112 (1996).

Shore, P, Sharrocks, AD: The MADS-box family of transcription factors. Eur. J.

Biochem. 229: 1-13 (1995).

41. Soni, R, Murray, JAH: Isolation of intact DNA and RNA from plant tissues. Anal.

Biochem. 218: 474-476 (1994).

42. Souer, E, van Houwelingen, A, Kloos, D, Mol, J, Koes, R: The No Apical Meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell 85: 159-170 (1996).

43. Suarez-Lo6pez, P, Gutierrez, C: DNA replication of wheat dwarf geminivirus vectors: effects of origin structure and size. Virology 227: 389-399 (1997).

WO 98/56811 PCT/EP98/03662 44. Van der Krol, AR, Chua, N-H: Flower development in petunia. Plant Cell 5: 1195- 1203 (1993).

Vousden, K: Interactions of human papillomavirus transforming proteins with the products of tumor suppressor genes. FASEB J. 7: 872-879 (1993).

46. Xie, Q, Suarez-Lopez, P, Gutierrez, C: Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus: requirement for efficient viral DNA replication. EMBO J. 14: 4073-4082 (1995).

47. Xie, Q. Sanz-Burgos, AP, Hannon, GJ, Gutierrez, C: Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins. EMBO J. 4900-4908 (1996).

EDITORIAL NOTE NO.82160/98 This specification contains a sequence listing following the description and is numbered as follows: Sequence listing pages 28 to 43 Claim pages 44 to 51 Page 43a is also the part of description WO 98/56811 PCT/EP98/03662 SEQUENCE LISTING GENERAL INFORMATION:

APPLICANT:

NAME: CONSEJO SUPERIOR DE INVESTIGACIONES

CIENTIFICAS

STREET: SERRANO,113 CITY: MADRID COUNTRY: SPAIN POSTAL CODE (ZIP): 28006 NAME: CRISANTO GUTIERREZ-ARMENTA STREET: CENTRO DE BIOLOGIA MOLECULAR, CSIC-UAM CITY: MADRID COUNTRY: SPAIN POSTAL CODE (ZIP): 28049 NAME: QI XIE STREET: CENTRO DE BIOLOGIA MOLECULAR, CSIC-UAM CITY: MADRID COUNTRY: SPAIN POSTAL CODE (ZIP): 28049 NAME: ANDRES SANZ-BURGOS STREET: CENTRO DE BIOLOGIA MOLECULAR, CSIC-UAM CITY: MADRID COUNTRY: SPAIN POSTAL CODE (ZIP): 28049 (ii) TITLE OF INVENTION: PLANT GRAB PROTEINS (iii) NUMBER OF SEQUENCES: 12 (iv) COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.30 (EPO) (vi) PRIOR APPLICATION DATA: APPLICATION NUMBER: ES 9701292 FILING DATE: 12-JUN-1997 INFORMATION FOR SEQ ID NO: 1: SEQUENCE CHARACTERISTICS: LENGTH: 459 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO WO 98/56811 (iv) ANTI-SENSE: No (vi) ORIGINAL SOURCE: ORGANISM: Triticum monococcum (ix) FEATURE: NAME/KEY: CDS LOCATION:1. .459 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: CTGCCGNNNG GGTTCCGGTT CCACCCGACG GACGAGGAGN NNmrNN'iri N~JNr4IN4INN NNNNNNNN NNNNNNNN NNNNNNATCN NNNNNNNNN 120 NNNNNNCCGT GGNNNCTCCC GNNNNN NNNNNNNN NNNNNGAGTG 180 NNNNNNNNNN NNNNNAAGTA CCCCNNNGGC NNNCGCNNNA ACCGGNNNNN 240 TACTGGAAGG CCACCGGCNN NGACNNNNqNN NNNNNNNN INNNNNNNNN 300 AAGAAGNNNC TCGTCTTCTA CNNNGGCNNN NNNNNNNNNG GGNNNNNNNN 360 ATGCACGAGT ACCGCCTCWNNNNNN NNNNNN NNNNNNNNNNwu' 420 NNNNNN NNTGGNNNNN NNNNCGCNNN NNNNNNAAG 459 INFORMATION FOR SEQ ID NO: 2: SEQUENCE CHARACTERISTICS: LENGTH: 462 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICA.L: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Triticum monococcun (ix) FEATURE: NAME/KEY: CDS LOCATION:1. .462 PCT/EP98/03662

NTACCTCNNN

NLNNNNNN

GTACTTCTTC

NNNNNNNGGC

NNNNGGGNNN

NNNNTGGNNN

NNNNNNN

WO 98/568 11 PCT/EP98/03662 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: CTTCCANNNG GGTTCCGGTT CCACCCCACC GACGAGGAGN NNN4NLNWINL1 NTACCTCNNN NNNNNNNN NNNNNNN NNNNNNNNN NNNNNNATCN NNNNNNN NNNNNNNNN 120 NNNNNNCCGT GGNNNCTCCC L7NNNNNNNDNN NWNNI'4N NNNNNGAGTG GTTCTTCTTC 180 NNNNNN NNqNNNAAGTA CCCGNNNGGG NNNCGCNNNA ACCGGNNNNN NNNNNNNGGG 240 TACTGGAAGG CGACGGGGNN NGACNNNNNN NNNNNNNNN NNNNNNNNNNN 300 NNNNNNGGCN NNAAGAAGNN NCTCGTCTTT TACNNNGGCN Nm urNirNwN NGGCNNNNNN 360 NNNNqNNTGGN NNATGCACGA GTACCGCCTC NNNNNN NNNNNNNNNNN 420 NNNNNNNN NNNNNTGGNN NNNNNN1NCGG NNNNNNNNNA AA 462 INFOR~MATION FOR SEQ ID NO: 3: SEQUENCE CHARACTERISTICS: LENGTH: 153 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: ORGANISM: Triticjm monococcum (ix) FEATURE: NAME/KEY: CDS LOCATION:1. .459 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: Leu Pro Xaa Gly Phe Axg Phe His Pro Thr Asp Glu Glu Xaa Xaa Xaa 1 5 10 Xaa Tyr Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 25 WO 98/56811 Ile Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 40 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Glu Trp Tyr 50 55 Xaa Lys Tyr Pro Xaa Gly Xaa Arg Xaa Asn 70 Tyr Trp Lys Ala Thr Gly Xaa Asp Xaa Xaa 90 Xaa Xaa Gly Xaa Lys Lys Xaa Leu. Val Phe 100 105 Xaa Gly Xaa Xaa Xaa Xaa Trp Xaa Met His 115 120 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 Trp Xaa Xaa Xaa Arg Xaa Xaa Xaa Lys 145 150 INFORMATION FOR SEQ ID NO: 4: SEQUENCE CHARACTERISTICS: LENGTH: 154 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: peptide, (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: ORGANISM: Triticum monococcum Pro Trp Phe Phe Arg Xaa 75 Xaa Xaa Tyr Xaa Glu Tyr Xaa Xaa 140 Xaa Xaa Xaa Xaa Gly Arg 125 Xaa PCT/EP98/03662 Leu Pro Xaa Xaa Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa 110 Leu Xaa Xaa Xaa Xaa Xaa (xi) Leu 1 Xaa Ile Xaa SEQUENCE DESCRIPTION: SEQ ID NO: 4: Pro Xaa Gly Phe Arg Phe His Pro Thr Asp Glu Glu Xaa Xaa Xaa 5 10 Tyr Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 25 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Pro Trp Xaa Leu Pro Xaa 40 Xaa Xaa Xaa Xaa Xaa Xaa Glu Trp Phe Phe Phe Xaa Xaa Xaa Xaa 55 WO 98/56811 PTE9/36 PCT/EP98/03662 Xaa Lys Tyr Pro Xaa Gly Xaa Arg Xaa As: 70 Tyr Trp Lys Ala Thr Gly Xaa Asp Xaa Xa, 90 Xaa Xaa Xaa Xaa Xaa Xaa Gly Xaa Lys Ly: 100 105 Gly Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Xa~ 115 120 Arg Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaz 130 135 Xaa Trp Xaa Xaa Xaa Arg Xaa Xaa Xaa Lys 145 150 INFORMATION FOR SEQ ID NO: SEQUENCE CHARACTERISTICS: LENGTH: 459 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ARTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Triticun monococcun (ix) FEATURE: NAME/KEY: CDS LOCATION:1. .459 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: CTG CCG CCG GGG TTC CGG TTC CAC CCG ACG GAC 48 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp 1 5 10 GAC TAC CTC TGC GCG CGC GCG GCC GGC CGC GCG 96 Asp Tyr Leu Cys Ala Arg Ala Ala Gly Arg Ala 25 ATC GCC GAG CTC GAC CTC TAC CGG TTC GAC CCG 144 Ile Ala Glu Leu Asp Leu Tyr Arg Phe Asp Pro 40 nl Arg 75 a Xaa s Xaa i Trp Xaa Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Xaa Xaa Leu Val Phe Tyr Xaa 110 Xaa Met His Glu Tyr 125 Xaa Xaa Xaa Xaa Xaa 140 GAG GAG CTG GTG GCG Glu Glu Leu Val Ala CCG CCG GTG CCC ATC Pro .Pro Val Pro Ile TGG GAG CTC CCG GAG Trp Glu Leu Pro Glu WO 98/56811 PCT/EP98/03662 CGG GCG CTC TTC GGG GCG CGG GAG TGG TAC TTC TTC ACG CCG CGG GAC 192 Arg

CGC

240 Arg l0

TAC

288 Tyr Al a

AAG

Lys

TGG

Trp Leu Phe Gly Ala TAC CCC AAC GGC TCC Tyr Pro Asn Gly Ser 70 AAG GCC ACC GGC GCC Lys Ala Thr Gly Ala Glu Trp Tyr CGC CCC AAC Arg Pro Asn GAC AGG CCC Asp Arg Pro 90 CTC GTC TTC Leu Val Phe Phe Thr Pro Arg Asp CGG GCC GCC GGG GGC GGC Arg Ala Ala Gly Gly Gly 75 GTG GCG CGC GCG GGC AGG Val Ala Arg Ala Gly Arg TAC CAC GGC AGG CCG TCG Tyr His Gly Arg Pro Ser ACC GTC GGG ATC 336 Thr Val Gly AAG AAG GCG Lys Lys Ala Ile 100 105 110

GCG

384 Ala GGG GTC Gly Val 115 GCC GAC 432 Ala Asp 130 TGG GTG 459 Trp Val 145

GGA

Gly

CTC

Leu AAG ACG GAC TGG ATC ATG Lys Thr Asp Trp Ile Met 120 CGC GCC GCC AAG AAC GGC Arg Ala Ala Lys Asn Gly 135 TGC CGC CTA TAC AAC AAG Cys Arg Leu Tyr Asri Lys 150 CAC GAG TAC CGC CTC GCC GGC His Glu Tyr Arg Leu Ala Gly 125 GGC ACG CTC AGG CTT GAC GAA Gly Thr Leu Arg Leu Asp Glu 140 INFORMATION FOR SEQ ID NO: 6: SEQUENCE CHARACTERISTICS: LENGTH: 153 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: Leu Pro Pro Gly Phe Axg Phe His Pro Thr Asp Glu 1 5 10 Asp Tyr Leu Cys Ala Arg Ala Ala Gly Arg Ala Pro 25 Ile Ala Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp 40 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe 55 Glu Leu Val Ala Pro Val Pro Ile Glu Leu Pro Glu Thr Pro Arg Asp -33- WO 98/56811 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg 70 75 Tyr Trp Lys Ala Thr Gly Ala Asp Arg Pro Val 85 90 Thr Val Gly Ile Lys Lys Ala Leu Val Phe Tyr 100 105 Ala Gly Val Lys Thr Asp Trp Ile Met His Glu 115 120 Ala Asp Gly Arg Ala Ala Lys Asn Gly Gly Thr 130 135 Trp Val Leu Cys Arg Leu Tyr Asn Lys 145 150 INFORMATION FOR SEQ ID NO: 7: SEQUENCE CHARACTERISTICS: LENGTH: 462 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Triticum monococcum (ix) FEATURE: NAME/KEY: CDS LOCATION:1..462 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: CTT CCA CCG GGG TTC CGG TTC CAC CCC ACC GAC 48 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp 155 160 CAC TAC CTC ACC CGC AAG GTC CTC CGC GAA TCC 96 His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser 170 175 180 ATC ACC GAC GTC GAC CTC AAC AAG AAC GAG CCG 144 Ile Thr Asp Val Asp Leu Asn Lys Asn Glu Pro 190 195 PCT/EP98/03662 Ala Ala Gly Gly Gly Ala Arg Ala Gly Arg His Gly Arg Pro Ser 110 Tyr Arg Leu Ala Gly 125 Ieu Arg Leu Asp Glu 140 GAG GAG GTG Glu Glu Val 165 TTC TCC TGC Phe Ser Cys TGG.GAG CTC Trp Glu Leu -34- WO 98/56811 WO 9856811PCT/EP98/03662 CTC GCG AAG ATG GGC GAG AAG GAG TGG TTC TTC TTC GCG CAC AAG GGT Leu Ala Lys CGG AAG TAC 240 Aig Lys Tyr 220 TAC TGG AAG 288 Tyr Tip Lys Met 205

CCG

Pro

GCG

Ala Gly Glu Lys ACG GGG ACG Thr Gly Thr ACG GGG AAG Thr Gly Lys Glu

CGC

Arg 225 Phe Phe Phe Ala His Lys Gly 215 ACC AAC CGG GCG ACG AAG AAG GGG Thr Asn Aig Ala Thr Lys Lys Gly 230

CGG

336 Arg 250 235

GAC

Asp 240 GCC GTC CTT GTC GGC Ala Val Leu Val Gly 255 GAC AAG GAG ATC TTC Asp Lys Glu Ile Phe 245 ATO AAG AAG ACG CTC Met Lys Lys Thr Leu 260 AAG ACG CCG TGG GTG Lys Thr Pro Tip Val 275 CGC GGC AAG GGC Arg Gly Lys Gly GGC CGC GCC CCC AGC 384 Gly Arg Ala Pro Ser 270 CGC CTC GAG GGC GAG 432 Airg Leu Glu Gly Glu 285 GAT TGG GCT GTT TGC 462 Asp Tip Ala Val Cys 300 GGC GGG Gly Gly GTC TTT TAC ACC Val Phe Tyr Thr 265 ATG CAC GAG TAC Met His Glu Tyr 280 ACC GCC AAG GAC Thr Ala Lys Asp 295 CTG CCC CAT CGC CTT Leu Pro His Aig Leu 290 CGG GTG TTC AAC AAA CCC CGC Pro Aig Arg Val Phe Asn Lys 305 INFORMATION FOR SEQ ID NO: 8: SEQUENCE CHARACTERISTICS: LENGTH: 154 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: Leu Pro Pro Gly Phe Arg Phe His Pro Thi Asp Glu Glu 1 5 10 His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser 25 Ile Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Tip Glu 40 Leu Ala Lys Met Gly Glu Lys Glu Tip Phe Phe Phe Ala 55 Val Val Thi Cys Gln Val Leu Pro Gly His Lys Gly WO 98/56811 PCT/EP98/03662 Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys Lys Gly 70 75 Tyr Trp Lys Ala Thr Gly Lys Asp Lys Glu Ile Phe Arg Gly Lys Gly 85 90 Arg Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe Tyr Thr 100 105 110 Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His Glu Tyr 115 120 125 Arg Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Ala Lys Asp 130 135 140 Asp Trp Ala Val Cys Arg Val Phe Asn Lys 145 150 INFORMATION FOR SEQ ID NO: 9: SEQUENCE CHARACTERISTICS: LENGTH: 1090 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Triticum monococcum (ix) FEATURE: NAME/KEY: CDS LOCATION:94..954 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: AATTCGGCAC GAGACAGTCC ACCACGCACG TGCAGCAGCA CCAGCGCCCG AGAATCCCAT TCCCATCGAC GGAGAAGAAG AAGTGAAGAA ACA ATG GTG ATG GCA GCG GCG GAG 114 Met Val Met Ala Ala Ala Glu 155 160 CGG CGG GAC GCG GAG GCG GAG CTG AAC CTG CCG CCG .GGG TTC CGG TTC 162 Arg Arg Asp Ala Glu Ala Glu Leu Asn Leu Pro Pro .Gly Phe Arg Phe 165 170 175 CAC CCG ACG GAC GAG GAG CTG GTG GCG GAC TAC CTC TGC GCG CGC GCG 210 His Pro Thr Asp Glu Glu Leu Val Ala Asp Tyr Leu Cys Ala Arg Ala -36- WO 98/56811 WO 9856811PCT/EP98/03662 190 ATC ATC GCC GAG CTC GAC CTC TAC GCC GGC CGC GCG 258 Ala Gly Arg Ala 195 CGG TTC GAC CCG 306 0 Arg Phe Asp Pro CCG CCG GTG CCC Pro Pro Val Pro 200 TGG GAG CTC CCG Trp Giu Leu Pro

I

Ile Ile Ala GAG CGG GCG Glu Arg Ala 220 Giu 205

CTC

Leu Leu Asp Leu Tyr TTC GGG GCG CGG Phe Gly Ala Arg 225 210 GAG TGG TAC 354 Giu Trp Tyr 215 TTC TTC ACG Phe Phe Thr 230 CGC CCC AAC CGG GCC 402 Arg Pro Asn Arg Ala 245 GAC AGG CCC GTG GCG 450 Asp Axg Pro Val Ala

GCC

Al a

CGC

Arg CCG CGG GAC CGC Pro Arg Asp Arg 235 GGG GGC GGC TAC Gly Gly Gly Tyr 250 GCG GGC AGG ACC Ala Gly Arg Thr AAG TAC CCC AAC GGC TCC Lys Tyr Pro Asn Gly Ser 240 TGG AAG GCC ACC GGC GCC Trp Lys Ala Thr Gly Ala 255 GTC GGG ATC AAG AAG GCG Val Gly Ile Lys Lys Ala 270 GGG GTC AAG ACG GAC TGG Gly Val Lys Thr Asp Trp 265 CTC GTC TTC 498 Leu Val Phe 275 ATC ATG CAC 546 Ile Met His TAC CAC GGC AGG Tyr His Gly Arg 280 GAG TAC CGC CTC Glu Tyr Arg Leu 295

CCG

Pro 285 TCG GCG Ser Ala 290

AAC

594 Asn GCC GGC GCC GAC Ala Gly Ala Asp 300 GGA CGC Gly Arg GCC GCC AAG Ala Ala Lys 305 GGC GGC Gly Gly ACG CTC Thr Leu 310 AAC AAG AAG AAC 642 Asn Lys Lys Asn 325 GAG GCG GCG GCC 690 Glu Ala Ala Ala

CAG

Gin

AAG

Lys AGG CTT GAC GAP.

Axg Leu Asp Glu TGG GAG AAG ATG Trp Glu Lys Met 330 GCT GCG GCG TCA Ala Ala Ala Ser

TGG

Trp 315

GTG

Val CTC TGC CGC CTA TAC Leu Cys Arg Leu Tyr 320 CAG CGG CAG CGG CAG GAG GAG Gin Arg Gin Arg Gin Giu Giu 335 CAG TCG GTC TCC TGG GGT GAG Gin Ser Val Ser Trp Gly Giu 350 AAC GAT CCG TTC CCG GAG CTG Asn Asp Pro Phe Pro Glu Leu 365 340 ACG CGG ACG 738 345 CCG GAG TCC GAC GTC

GAC

Thr Arg 355 Thr Pro Giu Ser Asp Vai Asp 360 WO 98/56811 PCT/EP98/03662 GAC TCG CTG CCG GAG TTC CAG ACG GCA AAC GCG TCA ATA CTG CCC AAG 786 Asp Ser Leu Pro Glu Phe Gln Thr Ala Asn Ala Ser Ile Leu Pro Lys 370 375 380 385 GAG GAG GTG CAG GAG CTG GGC AAC GAC GAC TGG CTC ATG GGG ATC AGC 834 Glu Glu Val Gln Glu Leu Gly Asn Asp Asp Trp Leu Met Gly Ile Ser 390 395 400 CTC GAC GAC CTG CAG GGC CCC GGC TCC CTG ATG CTG CCC TGG GAC GAC 882 Leu Asp Asp Leu Gln Gly Pro Gly Ser Leu Met Leu Pro Trp Asp Asp 405 410 415 TCC TAC GCC GCC TCG TTC CTG TCG CCG GTG GCC ACG ATG AAG ATG GAG 930 Ser Tyr Ala Ala Ser Phe Leu Ser Pro Val Ala Thr Met Lys Met Glu 420 425 430 CAG GAC GTC AGC CCA TTC TTC TTC TGAGCTCTCA ATACTCTCAC GGTCGCACTG 984 Gin Asp Val Ser Pro Phe Phe Phe 435 440 TTGTGTGCGG CGTAACTGTA GATAGTTCAC ATTTGTTCAG GATTTATTTG TAACGTTGCT 1044 TCTTTTATAC GATACTCTCT TCCTTTCTAA AAAAAAAAAA AAAAAA 1090 INFORMATION FOR SEQ ID NO: SEQUENCE CHARACTERISTICS: LENGTH: 287 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) .SEQUENCE DESCRIPTION: SEQ ID NO: Met Val Met Ala Ala Ala Glu Arg Arg Asp Ala Glu Ala Glu Leu Asn 1 5 10 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Ala 25 Asp Tyr Leu Cys Ala Arg Ala Ala Gly Arg Ala Pro Pro Val Pro Ile 35 40 Ile Ala Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu 55 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp 70 75 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Ala Ala Gly Gly Gly -38- WO 98/56811 PTE9/36 PCT/EP98/03662 Thr Gly Ala Tyr Trp Lys Ala Asp Arg 105 Pro Val Ala Axg Ala Gly Arg Thr Ala Ala 145 Trp Gin Gin Asn Asn 225 Asp Leu Val Val Gly 130 Asp Val Arg Ser Asp 210 Ala Trp Met Ala Gly 115 Val Gly Leu Gin Val 195 Pro Ser Leu Leu Thr 275 100 Ile Lys Arg Cys Arg 180 Ser Phe Ile met Pro 260 Met Lys Thr Ala Arg 165 Gin Trp Pro Leu Giy 245 Trp Lys Lys Asp Ala 150 Leu Giu Gly Glu Pro 230 Ile Asp met Ala Leu 120 Trp Ile 135 Lys Asn Tyr Asn Giu Giu Giu Thr 200 Leu Asp 215 Lys Giu Ser Leu Asp Ser Giu Gin 280 Vai met Giy Lys Ala 185 Arg Ser Giu Asp Tyr 265 Asp Phe Tyr His Glu Giy Thr 155 Lys Asn 170 Ala Ala Thr Pro Leu Pro Val Gin 235 Asp Leu 250 Ala Ala His Tyr 140 Leu Gin Lys Giu Giu 220 Giu Gin Ser Gly 125 Arg Arg Trp Ala Ser 205 Phe Leu Gly Phe 110 Arg Leu Leu Giu Ala 190 Asp Gin Gly Pro Leu 270 Pro Ala Asp Lys 175 Ala Val Thr Asn Gly 255 Ser Ser Gly Giu 160 Met Ser Asp Ala Asp 240 Ser Pro Val Ser Pro Phe Phe Phe 285 INFORMATION FOR SEQ ID NO: 11: SEQUENCE CHARACTERISTICS: (iv) (vi) (ix) LENGTH: 1295 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: cDNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: ORGANISM: Triticun monococcum

FEATURE:

NAI4E/KEY: CDS LOCATION:109. .1161 -39- WO 98/56811 PTE9/36 PCT/EP98/03662 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: ATTCGGCACG AGATCACCTC TAACATCTCG ATCTACCTCT TCCTCCTCCT CAGCTCTCGT TCCATCAGGT TCTTCCACAG CGTAGCAAGG CAATCTAGTA GATCCTCC ATG TCG GAC 117 0 Met Ser Asp 290 GTG ACG GOG GTG ATG GAT CTG GAG GTG GAG GAG CCG CAG CTG GCG OTT Val Thr Ala Val Met 295 Asp Leu Giu Val Giu 300 Glu Pro Gin Leu Al a Leu 305 CCA CCG 213 Pro Pro TAO CTC 261 Tyr Leu ACC GAO 309 Thr Asp

GGG

Gly

ACC

Thr 325 TTC CGG Phe Arg 310 OGC AAG Arg Lys TTC CAC COO ACC GAC GAG GAG Phe His Pro Thr Asp Glu Giu 315 GTC CTC CGC GAA TCC TTC TCC Val Leu Arg Giu Ser Phe Ser GTG GTC ACC CAC Val Val Thr His 320

GCG

357 Ala 355

AAG

405 Lys 340

AAG

Lys

TAO

Tyr GTC GAC CTC AAC AAG Val Asp Leu Asn Lys 345 ATG GGC GAG AAG GAG Met Gly Glu Lys Giu 360 CCG ACG GGG ACG CGC Pro Thr Gly Thr Arg AAC GAG OCG TGG GAG Asn Glu Pro Trp Glu 350 TGG TTC TTC TTC GCG Trp Phe Phe Phe Ala 365 TGC CAA GTG ATC Cys Gin Val Ile 335 OTC CCG GGC CTC Leu Pro Gly Leu CAC AAG GGT CGG His Lys Gly Arg 370 ACC AAC CGG Thr Asn Arq 375 TGG AAG GCG AOG 453 Trp Lys Ala Thr 390 GAC GCO GTC CTT 501 Asp Ala Vai Leu GGG AAG GAO AAG GAG Gly Lys Asp Lys Giu 395 GTC GGC ATG AAG AAG Vai Gly Met Lys Lys 410 GGC GGG AAG, ACG OCG Gly Gly Lys Thr Pro GCG ACG AAG AAG GGG TAO Ala Thr Lys Lys Gly Tyr 385 TTC OGO GGO AAG GGO OGG Phe Arg Gly Lys Gly Arg 400 CTC GTC TTT TAO ACC GGC Leu Val Phe Tyr Thr Gly

ACG

Thr

OGC

549 Arg

GC

Ala 420 405

CCC

Pro

AGO

Ser 415.

TGG GTG ATG CAC. GAG Trp, Val Met His Giu TAC CGC Tyr Arg 425 430 WO 98/56811 PCT/EP98/03662 CTC GAG 597 Leu Glu 435 TGG GCT 645 Trp Ala GGC GAG CTG CCC CAT CGC CTT CCC CGC ACC GCC AAG GAC GAT Gly Glu Leu GTT TGC CGG GTG Val Cys Arg Val 455 His Arg Leu TTC AAC AAA Phe Asn Lys GCC GAC GGT Ala Asp Gly 475 ATC GAC ACC Ile Asp Thr Pro

GAC

Asp 460 Arg Thr Ala Lys 445 TTG GCG GCG AGG Leu Ala Ala Arg Asp Asp 450 AAT GCG Asn Ala 465 CCC CAG ATG GCG 693 Pro Gin Met Ala 470 TTC CTC GAT GAC 741 Phe Leu Asp Asp 485 CCG GCG Pro Ala TTG CTC Leu Leu GGC ATG GAG GAC CCG CTC GCC Gly Met Glu Asp Pro Leu Ala 480 GAC CTG TTC GAC GAC GCG GAC Asp Leu Phe Asp Asp Ala Asp 495 GGC GCT GAC GAC TTC GCC GGC Gly Ala Asp Asp Phe Ala Gly 490 CTG CCG 789 Leu Pro

GCT

837 Ala 515 500

TCG

Ser ATG CTC ATG GAC TCT Met Leu Met Asp Ser 505 AGC TCC ACC TGC AGC Ser Ser Thr Cys Ser 520 CCG GTG CTG CAT CCG Pro Val Leu His Pro CCG TCT Pro Ser GCG GCC CTG CCG Ala Ala Leu Pro 525 CAG CAG CAG CAG Gin Gin Gin Gln 510 CTT GAG CCG GAC GCG Leu Glu Pro Asp Ala 530 AGC CCC AAC TAC TTC Ser Pro Asn Tyr Phe 545 GAG CTA 885 Glu Leu 535 TTC ATG CCG GCG ACG 933 Phe Met Pro Ala Thr 550 GCC AAC GGC AAT Ala Asn Gly Asn 555 GGG GAC CAG CAG Gly Asp Gin Gin 540 CCC TAC CAG 981 Pro Tyr Gln 565 GCT ATG Ala Met CTT GGC GGC GCC GAG TAC TCA Leu Gly Gly Ala Glu Tyr Ser 560 GCC GCG ATC CGC AGG TAC TGC Ala Ala Ile Arg Arg Tyr Cys 575 TCG GCG CTG CTG AGC CCT TCG Ser Ala Leu Leu Ser Pro Ser 570 AAG CCG 1029 Lys Pro 580 CTG GGC 1077 Leu Gly 595 ATG CCG 1125 Met Pro

AAG

Lys

TTG

Leu GCG GAG GTA Ala Glu Val GAC ACG GCG Asp Thr Ala

GCG

Ala 585

TCT

Ser

TCG

Ser 590 600 TCA TCG CGG TCG Ser Ser Arg Ser GCG CTT GCC GGC GCG Ala Leu Ala Gly Ala 605 TAC CTC GAT CTG GAG Tyr Leu Asp Leu Glu GAG ACC TCC TTC CTG Glu Thr Ser Phe Leu 610 GAG CTG TTC CGG GGC Glu Leu Phe Arg Gly WO 98/568 11 PCTIEP98/03662 615 620 625 GAG CCT CTC ATG GAC TAC TCC AAC ATG TGG AAG ATC TGATGTGGAA 1171 Giu Pro Leu Met Asp Tyr Ser Asn Met Trp Lys Ile 630 635 GATCTGGAGC GTCTCAGTTT GCTGGTAGCT ATAGATGGGT ATTTGGTTGA TGCTAGCTCT 1231 TCGACTGATT AGTTGCTTCA TTAACTTTCG ATTAAGGATT GAGTTAAAAA AAAhAA 1291

AAAA

1295 INFORMATION FOR SEQ ID NO: 12: SEQUENCE CHARACTERISTICS: LENGTH: 351 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: Met Ser Asp Val Thr Ala Val Met Asp Leu Giu Val Giu Glu Pro Gin 1 5 10 Leu Ala Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val 25 Val Thr His Tyr Leu Thr Arg Lys Vai Leu Arg Giu Ser Phe Ser Cys 35 40 Gln Val Ile Thr Asp Vai Asp Leu Asn Lys Asn Giu Pro Trp Giu Leu 55 Pro Gly Leu Ala Lys Met Gly Giu Lys Giu Trp Phe Phe Phe Ala His 70 75 Lys Gly Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys 90 Lys Giy Tyr Trp Lys Ala Thr Gly Lys Asp Lys Giu Ile Phe Arg Giy 100 105 110 Lys Gly Arg Asp Ala Val Leu Val Giy Met Lys Lys Thr Leu Val Phe 115 120 125 Tyr Thr Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His 130 135 140 Glu Tyr Axg Leu Glu Gly Giu Leu Pro His Arg Leu Pro Axg Thr Ala 145 150 155 160 Lys Asp Asp Trp Ala Val Cys Axg Val Phe Asn Lys Asp Leu Ala Ala -42- WO 98/56811 WO 9856811PCT/EP98/03662 170 Arg Asn Pro Leu Asp Ala 210 Phe Ala 225 Pro Asp Asn Tyr Glu Tyr Arg Tyr 290 Ser Pro 305 Ser Phe Ala Ala 195 Asp Gly Ala Phe Ser 275 Cys Ser Leu Pro 180 Phe Leu Ala Glu Phe 260 Pro Lys Leu met Gln Met Ala Pro Ala Ala Asp Gly Gly Met Glu Asp Leu Pro Ser Leu 245 Met Tyr Pro Gly Pro 325 Asp Met Ser 230 Pro Pro Gln Lys Leu 310 Ser Asp Leu 215 Ser Val Ala Ala Ala 295 Asp Ser 185 Leu Leu 200 Met Asp Thr Cys Leu His Thr Ala 265 Met Gly 280 Glu Val Thr Ala Arg Ser Ile Ser Ser Pro 250 Asn Asp Ala Ala Tyr 330 Asp Pro Al a 235 Gln Gly Gln Ser Leu 315 Leu Thr Ser 220 Ala Gln Asn Gln Ser 300 Ala Asp Asp 205 Gly Leu Gln Leu Ala 285 Ser Gly Leu 190 Leu Phe Ala Asp Pro Leu Gln Ser 255 Gly Gly 270 Ala Ile Ala Leu Ala Glu Glu Glu 335 Asp Asp Glu 240 Pro Ala Arg Leu Thr 320 Leu Phe Arg Gly Pro Leu Met Asp Tyr 345 Ser Asn Met Trp Lys Ile 350 -43- 43a The term "comprises", and grammatical variations thereof such as "comprising" when used in the description and claims does not preclude the presence of additional features, integers, steps or components; or groups thereof.

Claims

1. A method of controlling plant cell cycle by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA characterised in that the protein or peptide comprises an amino acid sequence of homology of at least 70% to that of SEQ ID No 6 or SEQ ID No 8 and the method comprises incorporating a nucleic acid into the plant cell which encodes for the protein or peptide, is antisense to nucleic acid encoding the protein or peptide, or downregulates expression of native nucleic acid encoding the protein or peptide by gene silencing coexpression.

2. A method as claimed in claim 1 characterised in that the control of the plant cell cycle comprises one or more of control of plant cell or plant virus growth and/or replication, plant cell differentiation, plant cell development and/or scenescence. *A* r RCV. V(A:1liIPA.NIIJE-NCHE'N 05 91413, L4UTjIT71 .71 -Z 10:Z6 Do-UNGRIA S.A. 1147T-1 P./I F-Z PCTI-CHAPTER 11

3. A method as claimed in any one of the preceding characterised in ttiat the protein or peptide comorises an amino acid sequence having az least sequence homology to SEQ ID No 3 or SEQ ID NO 4.

4. A method as claimed in any one of the preceding claims characterised in that- it comprises overp-oducing or anderproducing the protein or peptide in the plant cell. A method as claimed in any one of the preceding claims characterised in that. the nucleic acid is in the form of recomrUilaft nucleic acid.

6. A method as claimed in Claim 5 characterised in that the sequence is positioned behind a pronotor capable of supporting expression of the protein or peptide comprising an amino acid sequence 'having at least homology to that of SEQ ID No 6 or SEQ TD No B, or production of antisense RNA to the nucleic acid sequence encoding the protein or peptide.

7. A method as claimed in any one of Claims I to 6 characterised in that the protein or peptide is prodiaced ectopically. AMENDED SHIEET

27- 8-02;16:30 ;WATERMARK PATENT ;61 3 98196010 3/ 46 8. A method as claimed in Claim 7 characterised in that the protein or peptide is produced in vegetative tissue or stem tissue. 9. A method as claimed in any one of the preceding claims characterised in that it comprises producing or inhibiting senescence in a plant cell comprising increasing or decreasing the plant cell levels of a protein or peptide comprising a sequence having at least 50% homology to that of SEQ ID No. A protein or peptide in enriched, isolated, cell free and/or recombinantly produced form characterised in that it has at least 70% amino acid sequence homology with that of SEQ ID No. 6 or SEQ ID No. 8 and is capable of binding with Geminivirus RepA with the proviso that the sequence is not that of EMBL sequence database AB002560. 11. A protein or peptide as claimed in Claim 10 characterised in that it has an N-terminal sequence having 90% or more homology to that of SEQ ID No. 6 or SEQ ID No. 8. 12. A protein or peptide as claimed in Claim 10 or 11 characterised in that it comprises an amino acid sequence of SEQ ID No. 10 or 12 or a functional variant thereof having an amino acid sequence of homology of at least 70% with that sequence. 13. An enriched, isolated, cell free and/or recombinant nucleic acid characterised in that it encodes for a protein or peptide comprising an amino acid sequence of homology of at least 70% to that of SEQ ID No. 6 or SEQ ID No. 8, is antisense to nucleic acid encoding for that protein or peptide or 27- 8-02;16:30 ;WATERMARK PATENT ;61 3 98196010 4/ 47 downregulates expression of native nucleic acid encoding that protein or peptide by gene silencing coexpression. 14. A nucleic acid as claimed in Claim 13 characterised in that it is a DNA or RNA polynucleotide comprising one or more of SEQ ID No. 1, 2, 5, 7, 9 or 11 or sequences that have at least 70% homology thereto. A method of producing a protein or peptide as claimed in any one of claims to 12 characterised in that it comprises expressing DNA or RNA as described in Claim 13 or 14. 16. A plant cell characterised in that it comprises a recombinant nucleic acid encoding for expression of an N-terminally truncated Geminivirus RepA protein comprising the RepA protein C-terminall amino acids 228 to 264. 17. A method of controlling plant cell cycle by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA characterised in that the protein or peptide comprises an amino acid sequence of homology of at least 70% to that of SEQ ID No. 6 or SEQ ID No. 8, and the method comprises incorporating the recombinant nucleic acid of Claim 16 into the plant cell, wherein the protein or peptide encoded by the recombinant nucleic acid encodes a polypeptide which does not comprise an LXCXE motif. 18. A nucleic acid probe or primer characterised in that it comprises an oligonucleotide or polynucleotide of 15 or more contiguous bases of sequence SEQ ID No. 5, 7, 9 or 11 or complementary sequences thereto or RNA sequences corresponding thereto with the proviso that the sequence is not that of EMBL sequence database X74756. 19. A nucleic acid probe as claimed in Claim 18 characterised in that it comprises from 30 contiguous bases to the complete sequence SEQ ID No. 5, 7, 9 or 11. 27- 8-02;16:30 ;WATERMARK PATENT ;61 3 9819601 0 5/ 48 A nucleic acid transformation vector characterised in that it comprises DNA or RNA as described in Claims 14 or 21. A method for producing transformed plant cells comprising nucleic acid as claimed in or described in any one of Claims 1 to 20 comprising introducing said nucleic acid into the cell in vector or free form. 22. A method as claimed in Claim 21 characterised in that the nucleic acid is introduced directly by electroporation or particle bombardment. 23. A plant cell comprising recombinant nucleic acid as described or claimed in any one of Claims 1 to 24. A transgenic plant or part thereof comprising a cell as claimed in Claim 23. 25. A plasmid containing a DNA of sequence coding for a protein of SEQ ID No. 10 or SEQ ID No. 12 as described herein as deposited under the provisions of the Budapest Treaty on the International Recognition of the Deposit of **0 *9 9 o 49 Microorganisms of 1977; these being deposited on 11 June 1997 at the Coleccion Espanola de Cultivos Tipo, with the accession numbers CECT 4889 or CECT

4890. 26. A method of controlling plant cell or plant virus replication by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA. characterised in that the protein or peptide comprises an amino acid sequence of homology of at least 70% to that of SEQ ID No 3 or SEQ ID No 4 and the method comprises incorporating a nucleic acid into the plant cell which i c V RCV. VON: FPA-MIJENCIEN 05 8-99' t:2 1LU 7 W)u 239914f-5: It 12 02-AGO-99" 10:ZT Do-UNGRIA S.A. 9141354IU T-751 P-12/13 F-223 PcT-CH-APTEP, ii encodes for the protein or peptide, (zl) is antisense to nucleic ac-ld encoding the protein or peptide or downregulates expression of native nucleic aci~d S encoding the protein or peptlde JOy gene silencing coexpression. 27. A method as claimed in Claim 26 chfaracrerised in zhat the protein or peptide~ comprises an amino ccd sequence having at least 90% sequence homology to S--Q 1D No 3 or SEQ ID No 4. 28. A method as claimed In any one of Claim 26 or Claim 27 charaCterised in that it comprises overproducing or underproducing the prote-In peptide in the plant cell. 29. A method as claimed in any one cf Claims 26 to. 28 characterised in that the nucleotides are in the form of recombinant nuclei4c dc id comprising the protein or peptide encoding sequence. A -method as claimed in Claim 29 chiaracterised in that the sequence is positioned bezind a promotor capable of supporting expression of the protein or paptide, or capable of production of antisense RNA to the nucleic acid sequence. AMEBjDED SHEET RO7' VON:1EPA-,MI.ELCHEN 0.3 2- 8-UJ. 10: 20 02'AGO-l" 10:-2T go-UNGiRIA S.A. U1I I+ 134 i +-WJ 89 23W4I4 6; HI M S 14135417 T-7U1I P. 12/13 F-ZZ3 PCT-CHAPTER It 31. A mnethod as claimed in any one of Claims 26 to craracterised in triat the protein or peptide is produced ectopical Ly. 32. A method as claimed in Claim. 31 characterised in. that the protein or peptide is produced in vegetative tissue or stem tissue. AMENDED SHfET