MXPA99011519A

MXPA99011519A - Plant grab proteins

Info

Publication number: MXPA99011519A
Application number: MXPA/A/1999/011519A
Authority: MX
Inventors: Gutierrezarmente Crisanto; Xie Qi; Pelayo Andres
Original assignee: Consejo Superior De Investigaciones Cientificas; Gutierrezarmenta Crisanto; Xie Qi; Sanzburgos Andres
Priority date: 1997-06-12
Filing date: 1999-12-10
Publication date: 2000-06-01

Abstract

A method of controlling plant cell and plant virus growth and/or replication, plant cell cycle, differentiation, development and/or scenescence is provided characterised in that it comprises increasing or decreasing the levels or binding capabilities of GRAB (Geminivirus RepA Binding) proteins other than Rb (Retinoblastoma) proteins within plant cells.

Description

VEGETABLE GRAFT PROTEINS DESCRIPTION OF THE INVENTION The present invention relates to methods for controlling the cell cycle of plants, particularly for the purpose of controlling the plant cell and the growth of plant viruses and / or replication, differentiation, development and / or senescence, for the use of non-native proteins. identified and / or non-isolated and / or nucleic acids in such methods, with the use of known proteins and nucleic acids of a native function previously unknown in such methods, with the proteins and nucleic acids per se not identified and / or not isolated, and in enriched, isolated, cell-free and / or recombinant form, and with plants comprising such recombinant nucleic acids. It has been well documented that the successful completion of viral replication cycles within infected cells usually requires the participation of cellular factors. This is particularly evident in the case of viruses with small genomes that code only for some proteins. For example, animal DNA viruses use the cellular machinery for their processes of transcription and DNA replication. In addition, it has been elucidated that one or more virally encoded proteins have ref. 31925 directly on the physiology of the infected cell to create an appropriate cellular environment for viral replication. A typical example is that of oncoproteins encoded by animal DNA tumor virus, ie, SV40 T antigen, E1A adenovirus proteins or human papilloma virus E7, which activates the cell cycle in the infected cell by interfering with the retinoblastoma pathway (26, 28, 45). A similar strategy seems to have evolved in plant geminivirus, a unique group of DNA plant viruses. The genome of geminivirus consists of one or two small DNA molecules (2.6-3.0 kb) of single chain and circular, which depend on the subgroups (11, 24). The geminivirus of wheat dwarfism (WDV) belongs to subgroup I whose members have the smallest genome, a single ssDNA molecule, 2750 nucleotides in length, which codes only for some proteins. Among these, only RepA (also called Cl) and Rep (also called C1: C2) are the only WDV proteins necessary for transcription and viral replication (24). The RepA protein is translated from a single transcript produced under the control of the complementary-direct promoter. After a splicing event of this mRNA, the Rep protein (37) is produced. Rep of WDV, absolutely necessary for viral DNA replication and this is the homolog for the Rep proteins of all geminiviruses. It has been demonstrated that Rep geminivirus has an in vitro DNA cutting and binding activity, recognition capacity of origin and ATPase activity. However, the RepA protein is unique to the WDV geminivirus subgroup and has been implicated in the modulation of Rep activity, protein binding of plant retinoblastomas (Rb) (45, 46) and stimulation of gene expression direct virion. In addition, it has recently been shown that WDV, the protein that binds Rb (RepA) and the initiator protein (Rep) seem to play coordinated roles during viral DNA replication. DNA replication of geminivirus occurs in the nucleus of infected cells and, due to the lack of replicative enzymes encoded by the viral genome, requires the S-phase functions. Consistent with this, is the accumulation of replicative intermediates in the nuclei in S phase (1). Geminiviruses usually infect nonproliferative cells but, interestingly, they induce the appearance of cellular proteins typical of the S phase, such as the proliferating cell nuclear antigen (PCNA) (29) which are thus undetectable in non-proliferating cells. . Geminivirus subgroup I such as WDV code for proteins that contain the LXCXE motif in the RepA protein, which mediates its ability to interact with Rb, involved in the mechanism by which geminiviruses affect the activation circuit of the cell cycle (45). These observations serve as a basis for isolating the full length cDNA encoding ZmRbl, a plant Rb protein, which can act as a regulator of Gl / S transit in plant cells (46). Consists with this function, there is the overexpression of plant Rb (as well as human Rb) in cultured plant cells which significantly inhibits the replication of WDV DNA (45, 46). Therefore, it seems that at least one of the mechanisms used by geminivirus to favor DNA replication is the activation of an S phase in the infected cell by sequestering Rb, and consequently, by interfering with its negative cell growth activity. . Regulation of the cell cycle, in growth, and differentiation in plants is the result of a complex relationship of regulators whose activity is the response to a wide variety of signals such as hormones, nutritive capacity or environmental conditions (20, 39). For example, a rapid increase in the concentrations of type D cyclin mRNAs are presented in response to sucrose or cytokinin treatment (41) while those of cyclin-dependent kinase (cdc2) mRNAs depend on the presence of auxin. The molecular nature of plant cell cycle regulators as well as their function in relation to cell growth and differentiation remain largely unknown. Therefore, it is important to identify the cellular factors involved in these control pathways to elucidate the molecular mechanisms that govern the response of plant cells to growth signals. Due to the absolute requirement for cellular factors to complete geminivirus replication, the present inventors postulated that geminiviruses can modulate cellular physiology by mechanisms other than interference with the Rb pathway and that such effect may be the consequence of the act of directing factors Cells, hitherto unknown, by the geminivirus proteins. An experimental strategy has been used to identify proteins that functionally interact with RepA, the protein that binds to WDV Rb, and now several cDNA clones have been provided that encode previously unidentified proteins and their function has been determined. Based on the analysis of the amino acid sequence, it has been determined that the proteins share a common N terminal domain, necessary for the interaction with the viral RepA protein, while their terminal C domains are unique among each of them. They can represent members, similar to the transcriptional regulatory activity, of a much larger family of proteins related to hormone regulators and nutrient response, meristem development and plant senescence. Therefore, in a first aspect of the present invention, there is provided a method for controlling the cycle of the plant cell, characterized in that it comprises increasing or decreasing the concentrations of proteins or peptides GRAB (which bind to RepA of geminivirus), or increase or decrease the binding capacities of proteins or peptides GRAB, within plant cells. Such control, for example, allows the control of the growth and / or replication of plant cells, the growth of plant viruses within the cells, the differentiation of plant cells, the development and / or senescence. It will be understood that such proteins and peptides are different from Rb (retinoblastomas), particularly those described hereinafter with respect to the sequence listing and its functional variants. The increase or decrease in protein peptide concentrations of GRAB can be obtained by overproduction or byproduction of protein or peptide in a plant cell, that is, compared to the normal level of production of the protein or peptide in the cell. A decrease in native GRAB binding activity can be obtained for example, by application of a protein or peptide binding agent GRAB, for example such as WDV RepA or a functional part or a variant thereof. Particularly, the GRAB proteins or peptides for use in this method are those comprising the amino acid sequence SEC. FROM IDENT. NO .: 2 or 4, as shown herein, or a functional variant thereof that is capable of binding RepA of geminivirus. The preferred proteins or peptides have the amino acid sequence homology of at least 70% with that of SEC. FROM IDENT. NO .: 2 or 4, more preferably at least 90%, and more preferably at least 95%. Particularly, the GRAB proteins are those in which the first 200 N-terminal amino acids are capable of binding to the viral protein RepA; more preferably, the first 170 N-terminal amino acids are capable, and most preferably, the first 150 amino acids. These methods may comprise the direct application of such GRAB proteins or peptides to plant cells or whole plants, but more conveniently will involve the use of encoding or antisense nucleotides for the corresponding protein or GRAB peptide, i.e., nucleic acids placed within the cells, particularly by the use of recombinant nucleic acid, for example, recombinant DNA comprising a coding sequence for the GRAB protein or peptide, placed in the cell behind a promoter capable of supporting the expression of the GRAB protein or peptide or the production of antisense RNA. The nucleic acids encoding the GRAB protein can be used to produce GRAB when required, for example, ectopically in a tissue where it is not normally expressed, for example a vegetative tissue or stem tissue, such as xylem or phloem. An alternative strategy may comprise expressing a peptide that binds to a GRAB protein, for example, RepA of geminivirus, a functional variant thereof or a portion that binds to GRAB protein thereof, such as the C-terminal portion. Such a peptide would bind to the native GRAB proteins and inhibit their activity. It will be appreciated that any expression of RepA and particularly only a part that binds to the GRAB protein thereof such as a RepA with a truncated N-terminal part, in a transgenic plant different from that produced by a complete intact geminivirus, will be novel. . A cDNA encoding for RepA in a functional relationship with a promoter or other regulatory sequence in a DNA or RNA vector or a DNA construct will be particularly useful for such a purpose. It will be appreciated that a more effective method for delivering proteins and peptides of the invention to plant cells is by expressing the nucleic acid encoding the same in itself. Such a method is conventionally carried out by incorporating oligonucleotides or polynucleotides, having sequences encoding the peptide or protein, into the DNA of the plant cell. Such nucleotides can also be used to down-regulate the expression of native GRAB by silent gene expression (6) or through antisense strategy. By using mutagenesis techniques, for example such as SDM, the nucleotides of the invention can be designed and can be produced to encode proteins and peptides which are functional variants or overactivated or inactivated in some other way, for example, with respect to to the union, of the invention. It will be appreciated by those skilled in the art that suitable promoters may be continuously active or may be inducible. It will be appreciated by those skilled in the art that inducible promoters will have advantages insofar as they are capable of providing alteration of the activity of the GRAB protein mentioned above only when required, for example, when in danger of infection viral, or when the plant is otherwise particularly vulnerable, or at a particular stage of cell development. Such promoters can be induced, for example, by environmental conditions such as stress inducing conditions, for example reduced availability of water caused by drying or freezing or by complex entities such as plant hormones, for example stress signaling hormones from plant to plant , or by simpler entities such as particular cations or anions, for example metal cations. No particular limitations are considered regarding the type of promoter used. Numerous specific examples of methods used to produce transgenic plants by cDNA insertion along with suitable regulatory sequence will be known to those familiar in the art. For example, plant transformation factors have been described by Denecke et al., (1992) EMBO J. 11, 2345-2355 and their further use to produce transgenic plants that produce trehalose described in US patent application No., of series 08 / 290,301, EP 0339009 Bl and US 5250515 that describe strategies to insert heterologous genes in plants (see column 8 to 26 of US 5250515). Pollen electroporation for producing both transgenic monocotyledonous and dicotyledonous plants is described in US 5629183, US 7530485 and US 7350356. Additional details can be found in reference works such as Recombinant Gene Expression Protocols, (1997) Edit Rocky S Tuan, Humana Press. ISBN 0-89603-333-3, 0-89603-480-1. It will be noted that no particular limitation is provided or considered regarding the type of transgenic plant that is provided; all types of plants, monocotyledonous or dicotyledonous, can be produced in transgenic form incorporating the nucleic acid of the invention to the extent that the activity of GRAB in the plant is altered, constitutively, ectopically or temporarily. A preferred embodiment of the first aspect of the invention provides a method for producing or inhibiting senescence in a plant cell, comprising increasing or decreasing the activity levels of the GRAB protein or peptide, particularly the GRAB1 protein of SEQ. FROM IDENT. NO .: 10 or a functional variant thereof capable of inducing senescence in N. bentamian plants in a plant cell. Again, such increase or decrease is obtained more effectively by the incorporation of nucleic acid, in this case from the SEC. FROM IDENT. NO .: 9 or a functional variant thereof, or can be obtained by using DNA encoding for RepA. A second aspect of the present invention provides novel GRAB proteins or peptides per se and in enriched, isolated, cell-free and / or recombinantly produced form. Such proteins or peptides can occur naturally or can be conservatively substituted homologs thereof, as referenced in the following. Preferred proteins and peptides have an N-terminal sequence having 90% or more of N-terminal 200 amino acid homology (most preferably with the first 170, and much more preferably with the first 150) of GRAB1 or GRAB2 described in the present, more preferably with 95%, and much more preferably with 98% or more. Preferred peptides comprise the sequence of the first 150 to 200 amino acids of any of these sequences, or the conservatively substituted variants thereof. Preferred peptides comprise such a sequence without the C terminal sequence of SENU, NAM, ATAF1 or ATAF2 shown in Figure 4 appended thereto. Particularly, the GRAB proteins and peptides are those that comprise an amino acid sequence of SEQ. FROM IDENT. NO .: 3 or 4, as shown herein, or a functional variant thereof that is capable of binding RepA of geminivirus and having the amino acid sequence homology of at least 70% with that of SEC. FROM IDENT. DO NOT. : 3 or 4, more preferably at least 90% and much more preferably at least 98%. More preferably, they comprise the SEC. FROM IDENT. NO .: 6 or 8 or such homology is limited to the functional variant thereof and more preferably the SEC. FROM IDENT. NO .: 10 or 12 or such homology of the limited functional variant thereof.

When the protein or peptide comprises SEC. FROM IDENT. DO NOT. : 3 or 4, it is not SENU, NAM, ATAF1 or ATAF2. The proteins or peptides can be derived from a native protein or peptide that codes for DNA that has been altered by mutagenic techniques, for example using chemical mutagenesis or mutagenic PCR. A third aspect of the present invention provides a GRAB protein or peptide that encodes antisense nucleic acid per se and in enriched, isolated, cell-free and / or recombinant form. Particularly a direct and antisense DNA is provided in the form of individual oligonucleotides and polynucleotides, with the proviso that DNA does not code for the complete amino acid sequence of SENU, NAM, ATAF1 or ATAF2, as shown in Figure 4. Specifically provided nucleic acid, for example, in the form of nucleotides, but preferably in the form of recombinant DNA or cRNA (mRNA) encoding the expression of the GRAB protein having an N-terminal sequence with at least 60% homology with the first 200 amino acids of the N-terminal part of GRAB1 or GRAB2, as described herein, that is, its first 200 codons have such homology. Preferably, the homology is at least 75%, and more preferably it is 90%.

The preferred nucleic acid is DNA or RNA comprising SEQ. FROM IDENT. NO .: 1, 2, 5, 7, 9 or 11 or a functional variant thereof having the homology limitations referred to above. The most preferred DNA is that of SEC. FROM IDENT. DO NOT. : 9 or 11, or a functional variant thereof. With respect to the specification and the claims, the following technical terms are used according to the definition made below, unless otherwise specified. A "functional variant" of a peptide, protein, nucleotide or polynucleotide is a peptide, protein, nucleotide or polynucleotide, the sequence of amino acids or bases from which it can be derived from the amino acid or base sequence of the peptide, protein, nucleotide or original polynucleotide by the substitution, deletion and / or addition of one or more amino acid residues or bases such that, despite the change in amino acid sequence or base, the functional variant retains at least part of at least one of the biological activities of the original peptide, protein, nucleotide or polynucleotide in that it is detectable for a person to become familiar in the art. A functional variant is generally at least 50% homologous (ie, the sequence of amino acids or bases thereof is 50% identical), but advantageously at least 70% homologous and even more advantageously, at least 90% homologous to the synthetic native sequence from which it can be derived. Any functional part of a protein or a variant thereof is also called a functional variant. The term "overproduce" is used in the present in its most general possible sense. A special type of molecule (usually a protein, peptide, or oligopeptide or RNA) is said to be "overproduced" in a cell if it is produced at a significantly and detectably higher level (eg 20% higher) than the natural level. The overproduction of a molecule in a cell can be obtained through both traditional mutation techniques such as selection and genetic manipulation methods. The term "ectopic expression" is used herein to designate a special embodiment of overproduction in the sense that, for example, a protein is produced ectopically at a spatial point of the plant where it is naturally not expressed all (or not). detectable manner), ie, the protein or peptide is overproduced at that point. The term "underproduction" is intended to encompass the production of peptides, polypeptides, proteins or mRNA at a level significantly lower than the natural level (e.g., 20% or more in a minor amount), particularly at undetectable levels.

The DNA or RNA of the invention may have a sequence containing degenerate substitutions at the nucleotides of the codons in the sequence encoding proteins or GRAB peptides, for example GRAB1 or GRAB2, and in which the RNAUs replace the T of DNA. The preferred DNA or RNA per se are capable of hybridizing with the polynucleotides encoding GRAB1 or GRAB2 under conditions of low stringency, it being preferable also to be layers of such hybridization under conditions of high stringency. The terms "low stringency conditions" and "high stringency conditions" are of course fully understood by those familiar with the art, but are conveniently exemplified in US 5202257, column 9 and 10. When modifications are made, they should be considered for the expression of a protein with different amino acids in the same class as the amino acids corresponding to this sequence of GRAB proteins; that is, they are conservative substitutions. Such substitutions are known to those familiar with the art (see, for example, US 5380712) and are considered only when the protein is activated as a GRAB protein. In a fourth aspect of the present invention, a protein or peptide expressed by the recombinant DNA or RNA referred to in the second aspect above is provided, and new proteins or peptides derived from that DNA or RNA are produced, and the protein or peptide that is produced from DNA or RNA that has been altered by metagenic means such as the use of mutagenic polymerase chain reaction primers. Methods for producing the proteins or peptides of the invention characterized in that they comprise the use of DNA or RNA of the invention to express them from cells are also provided in this aspect. A fifth aspect of the present invention provides competing nucleic acid probes and primers with any 15 or more contiguous bases of the DNA sequences identified herein below as SEQ. FROM IDENT. NO .: 5, 7, 9 or 11, or complementary sequences or RNA sequences corresponding thereto; particularly of the first 150 DNA bases encoding the N-terminal part of such sequences. These probes and primers in the form of oligonucleotides and polynucleotides can also be used to identify peptides or GRAB proteins that occur naturally or that are produced synthetically using, for example, Blotting Southern or Blotting Northern. Oligonucleotides for use as probes conveniently comprise at least 18 consecutive bases of the sequences of SEQ. FROM IDENT. NO .: 5, 7, 9 or 11 in the present, and preferably are from 30 to 100 bases long, but can be of any length up to the complete or even larger sequence. For use as PCR or LCR primers, the oligonucleotides are preferably 10 to 20 bases long, but may be larger. The primers can be single-stranded, but there can be double-stranded probes, that is, they include complementary sequences. A sixth aspect of the present invention provides vectors comprising DNA or RNA of the third aspect of the invention. A seventh aspect of the present invention provides a method for producing transformed cells comprising nucleic acid of the invention, which comprises introducing the nucleic acid into the cell, in the form of a vector. An eighth aspect of the present invention provides a method for producing transformed cells comprising nucleic acid of the invention comprising introducing the nucleic acid into the cell directly, for example, by electroporation or bombardment of particles. Particularly provided is the electroporation of pollen cells.

A ninth aspect of the present invention provides cells, particularly plant cells, for example including pollen and seed cells, comprising the recombinant nucleic acid of the invention, particularly the DNA or RNA of the invention, and plants comprising such cells. Plasmids containing a DNA encoding the expression of the GRAB GRAB1 and GRAB2 proteins are described herein and have been deposited under the provisions of the Budapest Treaty regarding the International Recognition of the Deposit of Microorganisms of 1977; these were deposited on June 11, 1997 in the Spanish Type Culture Collection, with the access numbers CECT 4889 (this contains the sequence GRAB1) and CECT 4890 (this contains the sequence GRAB2).

LIST OF SEQUENCES The SEC. FROM IDENT. DO NOT . : 1 and 2 show the nucleotide sequences of GRAB1 and GRAB2, respectively, which code for the conserved NON to N5 domains with interposed bases labeled N. SEC. FROM IDENT. DO NOT. : 3 and 4 show the respective sequences of amino acids corresponding to SEC. FROM IDENT. NO .: 1 and 2.

SEQ ID NOS (show complete nucleotide sequences encompassing Ni to N5 of GRAB1 and GRAB2, respectively SEQ ID NO: 6 and 8 show the corresponding amino acid sequences of SEQ ID. NO .: 5 and 7. SEQ ID NO: 9 and 11 show the full-length sequences of isolated cDNA including coding regions for GRAB1 and GRAB2, respectively SEQ ID NO: 10 and 12 show the corresponding amino acid sequences of GRAB1 and GRAB2 proteins.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the results of Northen analysis for GRAB1 and GRAB2 transcripts. Figure 2 shows the results of studies carried out to identify the region of GRAB1 and GRAB2 which are involved in the union of RepA of WDV. Figure 3 shows the results of studies carried out to identify the RepA region of WDV involved in binding with GRAB proteins. Figure 4 shows the interaction results of two yeast hybrids using purified proteins. Figure 5 shows the alignment of various protein sequences, known and previously unknown, having the NI to N5 domains of GRAB protein for use in the method of the invention. Figure 6 shows the load distribution of these proteins. The present invention will now be further described by way of illustration only with reference to the following non-limiting examples. The additional modalities that are within the scope of the claims will occur to a person skilled in the art in light of these. In the examples that follow, the following methods were used.

MATERIALS AND METHODS DNA manipulations The K protein, restriction endonucleases or other enzymes for DNA manipulations are from Merck, Boehringer Mannheim, New England Biolabs and Promega. Standard DNA manipulation techniques were applied as described in [34]. DNA sequencing is carried out using the Applied Biosystem automatic sequencing device. The oligonucleotides were from Isogen Bioscience BV (Maarsen, The Netherlands).

Purification of DNA and RNA Genomic DNA and total RNA were isolated from wheat leaves, roots and suspensions of cultured cells by shredding the material, previously frozen in liquid nitrogen, essentially as described in [41]. The powder is mixed with extraction buffer (50 mM Tris-HCl, pH 6.0, 10 mM EDTA, 2% SDS, 100 mM LiCl), and after heating at 65 ° C with phenol (1: 1, 65 ° C) it is swirled for 20 seconds and centrifuged at 4 ° C for 15 minutes at 12,000 rpm. The supernatant is extracted twice with the same volume of phenol: chloroform (1: 1) and precipitated with a volume of 4M LiCl. After centrifugation, the RNA pellet is resuspended in TE buffer, and two volumes are added from ethanol to the liquid phase to precipitate the genomic DNA. The purification of poly (A) + mRNA is carried out, as described in [47].

Construction of the yeast two-hybrid cDNA library from cultured wheat cells micrograms of poly (A) + mRNA isolated from the suspension of cultured cells is used as a substrate, for cDNA synthesis using a cDNA synthesis kit (Stratagena) according to the manufacturer's instructions, the resulting double-stranded DNA , which contains EcoRI and Xhol ends, has an average size of 1.3 kb. A sample (500 mg) of this cDNA is ligated to 750 ng of the vector pGAD-GH digested with EcoRI / Xhol (Clontech) for 48 h at 8 ° C. After the ligation, the library dialyzes against distilled water and is subjected to electroporation in E. coli DH10B (Gibco). For convenience, the cDNA library is separated from 5 sublibraries, each containing ~ ß x 105 primary transformants. The total DNA of the library is obtained by plating primary transformants on 50 150 mm LB plates plus ampicillin. The colonies are scraped off in LB medium (+ Amp) and the plasmid DNA is prepared as described in [34].

Analysis of two yeast hybrids The yeast strain HF7c (MATa ura3-52 his-200 ade2-101 lys2-801 trpl -901 len2-3, 112 gal 4 -542 gal 80-538 LYS2:: GAL1UAS-GAL1TATA-HIS3 URA3:: GAL4 1 7mers (x3 ) -CyClTATA-The cZ; [15]), which contain the two indicator genes cZ and HIS3 are used in the analysis of two hybrids [4, 16]. The yeasts are first transformed, as described in [38], with pB RepA, a plasmid containing the complete open reading frame of WDV RepA fused to the Gal4 DNA binding domain (BD, RPT1 marker) in the vector pGBT8 [46] Then, they are transformed with pGAD-GH (AD, LEU2 marker) from a wheat cDNA library. The transformation mixture is plated on a drip separation selection of yeast from a medium lacking tryptophan, leucine and histenedine, and supplemented with 5 mM and 10 mM of 3-amino-1,2-triazole (3 -AT; [5]) to reduce the appearance of false-positive growing colonies. Transformants are recovered as usual, for a period of 3 to 8 days and verified to determine growth in the presence of up to 20 mM 3-AT. To corroborate the interaction between the two fusion proteins, an activity assay with β-galactosidase is performed by means of a replica filter assay as described in [7]. The plasmid DNA is recovered in the positive colonies by transformation in E. coli MH4, since the strain is LeuB ', and its defect can be complemented by the LEU2 gene present in the plasmid pGAD-GH. Deletions of GRAB1 are constructed using the restriction sites Apal (1-253), Salí (1-208), Sacl (1-52) and SacII (80-287) and selections of GRAB2 using the Xhol restriction sites ( 1-149), BglII (1-108), Sali (1-55) and Smal (66-351).

Production of GST fusion proteins and in vitro binding experiments To produce the GST-GRAB fusion proteins, the oligonucleotide GRAB1-ATG (5'GGATCCATGGTGATGGCAGCGG) and the T7 primer and the oligonucleotides GRAB2-ATG (5 'GGATCCATGGCGGACGTGACGGAGGTG) and the T7 primer are used to amplify the coding regions of GRAB1 and GRAB2, respectively, by PCR. The products are then cloned in frame within the vector pGEX-KG. GST-RepA is produced by cloning the WDV RepA ORF in frame, within the vector pGEX-KG. Transformants of E. coli BL21 (DE3) are grown to an OD600 of 0.6 to 0.9, and then induced to express the fusion protein at 37 ° C for 30 minutes by the addition of 1 mM IPTG. The GST fusion proteins are purified using glutathione-Sepharose spheres (Pharmacia). The labeled RepA protein is obtained by transcription in vi tro and translation (IVT) using wheat germ extract (Promega), in the presence of 35S-methionine, according to the manufacturer's instructions, GRABl and GRAB2 are produced labeled by the use of a TNT crosslinking lysate (Promega) after cloning of the same PCR products from the GRAB1 and GRAB2 genes in the plasmid pBluescriptKS and transcription using T7 RNA polymerase.

Plant cell culture A suspension culture of Tri tumum monooccum from P. Mullineaux (John Innes Center, United Kingdom) is obtained and maintained as described in [46].

Inoculation of N. Ben.thamia.na plants The vector pP2C2S derived from PVX [10] is used for the transient expression of GRAB proteins in N. Benthamiana plants. For the GRAB1 constructs, a 1.1 kb fragment of Smal-Xhol containing the full-length GRAB1 cDNA is cloned into the vector pP2C2S digested with Nrul / Sall to produce the plasmid pP2-GRABl. To construct a GRAB1 mutant with frame shift (GRABlFs), plasmid pP2-GRABl is partially digested with SacII and then ligated again with treatment with T-DNA polymerase. For GRAB2 constructs, a 1.35 kb Smal-Xhol fragment containing the complete GRAB2 cDNA is cloned, in a vector of pP2C2S digested with Nrul / Sall, to produce the plasmid pP2-GRAB2. To construct the frame shift mutation (GRAB2Fs), plasmid pP2-GRAB2 is digested with BstEII and religated after treatment with Klenow. Infectious RNA is obtained by transcription in vi tro of plasmid DNA digested with Spel, using the T7 Cap Scribe equipment (Boeringher Mannheim). RNA transcripts are diluted in 5 mM Na3P04 (pH 7.0) and used to inoculate three-week-old N. Benthamiana plants (4 in each case) using carborundum, as described in [10,17].

Transfection of cultured wheat cells by particle bombardment Cells are pelleted by centrifugation at 1000 rpm for 3 minutes and the supernatant is removed. Approximately 0.20-0.25 ml of the packed cells are dispersed with a spatula on Whatman # 1 filter paper, which is placed on CHS medium supplemented with 0.25 M mannitol [30] and solidified with 0.8% agar (bombardment medium). The conditions for DNA uptake and bombardment of particles are those described in [43, 46]. Overexpression of GRAB proteins in cultured wheat cells is carried out by cloning the coding regions in a plasmid [47] under the control of the 35S promoter of CaMV. The EcoRI-XhoI 1.1 kb fragment of GRAB1, the EcoRI-Apall 1.3 kb fragment cloned into GRAB2 plasmid digested with EcoRI / NdeI p35S.ZmRbl [47] to produce p35SGRABl and p35SGRAB2. These plasmids contain the 3 'untranslated region of ZmRbl. Each experimental point in time corresponds to a plate of independently transfected cell. The experiments are repeated at least 2 times.

DNA replication analysis of WDV The replication of WDV DNA is analyzed essentially as described in [43-46]. The cells are crushed in liquid nitrogen and the DNA is isolated essentially as described in [41] (Soni et al., 1994). After electrophoresis on agarose gels 0.7%, the DNA was transferred to nylon membranes (Biodyne) and is detected by hybridization to labeled probes-11-dUTP, according to the conditions recommended by the manufacturer (equipment label DIG DNA detection, Boehringer Mannheim).

EXAMPLE 1 Isolation of cDNAs encoding GRAB protein Making use of the 2-yeast hybrid solution (Fields and Song, 1989; Fields, 1993), a cDNA library is constructed from mRNA that is prepared from an actively growing wheat cell suspension culture. The analysis is carried out using WDV RepA fused to the Gal4 DNA binding domain. A significant amount of cDNA clones of cotransformants are allowed to grow in a selective medium (-his, + 3AT). Among those that appear during the first 6 days after the transformation, those cotransformants that show a stronger interaction, based on their ability to grow in the presence of 3AT > 20 mM, and of producing an intense ß-gal signal. The partial analysis of the DNA sequence shows the existence of a group of 7 cDNA clones whose 5 'sequence is significantly related, although it represents different clones, as inferred by restriction analysis. Based on their ability to interact with WDV RepA, the proteins encoded by this group of cDNA clones are called GRAB proteins (which bind to Geminivirus RepA). Two proteins of GRAB, GRAB1 and GRAB2 are described in this document. Each protein encoded by cloned cDNA which binds strongly to RepA from WDV in yeast. The cDNA clones for GRAB1 and GRAB2 are -1.1 kbp in length and each has a unique open reading frame, which includes a putative ATG translation start site. The complete cDNA sequence and the deduced amino acid sequence for the two GRAB proteins are shown in the sequence listing as SEQ. FROM IDENT. NO .: 9 to 12. Isolated clones containing the full-length coding region with the sequence around the first putative methionine show a good consensus translation initiation sequence. The amino acid analysis of the GRAB1 and GRAB2 proteins shows certain surprising features. First, the two proteins are completely unrelated to their C-terminal portions, although they appear to be highly related to the region encompassing their N-terminal residues -170 where a significant degree of homology can be detected (58%). Interestingly, the distribution of charged residues is not random. The single C terminal domain of GRAB1 and GRAB2 contains 19% and 15%, respectively, of negatively charged residues (D, E), while its related N terminal domain, which contains a high proportion of charged residues (30% and 33%). %, respectively), shows a small deviation in favor of positively charged amino acids (R, K, H; 18% and 20%, respectively. In addition, Northern analysis shows the existence of mRNAs of expected sizes, each with the potential to encode for GRAB1 and GRAB2, respectively. Both mRNAs are present in small amounts in cultured wheat cells and are even less abundant in differentiated cell types, i.e., roots and leaves.

AND EMPO 2 N terminal part of GRAB proteins mediates the binding of RepA from WDV To identify the region in the GRAB proteins involved in complex formation with WDV RepA, a series of deletions are constructed and analyzed for their ability to interact with the viral RepA protein in yeast. The supersession of most (in GRAB1) or all (in GRAB2) of the C-terminal domain does not reduce the binding of GRAB-RepA (see Figure 2). Even a truncated GRAB2 protein contains only its 149 N-terminal residues yet retains a significant binding capacity to RepA (see Figure 2). Conversely, a relatively small deletion in the N-terminal part of GRAB1 (80 amino acids) or GRAB2 (66 amino acids) completely suppresses the interaction (see figure 2). Therefore, it is concluded that the domain N terminal present in both proteins confers the ability to form complexes with RepA from WDV. In addition, the region that is more towards the N-terminal region of the GRAB proteins seems to have the greatest contribution to the complex formation with RepA of -WDV.

EXAMPLE 3 The C domain of RepA of WDV mediates the interaction with proteins GRAB A similar supersion study was carried out to identify the sequences in the RepA protein of WDV responsible for binding to GRAB proteins. As shown in Figure 3, the deletion of most parts of the N terminal half of RepA (-150 amino acids) does not diminish the ability to interact with the GRAB proteins. However, the removal of only 37 amino acid residues in the C terminal part of RepA completely destroys the binding of both GRAB1 and GRAB2 (see Figure 3), indicating that this small domain of RepA contains critical residues for binding. The interaction of GRAB with the RepA protein of WDV was also analyzed, and an early WDV protein was produced, which is produced from the same mRNA that codes for RepA, but after the splicing phenomenon (Schalk et al., 1989 ). Therefore, the 210 terminal N residues of both RepA and Rep are identical, but the two viral proteins have distinct C terminal domains. Consistent with the idea that the C-terminal part of WDV RepA mediates the binding to GRAB, Rep of WDV was unable to form complexes with GRAB. These results, together with data on the differential binding of RepA and Rep of WDV with ZmRbl (Xie et al., 1997) strongly suggest that RepA is a unique WDV protein equally involved in interference with cellular physiology to create an environment cellular improvable for viral replication. To confirm and extend the interaction results of the two yeast hybrids, withdrawal experiments were carried out to evaluate the interaction using purified proteins. After incubation of equal amounts of GST-RepA (0.2 μg) purified with GST-GRAB1 or translated GST-GRAB2 in vitro (IVT), a fraction of the 35S-labeled GRAB proteins, bound to glutathione spheres, are recovered. -garosa (see figure 4). Similar resins are obtained using GST-GRAB1 and GST-GRAB2, and RepA protein from WDV IVT (see Figure 4). Therefore, it is concluded that the interaction between the GRAB and geminiviral RepA proteins can occur in the absence of other cellular proteins.

EXAMPLE 4 The expression of GRAB mRNA is restricted to a small number of cells in the roots and embryos To obtain certain clarity regarding the function that the GRAB proteins may have in the cell, their expression pattern was analyzed by hybridization in si tu. In Northern analysis it indicates that GRAB transcripts are not very abundant (see Figure 1). The presentation of GRAB mRNA in root meristems seems to be restricted to a small number of cells. A patch pattern similar to that of the histone H4 transcript, characteristic of cells in the S phase, is also observed. The expression of GRAB1 is restricted to some cells within the central cylinder and is virtually absent from the cortical or epidermal cells. MRNA for GRAB1 is also detected in some initial cells of the root end. A comparable situation is found in developing embryos. On the whole, our analysis of the pattern of expression of GRAB under different growth conditions leads us to conclude that mRNA concentrations for GRAB1 as for GRAB2 increases as a response to changes in the growth signals of, possibly, a subset of cells within the and that depend heavily on the availability of nutrients. In addition, they reinforce the idea that GRAB proteins can serve different roles as part of the immediate early response, which can be part of the translation path that connects external signals with the regulation of cell growth and / or differentiation. A group of plant proteins in this way are identified based on their ability to form complexes with RepA, the protein that binds to Rb from WDV, a member of the geminiviridae plant family. Based on the search database, we conclude that both GRAB1 and GRAB2 are not homologous with any known protein and, therefore, isolated cDNAs encode previously unidentified proteins. However, this study reveals that they are related, in terms of primary sequences, through their N-terminal region, using the amino acid sequence of GRAB1 and GRAB2, the result shows that these proteins have a significant homology with several plant proteins. unknown function. Interestingly, homology is also restricted to the first 150-170 residues of the N-terminal part, as already observed for the same GRAB protein group (see Figure 10A). Those shown in Figure 10A correspond to proteins that apparently are not related in any other way. First, two cDNA clones of Arabidopsis, ATAF1 and ATAF2, isolated for their ability to activate the Cauliflower Mosaic Virus (CAMV) 35S promoter in yeast (H. Hirt, personal communication). Second, the SENU5 cDNA isolated in senescence studies of tomato leaves (Genbank Acc. No.). Third, the NAM protein, the product of the Apical Meristem (na) gene of petunia, necessary for the proper development of apical button meristems, which has been proposed to determine the position of the meristem (Souer et al., 1996 ).

EXAMPLE 5 The expression of GRABl induces a necrotic phenotype As a first step towards the search for clarity regarding the cellular roles of the GRAB proteins, we determined the effect of expressing both GRAB1 and GRAB2 in N. Benthamiana plants. For this purpose, we use the expression vector based on the X virus of potatoes (PVX), which ensures high concentrations of systemic expression at a given time and in the absence of chromosomal effects [6]. This system has been used successfully to analyze the effects of foreign proteins expressed transiently [18, 31, 32].

When plants of N. ben thamiana in vi tro are inoculated with RNA for PVX, the appearance of typical symptoms, clearly evident 10 days after inoculation (dpi), is indicative of an efficient amplification of the PVX expression vector. , in comparison with plants inoculated in false. Plants inoculated with the PVX-GRABl construct are already systemically infected by 12 dpi due to the high level of expression vector amplification for GRABl. This is confirmed by the level of RNA for PVX-GRAB1 in the leaves, comparable with that of wild-type plants infected with PVX. Interestingly, all plants that express high levels of GRAB1 show a tendency to develop, already at 12 dpi, a degenerative process, as shown by the morphology of their oldest leaves. In addition, a prominent necrotic area appears near the base of the aerial parts of the plant, especially at 28 dpi. At this stage, a significant reduction in the development of leaves and roots is also evident. To determine if the effects observed in the whole plants are dependent on the expression of the full-length protein GRAB1, we inoculate plants with a PVX construct that expresses mRNA for GRAB1 that presents a frame shift mutation close to the N-terminal part. Therefore, PVX-GRABlFs presents a cDNA insert with a frame shift mutation at position 78 of amino acids, which maintains the two most conserved blocks of the N-terminal part (NI and N2), and can produce a protein truncated of 159 residues. The expression of GRABlFs does not produce any of the effects observed in plants that express the full length protein GRAB1. A similar study was carried out with the constructions of GRAB2. Plants infected with the PVX-GRAB2 construct show delayed syn- thetics in the amplification of the PVX vector. This prevents the high levels of expression of GRAB2 at 12 dpi and the plants present a morphology similar to that of plants inoculated in false. However, subsequently after inoculation, the PVX vector accumulated at high levels. Interestingly, these plants that express GRAB2 _ show more moderate symptoms than plants infected with PVX wild type. None of them developed the degenerative process observed in plants that express GRABl. We also tested the effect of expressing a truncated form of GRAB2. In this case, PVX-GRAB2Fs produce a cDNA for GRAB2 that has a frame shift mutation at position 33 of amino acids, so it produces a truncated GRAB2 protein with a length of 50 amino acids which only retains as a block of homology more towards the N terminal region (NI). Plants inoculated with the PVX-GRAB2Fs construct contain high levels of the RNA for both PVX and GRABFs. Taken together, the results of expression of the truncated forms of GRAB proteins indicate that the induction of necrotic areas by GRAB1 and the delay in the onset of symptoms by GRAB2 depend on the expression of the full-length protein and strongly suggest that these Specific effects can be mediated by the unique C-terminal domains of each of the GRAB1 and GRAB2 proteins. The alignment shown in Figure 4 shows the existence of several higconserved amino acid motifs between these related proteins. Thus, we observed the presentation of 5 motifs in the N terminal domain (NI to N5) which may correspond to critical blocks for their activity. Among them, the two reasons that are more towards the N terminal region (NI and N2) show a net negative charge, while the rest are positively charged. Based on our suppression analysis, all of these motifs are required for efficient interaction with WDV RepA, although N5 is not absolutely required, and NI appears to have a strong constribution (see Figure 3). The C terminal domain, although unique in its primary sequence for each protein in the family, shares the property of having a high net negative charge (15-20% of the residues are D or E). This is particularly evident in both GRAB proteins and in the two ATAF members. The two GRAB proteins presented here, but in particular GRAB2, have a Q-rich domain in their C-terminal domains which may be involved in the regulation of transcription, as has been shown to be the case for other examples. In addition, the number of partial cDNA sequences derived from randomly sequenced EST from Arabidopsis and rice have also been recovered using the N-terminal part of GRAB proteins as an application (not shown). Surprisingly, the sequences of yeast proteins or proteins of animal origin have not been recovered in this investigation. A surprising feature of this group of proteins is the large number of members with a related N terminal domain that appear to be present in each species. For example, at least 5 members related to NAM (Souer et al, 1996) and 7 members related to GRAB (this work) . Such abundance establishes the question of whether they actually have different functions. One possibility, already proposed for some of the NAM-related proteins, is that they have redundant functions in different positions of the plant during post-embryonic development (Souer, et al., 1996). Regarding the consequences of overexpression of GRAB in the appearance of symptoms in plants infected with PVX, it is possible that both WDV and PVX share a path, hitherto unknown, affected by GRAB, although very different replication strategies are used by these families in virus. An alternative possibility is that overexpression of GRAB can activate, directly or indirectly, a general defense pathway or, simply, lead to a cellular environment which protects cells against different types of infection.

EXAMPLE 6 Overexpression of GRAB proteins in cultured wheat cells inhibits WDV DNA replication To further investigate the possible function of GRAB proteins isolated on the basis of their interaction with the RepA protein of WDV, we determined the effect of proteins that express GRAB on the replication of geminiviral DNA. This assay has shown that it is useful to evaluate the effect of plant Rb (ZmRbl) on viral DNA replication [47]. Therefore, using a similar strategy, we co-transfected cultured wheat cells with combinations of the following plasmids: (i) a plasmid expressing GRAB1 or GRAB2 under the control of the CaMV 35S promoter, which is active in the wheat cells used [ 47], (ü) a second plasmid expressing the WDV proteins necessary for efficient replication of viral DNA (RepA and Rep) also under the control of the CaMV 35S promoter, and (iii) a third plasmid (pWori ??), a derived from pWori [43, 46], used to monitor WDV DNA replication, which can be replicated efficiently when viral proteins are provided in trans [35, 47]. The expression of both GRAB1 and GRAB2 is severely inhibited by the replication of WDV DNA in cultured wheat cells, where GRAB2 shows the strongest effect. These results indicate that the replication of WDV DNA is affected by the GRAB proteins under cell culture conditions.

REFERENCES 1. Accotto, G-P, Mullinecaux, PM, Brown, SC, Marie, D: Digitaria streak geminivirus replicative forms are abundant in S-phase nuclei of infected cells. Virology 195: 257-259 (1993). 2. Aida, M, Ishida, T, Fukaki. H, Fujisa a, H, Tasaka, M.: Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9: 841-857 (1997). 3. Angelí, SM, Baulcombe, DC: Consistent gene silencing in transgenic plants expressing a replicating potato virus X RNA. EMBO J. 16: 3675-3684 (1997). 4. Bartel, PL, Chien, C-T. Sternglanz, R, Fields, S: Using the two-hybrid system to detect protein-protein interactions. In Hartley, D.A. (ed.), Cellular lnteractions in Development: a practical approach. Oxford University Press, Oxford, United Kingdom, pp. 153-179 (1993a). 5. Bartel, PL, Chien, C-T, Sternglanz, R, Fields, S: Elimination of false positives that arise in using the two-hybrid system. BioTechniques 14: 920-924 (1993b). 6. Baulcombe, DC. , Chapman, S, Santa Cruz, S: Jellyfish green fluorescent protein as a reporter for virus infections. Plant J, 7: 1045-1053 (1995). 7. Breeden, L, Nasmyth, K: Regulation of the yeast HO gene. Cold Spring Harbor Symp. Quant. Biol. 50: 643-650 (1985). 8. Coen, ES., Meyerowitz, EM: The ar of whorls: genetic interactions controlling flower developmen. Nature 353: 31-37 (1991). 9. Courey, AJ, Tjian, R: Analysis of Spl in vivo reveáis multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55: 887-898 (1988).

. Chapman, S, Kavanagh, TA, Baulcombe, DC: Potato virus X as a vector for gene expression in plants. Plant J. 2: 549-557 (1992). 11. Davies, JW, Stanley, J: Geminivirus genes and vectors. Trends Genet. 5: 77-81 (1989). 12. Doerner, P, Jorgensen, J, You, R. Steppuhn, J. Lamb, C. Control of root growth and development by cyclin expression. Nature 380: 520-523 (1996). 13. Eagle, PA, Orozco, BM, Hanley-Bowdoin, L: A DNA sequence required for geminivirus replication also transcriptional regulation Plant Cell 6, 1157-1170 (1994). 14. Fanning, E, and Knippers, R: Structure and function of simian virus 40 large tumor antigen. Annu. Rev. Biochem. 61: 55-85 (1992). 15. Feilotter, HE, Hannon, GJ, Ruddell, CJ, Beach, D: Construction of an improved host strain for two-hybrid screening. Nucleic Acids Res. 22: 1502-1503 (1994). 16. Fields, S, Song, O: A novel genetic system to detect protein-protein interactions. Nature 340: 245-246 (1989) 17. Guo, HS, García, JA: Delayed resistance to plum pox potyvirus mediated to mutated RNA replicase gene: involvement of a gene-silencing, mechanism.Mol. Plant-Microbe inter. 160-170 (1997). 18. Hammond-Kosack, KE, Staskawicz, BJ, Jones, JDG, Baulcombe, DC: Functional expression of a fungal avirulence gene from a modified potato virus X genome. Mol Plant-Microbe Interact. 8: 181-185 (1995). 19. Hassel, JA, Brinton, BT: SV40 and polyomavirus DNA replication. In DePamphilis, M. L. (ed.). DNA replication in eukaryotic cells, Cold Spring Harbor Laboratory Press, New York, pp. 639-677 (1996). 20. Jacobs, T: Control of the cell cycle. Dev. Biol. 153: 1-15 (1992). 21. Jansen-Durr, P: How viral oncogenes make the cell cycle. Trends Genet. 12: 270-275 (1996). 22. John, I, Hackett, R, Cooper, W, Drake, R, Farrell, A, Grierson, D.: Cloning and characterization of tomato leaf senescence-related cDNAs. Plant Mol. Biol. 33: 641-651 (1997). 23. Kozak, M: At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196: 947-950 (1987). 24. Lazarowitz, S: Geminiviruses: genome structure and function. Crit. Rev Plant Sci 11: 327-349 (1992). - 25. Long, JA, Moan, El, Medford, JI, Barton, MK: A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379: 66-69 (1996). 26. Ludlow, JW: lnteractions between SV40 large-tumor antigen and the growth suppressor proteins pRB and p53. FASEB J. 7: 866-871 (1993). 27. Martin, C, Paz-Ares, J: MYB transcription factors in plants Trends Genet. 13: 67-73, (1997). 28. Moran, E: lnteraction of adenoviral proteins with pRB and p53. FASEB J. 7: 880-885 (1993). 29. Nagar, S, Pedersen, TJ, Carrick, KM, Hanley-Bowdoin, L, Robertson, D: A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells. Plant Cell 7: 705-719 (1995). 30. Perl, A, Kless, H, Blumenthal, A, Galili, G, Galun, E: lmprovement of plant regeneration and GUS expression in scutellar wheat calli by optimization of culture conditions and DNA-microproject delivery procedures. Mol. Gen. Genet. 235: 279-284 (1992). 31. Ratcliff, F, Harrison, BD, Baulcombe, DC: A similarity between viral defense and gene silencing in plants. Science 276: 1558-1560 (1997). '32. Rommens, CMT, Salmeron, JM, Baulcombe, DC, Staskawicz, BJ: Use of a gene expression system based on potato virus X to rapidly identify and characterize a tomato pto homolog that controls fenthion sensitivity. Plant Cell 7. 249-257 (1995). 33. Sablowski, RWM, Meyerowitz, EM: A homolog of No APICAL MERISTEM is an imediate target of the floral homeotic genes APETALA3 / PISTILLATA Cell 92: 93-103 (1998). 34. Sambrook, J, Fritsch, EF, Maniatis, T: Molecular cloning: A Laboratory Manual, Cold Spring, Harbor Laboratory Press, Cold Spring, Harbor, NY, USA. (1989). 35. Sanz-Burgos, AP, Gutiérrez, C: Organization of the cis-acting, element required for wheat dwarf geminivirus DNA replication and visualization of a Rep protein-DNA complex. Virology (1998, in press). 36. Saraste, M, Sibbald, PR, Wittinghofer, A: The P-loop-a common motif in ATP-and GTP-binding proteins. Trends Biochem. Sci. 15: 430-434 (1990). 37. Schalk, H-J, Matzeit, V, Schiller, B, Schell., J, Gronenborn, B: Wheat dwarf virus to geminivirus of graminaceous plants needs splicing for replication. EMBO J. 8: 359-364 (1989). 38. Schiestl, RH, Gietz, D: High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet, 16: 339-346 (1989). 39. Shaul, 0, van Montagu, M, Inzé, D: Regulation of cell division in Arabidopsis. Crit. Rev. Plant. Sci. 15: 97-112 (1996). 40. Shore, P, Sharrocks, AD: The MADS-box family of transcription factors. Eur. J. Biochem. 229: 1-13 (1995). 41. Soni, R, Murray, JAH: Isolation of intact DNA and RNA from plant tissues. Anal. Biochem. 218: 474-476 (1994). 42. Souer, E, van Houwelingen, A, Kloos, D, Mol, J, Koes, R: The No Apical Meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at the meristem and primordia boundaries, Cell 85 : 159-170 (1996). 43. Suárez-López, P, Gutiérrez, C: DNA replication of wheat dwarf geminivirus vectors: effects of origin structure and size. Virology 227: 389-399 (1997). 44. Van der Krol, AR, Chua, N-H Flower development in petunia Plant Cell 5: 1195-1203, (1993). 45. Vousden, K: Interactions of human papillomavirus transforming proteins with the products of tumor suppressor genes, FASEB J. 7: 872-879 (1993). 46. Xie, Q, Suárez-López, P, Gutiérrez, C: Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus: requirement for efficient viral DNA replication. EMBO J. 14: 4073-4082 (1995). 47. Xie, Q. Sanz-Burgos, AP, Hannon, GJ, Gutiérrez, C: Plant cells contain a novel member of the retinoblastoma family of growth Regulatory proteins. EMBO J. 15: 4900-490 (1996).

LIST OF SEQUENCES: (1) GENERAL INFORMATION (i) APPLICANT: (A) NAME: HIGHER COUNCIL OF SCIENTIFIC INVESTIGATIONS (B) STREET: SERRANO, 113 (C) CITY: MADRID (E) COUNTRY: SPAIN (F) ZIP CODE (ZIP): 28006 (A) NAME: CRISANTO GUTIERREZ-ARMENTA (B) STREET: CENTER OF MOLECULAR BIOLOGY, CSIC-UAM (C) CITY: MADRID (E) COUNTRY: SPAIN (F) ZIP CODE: 28049 (A) NAME: Ql XIE (B) STREET: MOLECULAR BIOLOGY CENTER, CSIC-UAM (C) CITY: MADRID (E) COUNTRY: SPAIN (F) POSTAL CODE (ZIP): 28049 (A) NAME: ANDRÉS SANZ-BURGOS (B) STREET: CENTER OF MOLECULAR BIOLOGY, CSIC-UAM (C) CITY: MADRID (E) COUNTRY: SPAIN (F) ZIP CODE: 28049 ; ii) TITLE OF THE INVENTION: VEGETABLE GRAFT PROTEINS (iii) NUMBER SEQUENCES: 12 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: flexible disk (B) COMPUTER: compatible with IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAMMING ELEMENTS (SOFTWARE): Patentln edition # 1.0, version # 1.30 (EPO) (vi) PREVIOUS APPLICATION DATA: (A) APPLICATION NUMBER: ES 9701292 (B) DATE OF SUBMISSION: JUNE 12, 1997 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 1 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 459 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear 15 (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO < iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Tri icum monococcum (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1.459 (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 1: CTGCCGNNNG GGTTCCGGTT CCACCCGACG GACGAGGAGN NNNNNNNNNN NTACCTCNNN 60 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNATCN NNNNNNNNNN NNNNNNNNNN 120 NNNNNNCCGT GGNNNCTCCC GNNNNNNNNN NNNNNNNNNN NNNNNGAGTG GTACTTCTTC 180 NNNNNNNNNN NNNNNAAGTA CCCCNNNGGC NNNCGCNNNA ACCGGNNNNN NNNNNNNGGC 240 TACTGGAAGG CCACCGGCITN NGACNNNNNN NNNNNIJNNNN NNNNNNNNNN NNNNGGGNNN 300 AAGAAGNNNC TCGTCTTCTA CNNNGGCNNN NNNNNNNNNG GGNNNNNNNN NNNNTGGNNN 360 ATGCACGAGT ACCGCCTCNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 420 NNNNNNNNNN NNTGGNNNNN NNNNCGCNNN NNNNNNAAG 459 (2) PARAL INFORMATION SEC. FROM IDENT. NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 462 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (i) ANTI-SENSE: NO () ORIGINAL SOURCE: (A) ORGANISM: Triticum monococc-m (ix) CHARACTERISTICS: (A) NAME / KEY: CDS < B > LOCALIZATION: 1.4662 (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2: CTTCCANNNG GGTTCCGGTT CCACCCCACC GACGAGGAGN NNNNNNNMNN NTACCTCNNN 60 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNATCN NNNNNNNNNN NNNNNNNNNN 120 NNNNNNCCGT GGNNNCTCCC GNNNNNNNNN NNNNNNNNNN NNNNNGAGTG GTTCTTCTTC 180 NNNNNNNNNN NNNNNAAGTA CCCGNNNGGG NNNCGCNNNA ACCGGNNNNN NNNNNNNGGG 240 TACTGGAAGG CGACGGGGNN NGACNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 300 NNNNNNGGCN NNAAGAAGNN NCTCGTCTTT TACNNNGGCN NNNNNNNNNN NGGCNNNNNN 360 NNNNNNTGGN NNATGCACGA GTACCGCCTC NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 420 NNNNNNNNNN NNNNNTGGNNNNNNNNNCGGNNNNNNNNN AA 462 (2) INFORMATION FOR SEC. FROM IDENT. NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 153 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (il) TYPE OF MOLECULE: peptide (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO () TYPE OF FRAGMENT: interior (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1 ..459 (i) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3: Leu Pro Xaa Gly Phe Axg Phe His Pro Thr Asp Glu Glu Xaa Xaa Xaa 1 5 10 15 Xaa Tyr Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 ie Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Pro Trp Xaa Leu Pro Xaa 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Glu Trp Tyr Phe Phe Xaa Xaa Xaa Xaa 50 55 60 Xaa Lys Tyr Pro Xaa Gly Xaa Arg Xaa Asn Arg Xaa Xaa Xaa Xaa Gly 65 70 75 80 Tyr Trp Lys Ala Thr Gly Xaa Asp Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95 Xaa Xaa Gly Xaa Xaa Lys Lys Xaa Leu Val Phe Tyr Xaa Gly Xaa Xaa Xaa Xaa 100 105 110 Xaa Gly Xaa Xaa Xaa Xaa Trp Xaa Met His Glu Tyr Arg Leu Xaa Xaa 115 120 125 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 140 Trp Xaa Xaa Xaa Arg Xaa Xaa Xaa Lys 145 150 (2) INFORMATION FOR THE IDENTI. NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETICAL: NO (? V) ANTI-SENSE: NO < ) TYPE OF FRAGMENT: interior (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (i) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4: Leu Pro Xaa Gly Phe Arg Phe His Pro Thr Asp Glu Glu Xaa Xaa Xaa 1 5 10 15 Xaa Tyr Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 lie Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Pro Xap Xaa Leu Pro Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Glu Trp Phe Phe Phe Xaa Xaa Xaa Xaa Xaa Lys Tyr Pro Xaa Gly Xaa Arg Xaa Asn Arg Xaa Xaa Xaa Xaa Gly 65 70 75 80 Tyr Trp Lys Ala Thr Gly Xaa Asp Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95 Xaa Xaa Xaa Xaa Xaa Xaa Gly Xaa Lys Lys Xaa Leu Val Phe Tyr Xaa 100 105 110 Gly Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Xaa Trp Xaa Met His Glu Tyr 115 120 125 - Arg Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 140 Xaa Trp Xaa Xaa Xaa Arg Xaa Xaa Xaa Lys 145 150 (2) INFORMATION FOR SEC. FROM IDENT. NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 459 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum < i?) FEATURES: (A) NAME / KEY: CDS (B) LOCATION: 1.459 (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 5: CTG CCG CCG GGG TTC CGG TTC CAC CCG ACG GAC GAG GAG CTG GTG GCG 48 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Ala 1 5 10 15 GAC TAC CTC TGC GCG CGC GCG GCC GGC CGC GCG CCG CCG GTG CCC ATC 96 Asp Tyr Leu Cys Wing Arg Wing Wing Gly Arg Wing Pro. Pro Val Pro lie 20 25 30 ATC GCC GAG CTC GAC CTC TAC CGG TTC GAC CCG TGG GAG CTC CCG GAG 144 lie Wing Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu CGG GCG CTC TTC GGG GCG CGG GAG TGG TAC TTC TTC ACG CCG CGG GAC 192 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp 50 55 60 CGC AAG TAC CCC AAC GGC TCC CGC CCC AAC CGG GCC GCC GGG GGC GGC 240 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Ala Wing Gly Gly Gly 65 70 75 80 TAC TGG AAG GCC ACC GGC GCC GAC AGG CCC GTG GCG CGC GCG GGC AGG 288 Tyr Trp Lys Wing Thr Gly Wing Asp Arg Pro Val Wing Arg Wing Gly Arg 85 90 95 ACC GTC GGG ATC AAG AAG GCG CTC GTC TTC TAC CAC GGC AGG CCG TCG 336 Thr Val Gly lie Lys Lys Wing Leu Val Phe Tyr His Gly Arg Pro Ser 100 105 110 GCG GGG GTC AAG ACG GAC TGG ATC ATG CAC GAG TAC CGC CTC GCC GGC 384 Wing Gly Val Lys Thr Asp Trp lie Met His Glu Tyr Arg Leu Wing Gly 115 120 125 GCC GAC GGC GCC GCC GCC GAG AAG GGC GGC ACG CTC AGG CTG GAC GAA 432 Wing Asp Gly Arg Ala Wing Lys Asn Gly Gly Thr Leu Arg Leu Asp Glu 130 135 140 TGG GTG CTC TGC CGC CTA TAC AAC AAG 459 Trp Val Leu Cys Arg Leu Tyr Asn Lys 145 150 (2) INFORMATION FOR SEC. FROM IDENT. NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 153 amino acids (B) TYPE: amino acid (D) TOPOLOGY: Linear (i i) TYPE OF MOLECULE: protein < xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 6: Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Wing 1 5 10 15 Asp Tyr Leu Cys Wing Arg Wing Wing Wing Arg Wing Pro Pro Val Pro lie 20 25 30 lie Wing Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu 35 40 45 Arg Wing Leu Phe Gly Wing Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Wing Wing Gly Gly Gly 65 70 75 80 Tyr Trp Lys Wing Thr Gly Wing Asp Arg Pro Val Wing Arg Wing Gly Arg 85 90 95 Thr Val Gly lie Lys Lys Wing Leu Val Phe Tyr His Gly Arg Pro Ser 100 105 110 Wing Gly Val Lys Thr Asp Trp lie Met His Glu Tyr Arg Leu Wing Gly 115 120 125 Wing Asp Gly Arg Wing Wing Lys Asn Gly Gly Thr Leu Arg Leu Asp Glu 130 135 140 Trp Val Leu Cys Arg Leu Tyr Asn Lys 145 150 (2) PAR FACTORING ID SEC. NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 462 base pairs (B) TYPE: nucleic acid (C) uo CHAIN: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (ix) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 1 .. 62 ( xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 7: C CCA CCG GGG TTC CGG TTC CAC CCC ACC GAC GAG GG GTG GTC ACC 48 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val Val Thr 155 160 165 CAC TAC CTC ACC CGC AAG GTC CTC CGC GAA TCC TTC TCC TGC CAÁ GTG 96 His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys Gln Val 170 175 180 185 ATC ACC GAC GTC GTC GTC CTC AAC AAG AAC GAG CCG TGG GAG CTC CCG GGC 144 lie Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu Pro Gly 190 195 200 CTC GCG AAG ATG GGC GAG AAG GAG TGG TTC TTC TTC GCG CAC AAG GGT 192 Leu Wing Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Wing Hxs Lys Gly 205 210 215 CGG AAG TAC CCG ACG GGG ACG CGC ACC AAC CGG GCG ACG AAG AAG GGG 240 Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Wing Thr Lys Lys Gly 220 225 230 TAC TGG AAG GCG ACG GGG AAG GAG AAG GAG ATC TTC CGC GGC AAG GGC 288 Tyr Trp Lys Wing Thr Gly Lys Asp Lys Glu lie Phe Arg Gly Lys Gly 235 240 245 CGG GAC GCC GTC CTT GTC GGC ATG AAG AAG ACG CTC GTC TTT TAC ACC 336 Arg Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe Tyr Thr 250 255 260 265 GGC CGC GCC CCC AGC GGC GGG AAG ACG CCG TGG GTG ATG CAC GAG TAC 384 Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His Glu Tyr 270 275 280 CGC CTC GAG GGC GAG CTG CCC CAT CGC CTT CCC CGC ACC GCC AAG GAC 432 Arg Leu Glu Glu Glu Leu Pro His Arg Leu Pro Arg Thr Wing Lys Asp 285 290 295 GAT TGG GCT GTT TGC CGG GTG TTC AAC AAA 462 Asp Trp Wing Val Cys Arg Val Phe Asn Lys 300 305 (2) INFORMATION FOR SEC. FROM IDENT. NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (Xi) DESCRIPTION OF SEQUENCE: SEC. FROM IDENT. NO: 8: Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val Val Thr 1 5 10 15 His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys Gln Val 20 25 30 He Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu Pro Gly 35 40 45 Leu Wing Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Ala His Lys Gly 50 55 60 Arg Ly = Tyr Pro Thr Gly Thr Arg Thr Asn Arg Ala Thr Lys Lys Gly 65 70 75 80 Tyr Trp Lys Wing Thr Gly Lys Asp Lys Glu He Phe Arg Gly Lys Gly 85 90 95 Arg Asp Ala Val Leu Val Gly Met Lys Lys Thr Leu Val Phe Tyr Thr 100 105 110 Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His Glu Tyr 115 120 125 Arg Leu Glu Glu Glu Leu Pro His Arg Leu Pro Arg Thr Ala Lys Asp 130 135 140 Asp Trp Wing Val Cys Arg Val Phe Asn Lys 145 150 (2) INFORMATION FOR ASEC.DE IDENT. NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1090 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Tri ticum monococcum (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 9 ..95 (Xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 9: AATTCGGCAC GAGACAGTCC ACCACGCACG TGCAGCAGCA CCAGCGCCCG AGAATCCCAT 60 TCCCATCGAC GGAGAAGAAG AAGTGAAGAA ACA ATG GTG ATG GCA GCG GCG GAG 114 Met Val Met Ala Ala Ala Glu 155 160 CGG CGG GAC GCG GAG GCG GAG CTG AAC CTG CCG CCG GGG TTC CGG TTC 162 Arg Arg Asp Ala Glu Ala Glu Leu Asn Leu Pro Pro Gly Phe Arg Phe 165 170 175 CAC CCG ACG GAC GAG GAG CTG GTG GCG GAC TAC CTC TGC GCG CGC GCG 210 His Pro Thr Asp Glu Glu Leu Val Wing Asp Tyr Leu Cys Wing Arg Wing 180 185 190 GCC GGC CGC GCG CCG CCG GTG CCC ATC ATC GCC GAG CTC GAC CTC TAC 258 Wing Gly Arg Wing Pro Pro Val Pro He He Wing Glu Leu Asp Leu Tyr 195 200 205 CGG TTC GAC CCG TGG GAG CTC CCG GAG CGG GCG CTC TTC GGG GCG CGG 306 Arg Phe Asp Pro Trp Glu Leu Pro Glu Arg Ala Leu Phe Gly Ala Arg 210 215 220 225 GAG TGG TAC TTC TTC ACG CCG CGG GAC CGC AAG TAC CCC AAC GGC TCC 354 Glu Trp Tyr Phe Phe Thr Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ser 230 235 240 CGC CCC AAC CGG GCC GCC GGG GGC GGC TAC TGG AAG GCC ACC GGC GCC 402 Arg Pro Asn Arg Wing Wing Gly Gly Tyr Trp Lys Wing Thr Gly Wing 245 250 255 GAC AGG CCC GTG GCG CGC GCG GGC AGG ACC GTC GGG ATC AAG AAG GCG 450 Asp Arg Pro Val Wing Arg Wing Gly Arg Thr Val Gly He Lys Lys Wing 260 265 270 CTC GTC TTC TAC CAC GGC AGG CCG TCG GCG GGG GTC AAG ACG GAC TGG 498 Leu Val Phe Tyr His Gly Arg Pro Ser Wing Gly Val Lys Thr Asp Trp 275 280 285 ATC ATG CAC GAG TAC CGC CTC GCC GGC GCC GAC GGA CGC GCC GCC AAG 546 He Met His Glu Tyr Arg Leu Wing Gly Wing Asp Gly Arg Wing Wing Lys 290 295 300 305 AAC GGC GGC ACG CTC AGG CTT GAC GAA TGG GTG CTC TGC CGC CTA TAC 594 Asn Gly Gly Thr Leu Arg Leu Asp Glu Trp Val Leu Cys Arg Leu Tyr 310 315 320 AAC AAG AAG AAG AAC CAG TGG GAG AAG ATG CAG CGG CAG CGG CAG GAG GAG 642 Asn Lys Lys Asn Gln Trp Glu Lys Met Gln Arg Gln Arg Gln Glu Glu 325 330 335 GAG GCG GCG GCC AAG GCT GCG GCG TCA CAG TCG GTC TCC TGG GGT GAG 690 Glu Ala Ala Ala Ala Ala Ala Ala Ser Gln Ser Val Ser Trp Gly Glu 340 345 350 ACG CGG ACG CCG GAG TCC GAC GTC GAC AAC GAT CCG TTC CCG GAG CTG 738 Thr Arg Thr Pro Glu Ser Asp Val Asp Asn Asp Pro Phe Pro Glu Leu 355 360 365 GAC TCG CTG CCG GAG TTC CAG ACG GCA AAC GCG TCA ATA CTG CCC AAG 786 Asp Ser Leu Pro Glu Phe Gln Thr Wing Asn Wing Being He Leu Pro Lys 370 375 380 385 GAG GAG GTG CAG GAG CTG GGC AAC GAC GAC TGG CTC ATG GGG ATC AGC 834 Glu Glu Val Gln Glu Leu Gly Asn Asp Asp Trp Leu Met Gly lie Ser 390 395 400 CTC GAC GAC CTG CAG GGC CCC GGC TCC CTG ATG CTG CCC TGG GAC GAC 882 Leu Asp Asp leu Gln Gly Pro Gly Ser Leu Met Leu Pro Trp Asp Asp 405 410 415 TCC TAC GCC GCC TCG TTC CTG TCG CCG GTG GCC ACG ATG AAG ATG GAG 930 Ser Tyr Wing Wing Ser Phe Leu Ser Pro Val Wing Thr Met Lys Met Glu 420 425 430 CAG GAC GTC AGC CCA TTC TTC TGAGCTCTCA ATACTCTCAC GGTCGCACTG 984 Gln Asp Val Ser Pro Phe Phe Phe 435 440 TTGTGTGCGG CGTAACTGTA GATAGTTCAC ATTTGTTCAG GATTTATTTG TAACGTTGCT 1044 TCTTTTATAC GATACTCTCT TCCTTTCTAA AAAAAAAAAA AAAAAA 1090 (2) INFORMATION FOR SEC. FROM IDENT. NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 287 amino acids (B) TLPO: amino acids (D) TOPOLOGY: line! (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 10: Met Val Met Ala Ala Ala Glu Arg Arg Asp Ala Glu Ala Glu Leu Asn 1 5 10 15 Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Wing 20 25 30 Asp Tyr Leu Cys Wing Arg Wing Wing Wing Arg Wing Pro Pro Val Pro He 35 40 45 lie Wing Glu Leu Asp Leu Tyr Arg Phe Asp Pro Trp Glu Leu Pro Glu 50 55 60 Arg Ala Leu Phe Gly Ala Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp 65 70 75 80 Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Wing Wing Gly Gly Tyr Trp Lys Wing Thr Gly Wing Asp Arg Pro Val Wing Arg Wing Gly Arg 100 105 110 Thr Val Gly He Lys Lys Wing Leu Val Phe Tyr His Gly Arg Pro Ser 115 120 125 Wing Gly Val Lys Thr Asp Trp He Met His Glu Tyr Arg Leu Wing Gly 130 135 140 Wing Asp Gly Arg Ala Wing Lys Asn Gly Gly Thr Leu Arg Leu Asp Glu 145 150 155 160 Trp Val Leu Cys Arg Leu Tyr Asn Lys Lys Asn Gln Trp Glu Lys Met 165 170 175 Gln Arg Gln Arg Gln Glu Glu Glu Wing Wing Wing Lys Wing Wing Wing 180 185 190 Gln Ser Val Ser Trp Gly Glu Thr Arg Thr Pro Glu Ser Asp Val Asp 195 200 205 Asn Asp Pro Phe Pro Glu Leu Asp Ser Leu Pro Glu Phe Gln Thr Wing 210 215 220 Asn Wing Being He Leu Pro Lys Glu Glu Val Gln Glu Leu Gly Asn Asp 225 230 235 240 Asp Trp Leu Met Gly Be Ser Leu Asp Asp Leu Gln Gly Pro Gly Ser 245 250 255 Leu Met Leu Pro Trp Asp Asp Ser Tyr Ala Wing Be Phe Leu Ser Pro 260 265 270 Val Ala Thr Met Lys Met Glu Gln Asp Val Ser Ero Phe Phe Phe 275 280 285 (2) INFORMATION FOR SEC. FROM IDENT. NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1295 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Triticum monococcum (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 109..1161 ( xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 11: ATTCGGCACG AGATCACCTC TAACATCTCG ATCTACCTCT TCCTCCTCCT CAGCTCTCGT 60 TCCATCAGGT TCTTCCACAG CGTAGCAAGG CAATCTAGTA GATCCTCC ATG TCG GAC 117 Met Ser Asp 290 GTG ACG GCG GTG ATG GAT CTG GAG GTG GAG GAG CCG CAG CTG GCG CTT 165 Val Thr Ala Val Met Asp Leu Glu Vallu Glu Pro Gln Leu Ala Leu 295 300 305 CCA CCG GGG TTC CGG TTC CAC CCC ACC GAC GAG GG GTG GTC ACC CAC 213 Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Val Val Thr His 310 315 320 TAC CTC ACC CGC AAG GTC CTC CGC GAA TCC TTC TCC TGC CA GTG ATC 261 Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys Gln Val He 325 330 335 ACC GAC GTC GAC CTC AAC AAG AAC GAG CCG TGG GAG CTC CCG GGC CTC 309 Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu Pro Gly Leu 340 345 350 GCG AAG ATG GGC GAG AAG GAG TGG TTC TTC TTC GCG CAC AAG GGT CGG 357 Wing Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Wing His Lys Gly Arg 355 360 365 370 AAG TAC CCG ACG GGG ACG CGC ACC AAC CGG GCG ACG AAG AAG GGG TAC 405 Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Wing Thr Lys Lys Gly Tyr 375 380 385 TGG AAG GCG ACG GGG AAG GAC AAG GAG ATC TTC CGC GGC AAG GGC CGG 453 Trp Lys Wing Thr Gly Lys Asp Lys Glu He Phe Arg Gly Lys Gly Arg 390 395 400 GAC GCC GTC CTT GTC GGC ATG AAG AAG ACG CTC GTC TTT TAC ACC GGC 501 Asp Wing Val Leu Val Gly Met Lys Lys Thr Leu Val Phe Tyr Thr Gly 405 410 415. CGC GCC CCC AGC GGC GGG AAG ACG CCG TGG GTG ATG CAC. GAG TAC CGC 549 Arg Wing Pro Ser Gly Gly Lys Thr Pro Trp Val Met His Glu Tyr Arg 420 425 430 CTC GAG GGC GAG CTG CCC CAT CGC CTT CCC CGC ACC GCC AAG GAC GAT 597 Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Wing Lys Asp Asp 435 440 445 450 TGG GCT GTT TGC CGG GTG TTC AAC AAA GAC TTG GCG GCG AGG AAT GCG 645 Trp Wing Val Cys Arg Val Phe Asn Lys Asp Leu Wing Wing Arg Asn Wing 455 460 465 CCC CAG ATG GCG CCG GCG GCC GAC GGT GGC ATG GAG GAC CCG CTC GCC 693 Pro Gln Met Wing Pro Wing Wing Asp Gly Gly Met Glu Asp Pro Leu Wing 470 475 480 TTC CTC GAT GAC TTG CTC ATC GAC ACC GAC CTG TTC GAC GAC GCG GAC 741 Phe Leu Asp Asp Leu Leu As Asp Thr Asp Leu Phe Asp Asp Wing Asp 485 490 495 CTG CCG ATG CTC ATG GAC TCT CCG TCT GGC GCT GAC GAC TTC GCC GGC 789 Leu Pro Met Leu Met Asp Ser Pro Ser Gly Wing Asp Asp Phe Wing Gly 500 505 510 GCT TCG AGC TCC ACC TGC AGC GCG GCC CTG CCG CTT GAG CCG GAC GCG 837 Wing Being Being Thr Cys Being Wing Wing Leu Pro Leu Glu Pro Asp Wing 515 520 525 530 GAG CTA CCG GTG CTG CAT CCG CAG CAG CAG CAG AGC CCC AAC TAC TTC 885 Glu Leu Pro Val Leu His Pro Gln Gln Gln Gln Ser Pro Asn Tyr Phe 535 540 545 TTC ATG CCG GCG ACG GCC AAC GGC AAT CTT GGC GGC GCC GAC TAC TCA 933 Phe Met Pro Wing Thr Wing Asn Gly Asn Leu Gly Gly Wing Glu Tyr Ser 550 555 560 CCC TAC CAG GCT ATG GGG GAC CAG CAG GCC GCG ATC CGC AGG TAC TGC 981 Pro Tyr Gln Wing Met Gly Asp Gln Gln Wing Wing Arg Arg Tyr Cys 565 570 575 AAG CCG AAG GCG GAG GTA GCG TCT TCG TCG GCG CTG CTG AGC CCT TCG 1029 Lys Pro Lys Wing Glu Val Wing Ser Ser Wing Leu Leu Ser Pro Ser 580 585 590 CTG GGC TTG GAC ACG GCG GCG CTT GCC GGC GCG GAG ACC TCC TTC CTG 1077 Leu Gly Leu Asp Thr Ala Ala Leu Ala Gly Ala Glu Thr Ser Phe Leu 595 600 605 610 ATG CCG TCA TCG CGG TCG TAC CTC GAT CTG GAG GAG CTG TTC CGG GGC 1125 Met Pro Ser Ser Arg Ser Tyr Leu Asp Leu Glu Glu Leu Phe Arg Gly 615 620 625 CCT CTC GAG ATG GAC TAC TGG ATG TCC AAC AAG ATC 1171 Glu Pro Leu TGATGTGGAA Met Asp Ser Tyr Met Asn Trp Lys 630 635 I GATCTGGAGC GTCTCAGTTT GCTGGTAGCT ATAGATGGGT ATTTGGTTGA TGCTAGCTCT 1231 TCGACTGATT AGTTGCTTCA TTAACTTTCG AAAAAAAAAA 1291 AAAA ATTAAGGATT GAGTTAAAAA 1295 (2) INFORMATION FOR SEC. FROM IDENT. NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 351 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 12: Met Ser Asp Val Thr Ala Val Met Asp Leu Glu Val Glu Glu Pro Gln 1 5 10 15 Leu Ala Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Val 20 25 30 Val Thr His Tyr Leu Thr Arg Lys Val Leu Arg Glu Ser Phe Ser Cys 35 40 45 Gln Val He Thr Asp Val Asp Leu Asn Lys Asn Glu Pro Trp Glu Leu 50 55 60 Pro Gly Leu Wing Lys Met Gly Glu Lys Glu Trp Phe Phe Phe Wing His 65 70 75 80 Lys Gly Arg Lys Tyr Pro Thr Gly Thr Arg Thr Asn Arg Wing Thr Lys 85 90 95 Lys Gly Tyr Trp Lys Wing Thr Gly Lys Asp Lys Glu He Phe Arg Gly 100 105 110 Lys Gly Arg Asp Wing Val Leu Val Gly Met Lys Lys Thr Leu Val Phe 115 120 125 Tyr Thr Gly Arg Ala Pro Ser Gly Gly Lys Thr Pro Trp Val Met His 130 135 140 Glu Tyr Arg Leu Glu Gly Glu Leu Pro His Arg Leu Pro Arg Thr Ala 145 150 155 160 Lys Asp Asp Trp Wing Val Cys Arg Val Phe Asn Lys Asp Leu Wing Wing 165 170 175 Arg Asn Wing Pro Gln Met Wing Pro Wing Wing Asp Gly Gly Met Glu Asp 180 185 190 Pro Leu Wing Phe Leu Asp Asp Leu Leu He Asp Thr Asp Leu Phe Asp 195 200 205 Asp Wing Asp Leu Pro Met Leu Met Asp Ser Pro Ser Gly Wing Asp Asp 210 215 220 Phe Wing Gly Wing Being Ser Thr Cys Ser Wing Wing Leu Pro Leu Glu 225 230 235 240 Pro Asp Wing Glu Leu Pro Val Leu His Pro Gln Gln Gln Gln Pro Pro 245 250 255 Asn Tyr Phe Met Pro Pro Ala Thr Ala A «-n Gly Asn Leu Gly Gly Ala 260 265 270 Glu Tyr Ser Pro Tyr Gln Ala Met Gly Asp Gln Gln Ala Wing He Arg 275 280 285 Arg Tyr Cys Lys Pro Lys Wing Glu Val Wing Being Ser Wing Leu Leu 290 295 300 Ser Pro Leu Gly Leu Asp Thr Wing Wing Leu Wing Gly Wing Glu Thr 305 310 315 320 Ser Phe Leu Met Pro Ser Ser Arg Ser Tyr Leu Asp Leu Glu Glu Leu 325 330 335 Phe Arg Gly Glu Pro Leu Met Asp Tyr Ser Asn Met Trp Lys He 340 345 350 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is the conventional one for the manufacture of the objects or products to which it refers.

Claims

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. A method for controlling the cell cycle of plants by increasing or decreasing the level of plant cells or the binding capabilities of protein or peptide that is capable of binding to Geminivirus RepA, characterized in that the protein or peptide comprises an amino acid sequence of homology of at least 70% with the SEC. FROM IDENT. NO .: 6 or the SEC. FROM IDENT. NO .: 8, and the method comprises incorporating a nucleic acid into the plant cell, which: (a) encodes the protein or peptide, (b) is antisense to the nucleic acid (a) encoding the protein or peptide , (c) down-regulates the expression of the native nucleic acid encoding the protein or peptide by silent co-expression of the gene, or (d) codes for a protein or peptide which binds to a polypeptide sequence of SEQ. FROM IDENT. NO .: 6 or the SEC. FROM IDENT. NO .: 8

2. The method, according to claim 1, characterized in that the control of the cycle of the plant cell comprises one or more of the growth control and / or replication of the plant cell or a plant virus, the differentiation of a plant cell and the development and / or senescence of a plant cell.

3. The method according to any of the preceding claims, characterized in that the protein or peptide comprises an amino acid sequence having at least 70% sequence homology with SEC. FROM IDENT. NO .: 3 or SEC. FROM IDENT. NO .: 4

4. The method according to any of the preceding claims, characterized in that it comprises the overproduction or subproduction of protein or peptide in the plant cell.

5. The method according to any of the preceding claims, characterized in that the nucleic acid is in the form of a recombinant nucleic acid.

6. The method according to claim 5, characterized in that the sequence is placed behind a producer capable of supporting the expression of the protein or peptide comprising an amino acid sequence having at least 70% homology with the SEC. FROM IDENT. DO NOT. : 6 or the SEC. FROM IDENT. NO .: 8, or the production of antisense RNA for the nucleic acid sequence encoding the protein or peptide.

7. The method, according to any of claims 1 to 6, characterized in that the protein or the peptide is ectopically produced.

8. The method according to claim 7, characterized in that the protein or the peptide is produced in vegetative tissue or stem tissue.

9. The method according to any of the preceding claims, characterized in that it comprises producing or inhibiting senescence in a plant cell, comprising increasing or decreasing the levels in the plant cell of a protein or peptide comprising a sequence that has at least 50% homology with the SEC. FROM IDENT. DO NOT. : 10

10. The method according to claim 1 (d), characterized in that the binding agent is the RepA protein of geminivirus or a RepA protein of geminivirus, truncated in the N-terminal part, comprising the amino acids of the C-terminal part 228 -264.

11. A protein or peptide in an enriched form, isolated, cell-free and / or recombinantly produced, characterized in that it has at least 70% homology in the amino acid sequence with SEC. FROM IDENT. NO .: 6 or the SEC. FROM IDENT. NO .: 8, and is capable of binding with RepA of geminivirus.

12. The protein or peptide, according to claim 11, characterized in that it has an N-terminal sequence that has 90% or more homology with SEC. FROM IDENT. NO .: 6 or the SEC. FROM IDENT. NO .: 8. I

13. The protein or peptide, according to claim 11 or 12, characterized in that it comprises an amino acid sequence of SEQ. FROM IDENT. NO .: 10 or 12, or a functional variant thereof that has an amino acid sequence of at least 70% homology with that sequence.

14. An enriched, isolated, cell-free and / or recombinant nucleic acid, characterized in that: (a) it encodes a protein or peptide comprising an amino acid sequence of at least 70% homology with SEC. FROM IDENT. NO .: 6 or the SEC. FROM IDENT. NO: 8, (b) is antisense to the nucleic acid encoding the protein or peptide, or (c) down-regulates the expression of the native nucleic acid encoding this protein or peptide by silent co-expression of the gene.

15. The nucleic acid, according to claim 14, characterized in that it is a DNA or RNA polynucleotide comprising one or more of SEQ. FROM IDENT. NO .: 1, 2, 5, 7, 9 or 11, or sequences that have at least 70% homology with it.

16. A method for producing a protein or peptide, according to any of claims 11 to 13, characterized in that it comprises expressing DNA or RNA, as described according to claim 14 or 15.

17. An enriched, isolated, cell-free and / or recombinant nucleic acid, characterized in that it encodes a Geminivirus RepA protein truncated in the N-terminal part, comprising amino acids 228-264 of the C-terminal part of the RepA protein.

18. A nucleic acid probe or primer, characterized in that it comprises an oligonucleotide or polynucleotide of 15 or more contiguous bases of the sequences of SEQ. FROM IDENT. NO .: 5, 7, 9 or 11, or sequences complementary thereto, or RNA sequences corresponding thereto.

19. The nucleic acid probe according to claim 18, characterized in that it comprises from 30 contiguous bases up to the complete sequence of SEQ. FROM IDENT. NO .: 5, 7, 9 or 11.

20. A nucleic acid transformation vector, characterized in that it comprises DNA or RNA, as described in accordance with claims 14 or 15.

21. A method for producing transformed cells, characterized in that it comprises nucleic acid, in accordance with, or as described in any of claims 1 to 20, which comprises introducing the nucleic acid into the cell as a vector or in free form.

22. The method according to claim 21, characterized in that the nucleic acid is introduced directly by electroporation or particle bombardment.

23. A cell, characterized in that it comprises recombinant nucleic acid, as described or claimed according to any of claims 1 to 20.

24. A transgenic plant or a part thereof, characterized in that it comprises a cell according to claim 23.

25. A plasmid, characterized in that it contains a sequence DNA coding for a protein of SEQ. FROM IDENT. NO .: 10 or SEC. FROM IDENT. NO .: 12, as described herein, as deposited under the provisions of the Budapest treaty with respect to the international recognition of the 1977 deposit of microorganisms; these were deposited on June 11, 1997 in the Spanish Type Culture Collection, with access numbers CECT 4889 or CECT 4890.

26. A method for controlling the replication of a plant cell or a plant virus, by increasing or decreasing the level of plant cells or the binding capacities of the protein or peptide that are capable of binding to RepA of geminivirus, characterized in that the protein or peptide it comprises an amino acid sequence of at least 70% homology with that of SEC. FROM IDENT. NO .: 3 or SEC. FROM IDENT. NO .: 4, and the method comprises incorporating a nucleic acid into the plant cell which: (a) encodes the protein or peptide, (b) is antisense to the nucleic acid (a) encoding the protein or peptide, or (c) downregulates the expression of native nucleic acid encoding the protein or peptide by silent co-expression of the gene.

27. The method according to claim 26, characterized in that the protein or peptide comprises an amino acid sequence having at least 90% sequence homology with SEC. FROM IDENT. DO NOT. : 3 or SEC. FROM IDENT. DO NOT. : 4.

28. The method according to any of claim 26 or claim 27, characterized in that it comprises the overproduction or underproduction of the protein or peptide in a plant cell.

29. The method according to any of claims 26 to 28, characterized in that the nucleotides are in the form of a recombinant nucleic acid comprising the sequence encoding the protein or the peptide.

30. The method according to claim 29, characterized in that the sequence is placed behind a promoter capable of supporting the expression of a protein or peptide, or capable of the production of antisense RNA for the nucleic acid sequence.

31. The method, according to any of claims 26 to 30, characterized in that the protein or peptide is ectopically produced.

32. The method, according to claim 31, characterized in that the protein or peptide is produced in vegetative tissue or in stem tissue.