NZ500529A - Modifying GRAB1 and or GRAB2 (Geminivirus RepA Binding) to affect cell plant cycle using antisense sequences - Google Patents

Abstract

A method of controlling plant cell and plant virus growth and/or replication, plant cell cycle, differentiation, development and/or senescence is provided characterised in that it comprises increasing or decreasing the levels or binding capabilities of GRAB (Geminivirus RepA Binding) proteins other than Rb (Retinoblastoma) proteins within plant cells.

Description

PLANT GRAB PROTEINS The present invention relates to methods of controlling plant cell cycle, particularly for the purpose of controlling plant cell and plant virus growth and/or replication, differentiation, development and/or scenescence, to use of previously 5 unidentified and/or unisolated proteins and/or nucleic acids in such methods, to use of known proteins and nucleic acids of previously unknown native function in such methods, to the unidentified and/or unisolated proteins and nucleic acids pei se and in enriched, isolated, cell free and/or recombinant form, and to plants comprising such recombinant nucleic acids 10 It has been well documented that successful completion of viral replication cycles within the infected cell usually requires the participation of cellular factors This is particularly evident in the case of viruses with small genomes that encode just a few proteins For example, animal DNA tumor viruses use the cellular machinery for their transcriptional and DNA replication processes In addition one or more virally-encoded 15 proteins have evolved that directly impinge on the infected cell physiology to create a cellular environment appropriate for viral replication One typical example is that of the oncoproteins encoded by animal DNA tumor viruses, i e , SV40 T antigen, adenovirus El A or human papilloma virus E7 proteins, which activate cell cycle in the infected cell by interfering with the retinoblastoma pathway (26, 28, 45) A similar strategy seems to have evolved in plant geminiviruses, a unique group of plant DNA viruses The geminivirus genome consists of 1 or 2 small (2 6-3 0 kb) circular single-stranded DNA molecules, depending on the subgroups (11, 24) Wheat dwarf geminivirus (WDV) belongs to subgroup I whose members have the smallest genome, a single ssDNA molecule, 2750 nucleotides in length, which encodes only a 25 few proteins Among them, RepA (also called CI) and Rep (also called CI C2) are the only WDV proteins required for viral transcription and replication (24) RepA is translated from the single transcript produced under the control of the complementary-sense promoter After a splicing event of this mRN A, the Rep protein is produced (37) WDV Rep, absolutely required for viral DNA replication and this is homologous to the 30 Rep proteins of all geminiviruses Geminivirus Rep has been shown to have DNA nicking-joining activity in vitro, origin-recognition ability and ATPase activity However, RepA protein is unique to the WDV geminivirus subgroup and has been Printed from Mimosa implicated in modulation of Rep activity, binding to plant retinoblastoma (Rb) protein (45, 46) and stimulation of virion-sense gene expression In addition, we have recently shown that in WDV, the Rb-binding protein (RepA) and the initiator protein (Rep) seem to play coordinate roles during viral DNA replication 5 Geminivirus DNA replication occurs in the nucleus of the infected cells and, due to the lack of replicative enzymes encoded by the viral genome, it requires S-phase functions Consistent with this is the accumulation of replicative intermediates in S-phase nuclei (1) Geminiviruses normally infect non-proliferating cells but, interestingly, they induce the appearance of cellular proteins typical of S-phase, such as 10 proliferating cell nuclear antigen (PCNA) (29) which is otherwise undetectable in non-prohferating cells Subgroup I geminiviruses such as WDV encode proteins containing a LXCXE motif in the RepA protein, which mediates its ability to interact with Rb, involved in the mechanism by which geminiviruses impinge on the cell cycle activation circuit (45) These observations served the basis to isolate a full-length cDNA encoding 15 ZmRbl, a plant Rb protein, which could act in plant cells as a regulator of the Gl/S transit (46) Consistent with this function, overexpression of plant Rb (as well as human Rb) in cultured plant cells significantly inhibits WDV DNA replication (45, 46) Therefore, it seems that at least one of the mechanisms used by geminiviruses to favour DNA replication is the triggering of an S-phase in the infected cell by sequestering Rb 20 and, consequently, by interfering with its negative cell growth activity Regulation of cell cycle, growth and differentiation in plants is the result of a complex interplay of regulators whose activity is the response to a wide variety of signals such as hormones, nutrient availability or environmental conditions (20, 39) For example, a rapid increase in the levels of D-type cyclin mRNAs occurs in response 25 to sucrose or cytokinin treatment (41) while those of the cyclin-dependent kinase (cdc2) mRNAs depends on the presence of auxin The molecular nature of other plant cell cycle regulators as well as their function in connection to cell growth and differentiation remains largely unknown Therefore, it is important to identify the cellular factors involved in these control pathways to elucidate the molecular mechanisms governing 30 the response of plant cells to growth signals Due to the absolute requirement for cellular factors to complete geminivirus replication, the present inventors postulated that geminiviruses might modulate cell Printed from Mimosa 500529 physiology by mechanisms other that the interference with the Rb pathway and that such effect might be the conscquence of the targeting of. so far. unknown cellular factors by the geminivirus proteins They have used an experimental strategy to identify proteins that interact functionally with RepA. the Rb-binding protein of WDV, and now have provided several cDNA clones encoding previously unidentified proteins and determined their function Based on amino acid sequence analysis, these proteins have been determined to share a common N-terminal domain, required for interaction with the viral RepA protein, while their C-terminal domains are unique to each of them They may represent members, likely with transcriptional regulatory activity, of a much larger family of proteins related to regulators of hormone and nutnent response, meristem development and plant senescence In general terms, the present invention provides a method of controlling a plant cell cycle characterised in that it comprises increasing or decreasing the levels of GRAB (Geminivirus RepA Binding) proteins or peptides or increasing or decreasing the binding capabilities of GRAB proteins or peptides within plant cells Such control, infer aha. allows control of plant cell growth and/or replication, plant virus growth within cells, plant cell differentiation, development and/or scenescence. It will be understood that such proteins and peptides are other than Rb (Retinoblastoma) proteins, being particularly those described herein below with regard to the sequence listing and their functional variants.

Therefore, m a first aspect the present invention provides a method of controlling a plant cell cycle by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA wherein the protein or peptide comprises an ammo acid sequence of homology of at least 70% to that of SEQ ID No 6 or SEQ ID No 8 and the method comprises incorporating a nucleic acid into the plant cell which INTELLECTUAL PROPERTY OFFICE OF N.Z. (followed by page 3 a) 2 4 AUG 2001 received (a) encodes for the protein or peptide, (b) is antisense to the nucleic acid (a) encoding the protein or peptide, (c) downregulates expression of native nucleic acid encoding the protein or peptide by gene silencing coexpression or (d) encodes for a protein or peptide which binds to a polypeptide sequence SEQ ID No 6 or SEQ ID No 8.

Increasing or decreasing the levels of GRAB proteins peptides may be achieved by overproducing or underproducing the protein or peptide in a plant cell, that is, as compared to the normal level of production of the protein or peptide in the cell Decrease of native GRAB binding activity may be achieved eg. by application of a GRAB proetin or peptide binding agent, eg. such as WDV RepA or a functional part or variant thereof In a further aspect, therefore, the present invention provides a method of producing a protein or a peptide of the invention wherein it comprises expressing DNA or RNA as described herein.

Particularly the GRAB proteins or peptides for use in this method are those comprising an ammo acid sequence SEQ ID No 2 or 4 as shown herein or a functional variant thereof that is capable of binding Geminivirus RepA Preferred proteins or peptides have amino acid sequence homology of at least 70% with that of SEQ ID No 2 or 4, more preferably at least 90% and most preferably at least 95% Particularly the -3a- (followed by page 4) 50 0 52 INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received GRAB proteins are those in which the first 200 N-terminal amino acids are capable of binding to viral RepA protein, more preferably the first 170 N-terminal amino acids are so capable and most preferably the first 150 amino acids These methods may comprise the direct application of such GRAB proteins or 5 peptides to plant cells or whole plants, but more conveniently will comprise use of the corresponding GRAB protein or peptide encoding or antisense nucleotides, le nucleic acids placed within the cells, particularly by use of recombinant nucleic acid, eg recombinant DNA comprising a GRAB protein or peptide encoding sequence, positioned in the cell behind a promotor capable of supporting GRAB protein or peptide 10 expression or production of antisense RNA GRAB protein encoding nucleic acids can be used to produce GRAB where required, eg ectopically in a tissue where it is not normally expressed, eg vegetative tissue or stem tissue such as xylem or phloem An alternative strategy might comprise expressing a GRAB protein binding peptide, eg Geminivirus RepA, a functional variant thereof or a GRAB protein binding portion 15 thereof, such as the C-terminal portion Such a peptide would bind to native GRAB proteins and inhibit their activity It will be realised that any expression of RepA, and particularly only a GRAB protein binding part thereof such as a RepA with a truncated N-terminal, in a transgenic plant other than that produce by a whole intact genimivirus would be novel A RepA encoding cDNA in functional relationship with a promoter or 20 other regulatory sequence in a DNA or RNA vector or DNA construct would be particularly useful for such purpose It will be realised that a most effective method of delivering proteins and peptides of the invention to plant cells is by expressing nucleic acid encoding them m situ Such method is conventionally carried out by incorporating oligonucleotides or 25 polynucleotides,having sequences encoding the peptide or protein, into the plant cell DNA Such nucleotides can also be used to downregulate native GRAB expression by gene silencing coexpression (6) or through antisense strategy By use of mutagenesis techniques, eg such as SDM, the nucleotides of the invention may be designed and produced to encode proteins and peptides which are functional variants or otherwise 30 overactivated or inactivated, eg with respect to binding, of the invention It will be realised by those skilled in the art that suitable promotors may be active continuously or may be inducible It will be appreciated by those skilled in the art Printed from Mimosa that inducible promotors will have advantage in so far as they are capable of providing alteration of the aforesaid GRAB protein activity only when required, eg when viral infection is threatened, or when the plant would otherwise be particularly vulnerable, or at a particular stage of cell development Such promoters may for example be induced 5 by environmental conditions such as stress inducing conditions, eg reduced water availability caused by drought or freezing, or by complex entities such as plant hormones, eg plant to plant signalling stress hormones, or by simpler entities such as particular cations or anions eg metal cations No particular limitation on the type of promoter to be used is envisoned 10 Numerous specific examples of methods used to produce transgenic plants by the insertion of cDNA in conjunction with suitable regulatory sequences will be known to those skilled in the art For example, plant transformation vectors have been described by Denecke et al (1992) EMBO J II, 2345-2355 and their further use to produce transgenic plants producing trehalose described in US Patent Application Serial 15 No 08/290,301 EP 0339009 B1 and US 5250515 describe strategies for inserting heterologous genes into plants (see columns 8 to 26 of US 5250515) Electroporation of pollen to produce both transgenic monocotyledonous and dicotyledonous plants is described in US 5629183, US 7530485 and US 7350356 Further details may be found in reference works such as Recombinant Gene Expression Protocols (1997) Edit Rocky 20 S Tuan Humana Press ISBN 0-89603-333-3, 0-89603-480-1 It will be realised that no particular limitation on the type of transgenic plant to be provided is envisaged, all classes of plant, monocot or dicot, may be produced in transgenic form incorporating the nucleic acid of the invention such that GRAB activity in the plant is altered, constituitively, ectopically or temporally 25 A preferred embodiment of the first aspect of the invention provides a method of producing or inhibiting senescence in a plant cell comprising increasing or decreasing the levels or activity of a GRAB protein or peptide, particularly a GRAB1 protein of SEQ ID No 10 or a functional variant therof capable of inducing senescence in N.bentamianct plants, in a plant cell Again such increase or decrease is most effectively 30 achieved through incorporation of nucleic acid, in this case of SEQ ID No 9, or a functional variant thereof, or may be achieved by use of RepA encoding DNA Printed from Mimosa a In general terms, the present invention provides novel GRAB proteins or peptides per .se and in enriched, isolated, cell free and/or rccombinantly produced form Such proteins or peptides may be naturally occurring or may be conservatively substituted homologucs thereof as referred to below Preferred proteins and peptides have an N-terminal sequence having, 90% or more homology to the N-terminal 200 (more preferably to the first 170 and most preferably the first 150) amino acids of GRAB1 or GRAB2 described herein, more preferably 95% or more and most preferably 98% or more. Preferred peptides comprise the sequence of the first 150 to 200 amino acids of either of these sequences or conservatively substituted variants thereof Preferred peptides comprise such a sequence without the C-tcrminal sequence of SENU, NAM, ATAFl or ATAF 2 shown in Figure 4 attached hereto Particularly the GRAB proteins and peptides are those comprising an amino acid sequence SEQ ID No 3 or 4 as shown herein or a functional variant thereof that is capable of binding Geminivirus RepA and have amino acid sequence homology of at least 70% with that of SEQ ID No 3 or 4, more preferably at least 90% and most preferably at least 98% More preferably they comprise SEQ ID No 6 or 8 or such homology limited functional variant thereof and most preferably SEQ ID No 10 or 12 or such homology limited functional variant thereof Where the protein or peptide comprises SEQ ID No 3 or 4 it is not of SENU. NAM, ATAFl or ATAF2 In a still further aspect, the present invention provides a protein or peptide m enriched, isolated, cell free and/or recombinantly produced form wherein it has at least 70% amino acid sequence homology with that of SEQ ID No 6 or SEQ ID No 8 and is capable of binding with Geminivirus RepA.

Therefore, proteins or peptides may be derived from native protein or peptide encoding DNA that has been altered by mutagenic techniques eg using chemical mutagenesis or mutagenic PCR.

Also, m general terms, the present invention provides GRAB protein or peptide encoding and antisense nucleic acid per se and in enriched, isolated, cell free and/or recombinant form Particularly provided is consense and antisense DNA in the form of (followed by page 6a) INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received o 0 individual oligonucleotides and polynucleotides, provided that said DNA does not encode the full amino acid sequence of SENU. NAM, ATAFl or ATAF2 as shown in Figure 4.

Therefore in a yet further aspect, the present invention provides an enriched, isolated, cell free and/or recombinant nucleic acid wherein it (a) encodes for a protem or peptide composing an amino acid sequence of homology of at least 70% to that of SEQ ID No 6 or SEQ ID No 8, (b) is antisense to nucleic acid encoding for that protein or peptide or (c) downregulates expression of native nucleic acid encoding that protem or peptide by gene silencing coexpression.

In another aspect, the present invention provides an enriched, isolated, cell free and/or recombmant nucleic acid which encodes for an N- terminally truncated Geminivirus RepA protem comprising the RepA protein C-terminal ammo acids 228-264.

Specifically provided is nucleic acid, eg m the form of a nucleotides but preferably in the form of recombinant DNA or cRNA (mRNA), that codes for the expression of the GRAB protein having an N-terminal sequence with at least 60% homology with the first 200 N-terminal amino acids of GRAB I or GRAB2 as described - 6a - (followed by page 7) INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received herein , le its first 200 codons having such homology Preferably the homology is at least 75% and most preferably at least 90% Preferred nucleic acid is DNA or RNA comprising of SEQ ID No 1, 2, 5, 7, 9 or 11 or a functional variant thereof having the homology Imitations referred to above 5 More preferred is DNA of SEQ ID No 9 or 11 or a functional variant thereof With respect to the present specification and claims, the following technical terms are used in accordance with the definitions below unless otherwise specified A "functional variant" of a peptide, protein, nucleotide or polynucleotide is a peptide, protein, nucleotide or polynucleotide the amino acid or base sequence of which 10 can be derived from the amino acid or base sequence of the original peptide, protein, nucleotide or polynucleotide by the substitution, deletion and/or addition of one or more ammo acid residues or bases in a way that, in spite of the change in the amino acid or base sequence, the functional variant retains at least a part of at least one of the biological activities of the original peptide, protein, nucelotide or polynucleotide in that 15 is detectable for a person skilled in the art A functional variant is generally at least 50% homologous (l e the amino acid or base sequence of it is 50% identical), but advantageously at least 70% homologous and even more advantageously at least 90% homologous to the native or synthetic sequence from which it can be derived Any functional part of a protein or a variant thereof is also termed functional variant 20 The term "overproducing" is used herein in the most general sense possible A special type of molecule (usually a protein, polypeptide or oligopeptide or an RNA) is said to be "overproduced" in a cell if it is produced at a level significantly and detectably higher (e g 20% higher) than natural level Overproduction of a molecule in a cell can be achieved via both traditional mutation and selection techniques and genetic 25 manipulation methods The term "ectopic expression" is used herein to designate a special realisation of overproduction in the sense that, for example, an ectopically expressed protein is produced at a spatial point of a plant where it is naturally not at all (or not detectably) expressed, that is, said protein or peptide is overproduced at said point 30 • The term 'underproducing' is intended to cover production of peptide, polypeptide, protein or mRNA at a level significantly lower than the natural level (eg 20% or more lower), particularly to undetectable levels Printed from Mimosa The DNA or RNA of the invention may Have a sequence containing degenerate substitutions in the nucleotides of the codons in the sequences encoding for GRAB proteins or peptides, eg GRAB I or GRAB2 , and in which the RNA U's replace the T's of DNA Preferred per se DNAs or RNAs are capablc of hybridising with the 5 polynucleotides encoding for GRAB1 or GRAB2 in conditions of low stringency, being preferably also capable of such hybridisation in conditions of high stringency The terms "conditions of low stringency" and "conditions of high stringency" are of course understood fully by those skilled in the art, but are conveniently exemplified in US 5202257, columns 9 and 10 Where modifications are made they should lead to 10 the expression of a protein with different amino acids in the same class as the corresponding amino acids to these GRAB protein sequences, that is to say, they are conservative substitutions Such substitutions are known to those skilled in the art (see, for example, US 5380712), and are considered only when the protein is active as a GRAB protein 15 Also described is a protein or peptide expressed by the recombinant DNA or RNA referred to in the second aspect above, new proteins or peptides derived from that DNA or RNA and protein or peptide that is produced from native DNA or RNA that has been altered by mutagenic means such as the use of mutagenic polymerase chain reaction primers Methods of producing the 20 proteins or peptides of the invention characterised in that they comprise use of the DNA or RNA of the invention to express them, from cells are also provided in this aspect Described but not claimed are nucleic acid probes and primers complementary to any 15 or more contiguous bases of the DNA sequences identified herein below as SEQ ID No 5, 7, 9 or 11 or complemetary sequences or RNA sequences 25 corresponding thereto, particularly of the first 150 N-terminal coding DNA bases of such sequences These probes and primers in the form of oligonucleotides and polynucleotides may also be used to identify further naturally occuring or synthetically produced GRAB peptides or proteins using eg southern or northern blotting' Oligonucleotides for use as probes conveniently comprise at least 18 30 consecutive bases of the sequences SEQ ID No 5, 7, 9 or II herein, preferably being of 30 to 100 bases long, but may be of any length up to the complete sequence or even longer For use as PCR or LCR primers the oligonucleotide preferably is of 10 to 20 INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received bases long but may be longer Primers should be single stranded but probes may be double stranded ie including complementary sequences Also described but not claimed are vectors comprising DNA or RNA of the invention.

In another aspect, the present invention provides a method for producing transformed cells comprising nucleic acid of the invention comprising introducing said nucleic acid into the cell in vector or free form.

The method for producing transformed cells comprising nucleic acid of the invention may comprise introducing said nucleic acid into the cell directly, eg by electroporation or particle bombardment Particularly provided is the electroporation of pollen cells In another aspect, the present invention provides a cell, particularly a plant cell eg including pollen and seed cells, comprising the recombinant nucleic acid of the invention, particularly the DNA or RNA of the invention, and plants comprising such 15 cells Plasmids containing a DNA coding for expression of the GRAB proteins GRAB 1 and GRAB 2 described herein have been deposited under the provisions of the Budapest Treaty on the international Recognition of the Deposit of Microorganisms of 1977, these being deposited on 11 June 1997 at the Coleccion Espanola de Cultivos 20 Tipo, with the accession numbers CECT 4S89 (this containing GRAB 1 sequence) and CECT 4S90 (this containing GRAB 2 sequence) Accordingly, in another aspect, the present invention provides a plasmid containing a DNA of sequence coding for a protein of SEQ ED No 10 or SEQ ID No 12 as described 25 herein as deposited under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms of 1977, these being deposited on 11 June 1997 at the Coleccion Espanola de Cultivos Tipo, with the accession numbers CECT 4889 or CECT 4890. (followed by page 9a) INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received In another aspect, the present invention provides a method of controlling plant cell or plant virus replication by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA.

SEQUENCE LISTING SEQ LD No I and 2 show the nucleotide sequences of GRAB1 and GRAB 2 respectively which encode for conserved domains N1 to N5 with intervening bases marked as N SEQ ID No 3 and 4 show the respective amino acid sequences corresponding to SEQ ID No I and 2 SEQ ID No 5 and 7 show the full nucleotide sequences spanning Nl to N5 of GRAB I and GRAB2 respectively SEQ ID No 6 and 8 show the corresponding ammo acid sequences to SEQ ID No 5 and 7 - 9a - (followed by page 10) INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received SEQ ID No 9 and 11 show the full length sequences of isolated cDNA including coding regions for GRAB1 and GRAB2 respectively SEQ ID No 10 and 12 show the corresponding amino acid sequences of proteins GRAB1 and GRAB2 BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the results of northern analysis for transcripts of GRAB 1 and GRAB 2 Figure 2 shows the results of studies carried out to to identify the region of GRAB 1 and GRAB 2 which are involved in the binding to WDV Rep A 10 Figure 3 shows the results of studies carried out to identify the region of WDV Rep A involved in the binding with GRAB proteins Figure 5 shows the alignment of various protein sequences, previously known and unknown, having the GRAB protein domains N1 to N5, for use in the method of the invention Figure 6 shows the charge distribution of these proteins The present invention will now be described further by way of illustration only by reference to the following non-limiting Examples Further embodiments falling within the scope of the claims will occur to those skilled in the art in the light of these In the Examples below the following methods were used MATERIALS AND METHODS DNA manipulations Proteinase K, restriction endonucleases and other enzymes for DNA manipulations 25 were from Merck, Boehringer Mannheim, New England Biolabs and Promega Standard DNA manipulation techniques were applied as described in [34] DNA sequencing was carried using an Applied Biosystem automatic sequencing device Oligonucleotides were from lsogen Bioscience BV (Maarsen, The Netherlands) DNA and RNA purification Printed from Mimosa Genomic DNA and total RNA were isolated from wheat leaves, roots and suspension cultured cells by grinding the material, previously frozen in liquid nitrogen, essentially as described [41] The powder was mixed with extraction buffer (50 mM Tris-HCI, pH 6 0, 10 mM EDTA, 2% SDS, 100 mM LiCl), and after heating at 65°C 5 with phenol (1 1, 65°C), vortexed for 20 sec and centnfuged at 4°C for 15 mm at 12000 rpm The supernatant was extracted twice with the same volume of phenol chloroform (1 1) and precipitated with one volume of 4M LiCl After centnfugation, the RNA pellet was resuspended in TE buffer and two volumes of ethanol were added to the liquid phase to precipitate genomic DNA Purification of poly(A)+ mRNA was carried out as 10 described [47] Construction of the yeast two-hybrid cDNA library from wheat cultured cells Five micrograms of poly(A)+ mRNA isolated from wheat suspension cultured cells were used as a substrate for cDNA synthesis using a cDNA synthesis kit 15 (Stratagene), according to the manufacturer's instructions The resulting double-stranded DNA, containing EcoRl and Xhol ends, had an average size of 1 3 Kb A sample (500 ng) of this cDN A was hgated to 750 ng of the EcoRI/XhoI-digested pGAD-GH vector (Clontech) for 48 hr at 8°C Following ligation, the library was dialyzed against distilled water and electroporated into E. coh DH10B (Gibco) For convenience, the cDNA 20 library was separated into five sub-libraries each containing -6x10^ primary transformants Total library DNA was obtained by plating primary transformants on fifty 150-mm LB plates plus ampicillin Colonies were scrapped off into LB (+Amp) medium, and plasmid DNA was prepared as described [34] Yeast two-hybrid screening The yeast strain HF7c (MA la ma3-52 his3-200 ade2-IOI Iys2-80l trpJ-901 Ieu2-3,112 gal4-542 galHO-538 I.YS2 GAL IUAS-GAI. IJ A TA -HIS3 URA3-GAL4 !7mer\(x3)-Gy( IIA IA-I'acZ, [15]), which contains the two reporter genes LacZ and Printed from Mimosa HIS3, was used in the two-hybrid screening [4, 16] Yeasts were first transformed, as described [38], with pBWRepA, a plasmid containing the entire WDV RepA open reading frame fused to the Gal4 DNA-bindmg domain (BD, IRPl marker) in the pGBT8 vector [46] Then, they were transformed with the pGAD-GH (AD, LEU2 marker) 5 wheat cDNA library The transformation mixture was plated on yeast drop-out selection media lacking tryptophan, leucine and histidine and supplemented with 5 mM and 10 mM 3-amino-l,2,4,triazole (3-AT, [5]) to reduce the appearance of false positive growing colonies Transformants were routinely recovered during a 3 to 8 days period and were checked for growth in the presence of up to 20 mM 3-AT To corroborate the 10 interaction between the two fusion proteins, P-galactosidase activity was assayed by a replica filter assay as described [7] Plasmid DNA was recovered from positive colonies by transforming into E coh MH4, since this strain is lenB', and its defect can be complemented by the LE112 gene present in the pGAD-GH plasmid Deletions of GRAB1 were constructed using the Apal (1-253), Sail (1-208), SacI (1-52) and SacII 15 (80-287) restriction sites and deletions ofGRAB2 using the Xhol (1-149), Bglll (1-108), Sail (1-55) and Smal (66-351) restriction sites Production of GST-fusion proteins and in vitro binding experiments To produce the GST-GRAB fusion proteins, the oligonucleotide GRAB1-ATG 20 (5'GGATCCATGGTGATGGCAGCGG) and T7 primer, and the oligonucleotides GRAB2-ATG (5'GGATCCATGGCGGACGTGACGGCGGTG) and T7 primer, were used to amplify the coding regions of GRAB1 and GRAB2, respectively by PCR The products were then cloned in frame into the pGEX-KG vector The GST-RepA was produced by cloning the WDV RepA ORF in frame into the pGEX-KG vector E coh 25 BL21(DE3) transformants were grown to an OD6OO of 0 6 to 0 9 and then induced to express the fusion protein at 37 °C for 30 min by the addition of IPTG to 1 mM GST fusion proteins were purified using glutathione-Sepharose beads (Pharmacia) Labeled Printed from Mimosa RepA protein was obtained by in vino transcription and translation (IVT) using wheat germ extract (Promega), in the presence of 35s_meth|0nine^ according to the manufacturer's conditions Labeled GRAB1 and GRAB2 were produced by using TNT reticulocyte lysate (Promega) after cloning the same PCR products from GRAB1 and 5 GRAB2 genes in plasmid pBluescnptKS and transcription using T7 RNA polymerase Plant cell culture The Tuticum motiococcum suspension culture was obtained from P Mullineaux (John lnnes Center, UK) and maintained as described [46] Inoculation of N. benthamiana plants The PVX-derived pP2C2S vector [10] was used for transient expression of GRAB proteins in N benthamiana plants For GRAB1 constructions, a 1 1 Kb Smal-Xhol fragment containing the complete GRAB I cDNA was cloned into Nrul/Sall digested 15 pP2C2S vector to produce plasmid pP2-GRABl To construct a frame-shift GRAB1 mutant (GRABl^s), plasmid pP2-GRABl was partially digested with Sacll and, then, religated after treatment with T4 DNA polymerase For GRAB2 constructions, a 1 35 Kb Smal-Xhol fragment containing the complete GRAB2 cDNA was cloned into Nrul/Sall digested pP2C2S vector to produce plasmid pP2-GRAB2 To construct the 20 frame-shift mutation (GRAB2FS), plasmid pP2-GRAB2 was digested with BstEII and religated after treatment with Klenow Infectious RNA was obtained by in vitro transcription of plasmid DNA digested with Spel, using the T7 Cap Scribe kit (Boeringher Mannheim) RNA transcripts were diluted in 5 mM Na3P04 (pH 7 0) and used to inoculate 3-week-old N benthamiana plants (four in each case) using 25 carborundum, as described [10, 17] Transfection of wheat cultured cells by particle bombardment Printed from Mimosa Cells were pelleted by centrifugation at 1000 rpm for 3 minutes and the supernatant was removed Approximately 0 20-0 25 ml of packed cells were spread with a spatula onto a Whatman #1 filter paper, which was placed on CHS medium supplemented with 0 25 M mannitol [30] and solidified with 0 8% agar (bombardment 5 medium) Conditions for DNA adsorption and particle bombardment were as described [43, 46] Overexpression of GRAB proteins in wheat cultured cells was carried out by cloning the coding regions in a plasmid [47] under the control of the CaMV 35S promoter The 1 1 Kb EcoRI-XhoI fragment of GRAB1 and the 1 3 Kb EcoRl-Apall fragment of GRAB2 were cloned into EcoRI/Ndel digested plasmid p35S ZmRbl [47] 10 to produce p35S GRAB1 and p35S GRAB2 These plasmids contain the 3'-untranslated region of ZmRbl Each experimental time point corresponds to a cell plate independently transfected Experiments were repeated at least twice Analysis of WDV DNA replication WDV DNA replication was analyzed essentially as described [43, 46] Cells were ground in liquid nitrogen and DNA was isolated essentially as described [41] (Soni et al, 1994) After electrophoresis in 0 7% agarose gels, DNA was transferred to nylon membranes (Biodyne A) and detected by hybridization to probes labeled with digoxigenin-11-dUTP according to the conditions recommended by the manufacturer 20 (DIG DNA labeling and detection kit, Boehringer Mannheim) EXAMPLE 1 Isolation of cDNAs encoding GRAB proteins Making use of the yeast two-hybrid approach (Fields and Song, 1989, Fields, 1993) a cDNA library was constructed from mRNA prepared from an actively growing 25 wheat cell suspension culture Screening was carried out using WDV RepA fused to the Gal4 DNA-binding domain A significantly large number of cDNA clones allowed growth of co-tansformants in selective (-his, +3AT) medium Among those appeared during the first 6 days after transformation, those co-transformants showing a stronger Prxnted from Mimosa WO 98/56811 PCT/EP98/03662 interaction, based on their ability to grow in the presence of >20 mM 3AT, and to produce an intense P-gal signal Partial DNA sequence analysis revealed the existence of a group of 7 cDNA clones whose 5'-sequence was significantly related although they represented different clones as deduced by restriction analysis Based on their ability to 5 interact with WDV RepA, ) the proteins encoded by this group of cDNA clones were named GRAB proteins (Geminivirus RepA Binding) Two GRAB proteins, GRAB1 and GRAB2, are described herein Each cloned cDNA encoded protein which bound strongly to WDV RepA in yeasts GRAB-1 and GRAB-2 cDNA clones were ~1 1 kbp long and each contained a 10 single open reading frame, including a putative ATG translation initiation site The complete cDNA sequence and deduced amino acid sequence for the two GRAB proteins are shown in the sequence listing as SEQ ID Nos 9 to 12 The isolated clones contain the full-length coding region with the sequence around the first putative methionine showing a good consensus translation initiation sequence 15 Amino acid analysis of GRAB1 and GRAB2 proteins revealed some striking features First, the two proteins are totally unrelated in their C-terminal moieties although they appear to be highly related over a region spanning their -170 N-termmal residues, where a significant degree of homology (58%) can be detected Interestingly, the distribution of charged residues is not random The unique C-terminal domain of 20 GRAB1 and GRAB2 contains 19% and 15%, respectively, of negatively charged residues (D, E) while their related N-terminal domain, which contains a high proportion of charged residues (30% and 33%, respectively), show a small bias in favour of positively charged amino acids (R, K, H, 18% and 20%, respectively Printed from Mimosa WO 98/56811 PCT/EP98/03662 In addition, northern analysis revealed the existence of mRNAs of the expected sizes each with the potential to encode GRAB1 and GRAB2, respectiveh Both mRNAs were present in small amounts in wheat cultured cells and were even less abundant in differentiated cell types, i e , roots and leaves Example 2 N-terminus of GRAB proteins mediates binding to WDV RepA To identify the region in the GRAB proteins involved m complex formation with WDV RepA, a series of deletions were constructed and analyzed for their ability to 10 interact with the viral RepA protein in yeasts Deletion of most (in GRAB1) or all (in GRAB2) the C-terminal domain did not reduce GRAB-RepA binding (Fig 2) Even a truncated GRAB2 protein containing only its N-terminal 149 residues still retained a significant RepA binding ability (Fig 2) On the contrary, a relatively small N-terminal deletion of GRAB1 (80 amino acids) or of GRAB2 (66 amino acids) totally abolished 15 interaction (Fig 2) Therefore, it is concluded that the N-terminal domain present in both proteins confers the capacity to form complexes with WDV RepA Furthermore, the most N-terminal region of GRAB proteins appears to have the largest contribution to complex formation with WDV RepA Example 3 C-terminal domain of WDV RepA mediates interaction with GRAB proteins A similar deletion study was carried out to identify the sequences in the WDV RebA protein responsible for binding to GRAB proteins As shown in Fig 3, deletion of most of the N-terminal half of RepA (~ 150 residues) did not decrease its ability to Printed from Mimosa WO 98/56811 PCT/EP98/03662 interact with GRAB proteins However, elimination of just the C-termina! 37 amino acid residues of RepA completely destroyed binding to both GRAB1 and GRAB2 (Fig 3), indicating that this small domain of RepA contains residues critical for binding Interaction of GRAB with WDV Rep protem was also analysed, the other WDV early 5 protein which is produced from the same mRNA encoding RepA but after a splicing event (Schalk et al, 1989) Thus, the 210 N-terminal residues of both RepA and Rep are identical, but the two virai proteins have distinct C-terminal domains In agreement with the idea that the C-terminus of WDV RepA mediates binding to GRAB, WDV Rep was unable to form complexes with GRAB These results together with data on the 10 differential binding of WDV RepA and Rep to ZmRbl (Xie et al, 1997) strongly suggest that RepA is a unique WDV protein likely involved in interfering with cellular physiology to create a cellular environment favorable to viral replication To confirm and extend the yeast two-hybrid interaction results, pull-down experiments were carrned out to evaluate the interaction using purified proteins After 15 incubation of equal amounts of purified GST-RepA (0 2p.g) with m vitro translated (IVT) GST-GRAB 1 or GST-GRAB2, a fraction of the input 35S-labeled GRAB proteins was recovered bound to gluthation-agarose beads (Fig 4) Similar results were obtained using GST-GRAB 1 and GST-GRAB2 and IVT WDV RepA protein (Fig 4). Therefore, it was concluded that interaction between GRAB proteins and the 20 geminiviral RepA can occur in the absence of other cellular proteins Example 4 Expression of GRAB mRNAs is restricted to a small number of cells in roots and embryos Printed from Mimosa WO 98/56811 PCT/EP98/03662 To obtain some insight on the function that GRAB proteins may have in the cell, their expression pattern was analyzed by m .situ hybridization Northern analysis indicated that GRAB transcripts are not very abundant (see Fig I). The occurrence of GRAB mRNAs in root meristems appears to be restricted to a small number of cells A 5 similar patchy pattern was also observed of the histone H4 transcript, characteristic of S-phase cells In particular, GRABl expression was restricted to some cells within the central cylinder and was virtually absent from cortical or epidermal cells GRABl mRNA was also detected in some root cap initial cells . A comparable situation was found in developing embryos 10 Altogether our analysis of the GRAB expression pattern under different growth conditions led us to conclude that both GRABl and GRAB2 mRNA levels increased as a response to changes in growth signals of, peihaps, a subset of cells within the culture and that they are largely dependent on nutrient availability Furthermore, they reinforce the idea that GRAB proteins may serve different roles as part of an immediate early 15 response, which may be a part of the transduction pathway connecting external signals to the regulation of cellular growth and/or differentiation A group of plant proteins is thus identified on the basis of their ability to form complexes with the RepA, the Rb-binding protein of WDV, a member of the plant geminiviridae family Based on a database searching, we conclude that both GRAB 1 20 and GRAB2 are not homologs to any known protein and, therefore, the cDNAs isolated encode previously unidentified proteins However, this study revealed that they are related, in terms of primary sequence, throughout their N-termmal region Using the amino acid sequence of GRABl or GRAB2. the output showed that these proteins possess a significant homology to several plant proteins of unknown function Printed from Mimosa WO 98/56811 PCT/EP98/03662 Interestingly, the homology was also restricted to the N-terminal first 150-170 residues, as initially observed for the group of GRAB proteins itself (Fig 10A) Those shown in Fig 10A correspond to otherwise apparently unrelated proteins First, two Arabidopsis cDNA clones, ATAFl and ATAF2, isolated by their ability to activate the 35S 5 cauliflower mosaic virus (CAMV) promoter in yeasts (H Hirt, personal communication) Second, the SENU5 CDNA, isolated in studies of leaf senescence in tomato (Genbank Acc No ) Third, the NAM protein, the product of the Petunia No Apical Meristem (nam) gene, required for proper development of shoot apical meristems, which has been proposed to determine meristem location (Souer et al, 10 1996) Example 5 Expression of GRAB 1 induces a necrotic phenotvpe As a first step towards getting insight into the cellular roles of GRAB proteins we determined the effect of expressing either GRABl or GRAB2 in N. benthamiana plants 15 For this purpose, we made use of a potato virus X (PVX)-based expression vector, which ensures high levels of systemic expression at a given time and in the absence of chromosomal effects [6] This system has been successfully used to analyze the effects of transiently expressed foreign proteins [18, 31, 32] When N. benthamiana plants were inoculated with in vitro transcribed PVX RNA, 20 the appearance of typical symptoms, clearly apparent at 10 days post inoculation (dpi), was indicative of efficient amplification of the PVX expression vector as compared with the mock-inoculated plants Plants inoculated with the PVX-GRAB1 construct were already systemically infected by 12 dpi due to high level amplification of the GRAB1-expressing vector This is confirmed by the level of PVX-GRAB1 RNA in the leaves, 25 comparable to that of the wild type PVX-infected plants Interestingly, all plants Printed from Mimosa expressing high levels of GRAB I showed a tendency to develop, already at 12 dpi, a degenerative process, as revealed by the morphology of their older leaves Furthermore, a prominent necrotic area appeared near the base of the aerial parts of the plant, especially at 28 dpi At this stage, a significant reduction in the development of leaves 5 and roots was also apparent To determine whether the effects observed in whole plants were dependent on the expression of a full-length GRABl protein, we inoculated plants with a PVX construct that expressed GRABl mRNA carrying a frame-shifit mutation close to the N-terminus Thus, PVX-GRAB1 bears a cDNA insert with a frame-shift mutation at amino acid position 78, which maintains the two most N-terminal conserved 10 blocks (N1 and N2), and can produce a truncated protein of 159 residues Expression of GRAB1^S did not produce any of the effects observed in plants expressing the full-length GRABl protein A similar study was carried out with the GRAB2 constructs Plants infected with the PVX-GRAB2 construct showed delayed kinetics in the PVX vector amplification 15 This precluded high levels of GRAB2 expression at 12 dpi and plants had a morphology similar to that mock-inoculated plants However, later after inoculation, the PVX vector accumulated at high levels Interestingly, these GRAB2-expressing plants showed milder symptoms than plants infected with wild type PVX None of them developed the degenerative process observed in GRABl-expressing plants We also tested the effect of 20 expressing a truncated form of GRAB2 In this case, PVX-GRAB2^S produces a GRAB2 cDNA carrying a frame-shift mutation at amino acid position 33, thus producing a 50 amino acid-long truncated GRAB2 protein which conserved only the most N-terminal (Nl) homology block Plants inoculated with the PVX-GRAB2PS construct contain high levels of PVX and of GRAB^s RNAs Taken together, the results of 25 expressing the truncated forms of GRAB proteins, indicate that the induction of necrotic areas by GRAB 1 and the delay in symptom appearance by GRAB2 are dependent upon Printed from Mimosa the expression of full-length proteins and strongly suggest that these specific effects may be mediated by the unique C-terminal domains of each GRABl and GRAB2 proteins The alignment shown in Fig 4 revealed the existence of several amino acid motifs highly conserved among these related proteins Thus, we noted the occurrence of five motifs in the N-terminal domain (Nl to N5) which could correspond to blocks critical for their activity Among them, the two most N-terminal motifs (Nl and N2) exhibit a net negative charge while the rest are positively charged Based on our deletion analysis, all these motifs are required for efficient interaction with WDV RepA although N5 is not absolutely required and Nl seems to have a strong contribution (Fig 3) The C-terminal domain, although unique in primary sequence to each protein in the family, shares the property of having a high net negative charge (15-20% of the residues are either D or E) This is particularly evident in both the GRAB proteins and the two ATAF members The two GRAB proteins reported here, but in particular GRAB2, have a Q-rich domain in their C-terminal domains which could be involved in transcriptional regulation as has been shown to be the case for other examples In addition, a number of partial cDNA sequences derived from randomly sequenced EST from Arabidopsis and rice were also retrieved using the N-terminus of GRAB proteins as a query (not shown) Surprisingly, protein sequences from yeast or animal origins were not retrieved in this search One striking feature of this group of proteins is the large number of members with a related N-terminal domain that appears to be present in each species For example, at least 5 members related to NAM (Souer et al, 1996) and 7 members related to GRAB (this work) Such an abundance poses the question of whether they actually have different functions One possibility, already proposed for some NAM-related proteins is Printed from Mimosa that thay have redundant functions in different locations of the plant during postembryonic development (Souer et al, 1996) Regarding the consequences of GRAB overexpression on symptom appearance in PVX-infected plants, it is possible that both WDV and PVX share a, so far, unknown 5 pathway affected by GRAB, although very different replication strategies are employed by these virus families An alternative possibility is that GRAB overexpression may directly or indirectly trigger a general defense pathway or, simply, lead to a cellular environment which protect cells against different types of infection Example 6.

Overexpression of GRAB proteins in wheat cultured cells inhibits WDV DNA replication To further investigate the possible function of the GRAB proteins isolated on the basis of their interaction with WDV RepA protein, we determined the effect of 15 expressing GRAB proteins on geminiviral DNA replication This assay has proven to be useful to evaluate the effect of plant Rb (ZmRbl) in viral DNA replication [47] Thus, using a similar strategy, we co-transfected wheat cultured cells with combinations of the following plasmids (1) one plasmid expressing either GRABl or GRAB2 under the control of the 35S CaMV promoter, which is active in the wheat cells used [47], (n) a 20 second plasmid expressing the WDV proteins required for efficient viral DNA replication (RepA and Rep) also under the control of the 35S CaMV promoter, and (111) a third plasmid (pWonAA), a derivative of pWori [43, 46], used to monitor WDV DNA replication, which can replicate efficiently when the viral proteins are provided m trans [35, 47] Expression of either GRABl or GRAB2 severely inhibited WDV DNA 25 replication in cultured wheat cells, with GRAB2 exhibiting a stronger effect These results indicate that WDV DNA replication is affected by GRAB proteins under cell culture conditions Printed from Mimosa REFERENCES I Accotto, G-P, Mullineaux, PM, Brown, SC, Marie, D Digitana streak geminivirus replicative forms are abundant in S-phase nuclei of infected cells Virology 195 257-259 (1993) 2 Aida, M, Ishida, T, Fukaki, H, Fujisawa, H, Tasaka, M Genes involved in organ separation in Arabidopsis an analysis of the cup-shaped cotyledon mutant Plant Cell 9 841-857(1997) 3 Angell, SM, Baulcombe, DC Consistent gene silencing in transgenic plants expressing a replicating potato virus X RNA EMBO J 16 3675-3684(1997) 10 4 Bartel, PL, Chien, C-T, Sternglanz, R, Fields, S Using the two-hybrid system to detect protein-protein interactions In Hartley, D A (ed ), Cellular Interactions in Development a practical approach Oxford University Press, Oxford, UK, pp 153-179 (1993a) Bartel, PL, Chien, C-T, Sternglanz, R, Fields, S Elimination of false positives that 15 arise in using the two-hybrid system BioTechniques 14 920-924 (1993b) 6 Baulcombe, DC , Chapman, S, Santa Cruz, S Jellyfish green fluorescent protein as a reporter for virus infections Plant J 7 1045-1053 (1995) 7 Breeden, L, Nasmyth, K Regulation of the yeast HO gene Cold Spring Harbor Symp Quant Biol 50 643-650(1985) 8 Coen, ES , Meyerowitz, EM The war of whorls genetic interactions controlling flower developmen Nature 353 31-37(1991) 9 Courey, A J, Tjian, R Analysis of Spl in vivo reveals multiple transcriptional domains, including a novel glutamine-nch activation motif Cell 55 887-898 (1988) Chapman, S, Kavanagh, TA, Baulcombe, DC Potato virus X as a vector for gene 25 expression in plants Plant J 2 549-557(1992) II Davies, JW, Stanley, J Geminivirus genes and vectors Trends Genet 5 77-81 (1989) Printed from Mimosa 12 Doerner, P, Jorgensen, J, You, R, Steppuhn, J, Lamb, C Control of root growth and development by cyclin expression Nature 380 520-523 (1996) 13 Eagle, PA, Orozco, BM, Haniey-Bowdoin, L A DNA sequence required for geminivirus replication also mediates transcriptional regulation Plant Cell 6 1157- 1170(1994) 14 Fanning, E, and Knippers, R Structure and function of simian virus 40 large tumor antigen Annu Rev Biochem 61 55-85 (1992) Feilotter, HE, Hannon, GJ, Ruddell, CJ, Beach, D Construction of an improved host strain for two-hybrid screening Nucleic Acids Res 22 1502-1503 (1994) 16 Fields, S, Song, O A novel genetic system to detect protein-protein interactions Nature 340 245-246(1989) 17 Guo, HS, Garcia, J A Delayed resistance to plum pox potyvirus mediated by a mutated RNA rephcase gene involvement of a gene-silencing mechanism Mol Plant-Microbe Inter 10 160-170 (1997) 18 Hammond-Kosack, KE, Staskawicz, BJ, Jones, JDG, Baulcombe, DC Functional expression of a fungal avirulence gene from a modified potato virus X genome Mol Plant-Microbe Interact 8 181-185 (1995) 19 Hassel, JA, Brinton, BT SV40 and polyomavirus DNA replication In DePamphilis, M L (ed ) DNA replication in eukaryotic cells Cold Spring Harbor Laboratory Press, New York, pp 639-677(1996) Jacobs, T Control of the cell cycle Dev Biol 153 1-15 (1992) 21 Jansen-Durr, P How viral oncogenes make the cell cycle Trends Genet 12 270-275 (1996) 22 John, I, Hackett, R, Cooper, W, Drake, R, Farrell, A, Grierson, D Cloning and characterization of tomato leaf senescence-related cDN As Plant Mol Biol 33 641-651(1997) Printed from Mimosa 23 Kozak, M At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells J Mol Biol 196 947-950(1987) 24 Lazarowitz, S Geminiviruses genome structure and gene function Crit Rev Plant Sci II 327-349(1992) 25 Long, JA, Moan, El, Medford, JI, Barton, MK A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis Nature 379 66-69 (1996) 26 Ludlow, JW Interactions between SV40 large-tumor antigen and the growth suppressor proteins pRB and p53 FASEB J 7 866-871(1993) 27 Martin, C, Paz-Ares, J MYB transcription factors in plants Trends Genet 13 67-73 (1997) 28 Moran, E Interaction of adenoviral proteins with pRB and p53 FASEB J 7 880-885 (1993) 29 Nagar, S, Pedersen, TJ, Carrick, KM, Hanley-Bowdoin, L, Robertson, D A 15 geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells Plant Cell 7 705-719 (1995) Perl, A, Kless, H, Blumenthal, A, Galili, G, Galun, E Improvement of plant regeneration and GUS expression in scutellar wheat calli by optimization of culture conditions and DNA-microprojectile delivery procedures Mol Gen Genet 235 279-284(1992) 31 Ratchff, F, Harrison, BD, Baulcombe, DC A similarity between viral defense and gene silencing in plants Science 276 1558-1560(1997) 32 Rommens, CMT, Salmeron, JM, Baulcombe, DC, Staskawicz, BJ Use of a gene expression system based on potato virus X to rapidly identify and characterize a tomato pto homolog that controls fenthion sensitivity Plant Cell 7 249-257 (1995) Prmted from Mimosa 33 Sablowski, RWM, Meyerowitz, EM A homolog of NO APICAL MICRISII.M is an immediate target of the floral homeotic genes A PL'. IA LA 3 //'AY /1 LI.A LA Cell 92 93-103 (1998) 34 Sambrook, J, Fritsch, EF, Maniatis, T Molecular cloning A laboratory Manual, 5 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, (1989) Sanz-Burgos, AP, Gutierrez, C Organization of the c/.v- acting element required for wheat dwarf geminivirus DNA replication and visualization of a Rep protein-DN A complex Virology (1998, in press) 36 Saraste, M, Sibbald, PR, Wittmghofer, A The P-loop — a common motif m ATP-10 and GTP-binding proteins Trends Biochem Sci 15 430-434 (1990) 37 Schalk, H-J, Matzeit, V, Schiller, B, Schell, J, Gronenborn, B Wheat dwarf virus, a geminivirus of graminaceous plants needs splicing for replication EMBO J 8 359-364 (1989) 38 Schiestl, RH, Gietz, D High efficiency transformation of intact yeast cells using 15 single stranded nucleic acids as a carrier Curr Genet 16 339-346(1989) 39 Shaul, O, van Montagu, M, Inze, D Regulation of cell division in Arabidopsis Crit Rev Plant Sci 15 97-112(1996) 40 Shore, P, Sharrocks, AD The MADS-box family of transcription factors Eur J Biochem 229 1-13 (1995) 41 Soni, R, Murray, JAH Isolation of intact DNA and RNA from plant tissues Anal Biochem 218 474-476(1994) 42 Souer, E, van Houwehngen, A, Kloos, D, Mol, J, Koes, R The No Apical Meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and pnmordia boundaries Cell 85 159-170 (1996) 25 43 Suarez-Lopez, P, Gutierrez, C DNA replication of wheat dwarf geminivirus vectors effects of origin structure and size Virology 227 389-399(1997) Printed from Mimosa 44 Van der Krol, AR, Chua, N-H Flower development in petunia Plant Cell 5 1195-1203(1993) 45 Vousden, K Interactions of human papillomavirus transforming proteins with the products of tumor suppressor genes FASEB J 7 872-879 (1993) 46 Xie, Q, Suarez-Lopez, P, Gutierrez, C Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus requirement for efficient viral DNA replication EMBO J 14 4073-4082 (1995) 47 Xie, Q Sanz-Burgos, AP, Hannon, GJ, Gutierrez, C Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins EMBO J 15 10 4900-4908 (1996) Printed from Mimosa SEQUENCE LISTING (1) GENERAL INFORMATION- (l) APPLICANT.

(A) NAME- CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (B) STREET: SERRANO,113 <C) CITY: MADRID (E> COUNTRY: SPAIN (F) POSTAL CODE (ZIP): 28006 (A) NAME: CRISANTO GUTIERREZ-ARMENTA (B) STREET: CENTRO DE BIOLOGIA MOLECULAR, CSIC-UAM (C) CITY: MADRID (E) COUNTRY. SPAIN (F) POSTAL CODE (ZIP): 28049 (A) NAME: QI XIE (B) STREET: CENTRO DE BIOLOGIA MOLECULAR, CSIC-UAM (C) CITY: MADRID (E) COUNTRY: SPAIN (F) POSTAL CODE (ZIP): 28049 (A) NAME: ANDRES SANZ-BURGOS (B) STREET CENTRO DE BIOLOGIA MOLECULAR, CSIC-UAM <C) CITY: MADRID (E) COUNTRY: SPAIN (F) POSTAL CODE (ZIP): 28049 (11) TITLE OF INVENTION: PLANT GRAB PROTEINS (ill) NUMBER OF SEQUENCES: 12 (IV) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM. PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.30 (EPO) (vi) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: ES 9701292 (B) FILING DATE. 12-JUN-1997 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS.

(A) LENGTH- 459 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (11) MOLECULE TYPE: cDNA (ill) HYPOTHETICAL- NO Printed from Mimosa (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (xx) FEATURE: (A) NAME/KEY: CDS (B) LOCATION:!. 459 (XI) SEQUENCE DESCRIPTION- SEQ ID NO: 1: CTGCCGNNNG GGTTCCGGTT CCACCCGACG GACGAGGAGN NNNNNNNNNN NTACCTCNNN 60 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNATCN NNNNNNNNNN NNNNNNNNNN 120 NNNNNNCCGT GGNNNCTCCC GNNNNNNNNN NNNNNNNNNN NNNNNGAGTG GTACTTCTTC 180 NNNNNNNNNN NNNNNAAGTA CCCCNNNGGC NNNCGCNNNA ACCGGNNNNN NNNNNNNGGC 240 TACTGGAAGG CCACCGGCNN NGACNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNGGGNNN 300 AAGAAGNNNC TCGTCTTCTA CNNNGGCNNN NNNNNNNNNG GGNNNNNNNN NNNNTGGNNN 360 ATGCACGAGT ACCGCCTCNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 420 NNNNNNNNNN NNTGGNNNNN NNNNCGCNNN NNNNNNAAG 459 (2) INFORMATION FOR SEQ ID NO: 2: <l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 462 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (n) MOLECULE TYPE: cDNA (m) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (VI) ORIGINAL SOURCE- (A) ORGANISM: Triticum monococcum (IX) FEATURE : (A) NAME/KEY: CDS (B) LOCATION:!..462 Printed from Mimosa WO 98/56811 PCT/EP98/03662 (XI> SEQUENCE DESCRIPTION: SEQ ID NO. 2 CTTCCANNNG GGTTCCGGTT CCACCCCACC GACGAGGAGN NNNNNNNNNN NTACCTCNNN 60 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNATCN NNNNNNNNNN NNNNNNNNNN 120 NNNNNNCCGT GGNNNCTCCC GNNNNNNNNN NNNNNNNNNN NNNNNGAGTG GTTCTTCTTC 180 NNNNNNNNNN NNNNNAAGTA CCCGNNNGGG NNNCGCNNNA ACCGGNNNNN NNNNNNNGGG 240 TACTGGAAGG CGACGGGGNN NGACNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 300 NNNNNNGGCN NNAAGAAGNN NCTCGTCTTT TACNNNGGCN NNNNNNNNNN NGGCNNNNNN 360 NNNNNNTGGN NNATGCACGA GTACCGCCTC NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 420 NNNNNNNNNN NNNNNTGGNN NNNNNNNCGG NNNNNNNNNA AA 462 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 amino acids (B) TYPE: amino acid (C) STRANDEDNESS• single (D) TOPOLOGY: linear (n) MOLECULE TYPE: peptide (111) HYPOTHETICAL. NO (iv) ANTI-SENSE: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (ix) FEATURE: (A) NAME/KEY- CDS (B) LOCATION•1..459 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO Leu Pro Xaa Gly Phe Arg Phe His Pro 1 5 Xaa Tyr Leu Xaa Xaa Xaa Xaa Xaa Xaa 20 25 Printed from Mimosa : 3: Thr Asp Glu Glu Xaa Xaa Xaa 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa 40 45 50 55 lie Xaa Xaa Xaa Xaa Xaa Xaa Xaa 35 40 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Qlu 50 55 Xaa Lys Tyr Pro Xaa Gly Xaa Arg 65 70 Tyr Trp Lys Ala Thr Gly Xaa Asp 85 Xaa Xaa Gly Xaa Lys Lys Xaa Leu 100 Xaa Gly Xaa Xaa Xaa Xaa Trp Xaa 115 120 Xaa Xaa Pro Trp Xaa Leu Pro Xaa 45 Trp Tyr Phe Phe Xaa Xaa Xaa Xaa 60 Xaa Asn Arg Xaa Xaa Xaa Xaa Gly 75 80 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 90 95 Val Phe Tyr Xaa Gly Xaa Xaa Xaa 105 110 Met His Glu Tyr Arg Leu Xaa Xaa 125 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 140 Trp Xaa Xaa Xaa Arg Xaa Xaa Xaa Lys 145 150 (2) INFORMATION FOR SEQ ID NO: 4 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 154 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (11) MOLECULE TYPE- peptide (ill) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Leu Pro Xaa Gly Phe Arg Phe His Pro Thr Asp Glu Glu Xaa Xaa Xaa 15 10 15 Xaa Tyr Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 lie Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Pro Trp Xaa Leu Pro Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Glu Trp Phe Phe Phe Xaa Xaa Xaa Xaa 50 55 60 Printed from Mimosa WO 98/56811 PCT/EP98/03662 Xaa Lys Tyr Pro Xaa Gly Xaa Arg Xaa Asn Arg Xaa Xaa Xaa Xaa Gly 65 70 75 80 Tyr Trp Lys Ala Thr Gly Xaa Asp Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95 Xaa Xaa Xaa Xaa Xaa Xaa Gly Xaa Lys Lys Xaa Leu Val Phe Tyr Xaa 100 105 110 Gly Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Xaa Trp Xaa Met His Glu Tyr 115 120 125 Arg Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 140 Xaa Trp Xaa Xaa Xaa Arg Xaa Xaa Xaa Lys 145 150 (2) INFORMATION FOR SEQ ID NO. 5. (i) SEQUENCE CHARACTERISTICS" (A) LENGTH: 459 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (11) MOLECULE TYPE: cDNA (m) HYPOTHETICAL: NO (iv) ANTI-SENSE. NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (IX) FEATURE: (A) NAME/KEY: CDS (B) LOCATION:1..459 (XI) SEQUENCE DESCRIPTION: SEQ ID NO: 5: CTG CCG CCG GGG TTC CGG TTC CAC CCG ACG GAC GAG GAG CTG GTG GCG 48 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Ala 15 10 15 GAC TAC CTC TGC GCG CGC GCG GCC GGC CGC GCG CCG CCG GTG CCC ATC 96 Asp Tyr Leu Cys Ala Arg Ala Ala Gly Arg Ala Pro Pro Val Pro lie 20 25 30 ATC GCC GAG CTC GAC CTC TAC CGG TTC GAC CCG TGG GAG CTC CCG GAG 144 lie Ala Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu 35 40 45 Printed from Mimosa WO 98/56811 PCT/EP98/03662 CGG GCG CTC TTC GGG GCG CGG GAG TGG TAC TTC TTC ACG CCG CGG GAC 192 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp 50 55 60 CGC AAG TAC CCC AAC GGC TCC CGC CCC AAC CGG GCC GCC GGG GGC GGC 240 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Ala Ala Gly Gly Gly 65 70 75 80 TAC TGG AAG GCC ACC GGC GCC GAC AGG CCC GTG GCG CGC GCG GGC AGG 288 Tyr Trp Lys Ala Thr Gly Ala Asp Arg Pro Val Ala Arg Ala Gly Arg 85 90 95 ACC GTC GGG ATC AAG AAG GCG CTC GTC TTC TAC CAC GGC AGG CCG TCG 336 Thr Val Gly lie Lys Lys Ala Leu Val Phe Tyr His Gly Arg Pro Ser 100 105 110 GCG GGG GTC AAG ACG GAC TGG ATC ATG CAC GAG TAC CGC CTC GCC GGC 384 Ala Gly Val Lys Thr Asp Trp lie Met His Glu Tyr Arg Leu Ala Gly 115 120 125 GCC GAC GGA CGC GCC GCC AAG AAC GGC GGC ACG CTC AGG CTT GAC GAA 432 Ala Asp Gly Arg Ala Ala Lys Asn Gly Gly Thr Leu Arg Leu Asp Glu 130 135 140 TGG GTG CTC TGC CGC CTA TAC AAC AAG 459 Trp Val Leu Cys Arg Leu Tyr Asn Lys 145 150 (2) INFORMATION FOR SEQ ID NO:j 6. (i) SEQUENCE CHARACTERISTICS: (A) LENGTH' 153 amino acids (B) TYPE: amino acid ' (D) TOPOLOGY: linear (n) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Ala 15 10 15 Asp Tyr Leu Cys Ala Arg Ala Ala Gly Arg Ala Pro Pro Val Pro lie 20 25 30 lie Ala Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu 35 40 45 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp 50 55 60 Printed from Mimosa WO 98/56811 PCT/EP98/03662 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Ala Ala Gly Gly Gly 65 70 75 80 Tyr Trp Lys Ala Thr Gly Ala Asp Arg Pro Val Ala Arg Ala Gly Arg 85 90 95 Thr Val Gly lie Lys Lys Ala Leu Val Phe Tyr His Gly Arg Pro Ser 100 105 110 Ala Gly Val Lys Thr Asp Trp lie Met His Glu Tyr Arg Leu Ala Gly 115 120 125 Ala Asp Gly Arg Ala Ala Lys Asn Gly Gly Thr I>eu Arg Leu Asp Glu 130 135 140 Trp Val Leu Cys Arg Leu Tyr Asn Lys 145 150 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 462 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY linear (ii) MOLECULE TYPE: cDNA (ill) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE- (A) ORGANISM: Triticum monococcum (IX) FEATURE: (A) NAME/KEY: CDS (B) LOCATION:1..462 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: CTT CCA CCG GGG TTC CGG TTC CAC CCC ACC GAC GAG GAG GTG GTC ACC 48 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val Val Thr 155 160 165 CAC TAC CTC ACC CGC AAG GTC CTC CGC GAA TCC TTC TCC TGC CAA GTG 96 His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys Gin Val 170 175 180 185 ATC ACC GAC GTC GAC CTC AAC AAG AAC GAG CCG TGG GAG CTC CCG GGC 144 lie Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu Pro Gly 190 195 200 Pnrvted from Mimosa 40 45 50 55 CTC GCG AAG ATG GGC GAG AAG GAG TGG TTC TTC TTC GCG CAC AAG GGT 192 Leu Ala Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Ala His Lys Gly 205 210 215 CGG AAG TAC CCG ACG GGG ACG CGC ACC AAC CGG GCG ACG AAG AAG GGG 240 Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys Lys Gly 220 225 230 TAC TGG AAG GCG ACG GGG AAG GAC AAG GAG ATC TTC CGC GGC AAG GGC 288 Tyr Trp Lys Ala Thr Gly Lys Asp Lys Glu lie Phe Arg Gly Lys Gly 235 240 245 CGG GAC GCC GTC CTT GTC GGC ATG AAG AAG ACG CTC GTC TTT TAC ACC 336 Arg Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe Tyr Thr 250 255 260 265 GGC CGC GCC CCC AGC GGC GGG AAG ACG CCG TGG GTG ATG CAC GAG TAC 384 Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His Glu Tyr 270 275 280 CGC CTC GAG GGC GAG CTG CCC CAT CGC CTT CCC CGC ACC GCC AAG GAC 432 Arg Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Ala Lys Asp 285 290 295 GAT TGG GCT GTT TGC CGG GTG TTC AAC AAA 462 Asp Trp Ala Val Cys Arg Val Phe Asn Lys 300 305 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 154 amino acids (B) TYPE: amino acid <D) TOPOLOGY: linear (11) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: lieu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val Val Thr 15 10 15 His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys Gin Val 20 25 30 lie Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu Pro Gly 35 40 45 Leu Ala Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Ala His Lys Gly 50 55 60 Printed from Mimosa 40 45 Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys 65 70 75 Tyr Trp Lys Ala Thr Gly Lys Asp Lys Glu lie Phe Arg Gly 85 90 Arg Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe 100 105 110 Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His 115 120 125 Arg Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Ala 130 135 140 Asp Trp Ala Val Cys Arg Val Phe Asn Lys 145 150 (2) INFORMATION FOR SEQ ID NO: 9: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1090 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY, linear (n) MOLECULE TYPE: cDNA (ill) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (VI) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 94 .954 (xi) SEQUENCE DESCRIPTION- SEQ ID NO: 9: AATTCGGCAC GAGACAGTCC ACCACGCACG TGCAGCAGCA CCAGCGCCCG AGAATCCCAT 60 TCCCATCGAC GGAGAAGAAG AAGTGAAGAA ACA ATG GTG ATG GCA GCG GCG GAG 114 Met Val Met Ala Ala Ala Glu 155 160 CGG CGG GAC GCG GAG GCG GAG CTG AAC CTG CCG CCG GGG TTC CGG TTC 162 Arg Arg Asp Ala Glu Ala Glu Leu Asn Leu Pro Pro Gly Phe Arg Phe 165 170 175 CAC CCG ACG GAC GAG GAG CTG GTG GCG GAC TAC CTC TGC GCG CGC GCG 210 His Pro Thr Asp Glu Glu Leu Val Ala Asp Tyr Leu Cys Ala Arg Ala Lys Gly 80 Lys Gly 95 Tyr Thr Glu Tyr Lys Asp Printed from Mimosa 40 45 50 55 WO 98/56811 PCT/EP98/03662 180 185 190 GCC GGC CGC GCG CCG CCG GTG CCC ATC ATC GCC GAG CTC GAC CTC TAC 258 Ala Gly Arg Ala Pro Pro Val Pro lie lie Ala Glu Leu Asp Leu Tyr 195 200 205 CGG TTC GAC CCG TGG GAG CTC CCG GAG CGG GCG CTC TTC GGG GCG CGG 306 Arg Phe Asp Pro Trp Glu Leu Pro Glu Arg Ala Leu Phe Gly Ala Arg 210 215 220 225 GAG TGG TAC TTC TTC ACG CCG CGG GAC CGC AAG TAC CCC AAC GGC TCC 354 Glu Trp Tyr Phe Phe Thr Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ser 230 235 240 CGC CCC AAC CGG GCC GCC GGG GGC GGC TAC TGG AAG GCC ACC GGC GCC 402 Arg Pro Asn Arg Ala Ala Gly Gly Gly Tyr Trp Lys Ala Thr Gly Ala 245 250 255 GAC AGG CCC GTG GCG CGC GCG GGC AGG ACC GTC GGG ATC AAG AAG GCG 450 Asp Arg Pro Val Ala Arg Ala Gly Arg Thr Val Gly lie Lys Lys Ala 260 265 270 CTC GTC TTC TAC CAC GGC AGG CCG TCG GCG GGG GTC AAG ACG GAC TGG 498 Leu Val Phe Tyr His Gly Arg Pro Ser Ala Gly Val Lys Thr Asp Trp 275 280 285 ATC ATG CAC GAG TAC CGC CTC GCC GGC GCC GAC GGA CGC GCC GCC AAG 546 lie Met His Glu Tyr Arg Leu Ala Gly Ala Asp Gly Arg Ala Ala Lys 290 295 300 305 AAC GGC GGC ACG CTC AGG CTT GAC GAA TGG GTG CTC TGC CGC CTA TAC 594 Asn Gly Gly Thr Leu Arg Leu Asp Glu Trp Val Leu Cys Arg Leu Tyr 310 315 320 AAC AAG AAG AAC CAG TGG GAG AAG ATG CAG CGG CAG CGG CAG GAG GAG 642 Asn Lys Lys Asn Gin Trp Glu Lys Met Gin Arg Gin Arg Gin Glu Glu 325 330 335 GAG GCG GCG GCC AAG GCT GCG GCG TCA CAG TCG GTC TCC TGG GGT GAG 690 Glu Ala Ala Ala Lys Ala Ala Ala Ser Gin Ser Val Ser Trp Gly Glu 340 345 350 ACG CGG ACG CCG GAG TCC GAC GTC GAC AAC GAT CCG TTC CCG GAG CTG 738 Thr Arg Thr Pro Glu Ser Asp Val Asp Asn Asp Pro Phe Pro Glu Leu 355 360 365 Printed from Mimosa 40 45 WO 98/56811 PCT/EP98/03662 GAC TCG CTG CCG GAG TTC CAG ACG GCA AAC GCG TCA ATA CTG CCC AAG 786 Asp Ser Leu Pro Glu Phe Gin Thr Ala Asn Ala Ser lie Leu Pro Lys 370 375 380 385 GAG GAG GTG CAG GAG CTG GGC AAC GAC GAC TGG CTC ATG GGG ATC AGC 834 Glu Glu Val Gin Glu Leu Gly Asn Asp Asp Trp Leu Met Gly lie Ser 390 395 400 CTC GAC GAC CTG CAG GGC CCC GGC TCC CTG ATG CTG CCC TGG GAC GAC 882 Leu Asp Asp Leu Gin Gly Pro Gly Ser Leu Met Leu Pro Trp Asp Asp 405 410 415 TCC TAC GCC GCC TCG TTC CTG TCG CCG GTG GCC ACG ATG AAG ATG GAG 930 Ser Tyr Ala Ala Ser Phe Leu Ser Pro Val Ala Thr Met Lys Met Glu 420 425 430 CAG GAC GTC AGC CCA TTC TTC TTC TGAGCTCTCA ATACTCTCAC GGTCGCACTG 984 Gin Asp Val Ser Pro Phe Phe Phe 435 440 TTGTGTGCGG CGTAACTGTA GATAGTTCAC ATTTGTTCAG GATTTATTTG TAACGTTGCT 1044 TCTTTTATAC GATACTCTCT TCCTTTCTAA AAAAAAAAAA AAAAAA 1090 (2) INFORMATION FOR SEQ ID NO- 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 287 amino acids (B) TYPE: amino acid (D) TOPOLOGY- linear (n) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: Met Val Met Ala Ala Ala Glu Arg Arg Asp Ala Glu Ala Glu Leu Asn 15 10 15 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Ala 20 25 30 Asp Tyr Leu Cys Ala Arg Ala Ala Gly Arg Ala Pro Pro Val Pro lie 35 40 45 lie Ala Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu 50 55 60 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp 65 70 75 80 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Ala Ala Gly Gly Gly Printed from Mimosa 40 45 50 55 WO 98/56811 PCT/EP98/03662 85 90 95 Tyr Trp Lys Ala Thr Gly Ala Asp Arg Pro Val Ala Arg Ala Gly Arg 100 105 110 Thr Val Gly He Lys Lys Ala Leu Val Phe Tyr His Gly Arg Pro Ser 115 120 125 Ala Gly Val Lys Thr Asp Trp lie Met His Glu Tyr Arg Leu Ala Gly 130 135 140 Ala Asp Gly Arg Ala Ala Lys Asn Gly Gly Thr Leu Arg Leu Asp Glu 145 150 155 160 Trp Val Leu Cys Arg Leu Tyr Asn Lys Lys Asn Gin Trp Glu Lys Met 165 170 175 Gin Arg Gin Arg Gin Glu Glu Glu Ala Ala Ala Lys Ala Ala Ala Ser 180 185 190 Gin Ser Val Ser Trp Gly Glu Thr Arg Thr Pro Glu Ser Asp Val Asp 195 200 205 Asn Asp Pro Phe Pro Glu Leu Asp Ser Leu Pro Glu Phe Gin Thr Ala 210 215 220 Asn Ala Ser lie Leu Pro Lys Glu Glu Val Gin Glu Leu Gly Asn Asp 225 230 235 240 Asp Trp Leu Met Gly lie Ser Leu Asp Asp Leu Gin Gly Pro Gly Ser 245 250 255 Leu Met Leu Pro Trp Asp Asp Ser Tyr Ala Ala Ser Phe Leu Ser Pro 260 265 270 Val Ala Thr Met Lys Met Glu Gin Asp Val Ser Pro Phe Phe Phe 275 280 285 (2) INFORMATION FOR SEQ ID NO: 11: (l) SEQUENCE CHARACTERISTICS: <A) LENGTH: 1295 base pairs (B) TYPE: nucleic acid <C> STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (m) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE- (A) ORGANISM Triticum monococcum (ix) FEATURE: (A) NAME/KEY- CDS (B) LOCATION:109..1161 Printed from Mimosa (xa) SEQUENCE DESCRIPTION: SEQ ID NO: 11 ATTCGGCACG AGATCACCTC TAACATCTCG ATCTACCTCT TCCTCCTCCT CAGCTCTCGT 60 TCCATCAGGT TCTTCCACAG CGTAGCAAGG CAATCTAGTA GATCCTCC ATG TCG GAC 117 Met Ser Asp 290 GTG ACG GCG GTG ATG GAT CTG GAG GTG GAG GAG CCG CAG CTG GCG CTT 165 Val Thr Ala Val Met Asp Leu Glu Val Glu Glu Pro Gin Leu Ala Leu 295 300 305 CCA CCG GGG TTC CGG TTC CAC CCC ACC GAC GAG GAG GTG GTC ACC CAC 213 Pro Pro Gly Phe Arg Phe Has Pro Thr Asp Glu Glu Val Val Thr Has 310 315 320 TAC CTC ACC CGC AAG GTC CTC CGC GAA TCC TTC TCC TGC CAA GTG ATC 261 Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys Gin Val lie 325 330 335 ACC GAC GTC GAC CTC AAC AAG AAC GAG CCG TGG GAG CTC CCG GGC CTC 309 Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu Pro Gly Leu 340 345 350 GCG AAG ATG GGC GAG AAG GAG TGG TTC TTC TTC GCG CAC AAG GGT CGG 357 Ala Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Ala Has Lys Gly Arg 355 360 365 370 AAG TAC CCG ACG GGG ACG CGC ACC AAC CGG GCG ACG AAG AAG GGG TAC 405 Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys Lys Gly Tyr 375 380 385 TGG AAG GCG ACG GGG AAG GAC AAG GAG ATC TTC CGC GGC AAG GGC CGG 453 Trp Lys Ala Thr Gly Lys Asp Lys Glu lie Phe Arg Gly Lys Gly Arg 390 395 400 GAC GCC GTC CTT GTC GGC ATG AAG AAG ACG CTC GTC TTT TAC ACC GGC 501 Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe Tyr Thr Gly 405 410 415 CGC GCC CCC AGC GGC GGG AAG ACG CCG TGG GTG ATG CAC GAG TAC CGC 549 Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met Has Glu Tyr Arg 420 425 430 Printed from Mimosa 40 45 50 55 WO 98/56811 PCT/EP98/03662 CTC GAG GGC GAG CTG CCC CAT CGC CTT CCC CGC ACC GCC AAG GAC GAT 597 Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Ala Lys Asp Asp 435 440 445 450 TGG GCT GTT TGC CGG GTG TTC AAC AAA GAC TTG GCG GCG AGG AAT GCG 645 Trp Ala Val Cys Arg Val Phe Asn Lys Asp Leu Ala Ala Arg Asn Ala 455 460 465 CCC CAG ATG GCG CCG GCG GCC GAC GGT GGC ATG GAG GAC CCG CTC GCC 693 Pro Gin Met Ala Pro Ala Ala Asp Gly Gly Met Glu Asp Pro Leu Ala 470 475 480 TTC CTC GAT GAC TTG CTC ATC GAC ACC GAC CTG TTC GAC GAC GCG GAC 741 Phe Leu Asp Asp Leu Leu lie Asp Thr Asp Leu Phe Asp Asp Ala Asp 485 490 495 CTG CCG ATG CTC ATG GAC TCT CCG TCT GGC GCT GAC GAC TTC GCC GGC 789 Leu Pro Met Leu Met Asp Ser Pro Ser Gly Ala Asp Asp Phe Ala Gly 500 505 510 GCT TCG AGC TCC ACC TGC AGC GCG GCC CTG CCG CTT GAG CCG GAC GCG 837 Ala Ser Ser Ser Thr Cys Ser Ala Ala Leu Pro Leu Glu Pro Asp Ala 515 520 525 530 GAG CTA CCG GTG CTG CAT CCG CAG CAG CAG CAG AGC CCC AAC TAC TTC 885 Glu Leu Pro Val Leu His Pro Gin Gin Gin Gin Ser Pro Asn Tyr Phe 535 540 545 TTC ATG CCG GCG ACG GCC AAC GGC AAT CTT GGC GGC GCC GAG TAC TCA 933 Phe Met Pro Ala Thr Ala Asn Gly Asn Leu Gly Gly Ala Glu Tyr Ser 550 555 560 CCC TAC CAG GCT ATG GGG GAC CAG CAG GCC GCG ATC CGC AGG TAC TGC 981 Pro Tyr Gin Ala Met Gly Asp Gin Gin Ala Ala lie Arg Arg Tyr Cys 565 570 575 AAG CCG AAG GCG GAG GTA GCG TCT TCG TCG GCG CTG CTG AGC CCT TCG 1029 Lys Pro Lys Ala Glu Val Ala Ser Ser Ser Ala Leu Leu Ser Pro Ser 580 585 590 CTG GGC TTG GAC ACG GCG GCG CTT GCC GGC GCG GAG ACC TCC TTC CTG 1077 Leu Gly Leu Asp Thr Ala Ala Leu Ala Gly Ala Glu Thr Ser Phe Leu 595 600 605 610 ATG CCG TCA TCG CGG TCG TAC CTC GAT CTG GAG GAG CTG TTC CGG GGC 1125 Met Pro Ser Ser Arg Ser Tyr Leu Asp Leu Glu Glu Leu Phe Arg Gly Printed from Mimosa 615 620 625 GAG CCT CTC ATG GAC TAC TCC AAC ATG TGG AAG ATC TGATGTGGAA 1171 Glu Pro Leu Met Asp Tyr Ser Asn Met Trp Lys lie 630 635 GATCTGGAGC GTCTCAGTTT GCTGGTAGCT ATAGATGGGT ATTTGGTTGA TGCTAGCTCT 1231 TCGACTGATT AGTTGCTTCA TTAACTTTCG ATTAAGGATT GAGTTAAAAA AAAAAAAAAA 1291 AAAA 1295 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH. 351 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (li) MOLECULE TYPE: protein (XI) SEQUENCE DESCRIPTION- SEQ ID NO: 12: Met Ser Asp Val Thr Ala Val Met Asp Leu Glu Val Glu Glu Pro Gin 15 10 15 Leu Ala Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val 20 25 30 Val Thr His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys 35 40 45 Gin Val lie Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu 50 55 60 Pro Gly Leu Ala Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Ala His 65 70 75 80 Lys Gly Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys 85 90 95 Lys Gly Tyr Trp Lys Ala Thr Gly Lys Asp Lys Glu lie Phe Arg Gly 100 105 110 Lys Gly Arg Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe 115 120 125 Tyr Thr Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His 130 135 140 Glu Tyr Arg Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Ala 145 150 155 160 Lys Asp Asp Trp Ala Val Cys Arg Val Phe Asn Lys Asp Leu Ala Ala Printed from Mimosa 165 170 175 Arg Asn Ala Pro Gin Met Ala Pro Ala Ala Asp Gly Gly Met Glu Asp 180 185 190 Pro Leu Ala Phe Leu Asp Asp Leu Leu lie Asp Thr Asp Leu Phe Asp 195 200 205 Asp Ala Asp Leu Pro Met Leu Met Asp Ser Pro Ser Gly Ala Asp Asp 210 215 220 Phe Ala Gly Ala Ser Ser Ser Thr Cys Ser Ala Ala Leu Pro Leu Glu 225 230 235 240 Pro Asp Ala Glu Leu Pro Val Leu His Pro Gin Gin Gin Gin Ser Pro 245 250 255 Asn Tyr Phe Phe Met Pro Ala Thr Ala Asn Gly Asn Leu Gly Gly Ala 260 265 270 Glu Tyr Ser Pro Tyr Gin Ala Met Gly Asp Gin Gin Ala Ala lie Arg 275 280 285 Arg Tyr Cys Lys Pro Lys Ala Glu Val Ala Ser Ser Ser Ala Leu Leu 290 295 300 Ser Pro Ser Leu Gly Leu Asp Thr Ala Ala Leu Ala Gly Ala Glu Thr 305 310 315 320 Ser Phe Leu Met Pro Ser Ser Arg Ser Tyr Leu Asp Leu Glu Glu Leu 325 330 335 Phe Arg Gly Glu Pro Leu Met Asp Tyr Ser Asn Met Trp Lys lie 340 345 350 Printed from Mimosa Applicant's or agent's file reference number 198.091/EXT International application Ko INDICATIONS RELATING TO A DEPOSITED MICROORGANISM (PCT Rule I 3bts) A. The indications made below relate to the microorganism referred to in the description on page , line 20 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet □ Name of depositary institution COLECCI6N ESPANOLA DE CULTIVOS TIPO Address of depositary institution (including postal code and country) Microbiology Department Biological Science Faculty/UNIVERSITY OF VALENCIA 46100 Burjasot /Valencia/Spain Date of deposit 11th June 1997 Accession Number CECT 4889 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet □ D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States) E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable) The indications listed below will be submitted to the International Bureau later (specify the general nature cfthe indications e.g. "Accession Number of Deposit") For receiving Office use only [33 This sheet was received with the international application Authonzed officer L.R. Pethe.

For International Bureau use only □ This sheet was received by the International Bureau on Authonzed officer Form PCT/RO/134 (July 1992) 44 Printed from Mimosa Applicant's or agent's file reference number 198.091/EXT International application No INDICATIONS RELATING TO A DEPOSITED MICROORGANISM (PCT Rule 136«) A The indications made below relate to the microorganism referred to in the description on page 9 , line 21 B. IDENTIFICATION OF DEPOSIT Further deposits arc identified on an additional sheet □ Name of depositary institution C0LECCI6N ESPANOLA DE CULTIVOS TIPO Address of depositary institution (including postal cade and country) Microbiology Department Biological Science Faculty/UNIVERSITY OF VALENCIA 46100 Burjasot/Valencia/Spain Date of deposit 11th June 1997 Accession Number CECT 4890 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet □ D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States) E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable) The indications listed below will be submitted to the Internauonal Bureau later (specify the genera! nature cf the indications e.g, "Accession Number of Deposit") For receiving Office use only [XI This sheet was received with the international application Authonzed officer L.R. Pettier For International Bureau use only □ This sheet was received by the International Bureau on: Authonzed officer Form PCT/RO/134 (July 1992) 45 Printed from Mimosa

Claims (40)

44 What We Claim Is:

1. A method of controlling a plant cell cycle by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA characterised in that the protein or peptide comprises an amino acid sequence of homology of at least 70% to that of SEQ ID No 6 or SEQ ID No 8 and the method comprises incorporating a nucleic acid into the plant cell which (a) encodes for the protein or peptide, (b) is antisense to the nucleic acid (a) encoding the protein or peptide, (c) downregulates expression of native nucleic acid encoding the protein or peptide by gene silencing coexpression or (d) encodes for a protein or peptide which binds to a polypeptide sequence SEQ ID No 6 or SEQ ID No 8.

2 . A method as claimed in Claim 1 characterised in that the control of the plant cell cycle comprises one or more of control of plant cell or plant virus growth and/or replication, plant cell differentiation, plant cell development and/or senescence. INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received V0\ hiJA-MljbNCHL.N 05 2- b-U'J . m •'» G2-AGO-9S 10:ZS Ua-UNGRIA S A. 45 • J l 1 i Otj I 1 i -• 14136417 -i-t.; o:j iuo ,t T"78l P 07/13 F-223 PCT-CHAPTER II 10

3. A method as claimed in any one of the preceding claims characterised ir. tnat the proiem cr peptide comprises an amino acid sequence having at least 70% sequence homology to S£Q ID No 3 or SEQ ID no 4 .

4. A method as claimed in any one of the preceding claims characterised in tnat it comprises overproducing or ur.derDroducing the protein or peptide in the clant -— cell.

5. A method as claimed in any one of the preceding claims characterised in that the nucleic acid is in the form of recombinant nucleic acid. 15

6. A method as claimed in Claim 5 characterised in that the sequence is positioned behind a pronotor capable of supporting expression of the protein or peptide comprising an amino acid sequence having at least 7 0% homology to that of SEQ ID No 6 or SEQ ID No 8, or 20 production of antisense RNA to the nucleic acid sequence encoding the protein or peptide. 25

7. A method as claimed in any one of Claims 1 to 6 characterised in that the protein or peptide is produced ectopically. AMENDED SHEET 46 50 052

8. A method as claimed in Claim 7 characterised in that the protein or peptide is produced in vegetative tissue or stem tissue.

9. A method as claimed in any one of the preceding claims characterised in that it comprises producing or inhibiting senescence in a plant cell comprising increasing or decreasing the plant cell levels of a protein or peptide comprising a sequence having at least 50% homology to that of SEQ ID No 10.

10. A method as claimed m Claim 1 (d) characterised in that the binding agent is Geminivirus RepA protein or an N-terminally truncated Geminivirus RepA protein comprising the C-terminal amino acids 228 to 264.

11. A protein or peptide in enriched, isolated, cell free and/or recombinantly produced form characterised in that it has at least 70% amino acid sequence homology with that of SEQ ID No 6 or SEQ ID No 8 and is capable of binding with Geminivirus RepA.

12. A protein or peptide as claimed m Claim 11 characterised in that it comprises an amino acid sequence of SEQ ID No 10 or 12 or a functional variant thereof having an amino acid sequence of homology of at least 70% with that sequence. intellectual property OFFICE OF N.Z. 2 4 AUG 2001 received 47

13. An enriched, isolated, cell free and/or recombinant nucleic acid characterised in that it (a) encodes for a protein or peptide comprising an amino acid sequence of homology of at least 70% to that of SEQ ID No 6 or SEQ ID No 8, (b) is antisense to nucleic acid encoding for that protein or peptide or (c) downregulates expression of native nucleic acid encoding that protein or peptide by gene silencing coexpression.

14. A nucleic acid as claimed in Claim 13 characterised in that it is a DNA or RNA polynucleotide comprising one or more of SEQ ID No 1, 2, 5, 7, 9 or 11 or sequences that have at least 70% homology thereto.

15. A method of producing a protein or peptide as claimed in Claim 11 characterised in that it comprises expressing DNA or RNA as described in Claim 13 or 14.

16. An enriched, isolated, cell free and/or recombinant nucleic acid characterised in that it encodes for an N-terminally truncated Geminivirus RepA protein comprising the RepA protein C-terminal ammo acids 228 to 264.

17. A nucleic acid transformation vector characterised in that it comprises DNA or RNA as described in Claims 13 or 14. INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 RECEIVED 50 48

18. A method for producing transformed cells comprising nucleic acid as claimed in or described in any one of Claims 1 to 17 comprising introducing said nucleic acid into the cell in vector or free form.

19. A method as claimed in Claim 18 characterised in that the nucleic acid is introduced directly by electroporation or particle bombardment.

20. A cell comprising recombinant nucleic acid as described or claimed in any one of Claims 1 to 17.

21. A transgenic plant or part thereof comprising a cell as claimed m Claim 20.

22 . A plasmid containing a DNA of sequence coding for a protein of SEQ ID No 10 or SEQ ID No 12 as described herein as deposited under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms of 1977; these being deposited on 11 June 1997 at the Coleccion Espanola de Cultivos Tipo, with the accession numbers CECT 4889 or CECT 4890.

23. A method of controlling plant cell or plant virus replication by increasing or decreasing the plant cell level or binding capabilities of protein or peptide that is capable of binding Geminivirus RepA characterised in that the protein or peptide comprises an amino acid sequence of homology of at least 70% to that of INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received 49 SEQ ID No 3 or SEQ ID No 4 and the method comprises incorporating a nucleic acid into the plant cell which (a) encodes for the protein or peptide, (b) is antisense to nucleic acid (a) encoding the protein or peptide or (c) downregulates expression of native nucleic acid encoding the protein or peptide by gene silencing coexpression.

24. A method as claimed in Claim 23 characterised in that the protein or peptide comprises an amino acid sequence having at least 90% sequence homology to SEQ ID No 3 or SEQ ID No 4.

25. A method as claimed in any one of Claim 23 or Claim 24 characterised in that it comprises overproducing or underproducing the protein or peptide in the plant cell.

26. A method as claimed in any one of Claims 23 to 25 characterised in that the nucleotides are in the form of recombinant nucleic acid comprising the protein or peptide encoding sequence.

27. A method as claimed in Claim 26 characterised in that the sequence is positioned behind a promotor capable of supporting expression of the protein or peptide, or capable of production of antisense RNA to the nucleic acid sequence.

28. A method as claimed in any one of Claims 23 to 27 characterised in that the protein or peptide is produced ectopically. INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received

29. A method as claimed in Claim 28 characterised in that the protein or peptide is produced in vegetative tissue or stem tissue.

30. A method of controlling a plant cell cycle as defined in Claim 1 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

31. A protein or peptide as defined in Claim 11 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

32. An enriched, isolated, cell free and/or recombinant nucleic acid as defined in Claim 13 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

33. A method as claimed in Claim 15 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

34. An enriched, isolated, cell free and/or recombinant nucleic acid as claimed in Claim 16 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 RECEIVED 50 0 51

35. A nucleic acid transformation vector as claimed in Claim 17 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

36. A method as defined in Claim 18 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

37. A cell comprising recombinant nucleic acid as claimed in Claim 2 0 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

38. A transgenic plant or part thereof as claimed in Claim 21 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

39. A plasmid as claimed in Claim 22 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

40. A method as defined in Claim 23 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. END OF CLAIMS INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 AUG 2001 received