JP2002506345A - Plant GRAB protein - Google Patents

Abstract

(57) Abstract: Proliferation and growth of a plant cell or a plant virus, which comprises increasing or decreasing the level of a GRAB (Geminivirus RepA Binding) protein or peptide or a geminivirus RepA binding ability in a plant cell. Methods are provided for controlling replication and / or differentiation, growth and / or aging of plant cells.

Description

DETAILED DESCRIPTION OF THE INVENTION                          Plant GRAB protein   The invention is particularly applicable to the growth and / or replication, differentiation, development of plant cells and plant viruses. A method of controlling the cell cycle to control life and / or aging; Identifying and / or unisolated proteins and / or nucleic acids in such methods. Use; such a use of previously unknown natural functions of known proteins and nucleic acids Use in methods; unidentified and / or unisolated proteins and nucleic acids themselves, and In an enriched, isolated, cell-free and / or recombinant form; A plant comprising the recombinant nucleic acid.   Cellular factors are required for successful completion of the virus replication cycle in infected cells. The need for child involvement is well documented. This means that several Especially evident in viruses with small genomes that encode only proteins It is. For example, animal DNA tumor viruses are involved in the process of transcription and DNA replication. Use intracellular devices. One or more further encoded by the virus Proteins are used by infected cells to create an intracellular environment suitable for viral replication. It has developed to have a direct effect on physiology. One typical example is the retinal bud Animal DNA activates the cell cycle in infected cells by interfering with the tumor pathway An oncoprotein encoded by the oncovirus, ie, the SV40 T antigen, Adenovirus EIA or human papilloma virus (human papill) oma virus) E7 protein (26, 26, 45).   A similar strategy is plant geminivirus, plant DNA It is presumed that it has evolved in a unique group of viruses. Geminiu The ils genome can be one or two small (2. 6-3. 0 kb) consisting of a circular single-stranded DNA molecule (11, 24). Wheat tower small virus (w heat dwarf Geminivirus (WDV) is a component Ruth is 2750 nucleotides in length, the smallest of a single stranded ssDNA molecule. It belongs to subgroup I with genome and encodes only a few proteins. So Of these, RepA (also called C1) and Rep (also called C1: C2) ) Is the only WDV protein required for viral transcription and replication (24). R epA is derived from a single transcript produced under the control of a complementary sense promoter. Will be translated. Rep protein is produced after this mRNA is spliced. (37). WDV Rep is absolutely required for viral DNA replication And this is homologous to the Rep protein of all geminiviruses. Jemi The virus Rep is responsible for in vitro nicking-ligation activity, replication initiation of DNA It has been shown to have point recognition activity and ATPase activity. However, The RepA protein is unique to the WDV geminivirus subgroup and Activity, binding to plant retinoblastoma (Rb) protein (45, 46) and Stimulation of viral sense gene expression has been implicated in the control. More recently We have shown in WDV that the Rb binding protein (RepA) and the starting protein ( Rep) showed that it appears to play an equivalent role in viral DNA replication. .   Geminivirus DNA replication occurs in the nucleus of infected cells and is Replication is deficient in the S-phase Noh is necessary. Accumulation of replication intermediates in the S phase nucleus is consistent with this (1 ). Geminiviruses usually infect non-proliferating cells, but interestingly , They are proliferative cell nuclear antigens (P Induces the appearance of cellular proteins typical of S phase such as (CNA) (29). W Subgroup I geminiviruses such as DV regulate their ability to interact with Rb And participate in the mechanism by which geminivirus affects the cell cycle activation circuit Encodes a protein containing the LXCXE motif of the RepA protein (4 5). These observations indicate that ZmRb1, a regulator of G1 / S phase transition in plant cells A full-length cDNA encoding a plant Rb protein capable of acting in It was the basis for isolation (46). Consistent with this function, cultured plant cells Overexpression of plant Rb (and human Rb) significantly inhibits WDV DNA replication Harm (45, 46). Therefore, in order to facilitate DNA replication, At least one mechanism used for geminiviruses sequesters Rb, And infected cells by affecting the resulting negative cell proliferation activity It is presumed that this is the induction of S phase in.   Control of cell cycle, growth and differentiation in plants depends on hormones, nutritional status or environmental A complex of regulators with activities that respond to a wide variety of signals, such as states It is the result of the interaction (20, 39). For example, the concentration of D-type cyclin mRNA Sharp rise in response to sucrose or cytokinin treatment (41) , The concentration of cyclin-dependent kinase (cdc2) mRNA depends on the presence of auxin Dependent. Molecular properties of other plant cell cycle regulators and their involvement in cell growth and differentiation The linked features are little known. Therefore, plants to the growth signal Involvement in these regulatory pathways to elucidate the molecular mechanisms governing cellular responses It is important to identify such cellular factors.   Because cellular factors are absolutely required for completion of geminivirus replication The present inventors have reported that gemini Lewisl is more specific by a mechanism other than affecting the Rb pathway. Regulates cell physiology, and such effects are controlled by geminivirus proteins. Thus, at present it was assumed that unknown cellular factors were the result of being targeted. they Is a protein that interacts functionally with RepA, an Rb binding protein of WDV. Use experimental techniques to identify quality and encode unknown proteins Several cDNA clones were now provided and their function determined.   Based on amino acid sequence analysis, these proteins were identified as viral RepA tags. Have a common N-terminal domain required for interaction with proteins and Have been confirmed to be unique. Transcription system As in regulator activity, they are responsible for hormonal and nutrient responses, meristem development And a larger family of proteins related to regulators of plant aging. There is also the possibility to represent   Therefore, in the first aspect of the present invention, GRAB (Gemin) ivRepA Binding) Protein or peptide level Increasing or decreasing the binding capacity of GRAB protein or peptide A method for controlling the plant cell cycle characterized by increasing or decreasing force Provided. Such controls may include, among other things, the growth and / or replication of plant cells, Regulates plant virus growth, plant cell differentiation, development and / or aging in the vesicle Also make things possible. Such proteins and peptides are known as Rb (Retinobl). astoma) is understood to be different from proteins, especially the sequence listing and their function Such variants are described later herein.   Increasing or decreasing the concentration of GRAB protein peptide is Protein or peptide compared to the normal production concentration of the protein or peptide It is caused by overproduction or underproduction of pide in plant cells. The decrease in the native GRAB binding activity is, for example, WDV RepA or a functional site thereof. Or a substance such as a mutant, which binds to GRAB protein or peptide Is achieved by   In particular, GRAB proteins or peptides for use in the present methods are described herein. Containing the amino acid sequence of SEQ ID NO: 2 or 4, or a geminivirus Those functional variants that have the ability to bind RepA. Preferred tampa The protein or peptide is at least 70%, more preferably, SEQ ID NO: 2 or 4, At least 90% and most preferably at least 95% amino acid sequence homology Having. In particular, the GRAB protein has the first 200 amino acids at its N-terminus Has the ability to bind to irritable RepA; more preferably the first 170 Amino acids and most preferably the first 150 amino acids at the N-terminus are such It has power.   These methods provide a plant cell or plant with such GRAB protein or pea. It may include administering the peptide directly, however, more conveniently, A nucleotide or antisequence encoding a corresponding GRAB protein or peptide; And the use of oligonucleotides. That is, for example, GRAB tan Pro-protein that enables the expression of proteins or peptides or the production of antisense RNA Downstream of the motor contains a sequence encoding GRAB protein or peptide. In particular, the recombinant DNA is placed inside the cell as if it were placed inside the cell by the use of recombinant nucleic acid. Nucleic acid to be placed. Nucleic acids encoding GRAB proteins require GRAB. Where it is needed, e.g. an ectopic tissue where it is not normally expressed, e.g. To produce it in a nourishing tissue or a stem tissue such as wood or phloem Can be used. Other strategies include GRAB protein binding peptides such as Geminiu GRAB proteins such as ils RepA, a functional variant thereof or a C-terminal part thereof Expression of a protein binding site. Such a peptide is a natural GRA It will bind to B proteins and inhibit their activity. Complete gemini RepA in transgenic plants other than viral production, and especially Expression of only the GRAB protein binding portion such as N-terminal deleted RepA is novel. It is recognized that. Promote in DNA or RNA vector or DNA construct The cDNA encoding RepA, which is in a functional relationship with the Are particularly useful for such purposes.   The most effective way to deliver the proteins and peptides of the invention to plant cells is It is clearly evident that expressing the nucleic acids encoding them in situ. Will be understood. Such methods include the use of sequences encoding peptides or proteins. Of an oligonucleotide or a polynucleotide having a DNA into a plant cell DNA By doing so it is customary. Such nucleotides are The expression of native GRAB is controlled by co-expression (6) or by the antisense method. It may also be used to reduce. Mutagenesis techniques, such as SDM, The nucleotides of the invention are thereby functional variants or otherwise of the invention, Proteins that are overactivated or inactivated, eg, for binding activity; It can be designed or manufactured to encode a peptide.   One of skill in the art will appreciate that a suitable promoter may be continuously or inducibly active. And will clearly understand. The inducible promoter is the GRAB protein described above. Only when activity of the protein is required, for example when signs of viral infection appear or When the plant is otherwise vulnerable or at a particular stage of cell development It will be appreciated by those skilled in the art that there is an advantage in that Properly understood. For example, such a promoter might induce stress Environmental conditions such as reduced water availability due to drying or freezing. Or complex factors such as plant hormones such as interplant stress transfer hormone Thus, or as a specific cation or anion, such as a metal cation. It may be induced by a simple factor. About the type of promoter used Does not assume any particular restrictions.   Transgenic plants by inserting cDNA with appropriate control sequences Numerous specific examples of the methods used to produce There will be. For example, plant transformation vectors are described in Denecke et al., (1992) E MBOJ. For producing totehalose as described in US Pat. Their further use for producing transgenic plants that produce Patent Application No. 08/290301, EP0339009B1, and No. 5,250,515 describes a method for inserting a heterologous gene into a plant. (See U.S. Pat. No. 5,250,515, columns 8 to 26). Transgenic Pollen electroporation for producing both monocot and dicot plants is described in U.S. Pat. No. 5,629,183, US Pat. No. 7,530,485 and US Pat. No. 7,350,356. No. For further details, see Rocky S.M. Tuan. Edited by Recombinant Gene Expression Prot ocols (1997) Humana Press, ISBN 0-89603- 333-3; 0-89603-480-1, etc. is there. No specific restrictions on the types of transgenic plants provided It is clearly understood that this is not envisioned; all classes of plants, monocots or dicots, GRAB activity in plants is constitutively, ectopically or transiently caused by insertion of the nucleic acid of the present invention. It can also be produced in a transgenic form, which will vary.   A preferred embodiment of the first aspect of the present invention provides a method for preparing a GRAB protein in a plant cell. Or a peptide, particularly the GRAB1 protein of SEQ ID NO: 10, or benta a functional variant thereof capable of inducing aging in Miana plants. Increase aging in plant cells, including increasing or decreasing levels or activities A method is provided for causing or inhibiting. Further, such an increase or decrease may be Is most effectively achieved by the incorporation of SEQ ID NO: 9 or a functional variant thereof. Alternatively, it may be achieved by using DNA encoding RepA.   The second aspect of the present invention relates to a novel GRAB protein or peptide per se as well as Into a concentrated, isolated, cell-free and / or recombinantly produced form. Offer. Such proteins and peptides can be naturally occurring Or may be substituted so as to retain homology as described below. No. Preferred proteins and peptides are GRAB1 or GRA according to the invention. N-terminal 200 of B2 (more preferably the first 170 and most preferably 150 )) 90% or higher, more preferably 95% or higher for amino acids Higher, and most preferably 98% or higher, N-terminal with homology Has an array. Preferred peptides are those that conserve these sequences or their homology. The first 150 to 200 amino acids of any of the sequences of the substituted variant Contains an array. A preferred peptide is the C-terminal sequence S shown in FIG. Includes such sequences except ENU, NAM, ATAF1 or ATAF2.   In particular, the GRAB protein and peptide are those of SEQ ID NO: 3 or 4 shown herein. Or binding activity to Geminivirus RepA, and SEQ ID NO: 3 or Is 4 and at least 70%, more preferably at least 90% and most preferably Or at least 98% of those functional variants having an amino acid sequence. Noic acid sequences. More preferably they are SEQ ID NO: 6 or 8 or Is a functional variant whose homology is limited and most preferably SEQ ID NO: 10 or Include 12 or such functional variants thereof with limited homology. protein Or, if the peptide comprises SEQ ID NO: 3 or 4, it may be SENU, NAM, ATAF 1 or ATAF2.   The protein or peptide encodes a naturally occurring protein or peptide, Mutagenesis techniques using, for example, chemical mutagenesis or mutagenesis PCR May be derived from DNA that has been modified by   A third aspect of the invention relates to a nucleic acid encoding a GRAB protein or peptide and The antisense nucleic acids themselves as well as their enriched, isolated, cell-free and And / or in a recombinantly produced form. Specially provided Sense strand and antisense in the form of individual oligonucleotides and polynucleotides DNA, and as shown in FIG. 4, SENU, NAM, ATAF1 or ATA The aforementioned DNA not encoding the complete amino acid sequence of F2 is provided.   Particularly provided are, for example, in the form of nucleotides, but preferably GRAB1 or G as described herein in the form of DNA or cRNA (mRNA) N with at least 60% homology to the first 200 N-terminal amino acids of RAB2 A nucleic acid encoding the expression of a GRAB protein having a terminal sequence; First 200 codons with such homology. Preferably the homology is at least 75% and most preferably 90%.   Preferred nucleic acids are SEQ ID NOs: 1, 2, 5, 7, 9 or 11 or the homology limits described above. DNAs or RNAs containing those functional variants having the same specificity. Most preferred Is the DNA of SEQ ID NO: 9 or 11, or a functional variant thereof.   In the description and the claims of the present invention, the following technical terms shall be used unless otherwise specified. And is used in the following definitions.   "Functional variants" of peptides, proteins, nucleotides or polynucleotides ”Refers to the identity of the prototype peptide, protein, nucleotide or polynucleotide. One or more amino acid residues in the amino acid or base sequence may be substituted or deleted. Loss and / or insertion, or by doing the same for bases Peptides, proteins, which have an amino acid or base sequence that can also Nucleotides or polynucleotides that may be altered in amino acid or base sequence Nevertheless, a functional variant is an intact peptide, protein, nucleotide or polypeptide. At least one biological activity detectable by those skilled in the art of oligonucleotides. Have also left some. Functional variants are generally at least 50% homologous (ie, Their amino acids or base sequences are 50% identical), but advantageously At least 70% homologous and even more advantageously at least 90% are derived therefrom. Homologous to natural or synthetic sequences that can be used. Functional part of the protein or its variant Minutes are also defined as functional variants.   "Overproduction" is used herein in the most common manner possible. specific Of the type (generally a protein, polypeptide or oligopeptide or R NA) is significantly and detectably higher (eg, 20% higher) than the natural concentration When it is produced, it is called "overproduction" in the cell. Of intracellular molecules Overproduction is achieved by both traditional mutagenesis and selection techniques, and genetic engineering. It is also possible that   As used herein, the term “ectopic expression” is in some sense particularly Recognized overproduction, for example, which is not expressed at all (or to an undetectable extent) Ectopically expressed protein is produced in the parts of the plant, The protein or peptide is overproduced at the site.   The term “underproduction” is significantly lower than the natural concentration (eg, 20% or less). Low), especially at undetectable concentrations, in peptides, polypeptides, proteins or mRNs. A is used in a sense including that A is produced.   The DNA or RNA of the present invention is a GRAB protein or peptide, such as GRA. Degenerate at codon nucleotides in sequences encoding B1 or GRAB2 May comprise a sequence that includes an exchange, wherein the T of the DNA is replaced by the U of the RNA. Has been replaced. Preferred DNAs or RNAs themselves have low stringency conditions. Hybridized to a polynucleotide encoding GRAB1 or GRAB2 Soybeans, preferably in high stringency conditions Can also perform such hybridization.   The terms "low stringency conditions" and "high stringency conditions" , Of course, will be well understood by those skilled in the art, but for convenience US Pat. No. 5,202,257. Examples are shown in columns 9 and 10. When modifying, these GRAB proteins Having different amino acids of the same class as the corresponding amino acids in the protein sequence Quality should be expressed; that is, they are conservative substitutions. Such substitutions are well known to those skilled in the art (see, for example, US Pat. No. 5,380,712). No.), and only when the protein is active as a GRAB protein I do.   In the fourth aspect of the present invention, the DNA or the DNA referred to in the second aspect described above. Protein or peptide expressed by recombinant RNA, its DNA or RN Novel Protein or Peptide Derived from A and Mutagenized Polymerase Modified by a mutagenesis method such as the use of A protein or peptide produced from DNA or RNA is provided. Book Including using the DNA or RNA of the invention to express them from cells A method for producing the protein or peptide of the present invention, which is characterized by Provided.   A fifth aspect of the present invention provides a method according to SEQ ID NO: 5, 7, 9 or 11 described later herein. Or the complementary sequence thereof, or the corresponding RN DNA base encoding the A sequence, especially the first 150 N-terminal sequence of such sequence Nucleic acid probes and primers that are complementary to 15 or more adjacent bases of Offer a ma. These probes and primers are oligonucleotide or In the form of oligonucleotides, for example using Southern or Northern blotting methods To produce a naturally occurring or synthetically produced GRAB peptide or protein. It can also be used to identify.   Oligonucleotides used as probes are conveniently SEQ ID NO: 5, Comprising at least 18 contiguous bases of the sequence of 7, 9 or 11 and preferably having a length of 30 to 100 bases, but up to or even the full sequence length May be longer. Oligonuclease when used as a primer for PCR or LCR The nucleotides are preferably 10 to 20 bases long, but may be longer. No. The primer should be single stranded but the probe should be double stranded, ie the complementary sequence May be included.   A sixth aspect of the present invention provides a vector comprising the DNA or RNA according to the third aspect of the present invention. Offer.   A seventh aspect of the present invention is a method for producing a transformed cell containing the nucleic acid of the present invention. And introducing the nucleic acid into a cell in the form of a vector. I do.   An eighth aspect of the present invention is a method for producing a transformed cell containing the nucleic acid of the present invention. The nucleic acid directly into the cells, for example by electroporation or particle bombardment (particl e) providing said method, including introducing by e. You. Particularly provided is electroporation of pollen cells.   A ninth aspect of the present invention relates to a recombinant nucleic acid of the present invention, in particular, a DNA or RNA of the present invention. , For example, plant cells and such cells, including pollen and seed cells. A plant comprising:   Coding the expression of the GRAB proteins GRAB1 and GRAB2 described herein. Plasmid containing the DNA to be deposited is subject to international approval for the deposit of the microorganism in 1977. Have been deposited under the terms of the Budapest Treaty; these are June 1997 On November 11 Collecion Espanola de Cultivos T ipo has accession number CECT4889 (including the GRAB1 sequence) and accession number 4 890 (including the GRAB2 sequence). Sequence listing SEQ ID NOs: 1 and 2 are conserved domains each having an intervening base denoted as N Figure 3 shows the nucleotide sequence of GRAB1 and GRAB2 encoding N1 to N5 . SEQ ID NOs: 3 and 4 show amino acid sequences corresponding to SEQ ID NOs: 1 and 2, respectively. You. SEQ ID NOs: 5 and 7 span from N1 to N5 of GRAB1 and GRAB2, respectively. 1 shows the full-length nucleotide sequence. SEQ ID NOs: 6 and 8 show the amino acid sequences corresponding to SEQ ID NOs: 5 and 7. SEQ ID NOs: 9 and 11 contain the coding regions for GRAB1 and GRAB2, respectively 1 shows the full-length sequence of the isolated cDNA. SEQ ID NOs: 10 and 12 show the corresponding amino acids of GRAB1 and GRAB2 proteins. 3 shows the acid sequence. Brief description of figures FIG. 1 shows the results of Northern analysis of GRAB1 and GRAB2 transcripts. FIG. 2. Regions of GRAB1 and GRAB2 involved in binding to WDV RepA. 2 shows the results of a study performed to identify. FIG. 3 identifies regions of WDV RepA involved in binding to GRAB protein 3 shows the results of a study conducted to FIG. 5 shows the GRAB protein domains N1 to N5 used in the method of the present invention. 1 shows an alignment of various protein sequences, known or unknown, having FIG. 6 shows the charge distribution of these proteins.   The present invention is further described by the following non-limiting examples, which are illustrated by reference. It is. Further embodiments within the scope of the claims may be made by those skilled in the art in light of these facts. Will be found in   The following method was used in the examples described below. Materials and methods DNA manipulation   Proteinase K, restriction endonucleases and other enzymes for DNA manipulation Is Merk, Boehringer Mannheim, New England d Obtained from Biolabs and Promega. Standard DNA manipulation techniques are described in [34. ] Was used. DNA sequence analysis is performed by Applied Biosystem. This was performed using an automated sequence analyzer from Em. Oligonucleotides are Isogen   Bioscience BV (Maarsen, The Netherlands) ds). Purification of DNA and RNA   Genomic DNA and total RNA are derived from wheat leaves, roots and suspension cultures, essentially [ 41], the material previously frozen with liquid nitrogen is simply ground by grinding. Released. The powder was extracted with an extraction buffer (50 mM Tris-HCl, pH 6. 0, 1 0 mM EDTA, 2% SDS, 100 mM LiCl). After heating at 65 ° C. with ethanol (1: 1, 65 ° C.), stir for 20 seconds and 4 ° C. For 15 minutes at 12,000 rpm. Supernatant with an equal volume of phenol: Extracted twice with chloroform (1: 1) and precipitated with 1 volume of 4M LiCl Was. After centrifugation, the RNA precipitate was resuspended in TE buffer and 2 volumes of ethanol Was added to the liquid layer to precipitate genomic DNA. Poly (A)⁺mRNA purification Performed as described in [47]. Construction of yeast two-hybrid cDNA library from wheat culture cells   5 micrograms of poly (A) isolated from wheat suspension culture cells⁺mRNA Use a cDNA synthesis kit (Stratagene) and follow the manufacturer's instructions. Used as a substrate for cDNA synthesis. Including the obtained EcoRI and XhoI ends The double-stranded DNA had an average size of 1.3 Kb. A part of this cDNA (500n g) was digested with 750 ng of EcoRI / XhoI digested pGAD-GH vector (Clo ntech) for 48 hours at 8 ° C. Following ligation, the library is steamed. Dialysed against distilled water, and E. coli DH10B (Gibco) It was introduced by the hole method. For simplicity, the cDNA libraries were each 6 × 10^Five Were divided into five sublibraries containing primary transformants. Total Library DN A: Primary transformants are plated on 15 LB plates containing 150 mm ampicillin Was obtained. Colonies were transferred to LB (+ Amp) medium and plasmid D NA was prepared as described in [34]. Yeast two-hybrid screening   Yeast HF7c strain containing two reporter genes LacZ and HIS3 (MAT a ura3-52 his3-200 ade2-101 lys2-801   trpl-901 leu2-3,112 gal4-542 ga180- 538 LYS2 :: GALIUAS-GALITATA-HIS3 URA3 :: GAL4 17mers (x3) -CyCITATA-LacZ; [15] ) Was used for two-hybrid screening [4.16]. First, the yeast 38], the GalB in pBWRepA, pGBT8 vector [46]. 4 Complete WDVR fused to DNA binding domain (BD; TRPI marker) The plasmid was transformed with the plasmid containing the epA reading frame. Then, put them in pGA Transformed with D-GH (AD, LEU2 marker) wheat cDNA library . Transformation mixture contains no tryptophan, leucine and histidine, false positive To suppress the appearance of colonies, 5 mM and 10 mM 3-amino-1,2,4 The cells were plated on a yeast-removed selection medium supplemented with triazole (3-AT; [5]). form Transformants regenerate as usual between 3 and 8 days and are stored in the presence of 20 mM 3-AT. Growth in the presence was examined. To confirm the interaction between two fusion proteins Next, β-galactosidase activity was analyzed by the replica method as described in [7]. Plasmid DNA was obtained from E. coli from positive colonies. coli MH4 And was recovered. Because this strain is leuB^-And the deletion is pG Can be complemented by the LEU2 gene present in the AD-GH plasmid. This is because that. Deletions of GRAB1 include Apal (1-253) and SalI (1- 208), SacI (1-52) and SacII (80-287) restriction sites And the deletion of GRAB2 is XhoI (1-149), BglII (1-108), SalI (1-55) and SmaI (66-351) restriction enzymes Was constructed using the site. Production of GST fusion protein and in vitro binding experiment   To produce a GST-GRAB fusion protein, the oligonucleotide GR AB1-ATG (5'GGATCCATGGGTGATGGCAGCGG) and T 7 primers, and the oligonucleotide GRAB2-ATG (5'GGATC CATGGCGGACGTGGAGGCGGGTG) and T7 primer are GRA The B1 and GRAB2 coding regions were used to amplify each by PCR. . The product was then cloned into pGEX-KG in the same reading frame. GST-Rep A clones WDV RepA ORF into pGEX-KG vector in the same reading frame. Manufactured by coating. E. FIG. coli BL21 (DE3) transformation Body is OD₆₀₀Is adjusted to 0.6 to 0.9, and the IPT becomes 1 mM. By adding G, the expression of the fusion protein was induced by culturing at 37 ° C. for 30 minutes. Was. The GST fusion protein is glutathione-sepharose beads (Pharma cia). Labeled RepA protein is wheat germ Using the extract (Promega)³⁵Manufacturer conditions in the presence of S-methionine By in vitro transcription and translation (IVT) according to Labeled G RAB1 and GRAB2 are the GRA in the pBluescriptKS plasmid. The PCR product was cloned from the B1 and GRAB2 genes and After performing transcription using polymerase, TNT reticulocyte lysate (Prome ga). Plant cell culture   Triticum monococcum suspension cultures are described in Mullinea ux (John Inns Center, UK) and [46] Maintained as described. N. inoculation of benthamiana plants   The PVX-derived pP2C2S vector [10] was obtained from N. benthamiana planting Used for transient expression of GRAB protein in the body. GRAB1 construction For this, a 1.1 Kb SmaI-XhoI fragment containing the complete GRAB1 cDNA Was cloned into a NruI / SalI digested pP2C2S vector, and pP2-GR AB1 plasmid was produced. A frameshift GRAB1 mutant (GRAB1^Fs )), The plasmid pP2-GRAB1 was partially digested with SacII. After re-ligation after T4 DNA polymerase treatment. For GRAB2 construction The 1.35 Kb SmaI-XhoI fragment containing the complete GRAB2 cDNA was Cloned into NruI / SalI digested pP2C2S vector, P2-GRAB2 was produced. A frameshift GRAB2 mutant (GRAB2^FS )), The plasmid pP2-GRAB2 is digested with BstEII, Then, after Klenow treatment, they were reconnected. Infectious RNA was purified by digestion with SpeI. Rasmid DNA T7 Cap Scrib Kit (Boeringher Obtained by in vitro transcription using Mannheim). RNA transcription The material is 5 mM Na_ThreePO_Four(PH 7.0) and after 3 weeks N. benthamiana plants (4 each) using silicon carbide [10 , 17]. Of wheat culture cells by particle bombardment Transfection   The cells are sedimented by centrifugation at 1000 rpm for 3 minutes and the supernatant Was removed. The cell mass of about 0.20-0.25 ml is a spatula, 0.25 mM On CHS medium (bombardment medium) with mannitol added and solidified with 0.8% agar Was spread on Whatman # 1 filter paper placed on a plate. DNA adsorption and particle bombardment (Particle bombardment) conditions are described in [43, 46] It was as follows. Overexpression of GRAB protein in cultured wheat cells The region was cloned under the control of the CaMV 35S promoter of plasmid [47]. It was done by 1.1 Kb EcoRI-XhoI of GRAB1 The fragment and the 1.3 Kb EcoRI-ApaII fragment of GRAB2 were ligated with EcoRI / N deI digested p35SZmRbI plasmid [47] and cloned into p35S. GRAB1 and p35S. GRAB2 was produced. These presmids are ZmR It contains the 3 'untranslated region of b1. The point at which each experiment is performed is Corresponding to each cell plate performed. The experiment was performed at least twice. Analysis of WDV DNA replication   WDV DNA replication was analyzed essentially as described in [43,46]. Fine Vesicles are placed in liquid nitrogen and DNA is isolated essentially as described in [41]. (Soni et al., 1994). After electrophoresis in a 0.7% agarose gel, The DNA was transferred to a nylon membrane (Biodyne A) and digoxige Using a probe labeled with nin-11-dUTP, the manufacturer (DIG DNA   labeling and detection kit, Boehring er Mannheim) according to the recommended conditions. Detected.Example 1 Isolation of cDNA encoding GRAB protein   Yeast two-hybrid method (Fields and Song, 1989; Field) , 1993) using a actively growing cDNA library. It was constructed from mRNA prepared from wheat cell suspension culture. Screening is Gal 4 was performed using WDV Rep A fused to the DNA binding domain. Yes Unexpectedly large number of cDNA clones co-transformed from selective medium (-his, + 3AT) It was able to grow as a body. These emerged during the first six days after transformation Among them, co-transformants grew in the presence of ≧ 20 mM 3AT and showed strong β A stronger interaction was demonstrated based on the ability to produce a -gal signal. part DNA sequence analysis suggests different clones derived from restriction enzyme analysis Nevertheless, a group of 7 cDNA clones whose 5 'sequences are significantly related Was found to exist. Due to its ability to interact with WDV RepA The protein encoded by this group of cDNA clones is GRAB (Ge minivirusRepA  (Binding) protein. Two GRAB proteins, GRAB1 and GRAB2, are described herein.   Each cloned cDNA is resistant to WDV RepA in yeast. It encoded a tightly bound protein. GRAB-1 and GRAB-2 c The DNA clones are approximately 1.1 kbp in length, each having a putative ATG translation start site. It contained one reading frame with a place. Complete cDNA of two GRAB proteins The sequence and deduced amino acid sequence are shown in the sequence listing as SEQ ID NOS: 9-12. Isolation The clone obtained is the first putative methionine with good consensus with the translation initiation sequence. It contains the full-length coding region together with the peripheral sequence of the protein.   Focus on some by amino acid analysis of GRAB1 and GRAB2 proteins The characteristics that should be clarified. First, the two proteins have -170 N-terminal residues , A high degree of homology (58%) Despite being detected, there is no association at the C-terminal part. Interesting Unfortunately, the distribution of charged residues is not irregular. GRAB1 and GRAB2 unique C-terminal domain has 19% and 15% negatively charged residues (D, E), respectively. But they contain a high proportion of their related and charged residues (30% each) And 33%) N-terminal domains were positively charged amino acids (R, K, H; 1 each, respectively). (8% and 20%).   Furthermore, each of GRAB1 and GRAB2 is encoded by Northern analysis. The presence of an mRNA of the expected size that may be possible was revealed. Both m RNA is present in small amounts in cultured wheat cells and in differentiated cell types, ie, roots and leaves, Even less.Example 2 N-terminus of GRAB protein mediates binding to WDV RepA   Identification of GRAB protein region involved in complex formation with WDV RepA To do so, a series of deletions were constructed and in yeast they The ability to interact with the epA protein was analyzed. Most (GRAB1 Or all (in GRAB2) C-terminal domains are deleted. B-RepA binding did not decrease (FIG. 2). Deletion with only the N-terminal 149 residues Even the defective GRAB2 protein retained significant RepA binding ability (FIG. 2). . In contrast, the ratio of GRAB1 (80 amino acids) or GRAB2 (66 amino acids) The interaction was completely abolished by the relatively small N-terminal deletion (FIG. 2). Therefore, N-terminal domain present in both proteins forms a complex with WDV RepA The conclusion is that you are granting abilities. Furthermore, the N-terminal region of GRAB protein Most of the region contributes the most to complex formation with WDV RepA Became clear.Example 3 C-terminal domain of WDV RepA mediates interaction with GRAB protein You.   Similar deletion studies have shown that the WDV RebA protein Was performed to identify sequences involved in the binding of. As shown in FIG. Also interacts with GRAB protein by most deletions in the N-terminal half of Its ability did not decrease. However, the C-terminal 37 amino acid residues of RepA Is deleted completely, the binding to both GRAB1 and GRAB2 is completely destroyed. (FIG. 3), which indicates that this small domain of RepA is critical for binding. Group. Between GRAB and WDV RepA protein Interactions were also analyzed, splicin of the same mRNA encoding RepA Other early WDV tampers produced from those after post-logging (Schalk et al., 1989). Quality. Thus, the N-terminal 210 residues of both RepA and Rep are identical, The two viral proteins have different C-terminal domains. WDV Rep Consistent with the theory that the C-terminus of A is involved in binding to GRAB, WDV Rep failed to form a complex with GRAB. WDV RepA and Data on the difference in binding of Rem and Rep to ZmRb1 (Xie et al., 1997) Together, these results indicate that RepA is an intracellular environment suitable for viral replication. WDV protein seems to be involved in affecting cell physiology in order to It strongly suggests that   To confirm and develop the results of the yeast two-hybrid interaction, A pull-down experiment was performed to evaluate the interaction using the prepared protein . Equal amounts of purified GST-RepA (0.2 μg) and in vitro translation (IVT) After incubating GST-GRAB1 or GST-GRAB2 ,³⁵Glutathione-agarose beads And collected (FIG. 4). Similar results were obtained for GST-GRAB1 and GST- It was obtained using GRAB2 as well as IVT WDV RepA protein (Fig. 4). Thus, the interaction between GRAB protein and geminivirus RepA Can also occur without the presence of other cellular proteins. Was.Example 4 GRAB mRNA expression is restricted to only a few cells of the root and embryo   Regarding the functions that GRAB protein can have in cells, In order to obtain such knowledge, their in situ hybridization The expression distribution was analyzed. Northern analysis shows GRAB transcripts are not very abundant (See FIG. 1). GRAB mRNA expression in root meristems It appears to be limited to a small number of cells. Similar mottle pattern is characteristic of S phase cells A histone H4 transcript was also observed. In particular, GRAB1 expression is It is restricted to some cells in the central column and is substantially absent in superficial or epidermal cells. Was not there. GRAB1 mRNA is also detected in some root cap progenitor cells Was done. A corresponding condition was detected in developing embryos.   Combining our GRAB expression pattern analysis under different growth conditions, GRAB1 in response to changes in growth signals from a subset of cells in culture And GRAB2 mRNA levels are elevated, which is Conclusion. Furthermore, it relates to the control of cell proliferation and / or differentiation. Very early, which can be part of the transduction pathway associated with exogenous signals GRAB proteins may play different roles as part of the response To reinforce the theory.   Accordingly, RepA, an Rb binding protein of WDV, a member of the genus of plant geminiviruses, A group of plant proteins was identified based on their ability to form complexes with proteins. Was. Based on the database search, both GRAB1 and GRAB2 are known Is not homologous to any protein, and thus the isolated cDNA has never been Encoded an unidentified protein. However, this study suggests that In the N-terminal region, it was revealed that they are related in terms of the primary sequence. Using the amino acid sequence of GRAB1 or GRAB2, these proteins Results with significant homology to some plant proteins of unknown function It has been shown. Interestingly, the first observations were made in the GRAB proteins themselves. Similarly, homology was limited to the first 150-170 residues at the N-terminus. (FIG. 10A). Shown in FIG. 10A is a tank that would otherwise be irrelevant. Corresponds to park quality. First, in yeast, cauliflower mosaic virus (ca) uliflower Mosaic Virus (CAMV) promoter Two Arabidopsis thaliana (Arabidop) isolated by their ability to activate sis) cDNA clones, ATAF1 and ATAF2 (H. Hirt, personal communication) . Second, the SENU5C DNA isolated in a study on tomato leaf aging ( Genbank ACC. No. ). Third, Petunia N o A product of the Apical Meristem (nam) gene, Necessary for proper tissue growth and determining meristem placement (Souer et al., 1) 996).Example 5 GRAB protein induces necrosis phenotype   The first step to gain insight into the role of GRAB protein in cells And we have plant N. GRAB1 or GRAB2 in benthamiana The effect of either expression was examined. For this purpose, without chromosome effects [6] Potato virus X ensures high level expression in whole tissues at any time An expression vector derived from (potato virus X) (PVX) was used. This system has been successfully used to analyze the effects of transient expression of foreign proteins. [18,31,32].   In vitro transcribed PVX RNA was isolated from plant N. contact with benthamiana Upon seeding, the appearance of typical symptoms, clearly appearing 10 days after inoculation (dpi), was false 9 shows efficient amplification of the PVX expression vector compared to inoculated plants. PVX -Plants inoculated with the GRAB1 construct have high levels of the GRAB1 expression vector. By replication, the entire tissue is infected by 12 dpi. This means that PVX in leaves Comparing the concentration of GRAB1 RNA with that in plants infected with wild-type PVX Confirmed by Interestingly, all those expressing GRAB1 at high levels All plants are already degraded at 12 dpi, as evidenced by old leaf morphology The process showed a tendency to proceed. In addition, protruding necrotic areas, especially at 28 dpi Occasionally, it appeared near the base of the plant growing in the air. At this stage Significant loss of leaf and root growth was also observed. The effects observed throughout the plant In order to investigate whether the expression was due to expression of the full-length GRAB1 protein, We express GRAB1 mRNA with a frameshift mutation near the N-terminus Plants were inoculated with the PVX construct. Therefore, PVX-GRAB1^FSIs the N-terminal A protein that retains the conserved regions (N1 and N2) and is defective at 159 residues Having a frameshift mutation at amino acid position 78 that is also capable of producing Holds NA. GRAB1^FsExpression of full-length GRAB1 protein Did not produce any of the effects observed in the growing plants.   A similar study was performed on the GRAB2 construct. PVX-GRAB2 construct A delay was observed in the rate of amplification of the PVX vector in plants inoculated with. this thing Inhibits high level expression of GRAB2 at 12 dpi and Had a morphology similar to mock-inoculated plants. However, when the time has passed after inoculation, , PVX vector accumulated at high levels. Interestingly, these GRAB2 The expressing plants exhibited milder symptoms than plants infected with wild-type PVX. GRA None exhibited the degeneration process observed in B1-expressing plants. We are G The effect of expression of the defective form of RAB2 was also examined. In this case, PVX-GRAB2^Fs Produces GRAB2 cDNA having a frameshift mutation at amino acid position 33, Thus, 50 amino acids in length retaining most of the N-terminal (N1) homology region Produces a defective GRAB2 protein. PVX-GRAB2^FsInoculate the construct The isolated plants have high levels of PVX and GRAB^FsIncluding RNA. Defective GRAB Considering both the results of protein expression, the induction and induction of necrotic regions by GRAB1 Delay in the onset of symptoms caused by GRAB2 and GRAB2 depends on the expression of full-length protein Induced, and such specific effects are the GRAB1 and GRAB2 proteins It is strongly suggested that each unique C-terminal domain may be mediated by .   The alignment shown in FIG. 4 shows that highly retained of these related proteins Revealed the existence of several amino acid motifs. Therefore, we are active N-terminal domains (N1 to N5) that can also correspond to critical regions Note the appearance of the five motifs in parentheses. In them, the two main N-terminal Chiefs (N1 and N2) have a net negative charge, while others are positively charged Is shown. Based on our deletion analysis, N5 is not completely necessary. And N1 seems to have contributed significantly (Figure 3), but all these models The chief is required for efficient interaction with WDV RepA. C-terminal domain Is unique in the primary sequence to each protein in this family. Nevertheless, they share the property of having a high net negative charge (15-20% residual). The group is D or E). This indicates that both GRAB proteins and two ATAs It is particularly evident in the F component. The two GRAs reported herein The B protein, as shown in other examples, especially in GRAB2 In their C-terminal domain, which can also be involved in transcriptional regulation, Q-rich Have a domain. In addition, Arabidopsis and Arabidopsis Multiple parts c derived from ESTs randomly sequenced from rice DNA sequence is also extracted by search using the N-terminus of GRAB protein as search condition (Not disclosed). Surprisingly, protein sequences from yeast or animals Not extracted in search.   One notable property of this group of proteins resides in each molecular species The number of components with an associated N-terminal domain And For example, at least five components are associated with NAM (Souer et al. 1996), and seven components are associated with GRAB (this study). That's it Whether they actually have different functions. Question is presented. One possibility is that some NAM-related proteins Already proposed are different parts of the plant during post-embryonic development Has a redundant function (Souer et al., 1996).   Consider the consequences of GRAB overexpression in the appearance of symptoms in PVX infected plants This is despite the fact that these virus genera use completely different propagation methods. So far, unknown routes, affected by GRAB, have WDV and And PVX. Another possibility is GRAB excess Expression either directly or indirectly triggers a common defense pathway, or simply It is also possible to guide the intracellular environment that protects cells against different types of infection. Example 6 Overexpression of GRAB protein in cultured wheat cells inhibits WDV DNA replication Harm   GRAB tan isolated based on interaction with WDV RepA protein To further investigate the putative functions of the protein, we examined the geminivirus The effect of GRAB protein expression on production was examined. This analysis is viral Useful for evaluating the effect of plant Rb (ZmRb1) on DNA replication. [47]. Therefore, using a similar method, we The cultured cells were co-transfected with the following plasmid combinations; (i) use GR under the control of the 35S CaMV promoter that is active in A first plasmid expressing either AB1 or GRAB2 (ii) Necessary for efficient viral DNA replication under the control of the 5S CaMV promoter A second plasmid expressing a WDV protein (RepA and Rep), and (Iii) Effective when viral proteins are provided in trans Capable of replicating [35,47] used to monitor WDV DNA replication A third plasmid (pWori [43, 46]) which is a derivative of pWori [43, 46]. ΔΔ). Expression of either GRAB1 or GRAB2 is determined by WD in cultured wheat cells. Strongly inhibits V DNA replication, GRAB2 shows a stronger effect. These results Suggests that WDV DNA replication is affected by GRAB protein under cell culture conditions. It indicates that you will receive it.

[Procedure for Amendment] Article 184-8, Paragraph 1 of the Patent Act [Date of Submission] August 5, 1999 (1999.8.5) [Contents of Amendment] Claims 1. A method of controlling the plant cell cycle by increasing or decreasing the binding capacity of a protein or peptide capable of binding to geminivirus RepA or the level of plant cells, wherein the protein or peptide has SEQ ID NO: 6 or SEQ ID NO: 8 having at least 70% homology with the amino acid sequence of SEQ ID NO: 8 and the method encodes the following nucleic acid (a) protein or peptide in plant cells: (b) antisense nucleic acid (a) encoding protein or peptide (C) suppressing the expression of a natural nucleic acid encoding the protein or peptide by gene suppression coexpression, or (d) binding a protein or peptide that binds to the polypeptide having the sequence of SEQ ID NO: 6 or SEQ ID NO: 8. Said method comprising inserting a code. 2. Controlling the plant cell cycle comprises one or more of controlling plant cell or plant virus proliferation and / or replication, plant cell differentiation, growth and / or aging, The method of claim 1. 3. The method according to any one of claims 1 to 2, wherein the protein or peptide comprises an amino acid sequence that is at least 70% homologous to the sequence of SEQ ID NO: 3 or SEQ ID NO: 4. 4. The method according to any one of claims 1 to 3, comprising overproducing or underproducing a protein or peptide in a plant cell. 5. 5. The method according to claim 1, wherein the nucleic acid is in the form of a recombinant nucleic acid. 6. It can also support the expression of a protein or peptide comprising an amino acid sequence having at least 70% homology with the sequence of SEQ ID NO: 6 or SEQ ID NO: 8, or the production of antisense RNA of a nucleic acid encoding the protein or peptide. 6. The method of claim 5, wherein said sequence is located downstream of a promoter. 7. The method according to any one of claims 1 to 6, wherein the protein or peptide is produced ectopically. 8. 8. The method of claim 7, wherein the protein or peptide is produced in a vegetative or stem tissue. 9. Promoting or inhibiting aging in plant cells, including increasing or decreasing plant cell levels of a protein or peptide comprising a sequence having at least 50% homology to the sequence of SEQ ID NO: 10 The method according to any one of claims 1 to 8, characterized in that: 10. The method according to claim 1, wherein the binding agent is Geminivirus RepA or N-terminal-deficient Geminivirus RepA containing C-terminal 228-264 amino acids. 11. Enriched, isolated, characterized in that it has at least 70% amino acid sequence homology to the sequence of SEQ ID NO: 6 or SEQ ID NO: 8 and is also capable of binding to geminivirus RepA A protein or peptide in the form of cells and / or recombinantly produced. 12. 12. The protein or peptide according to claim 11, which has an N-terminal sequence having 90% or higher homology with the sequence of SEQ ID NO: 6 or SEQ ID NO: 8. 13. 13. The protein or peptide of claim 11 or 12, comprising a functional variant having the amino acid sequence of SEQ ID NO: 10 or 12 or an amino acid sequence that is at least 70% homologous to said sequence. 14． (A) encoding a protein or peptide comprising an amino acid sequence that is at least 70% homologous to the sequence of SEQ ID NO: 6 or SEQ ID NO: 8; (b) antisense to a nucleic acid encoding the protein or peptide; or (c) An enriched, isolated, cell-free and / or recombinant nucleic acid, characterized in that expression of a natural nucleic acid encoding a protein or peptide is suppressed by gene suppression co-expression. 15. A DNA or RNA polynucleotide comprising one or more of SEQ ID NOs: 1, 2, 5, 7, 9 or 11, or a sequence having at least 70% homology thereto. 14. 14 nucleic acids A method for producing the protein or peptide according to any one of claims 11 to 13, which comprises expressing the DNA or RNA according to claim 14 or 15. 17． An enriched, isolated, cell-free and / or recombinant nucleic acid encoding an N-terminally deleted geminivirus RepA comprising the C-terminal 228-264 amino acids of the RepA protein. 18. A nucleic acid probe comprising an oligonucleotide or polynucleotide that is 15 or more contiguous bases of the sequence of SEQ ID NO: 5, 7, 9 or 11, or a complementary sequence thereof, or a corresponding RNA sequence. Or a primer. 19. 19. The nucleic acid probe according to claim 18, wherein the nucleic acid probe comprises the adjacent 30 bases or the complete sequence of SEQ ID NO: 5, 7, 9 or 11. 20. A nucleic acid transformation vector comprising the DNA or RNA according to claim 14 or 15. 21. 21. A method for producing a transformed cell comprising the nucleic acid according to any one of claims 1 to 20, wherein the method comprises introducing the nucleic acid into a cell by a vector or alone. . 22. 22. The method according to claim 21, wherein the nucleic acid is introduced directly by electroporation or particle bombardment. 23. A cell comprising the recombinant nucleic acid as described or claimed in any one of claims 1 to 20. 24. A transgenic plant or part thereof comprising the cell of claim 23. 25. Plasmids containing DNA of the sequence encoding the protein of SEQ ID NO: 10 or 12 described herein, deposited under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms of 1977; It has been deposited on November 11 with the Co leccion Espanola de Cultivos Tipo under accession number CECT4889 or accession number 4890. 26. A method of controlling plant cell or plant virus replication by increasing or decreasing the intracellular level or binding capacity of a protein or peptide that is also capable of binding to a geminivirus RepA, wherein the protein or peptide has SEQ ID NO: 3 or SEQ ID NO: 4 has an amino acid sequence that is at least 70% homologous to the sequence, and the method encodes the following nucleic acid in a plant cell (a) a protein or peptide (b) a nucleic acid encoding the protein or peptide (a) Or c) inserting a gene that suppresses the expression of a natural nucleic acid encoding a protein or peptide by gene suppression co-expression. 27. 27. The method of claim 26, wherein the protein or peptide comprises an amino acid sequence having at least 90% sequence homology to SEQ ID NO: 3 or SEQ ID NO: 4. 28. 28. The method of any one of claims 26 or 27, comprising overproducing or underproducing a protein or peptide in a plant cell. 29. 29. The method according to any one of claims 26 to 28, wherein the nucleic acid comprises a sequence encoding the protein or peptide in recombinant form. 30. 30. The method of claim 29, wherein said sequence is located downstream of a promoter capable of supporting the expression of a protein or peptide or of producing an antisense RNA to a nucleic acid sequence. 31. 31. The method according to any one of claims 26 to 30, wherein the protein or peptide is produced ectopically. 32. 32. The method of claim 31, wherein the protein or peptide is produced in vegetative or stem tissue.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/21 C12P 21/02 C5 / 10 C12Q 1/68 A C12P 21/02 C12N 15/00 ZNAA C12Q 1/68 5/00 A (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE ), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, C , CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, GH, GM, GW, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL , TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW. Bio Rohia Molexral

Claims (1)

[Claims] 1. GRAB (Geminivirus RepA Bi) in plant cells nding) protein or peptide levels, or geminivirus Re A plant cell cycle comprising increasing or decreasing pA binding capacity How to control. 2. Propagation and / or replication of plant cells or plant viruses, differentiation and growth of plant cells And / or plant cells containing one or more of controlling aging. The method of claim 1, wherein the method is controlling. 3. The GRAB protein or peptide is domain N1 shown in FIG. 4 herein. , N2, N3, N4 and N5. Method. 4. GRAB protein or peptide binds to viral RepA protein 4. The N-terminal first 150 amino acids which can also be The method according to any one of the preceding claims. 5. The GRAB protein or peptide has SEQ ID NO: 3 or Can bind to the amino acid sequence of 4 or the geminivirus RepA. 5. A method according to claim 1, wherein said functional variant comprises The method of paragraph 1. 6. Overproduction or underproduction of protein or peptide in plant cells 6. The method according to any one of claims 1 to 5, comprising: 7. Add a drug that binds to GRAB protein or peptide 7. A method comprising reducing GRAB binding activity. The method according to any one of the preceding claims. 8. The GRAB protein or peptide has at least the sequence of SEQ ID NO: 3 or 4 8. The method according to claim 1, which has 70% amino acid sequence homology. Item 1. 9. Encodes the corresponding GRAB protein or peptide in plant cells The presence of a nucleotide or its antisense nucleotide. Item 9. The method according to any one of Items 1 to 8. 10. The nucleotide comprises a sequence encoding a GRAB protein or peptide. 10. The method of claim 9 in the form of a recombinant nucleic acid. 11. The sequence is GRAB protein or peptide expression or antisense R 11. The method of claim 10, wherein the method is located downstream of a promoter that supports the production of NA. 12. Characterized in that the protein or peptide is ectopically added or produced The method according to claim 1, wherein 13. 13. The method of claim 12, wherein the tissue is a nutritional or stem tissue. . 14． GRAB protein or peptide or functional mutation thereof in cells Including expressing proteins or peptides that can also bind to the body 14. The method according to any one of claims 1 to 13. 15. Suppresses the expression of natural GRAB by gene suppression co-expression or antisense method 15. A method according to any one of the preceding claims, comprising controlling . 16. Sequence of SEQ ID NO: 10 or plant N. in bentamiana GRAB proteins, including functional variants thereof that are also capable of inducing aging, or Involves increasing or decreasing the level or binding activity of a peptide, in a plant cell In promoting or inhibiting aging at, in a plant cell, The method according to any one of claims 1 to 15. 17． RepA, N-terminal-deleted RepA or one of these functionalities 17. The method of claim 16, comprising inserting a nucleic acid encoding the variant. 18. It is not any of SENU, NAM, ATAF1 or ATAF2 Conditional, GRAB protein or peptide itself, or enriched, isolated Cell-free and / or recombinantly produced forms. 19. GRAB1 or GRAB2 as described herein or a conservative arrangement thereof Has 90% or higher homology to the N-terminal first 150 amino acids of the transmutant 19. The protein or peptide according to claim 18, wherein the protein or peptide has an N-terminal sequence. 20. The amino acid sequence of SEQ ID NO: 3 or 4 described herein, or Has an amino acid sequence having at least 70% amino acid sequence homology to the sequence; Functional mutants capable of binding to one geminivirus RepA The GRAB protein or peptide according to claim 18, characterized by comprising: 21. SEQ ID NO: 6 or 8 or at least 70% of the sequence Claims: A functional variant having a homologous amino acid sequence. Item 21. The protein or peptide according to Item 20. 22. SEQ ID NO: 10 or 12, or at least 70 % Of functional variants having an amino acid sequence having homology 22. The protein or peptide of claim 21. 23. Copy full length amino acid sequence of SENU, NAM, ATAF1 or ATAF2 A nucleus encoding a GRAB protein or peptide, provided that it is not loaded The acid or antisense nucleic acid itself, or its concentrated, isolated, cell-free and / or Or a form produced by a recombinant. 24. The N-terminal first 200 amino acids of GRAB1 or GRAB2 described herein GRAB tan having an N-terminal sequence having at least 60% homology to the amino acid sequence Recombinant DNA or cRNA (mRNA) encoding expression of a protein or peptide The nucleic acid according to claim 23, which is in the form of: 25. SEQ ID NO: 1, 2, 5, 7, 9 or 11, or a functional variant thereof DNA or RNA polynucleotide containing one or more of the following: 25. The nucleic acid of claim 24, wherein the nucleic acid is a feature. 26. Expression of the DNA or RNA according to claim 24 or 25 is included. A protein or a protein according to any one of claims 18 to 23, characterized in that: Is a method for producing a peptide. 27. The DNA sequence identified as SEQ ID NO: 5, 7, 9 or 11 herein or Are the sequences complementary to them or 15 or more contiguous of the corresponding RNA sequences. Oligonucleotides or polynucleotides that are complementary to the bases And a nucleic acid probe or primer. 28. The DNA according to any one of claims 9 to 17 or 23 to 25. Alternatively, a nucleic acid transformation vector comprising RNA. 29. Claim or description in any one of claims 9 to 17 or 23 to 25 A method for producing a transformed cell containing the nucleic acid to be prepared, comprising the steps of: The above method, which comprises introducing into a cell alone or alone. 30. The nucleic acid is directly introduced by electroporation or particle bombardment. 30. The method of claim 29. 31. Claim or claim according to any one of claims 9 to 17 or 23 to 25 A cell containing the recombinant nucleic acid to be obtained. 32. A transgenic plant comprising the cell of claim 31, or a part thereof. 33. Articles of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms 1977 GRAB proteins GRAB1 and GR as described herein, deposited under Plasmids containing DNA encoding the expression of AB2; these are One day in Coleccion Espanola de Cultivos Ti and has been deposited under the accession number CECT4889 or accession number 4890.