EP1141270A1 - Ethylene-response-factor1 (erf1) in plants - Google Patents

Abstract

The invention provides an isolated nucleic acid encoding Ethylene Response Factor 1 (ERF1), an early responsive gene, encoding a GCC-box binding protein in the ethylene gas signaling pathway in plants. Also provided and characterized is the peptide ERF1, as well as methods of using ERF1 or its expression product to modulate the response in plants or plant cells to ethylene. Moreover, because ERF1 acts downstream of EIN3 and all previously identified members of the signaling pathway, and because constitutive expression of ERF1 results in the modulation of a variety of ethylene response genes and phenotypes, the invention provides novel and useful methods for regulating the ethylene signaling pathway.

Description

ETHYLENE-RESPONSE-FACTOR1 (ERFl) IN PLANTS

REFERENCE TO RELATED APPLICATIONS This application claims priority to US Provisional Application 60/109,973, filed

November 25, 1998.

FIELD OF THE INVENTION

The invention relates to the Ethylene-Response-Factorl (ERFl) and its function in the ethylene gas signaling pathway in plants. The existence of a hierarchy of enzymes in the biosynthetic and signaling pathways provides a means to finely regulate the complex plant response to ethylene as a growth or maturation regulator and/or stress or injury signal.

GOVERNMENT INTERESTS

This invention was supported in part by the National Science Foundation grant number MCB-95-07166. The Government may have certain rights in this invention.

BACKGROUND OF THE INVENTION The plant hormone ethylene (C₂H₄) regulates a variety of stress responses and developmental adaptations in plants. This gaseous molecule is well known for its participation in physiological processes as diverse as fruit ripening, senescence, abscission, germination, cell elongation, sex determination, pathogen defense response, wounding, nodulation and determination of cell fate (Abeles et al. (1992) in Ethylene in Plant Biology, Academic Press, Inc., New York; Tanimoto et al, Plant J. 8:943-948 (1995); Penninckx et al, Plant Cell 8:2309-2323 (1996); O'Donnell et al, Science 274: 1914-1917 (1996); Penmetsa et al, Science 275:527-530 (1997)). Understanding the molecular events that lead to this diversity of plant responses is essential to elucidate how ethylene modulates such functions. A number of biological stresses are known to induce ethylene production in plants, including wounding, abscission, bacterial, viral or fungal infection, and treatment with elicitors, such as glycopeptide elicitor preparations from fungal pathogen cells. In the case of abscission, a particular layer of cells in a zone located between the base of the leaf stalk and the stem (the abscission zone) responds to a complex combination of ethylene and other endogenous plant growth regulators by a process that is, to date, not fully understood. However, the effect of abscission is the controlled loss of part of the plant, typically localized; the result of which is visible as a dead leaf or flower, or as softening or "ripening" of fruit, ultimately leaving the plant wounded at the point of separation.

The synthetic pathway of ethylene has been well characterized (Kende, Plant Physiol, Pi: 1-4 (1989)). The conversion of ACC to ethylene is catalyzed by ethylene forming enzyme (Spanu et al, EMBO J 10:2007 (1991)). In a closed circular ethylene synthetic pathway, S-adenosyl-1 methionine (SAM) is produced from methionine. Then, in a rate-limiting step, SAM is converted to 1 aminocyclopropane-1-carboxylic acid (ACC) by an ACC synthase. In a final step, ethylene is produced from ACC by an ACC oxidase. The pathway, therefore, utilizes multiple ACC synthases and ACC oxidases, creating a cascade or hierarchy of enzymes in the biosynthetic pathway and providing a means for regulating the complex plant response.

Scientists are just beginning to understand the ethylene signal transduction pathway at the molecular level. To address the ethylene signaling mechanisms, a molecular/genetic approach has been applied using the ethylene-evoked triple response phenotype of Arabidopsis thaliana seedlings. The morphological changes evoked by continuous exposure of Arabidopsis seedlings to ethylene are known as the "triple response." Recognition of the triple-response to the hormone has allowed the identification of a number of components of the ethylene response pathway. Based upon the triple response, a dozen Arabidopsis mutants have been isolated into two classes (Ecker, Science 268:667-675 (1995); Johnson & Ecker, Annu. Rev. Genetics 32:227-254 (1998): US Pat. Nos. 5,367,065; 5,444,166; 5,602,322; 5,650,553; and 5,955,652, each of which is herein incorporated by reference). One class of mutants, the ein (ethylene insensitive) mutants, show reduced or complete insensitivity to exogenous ethylene. The group of insensitive includes etrl, etr2, eiιι2, ein3, ein4, ein5/ainl, einό, and ein7 mutants (Ecker, 1995; McGrath and Ecker, Plant Physiol. Biochem. 36: 103-113 (1998); Sakai et al, Proc. Nail. Acad. Sci. USA 95:5812-5817 (1998). Based on epistasis analysis, a genetic framework for the action of these genes has been established (Roman et al, Genetics 139, 1393-1409 (1995); Sakai et al, 1998). ETR1, ETR2 and EIN4 genes act upstream of CTR1, whereas EIN2, EIN3, EIN5/AIN1, EIN6 and E1N7 genes act downstream of CTRL

The other class of mutants (the constitutive hormone response mutants) display constitutive ethylene response phenotypes in the absence of exogenously applied hormones. Using antagonists of ethylene biosynthesis and activity, this class was further divided into those mutants that display a "constitutive" triple response phenotype as a result of either ethylene overproduction (etol, eto2 and eto3) (Guzman and Ecker, 1990; Kieber et al, Cell 72:427-441 (1993)), or constitutive activation of the pathway (ctrl; constitutive triple response) (Kieber et al, 1993). The latter mutants display "ethylene" phenotypes even in the presence of inliibitors of ethylene biosynthesis or receptor binding Based upon a loss-of-function mutation conferring an ethylene constitutive response phenotype, CTR1 has been identified as a negative regulator of the ethylene response pathway. The CTR1 gene encodes a protein with similarity to the Raf-family of protein kinases, implicating a MAP-kinase cascade in the ethylene response pathway (Kieber et al, 1993)). Coupling of a "bacterial"-type receptor and "Raf -like protein kinases in the osmo-sensing pathway in yeast is provided by phospho-relay proteins (Posas et al, Cell 86: 865-875 (1996)). While several proteins with both structural and functional similarity to response regulators have been identified in Arabidopsis (Imamura et al, Proc. Natl Acad. Sci. USA 95:2691-2696 (1998)), the ethylene receptors ETR1 and ERS1 (Chang, Trends Biochem. Sci. 21 :129-133 (1996); Schaller et al, Science 270:1809-1811 (1995)); can physically interact with CTR1 (Clark et al, Proc. Natl. Acad. Sci. USA 95:5401-5406 (1998)); thus by-passing an absolute requirement for such intermediates. Less is understood about the downstream components of the ethylene signaling pathway. Cloning and characterization of the E1N3 gene revealed that it encodes a nuclear-localized protein (Chao et al, Cell 89:1133-1144 (1997); Solano et al, Genes Dev. 72:3703-3714 (1998)). While sequence analysis failed to uncover homology to previously described proteins, EIN3 shares amino acid sequence similarity, conserved structural features and genetic function with three EIN3-LIKE (EIL) proteins. Genetic studies revealed that EIL1 and E1L2 were able to functionally complement the ein3 mutation, suggesting their participation in the ethylene signaling pathway. High level expression of E1N3 or EIL1 in transgenic wild-type or ein2 mutant plants conferred constitutive ethylene response phenotypes in all stages of development, indicating their sufficiency for activation of the pathway in the absence of ethylene.

The most extensively studied of the various classes of ethylene-responsive genes, are the secondary response genes, whose expression is activated by ethylene in response to attack by pathogens. These include basic-chitinases, β-l,3-glucanases, defensins and other pathogenesis-related (PR) proteins (Boiler et al, Planta 157:22-31 (1983); Felix et al, Planta 167:206-211(1986); Broglie et al, Plant Cell 1 :599-607 (1989); Ohme- Takagi et al, Plant Mol Biol 15:941-946 (1990); Samac et al, Plant Physiol. 93:907- 914 (1990); Eyal et α/., Plant J. 4:225-234 (1993); Penninckx et al, 1996). Analysis of the promoters of several of these genes revealed a common cw-acting ethylene response element called the GCC box. This element was shown to be necessary and sufficient for ethylene regulation in a variety of plant species (Eyal et al, 1993; Meller et al, Plant Mol. Biol. 23:453-463 (1993); Hart et al, Plant Mol Biol. 21, 121-131 (1993); Shinshi et al, Plant Mol Biol. 27:923-932 (1995); Sessa et al, Plant Mol. Biol 27:923-932 (1995); Ohme-Takagi et al, Plant Cell 7: 173-182 (1995); Sato et al, Plant & Cell Physiology 37:249-255 (1996)).

Efforts to isolate trans-acting factors in tobacco that bind the GCC box identified a family of proteins termed Efhylene-Responsive-Element-Binding-Proteins (EREBPs) (Ohme-Takagi et αl, 1995). These novel DNA-binding proteins interact in vitro with the GCC box through a domain homologous to that previously observed in the floral homeotic protein APETALA2 (Ecker, 1995; Weigel, Plant Cell 7:388-389 (1995)). In

Arabidopsis, over thirty genes belonging to this family have been identified by several groups (Wilson et al, Plant Cell 8:659-671 (1996); Buttner et al, Proc. Natl Acad. Sci. USA 94:5961-5966 (1997); Okamuro et al, Proc. Nail Acad. Sci. USA 94:7076-7081 (1997)) and as result of the Arabidopsis Genome Initiative (Bevan et al, Plant Cell 9:476-478 (1997), Ecker, Nature 391 :438-439 (1998)).

The expression of several members of the EREBP family has been reported to be regulated by ethephon, an ethylene releasing compound (Buttner et al, 1997; Ohme- Takagi et al, 1995), suggesting that they may have an intermediary role in the cascade of activators and receptors in the ethylene signaling pathway. Flowever, evidence for the direct involvement of an EREBP in the ethylene signaling pathway in Arabidopsis remained lacking until the inventors' discovery of the present invention. Thus, this discovery significantly advances the science and understanding of the ethylene biosynthesis and signaling, and offers means of controlling, modulating or regulating the ethylene response during plant maturation and development, flowering, ripening of fruit, response to stress, injury, pathogens and the like.

By thus improving understanding of the ethylene signal pathway, the present invention enhances the development of methods for improving the tolerance of plants to stress, injury or pathogens, as well as for developing easier and more efficient methods for identifying stress- or injury- or pathogen-tolerant plants. Moreover, by providing insight into plant hormones and mechanisms for their control, and by modulating and regulating their functions, it is possible to significantly improve the quality, quantity and longevity of plant food products, such as fruits and vegetables, flowers and flowering ornamentals, and other non-food plant products, such as commercially valuable crops, e.g. , cotton or flax, or ornamental green plants, thereby providing more and better products for market in both developed and underdeveloped countries.

-5- SUMMARY OF THE INVENTION

The present invention relates to the cloning and characterization of Ethylene Response Factor 1 (ERFl), an early responsive gene, encoding a GCC-box binding protein. EIN3 expression is both necessary and sufficient for ERFl transcription. In addition, like EIN3 over-expression in transgenic plants, constitutive expression of ERFl results in the modulation of a variety of ethylene response genes and phenotypes. Moreover, EIN3 and EILs are demonstrated to be novel, sequence-specific DNA-binding proteins that bind a primary response element in the promoter of ERFl. Consistent with the findings in the biochemical studies, genetic analysis revealed that ERFl acts downstream of EIN3 and all previously identified members of the ethylene gas signaling pathway.

The present invention provides an isolated nucleic acid encoding a plant ethylene response factor, which is activated by EIN3 or an EIN3-like (EIL) peptide in the plant ethylene signaling pathway, wherein the activated factor binds to a target GCC-box in a secondary ethylene response gene. It also provides an isolated nucleic acid comprising ERFl, as well mutants, derivatives, homologues or fragments of ERFl, encoding an expression product having ERFl -activity. It further provides the nucleic acid comprising SEQ ID NO:l . In addition, the invention provides a purified polypeptide encoded by the above- identified nucleic acids. It also provides a purified polypeptide comprising ERFl, as well as homologues, analogs, derivatives or fragments thereof, having GCC-box binding activity in a target secondary response gene. It further provides the polypeptide comprising SEQ ID NO:2, as well as the polypeptide, wherein ERFl GCC-box binding activity is E1N3- or EiZ-dependent.

The invention also provides a recombinant cell comprising the above-identified isolated nucleic acids.

It further provides a vector comprising the above-identified isolated nucleic acids. The invention further provides an antibody specific for a plant ΕRF1 polypeptide, and homologues, analogs, derivatives or fragments thereof, having GCC-box binding activity in a target secondary response gene. It also provides an isolated nucleic acid sequence comprising a sequence complementary to all or part of the ERFl nucleic acid sequence, and to mutants, derivatives, homologues or fragments thereof encoding a GCC-box binding expression product in a target secondary response gene. Thus, the invention also provides the nucleic acid having antisense activity at a level sufficient to regulate, control, or modulate the secondary ethylene response activity of a plant, plant cell, organ, flower or tissue comprising same.

The present invention provides a plant, plant cell, organ, flower, tissue, seed, or progeny comprising any of the above identified nucleic acids, including ERFl, wherein the plant cells, organs, flowers, tissues, seeds or progeny include those of a transgenic plant. Moreover, the invention is intended to include transgenic plants, plant cells, organs, flowers, tissues, seeds or progeny comprising the aforementioned recombinant nucleic acids or polypeptides.

In addition, the invention provides an isolated nucleic acid, further comprising a plant ERFl promoter sequence, or a fragment thereof having ERFl promoter activity; as well as a transgenic plant, the cells, organs, flowers, tissues, seed, or progeny of which contain a transgene comprising the ERFl promoter sequence.

The invention further provides an isolated ERFl nucleic acid, which further comprises a reporter gene operably fused thereto, or a fragment thereof having reporter activity. The invention also provides a method for manipulating in a plant the ERFl nucleic acid to permit the regulation, control or modulation of the ethylene response in said plant. It further provides such a method, whereby the regulation, control or modulation results in the initiation or enhancement of germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in the plant. In certain embodiments of the invention, the disclosed regulation, control or modulation method provides for the inhibition or prevention of germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in the plant. In certain other embodiments of the invention, the disclosed regulation, control or modulation method provides for the activation or enhancement of germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in the plant.

The invention also provides a method of identifying a compound capable of affecting the ethylene response in the ethylene signaling system in a plant comprising: providing a cell comprising an isolated nucleic acid encoding a plant ERFl sequence, having a reporter sequence operably linked thereto; adding to the cell a compound being tested; and measuring the level of reporter gene activity in the cell, wherein a higher or lower level of reporter gene activity in the cell compared with the level of reporter gene activity in a second cell to which the compound being tested was not added is an indicator that the compound being tested is capable of affecting the expression of a plant ERFl gene.

In addition, the invention provides a method for generating a modified plant with enhanced ethylene response activity as compared to that of comparable wild type plant comprising introducing into the cells of the modified plant an isolated nucleic acid encoding ERFl, wherein said ERFl nucleic acid binds to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant. In certain embodiments of the invention are provided a method for generating a modified plant with enhanced ethylene response activity as compared to that of comparable wild type plant comprising introducing into EIN3- or EIL-defective or deficient cells of the modified plant an isolated nucleic acid encoding EIN3 or EIL, wherein said E/N5 or EIL nucleic acid activates the ΕRF1 gene, thereby permitting activation of target secondary ethylene response genes of the modified plant.

The invention further provides a method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ΕRF1 molecules within the cells of the modified plant by introducing into said cells an isolated nucleic acid encoding a complementary nucleic acid to all or a portion of erf 1, wherein said erfl nucleic acid would otherwise bind to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant. In certain embodiments of the invention are provided a method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ERFl molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ERFl, wherein said ERFl polypeptide would otherwise bind to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.

In certain additional embodiments of the invention are provided a method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the EIN3 or EIL molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ELN3 or EIL, wherein said EIN3 or EIL polypeptide would otherwise activate the expression of ERFl, thereby permitting activation of target secondary ethylene response genes of the modified plant.

The invention also provides a method for manipulating the expression of ERFl in a plant cell comprising: operably fusing the nucleic acid ERFl or an operable portion thereof to a plant promoter sequence in the plant cell to form a chimeric DNA, and generating a transgenic plant, the cells of which comprise said chimeric DNA, whereupon by controlling activation of the plant promoter, one can manipulate expression of ERFl

The invention will be more fully understood from the following detailed description of preferred embodiments, drawings and examples, all of which are intended to be for illustrative purposes only, and not intended in any way to limit the invention.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows nuclear events in the ethylene gas signaling pathway. Shown is a model of the transcriptional regulatory cascade that mediates ethylene responses. Figure 2 sets forth the results of cloning and ethylene inducibility of ERFl. Figure 2A depicts the Northern blot analysis of ERFl mRNA expression induced in the presence of ethylene gas and its comparison with the induced expression of PDF 1.2. Figure 2B depicts the Northern blot analysis of the expression of ERFl mRNA in EIN3- overexpressing plants. Figure 2C depicts the Northern blot analysis of the cycloheximide induction of ERFl expression. Numbers above the lanes indicate μM concentrations of cycloheximide (ex).

Figure 3 sets forth the data showing that EIN3 is a sequence specific DNA- binding protein. Figure 3A shows the electrophoretic mobility shift assay (EMSA) of EIN3 protein, translated in vitro, binding to the -1238 to -950 fragment of the ERFl promoter. A control protein (control) or mock translated reticulocyte lysate (RL) was used in the indicated lanes. Figure 3B shows the EMSA of ELN3-3 mutant protein, ELN3 and several deletion derivatives bound to fragments -1238 to -1204 (1) and -1213 to - 1178 (2) of the ERFl promoter. Figure 3C shows the competition of the interaction of EIN3 with its target site, the EIN3 Binding Site (EBS) by addition of anti-ELN3 antibodies (Ab-EIN3). PI stands for pre-immune serum.

Figure 4 sets forth data to characterize the EBS. Figure 4 A depicts scan mutagenesis of the EBS. Wild-type EBS is shown with the palindromic repeats indicated by arrows. Base changes in the mutants tested are indicated. Dots indicate similar bases as in the wild-type EBS (Wt EBS). Figure 4B depicts the sequence alignment of the EBS and a fragment of the promoters of E4 and GST1 genes (including the ERE). Figure 5 sets forth data to characterize the EBS. Figure 5 A shows the competition of the EIN3-EBS complex formation by addition of an excess of unlabelled EBS or two mutant versions, EBSml and EBSm2. No competitor was added in the lanes marked as 0. Black triangles represent increasing amounts of competitor (20, 60 and 200 nanograms). Figure 5B shows a summary of ELN3 structural features and mutants used in EMSA experiments.

Figure 6 shows ELN3 homo-dimerization. Figure 6A depicts EMSA of full size ELN3 and deletion derivatives binding to the EBS. Figure 6B shows EιN3-ELN3 interactions assayed by the yeast "two-hybrid" system. Yeast cells transformed with the indicated constructs as shown in the top-left plate, were grown on synthetic complete (SC) medium containing histidine (+HIS) or in SC medium without histidine (-HIS) and with 50 mM 3-aminotriazole (3-AT, Sigma) to repress basal activity of the his3 reporter gene, β-gal activity of the colonies grown in -HIS (lacZ) was determined by the filter-lift assay. SNF4/SNF1 were used as a positive control. Colonies from two independent transformation experiments are shown (BD-EIN3a and BD-EIN3b). Figure 6C depicts binding of EIL proteins to the ELN3 target site in the ERFl promoter. EMSA was performed using in vitro translated EIN3, EIL1, EIL2 and EIL3 proteins and the wild- type EBS (W) or mutant (M) version, wherein the mutant exhibits a mutation at position 17 from G to C, as shown in Figure 4. Figure 7 shows data in support of ERFl as a GCC box DNA binding protein.

Electrophoretic mobility shift assays were performed using in vitro translated ERFl protein and promoter fragments from the Arabidopsis basic-chitinase (b-CHI) and bean chitinase5B (CH5B) genes. DNA fragments containing the GCC box or mutated versions (b-CHIm and CH5Bm) of these same elements were incubated with control, mock-translated rabbit reticulocyte lysate or those containing ELN3 protein.

Figure 8 depicts constitutive activation of ethylene response phenotypes in iJS.-.'ERFi-expressing seedlings. Transgenic seedlings overexpressing ERFl in wild type (Col-0) and ein3 mutant backgrounds were grown in continuous flow-through chambers with hydrocarbon-free air in agar with or without 10 μM ACC. Untransformed wild-type and ein3 mutant plants are also shown for comparison.

Figure 9 shows that ΕRF 1 acts downstream of ΕIN2 and ELN3 in the ethylene signaling pathway. Transgenic plants overexpressing ERFl in wild type (Col-0), ein2, einS-1 and ein3-3 mutant backgrounds were grown in continuous flow-through chambers with hydrocarbon-free air for 5 weeks. Untransformed wild-type, ctrl-l and E1N3- overexpressing plants are shown for comparison.

Figure 10 shows transcriptional activation of ethyl ene-responsive genes by ERFl. Figure 10A depicts Northern blot analysis (total RNA) of the expression of ethylene- induced genes in transgenic lines overexpressing ERFl in Wt (Col-0) and ethylene insensitive mutant backgrounds. Five independent transgenic lines in Col-0 and 2 independent lines in each of the mutants are shown. The same blot was probed with ethylene-induced genes PDF 1.2 and basic-chitinase, ERFl and a loading control probe (rDNA). Figure 10B shows constitutive activation of the ethylene-induced CH5B-GUS reporter gene in ERFl -overexpressing transgenic plants.

DETAILED DESCRIPTION OF THE INVENTION Cascades of enzymes are a common theme in gene regulation, present in virtually all organisms from bacteria to humans, and involved in the regulation of processes as diverse as nitrogen fixation, embryogenesis, cell differentiation, response to pathogens, injury or extracellular signals, or circadian rhythmicity. The existence of a hierarchy or cascade of transcription factors and enzymes in the signaling pathway for ethylene, therefore, provides a means for regulating the complex plant response to this gaseous plant growth regulator/stress signal.

The present invention provides the cloning and characterization of Ethylene- Response-F actor 1 (ERFl), an early ethylene responsive gene, which encodes a GCC-box binding protein. EIN3 expression is both necessary and sufficient for ERFl transcription. Like the over-expression of ELN3 in transgenic plants, the constitutive expression of ERFl results in activation of a variety of ethylene response genes and phenotypes. Moreover, ELN3 and EILs are demonstrated to be novel sequence-specific DNA-binding proteins that bind a primary ethylene response element in the promoter of ERFl. Consistent with the biochemical studies, genetic analysis revealed that ERFl acts downstream of E1N3 and all previously identified components in the ethylene gas signaling pathway.

The sequential action of EIN3 (or EIL) and ERFl DNA binding proteins adds a new level of complexity in the regulatory hierarchy of the ethylene-signaling pathway. As diagramed in Figure 1, binding of ethylene (C₂H₄) to membrane receptors activates EIN3, and apparently EIL1 and EIL2, through a signaling cascade described elsewhere (Chao et al, 1997). EIN3 directs the expression of ERFl and other primary target genes by directly binding, as a dimer, to the primary ethylene response element (PERE) present in their promoters. Thus, sequences in the promoter of ERFl serve as an immediate target of EIN3 binding. Although ELN3 is sufficient and necessary for ERFl expression, other factors, e.g., EIL activity, may be required for full ethylene-dependent ERFl induction. Consistent with this observation, HOOKLESS1, which contains a GCC element in its promoter, is not induced in ERFl transgenic plants, indicating that ERFl is responsible for the activation of a subset of the ethylene-responsive GCC-box-containing target genes. The subset of GCC-box-containing secondary response genes of the ethylene signaling pathway, which are activated or modulated by the ERFl of the present invention are referred to herein simply as the "target genes" or "target secondary ethylene response genes" or genes having "the described GCC-box binding capability." Such a subset is readily identified by one of ordinary skill in the art without undue experimentation. Following ethylene induction or constitutive expression, ERFl activates the transcription of downstream target secondary ethylene response genes. ERFl binds to the GCC box (secondary ethylene response element, SERE), thereby activating the expression of certain secondary ethylene response genes, such as basic-chitinases and defensins (PDF1.2). The secondary ethylene response genes are also referred to herein as ethylene-inducible target genes or effector genes in the ethylene signaling pathway.

The EREBP family of DNA-binding proteins have been identified based on their ability to bind to the GCC-box, and element that has been identified as being necessary for ethylene inducibility in response to pathogen attack as reviewed by Deikman, Physiol. Plantarum 100:561-566 (1997). In fact, interactions between EREBPs and bZIP transcription factors, as well as synergistic effects of their DNA target sites, the GCC box and G box, have been previously described (Hart et al, 1993; Sessa et al, 1995; Buttner et al, 1997).

However ERFl, although a member of the ethylene response cascade, is neither anticipated nor suggested by known members of the EREBP family. For example, one member of the Arabidopsis AP2/EREBP family, AtEBP, is reportedly regulated by ethylene (Buttner et al, 1997), and like ERFl, AtEBP is constitutively expressed in ctrl mutants. However, AtEBP does not appear to be a direct target of ELN3 since its expression in response to ethylene is cycloheximide-dependent, suggesting a regulatory cascade exists among members of the EREBP family in which AtEBP acts downstream of ERFl. Consistent with this idea, several of the EREBP genes were found to contain GCC box elements in their promoters, indicating that their expression is auto-regulated or controlled by other EREBPs. Thus, the existence of a transcriptional regulatory cascade is not constrained to EREBPs involved in ethylene signaling since it has been also inferred in the case of RAP genes (AP2/ EREBP family members), which are not obviously involved in the response to ethylene (Okamuro et al., 1997). It should be appreciated that the present invention is not limited to the proposed models and mechanisms described herein. It should be further recognized that models, such as Fig. 1, present a working model merely to schematically show the role of the interactive components of the ethylene signal transduction pathway, and their relationships to ERFl, as well as to each other. Thus, the model is intended simply to facilitate understanding of the invention.

Ethylene is an olefin, therefore its receptors are presumed to require coordination of a transition metal for hormone binding activity. In wild type plants, ethylene binding to its receptor inactivates the activity of ethylene receptors (presumably causing a reduction in the histidine kinase activity), and consequently causing induction of the ethylene response through activation (de-repression) of the signaling pathway. To identify mutations in novel components of the ethylene gas signal transduction pathway, a screen was initiated for Arabidopsis thaliana mutants that exhibited an ethylene-like triple response phenotype in response to a potent hormone antagonist. The "triple response" in Arabidopsis consists of three distinct morphological changes in dark-grown seedlings upon exposure to ethylene: 1) inhibition of hypocotyl and root elongation, 2) radial swelling of the stem and 3) exaggeration of the apical hook. A class of constitutive mutants, ctr, display a constitutive triple response in the presence of ethylene biosynthetic inhibitors, and is affected at, or downstream of the receptor. Screening includes screening for root or stem elongation and screening for increased ethylene production.

By "plant" as used herein, is meant any plant and any part of such plant, be it wild type, treated, genetically manipulated or recombinant, including transgenic plants. The term broadly refers to any and all parts of the plant, including plant cell, tissue, flower, leaf, stem, root, organ, and the like, and also including seeds, progeny and the like, whether such part is specifically named or not. "Modified plants" are plants in which the wild-type gene or protein character has been altered. Phenotypic alterations may enhance or inhibit a typical wild-type response in or by the plant cells; or there may be no phenotypic effect whatsoever. As one skilled in the art will recognize, absolute levels of endogenous ethylene production by a plant or plant cell will change with growth conditions. However, in "ethylene sensitive" plants, including wild type plants or plants in which the signaling cascade is complete, secondary ethylene responses are activated by ERFl . Such plants or plant cells typically demonstrate a shut-down or diminution of endogenous gas production in the presence of high concentrations of exogenous ethylene. By comparison, an "ethylene insensitive" plant or plant cell typically continues to produce endogenous ethylene, despite administration of inhibitory amounts of exogenous ethylene. An ethylene insensitive plant will produce more ethylene or produce it at a rate greater than that of a wild type plant upon administration of an inhibitory amount of exogenous ethylene. For the purposes of the present invention, ethylene insensitivity includes either a total or partial inability to display the triple response in the presence of increased levels of exogenous ethylene, such as would be expected if the ethylene signaling pathway in were interrupted in the plant or plant cell. In such ethylene insensitive plants, the impaired receptor function resulting from blocking or inhibiting the expression of the E1N3 (or EIL) or ERFl genes will be displayed as constitutive production of endogenous ethylene, despite the presence of an abundance of exogenous ethylene.

The gene corresponding to ERFl has been cloned as set forth below and the sequence of the cDNA clone is provided as SEQ ID No:l . Nevertheless, in view of the descriptions provided, it is understood that other alleles and variations would be available to one of ordinary skill in the art. Therefore, additional mutants are also enabled by the present invention that have insertions, deletions, alterations or substitutions within the same conserved protein motif, so long as GCC-box binding activity is expressed or regulated.

The invention should be construed to include the nucleic acid comprising erfl, or any mutant, derivative, homologue or fragment thereof, so long as it still encodes an early ethylene responsive gene which encodes a binding element for the GCC-box, and which is capable of activating or modulating the expression of target secondary ethylene response genes in the ethylene signaling pathway. In accordance with the present invention, nucleic acid sequences include, but are not limited to DNA, including and not limited to cDNA and genomic DNA; RNA, including and not limited to mRNA and tRNA, and may include chiral or mixed molecules. Preferred nucleic acid sequences include, for example, the sequence set forth in

SEQ ID No: 1, as well as modifications of the nucleic acid sequence, including alterations, insertions, deletions, mutations, homologues and fragments thereof encoding the active region of ERFl or an ERFl -type regulatory protein in the ethylene response pathway capable of ERFl -GCC-box binding activity resulting in modulation of the expression of a target secondary ethylene response gene.

Expression of the secondary ethylene response genes is modulated by ERFl . "Modulation" of expression by ERFl preferably means activation of expression, although in the present invention it is also meant to include enhanced expression of the target genes. Depending on conditions, however, it is also meant to include inhibition or prevention of expression of the target genes.

A "fragment" of a nucleic acid is included within the present invention if it encodes substantially the same expression product as the isolated nucleic acid, or if it encodes a peptide having the described GCC-box binding capability. The invention should also be construed to include peptides, polypeptides or proteins comprising ERFl, or any mutant, derivative, variant, analogs, homologue or fragment thereof, having the described GCC-box binding capability in the ethylene signaling pathway. The terms "protein," "peptide," "polypeptide," and "protein sequences" are used interchangeably within the scope of the present invention, and include, but are not limited to the sequence set forth in SEQUENCE ID NO: 2, the putative amino acid sequences corresponding to nucleic acid SEQUENCE ID NO: 1, as well as those sequences representing mutations, derivatives, analogs or homologues or fragments thereof having the described GCC-box binding capability in the ethylene response pathway. The invention also provides for analogs or homologues of proteins, peptides or polypeptides encoded by the gene of interest, preferably ERFl. "Analogs" can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both, "homologues" are chromosomal DNA carrying the same genetic loci; when carried on a diploid cell there is a copy of the homologue from each parent. For example, conservative amino acid changes may be made, which although they alter the primary sequence of the peptide, do not normally alter its function. Conservative amino acid substitutions of this type are known in the art, e.g., changes within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; or phenylalanine and tyrosine.

Modifications (which do not normally affect the primary sequence) include in vivo or in vitro chemical derivatization of the peptide, e.g., acetylation or carbonation. Also included are modifications of glycosylation, e.g., modifications made to the glycosylation pattern of a polypeptide during its synthesis and processing, or further processing steps. Also included are sequences in which amino acid residues are phosphorylated, e.g., phosphotyrosine, phosphoserine or phosphothreonine.

Also included in the invention are polypeptides which have been modified using ordinary molecular biology techniques to improve their resistance to proteolytic degradation or to optimize solubility or to render them more effective as a regulatory agent. Analogs of such peptides include those containing residues other than the naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic molecules. However, the polypeptides of the present invention are not intended to be limited to products of any specific exemplary process defined herein. "Derivative" is intended to include both functional and chemical derivatives, including fragments, segments, variants or analogs of a molecule. A molecule is a "chemical derivative" of another, if it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half-life, and the like, or they may decrease toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, and the like. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980). Procedures for coupling such moieties to a molecule are well known in the art. Included within the meaning of the term "derivatives" as used in the present invention are "alterations," "insertions," and "deletions" of nucleotides or peptides, polypeptides or the like. A "fragment" of a polypeptide is included within the present invention if it retains substantially the same activity as the purified peptide, or if it has the described GCC-box binding capability. Such fragment of a peptide is also meant to define a fragment of an antibody. A "variant" or "allelic or species variant" of a protein refers to a molecule substantially similar in structure and biological activity to the protein. Thus, if two molecules possess a common activity and may substitute for each other, it is intended that they are "variants," even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the amino acid or nucleotide sequence is not identical.

In accordance with the invention, the ERFl polypeptide and ERFl nucleic acid sequences employed in the invention may be exogenous sequences. Exogenous or heterologous, as used herein, denotes a nucleic acid sequence which is not obtained from and would not normally form a part of the genetic makeup of the plant, cell, organ, flower or tissue to be transformed, in its untransformed state. Plants comprising exogenous nucleic acid sequences of ERFl, or erfl mutations are encoded by, but not limited to, the nucleic acid sequences of SEQ ID No: 1 , including alterations, insertions, deletions, mutations, homologues and fragments thereof.

Transformed plant cells, tissues and the like, comprising nucleic acid sequence of ERFl or erfl mutations, such as, but not limited to, the nucleic acid sequence of SEQ ID No: 1 are within the scope of the invention. Transformed cells of the invention may be prepared by employing standard transformation techniques and procedures as set forth in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). By the term "nucleic acid encoding" the plant cell and the like wherein secondary target cell expression is modulated by GCC-box binding, as used herein is meant a gene encoding a polypeptide having the described GCC-box binding capability which activates or modulates the expression of ERFl -regulated secondary ethylene response genes. The term is meant to encompass DNA, RNA, and the like. As described in the following Examples, ERFl genes encode proteins having specific domains located therein, for example, terminal extensions, transmembrane spans, TM1 and TM2, nucleotide binding folds, a putative regulatory domain, and the C- terminus. A mutant, derivative, homologue or fragment of the subject gene is, therefore also one in which selected domains in the related protein share significant homology (at least about 40% homology) with the same domains in the preferred embodiment of the present invention. It will be appreciated that the definition of such a nucleic acid encompasses those genes having at least about 40% homology, in any of the described domains contained therein under conditions of stringency that would be appreciated by one of ordinary skill in the art.

In addition, when the term "homology" is used herein to refer to the domains of these proteins, it should be construed to mean homology at both the nucleic acid and the amino acid levels. Significant homology between similar domains in such nucleic acids is considered to be at least about 40%, preferably, the homology between nucleic acid domains is at least about 50%, more preferably, at least about 60%, even more preferably, at least about 70%, even more preferably, at least about 80%, yet more preferably, at least about 90% and most preferably, the homology between similar nucleic acid domains is about 99%. Significant homology between similar amino acid domains in such protein or polypeptides is considered to be at least about 40%, preferably, the homology between amino acid domains is at least about 50%, more preferably, at least about 60%, even more preferably, at least about 70%, even more preferably, at least about 80%, yet more preferably, at least about 90% and most preferably, the homology between similar amino acid domains is about 99%.

According to the present invention, preferably the isolated nucleic acid encoding the biologically active ERFl polypeptide or fragment thereof is full length or of sufficient length to encode a regulated or active GCC-box binding protein capable of activating or modulating the expression of the secondary ethylene response genes. In one embodiment the nucleic acid is at least about 200 nucleotides in length. More preferably, it is at least 400 nucleotides, even more preferably, at least 600 nucleotides, yet more preferably, at least 800 nucleotides, and even more preferably, at least 1000 nucleotides in length. In another embodiment, preferably, the purified preparation of the isolated polypeptide having the described GCC-box binding activity in the ethylene signal system is at least about 60 amino acids in length. More preferably, it is at least 120 amino acids, even more preferably, at least 300 amino acids, yet more preferably, at least 500 amino acids, and even more preferably, at least 700 amino acids in length. In an additional embodiment the polypeptide encodes the full-length ERFl protein or a regulated version thereof. The invention further includes a vector comprising a gene encoding ERFl . DNA molecules composed of a protein gene or a portion thereof, can be operably linked into an expression vector and introduced into a host cell to enable the expression of these proteins by that cell. Alternatively, a protein may be cloned in viral hosts by introducing the AhybridΘ gene operably linked to a promoter into the viral genome. The protein may then be expressed by replicating such a recombinant virus in a susceptible host. A DNA sequence encoding a protein molecule may be recombined with vector DNA in accordance with conventional techniques. When expressing the protein molecule in a virus, the hybrid gene may be introduced into the viral genome by techniques well known in the art. Thus, the present invention encompasses the expression of the desired proteins in either prokaryotic or eukaryotic cells, or viruses that replicate in prokaryotic or eukaryotic cells.

Preferably, the proteins of the present invention are cloned and expressed in a virus. Viral hosts for expression of the proteins of the present invention include viral particles which replicate in prokaryotic host or viral particles which infect and replicate in eukaryotic hosts. Procedures for generating a vector for delivering the isolated nucleic acid or a fragment thereof, are well known, and are described for example in Sambrook et al, supra. Suitable vectors include, but are not limited to, disarmed Agrobacterium tumor inducing (Ti) plasmids (e.g., pBIN19) containing a target gene under the control of a vector, such as the cauliflower mosaic (CaMV) 35S promoter (Lagrimini et al, Plant Cell 2:7-18 (1990)) or its endogenous promoter (Bevan, Nucl. Acids Res. 72:8711-

8721(1984)), adenovirus, bovine papilloma virus, simian virus, tobacco mosaic virus and the like.

Once the vector or DNA sequence containing the constructs has been prepared for expression, the DNA constructs may be introduced or transformed into an appropriate host. Various techniques may be employed, such as protoplast fusion, calcium phosphate precipitation, electroporation, or other conventional techniques. As is well known, viral sequences containing the AhybridΘ protein gene may be directly transformed into a susceptible host or first packaged into a viral particle and then introduced into a susceptible host by infection. After the cells have been transformed with the recombinant DNA (or RNA) molecule, or the virus or its genetic sequence is introduced into a susceptible host, the cells are grown in media and screened for appropriate activities. Expression of the sequence results in the production of the protein of the present invention.

Procedures for generating a plant cell, tissue, flower, organ or a fragment thereof, are well known in the art, and are described, for example, in Sambrook et al, supra. Suitable cells include, but are not limited to, cells from yeast, bacteria, mammal, baculovirus-infected insect, and plants, with applications either in vivo, or in tissue culture. Also included are plant cells transformed with the gene of interest for the purpose of producing cells and regenerating plants having the described GCC-box binding capability, thereby modulating the expression of the target secondary ethylene response elements.

Suitable vector and plant combinations will be readily apparent to those skilled in the art and can be found, for example, in Maliga et al, 1994, Methods in Plant Molecular Biology: A Laboratory Manual, Cold Spring Harbor, New York).

Transformation of plants may be accomplished using Agrobacterium-mediated leaf disc transformation methods described by Horsch et αl, 1988, Leaf Disc

Transformation: Plant Molecular Biology Manual A5: l). Numerous procedures are known in the art to assess whether a transgenic plant comprises the desired DNA. and need not be reiterated.

The expression of the desired protein in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic promoters include, but are not limited to, the SV40 early promoter (Benoist et αl, Nature (London) 2P0:304-310 (1981)); the yeast gal4 gene promoter (Johnston et al, Proc. Natl. Acad. Sci. (USA) 79:6971-6975 (1982)) and the exemplified pYES3 PGK1 promoter. As is widely known, translation of eukaryotic mRNA is initiated at the codon, which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes the desired protein does not contain any intervening codons which are capable of encoding a methionine (i.e., AUG). The desired protein encoding sequence and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a non-replicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule. Since such molecules are incapable of autonomous replication, the expression of the desired protein may occur through the transient expression of the introduced sequence. Alternatively, permanent expression may occur through the integration of the introduced sequence into the host chromosome. For expression of the desired protein in a virus, the hybrid gene operably linked to a promoter is typically integrated into the viral genome, be it RNA or DNA. Cloning into viruses is well known and thus, one of skill in the art will know numerous techniques to accomplish such cloning.

Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more reporter genes or markers which allow for selection of host cells which contain the expression vector. The reporter gene or marker may complement an auxotrophy in the host (such as leu2, or ura3, which are common yeast auxotrophic markers), biocide resistance, e.g., antibiotics, or resistance to heavy metals, such as copper, or the like. The selectable marker gene can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection.

Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. The cDNA expression vectors incorporating such elements include those described by Okayama, H., Mol. Cell Biol. 3:280 (1983), and others.

In another embodiment, the introduced sequence will be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host cell. Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.

The invention further defines methods for manipulating the nucleic acid in a plant to permit the regulation, control or modulation of germination, abscission, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, or response to stress in said plant. In a preferred embodiment the method activates or enhances the above responses, whereas in another preferred embodiment the method inhibits or prevents the above responses.

Thus, methods of the present invention define embodiments in which the GCC- box binding activity is prevented or inhibited. By "prevention" is meant the cessation of GCC-box binding to target secondary response proteins in the ethylene signal pathway. By "inhibition" is meant a statistically significant reduction in the amount of GCC-box binding binding, or in the amount of expression of the target ethylene response cells, or of detectable ERFl protein as compared with plants, plant cells, organs, flowers or tissues grown without the inhibitor or disclosed method of inhibition. Preferably, by blocking or inhibiting ERFl the ERFl inhibitor reduces GCC-box binding thereby inhibiting or reducing expression of the secondary ethylene response gene by at least 20 %, more preferably by at least 50%, even more preferably by 80% or greater, and also preferably, in a dose-dependent manner. The effect of such prevention or inhibition would block (insensitivity) or inhibit the ethylene response of a plant or plant cell comprising such DNA or protein expression product.

In accordance with another preferred embodiment of the invention, once inhibitors satisfying these requirements are identified, the utilization of assay procedures to identify the manner in which the GCC-box binding or target gene expression is inhibited are particularly useful.

Ethylene insensitive plants are disease and pathogen tolerant. For purposes of the present invention, disease tolerance is the ability of a plant or plant cell to survive stress, infection or injury with minimal damage or reduction in the harvested yield of commercial product. Plants with disease tolerance may have extensive levels of infection, but little necrosis and few or no lesions, The plants or plant cells may also have reduced necrotic and water soaking responses and chlorophyll loss may be virtually absent. In contrast, resistant plants generally limit the growth of the pathogens and contain the infection to a localized area within multiple apparently injurious lesions.

Similarly, methods of the present invention are also defined in which the GCC- box binding activity is initiated, stimulated or enhanced if there is a statistically significant increase in the amount of GCC-box binding or in the amount of expression of the target ethylene response cells, or of detectable ERFl protein detected as compared with plants, plant cells, organs, flowers or tissues grown without the enhancer or disclosed method of enhancement. Preferably, the ERFl enhancer increases binding capability by at least 20 %, more preferably by at least 50%, even more preferably by 80% or greater, and also preferably, in a dose-dependent manner. Once enhancers satisfying these requirements are identified, the utilization of assay procedures to identify the manner in which the GCC-box binding is enhanced are particularly useful.

The invention further features an isolated preparation of a nucleic acid which is antisense in orientation to a portion or all of ERFl or of a gene encoding a peptide having plant GCC-box binding capability. The antisense nucleic acid should be of sufficient length as to inhibit expression of the target gene of interest. The actual length of the nucleic acid may vary, depending on the target gene, and the region targeted within the gene. Typically, such a preparation will be at least about 15 contiguous nucleotides, more typically at least 50 or even more than 50 contiguous nucleotides in length. As used herein, a sequence of nucleic acid is considered to be antisense when the sequence being expressed is complementary to, and essentially identical to the non- coding DNA strand of the ERFl gene, but which does not encode ERFl . "Complementary" refers to the subunit complementarity between two nucleic acids, e.g. , two DNA molecules. When a nucleotide position in both molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are said to be complementary to each other. Thus two nucleic acids are complementary when a substantial number (at least 40% or at least 50%, or preferably at least 60%, or more preferably at least 70% or 80%, or more preferably at least 90% or at least 99%) of the corresponding positions in each of the molecules are occupied by nucleotides which normally base-pair with each other (e.g. , A:T and G:C nucleotide pairs.). In yet another aspect of the invention, antibodies are provided which are directed against the GCC-box binding peptides or polypeptides, such as ERFl , which are capable of binding the GCC-box of secondary response proteins in the ethylene signaling pathway, thereby blocking or modulating their expression. Such an antibody is specific for the whole molecule, its N- or C-terminal, or internal portions. Methods of generating such antibodies are well known in the art.

In the embodiment directed to the antibody specific for a plant ERFl polypeptide, including functional equivalents of the antibody, the term "functional equivalent" refers to any molecule capable of specifically binding to the same antigenic determinant as the antibody, thereby neutralizing the molecule, e.g., antibody-like molecules, such as single chain antigen binding molecules.

The invention further includes a transgenic plant comprising an isolated DNA encoded ERFl or a GCC-box binding protein capable of activating the expression of secondary ethylene response genes in the plant ethylene signaling pathway. For instance provided in at least one example of the current invention, a transgenic Arabidopsis plant comprising a yeast cccΔ transgene rescued by the addition of ERFl, which when expressed confers upon the plant the ability recognize the presence of ethylene, an ability that had been deleted from the original yeast gene.

By "transgenic plant" as used herein, is meant a plant, plant cell, tissue, flower, organ, including seeds, progeny and the like, or any part of a plant, which comprise a gene inserted therein, which gene has been manipulated to be inserted into the plant cell by recombinant DNA technology. The manipulated gene is designated a "transgene." The "non-transgenic," but substantially homozygous "wild type plant" as used herein, means a nontransgenic plant from which the transgenic plant was generated. The transgenic transcription product may also be oriented in an antisense direction as describe above.

The generation of transgenic plants comprising sense or antisense DNA encoding the GCC-box binding molecules, such as ERFl, capable of activating, blocking or modulating the expression ethylene-inducible target genes, may be accomplished by transforming the plant with a plasmid, liposome, or other vector encoding the desired DNA sequence. Such vectors would, as described above, include, but are not limited to the disarmed Agrobacterium tumor-inducing (Ti) plasmids containing a sense or antisense strand placed under the control of a strong constitutive promoter, such as the CaMV 35S promoter or under an inducible promoter. Methods of generating such constructs, plant transformation and plant regeneration methods are well known in the art once the sequence of the gene of interest is known, for example as described in Ausubel et al, 1993, Current Protocols in Molecular Biology, Greene & Wiley, New York).

In accordance with the present invention, plants included within its scope include both higher and lower plants of the Plant Kingdom. Mature plants, including rosette stage plants, and seedlings are included in the scope of the invention. A mature plant, therefore, includes a plant at any stage in development beyond the seedling. A seedling is a very young, immature plant in the early stages of development.

Transgenic plants are also included within the scope of the present invention, having a phenotype characterized by the ERFl gene or er/7 mutations, or by the E7N3 gene or ein3 mutations (including e/7 mutations) affecting the activation of, or expression of, the RTF3.

Preferred plants of the present invention, which are affected by ΕRF1 or GCC- box binding to modulate expression of the secondary ethylene response genes in the ethylene signal system include, but are not limited to, high yield crop species for which cultivation practices have already been perfected (including monocots and dicots, e.g., alfalfa, cashew, cotton, peanut, fava bean, french bean, mung bean, pea, walnut, maize, petunia, potato, sugar beet, tobacco, oats, wheat, barley and the like), or engineered endemic species. Particularly preferred plants are those from: the Family Umbelliferae, particularly of the genera Daucus (particularly the species carota, carrot) and Apium (particularly the species graveolens dulce, celery) and the like; the Family Solanacea, particularly of the genus Lycopersicon, particularly the species esculentum (tomato) and the genus Solanum, particularly the species tuberosum (potato) and melongena (eggplant), and the like, and the genus Capsicum, particularly the species annum (pepper) and the like; and the Family Leguminosae, particularly the genus Glycine, particularly the species max (soybean) and the like; and the Family Cruciferae, particularly of the genus Brassica, particularly the species campestris (turnip), oleracea cv Tastie (cabbage), oleracea cv Snowball Y (cauliflower) and oleracea cv Emperor (broccoli) and the like; the Family Compositae, particularly the genus Lactuca, and the species satira (lettuce), and the genus Arabidopsis, particularly the species thaliana (Thale cress) and the like. Of these Families, the more preferred are the leafy vegetables, for example, the Family Cruciferae, especially the genus Arabidopsis, most especially the species thaliana. Preferred plants particularly include flowering plants, such as roses, carnations, chrysanthemums, geraniums and the like, in which longevity of the flower on the stem (delayed abscission) is of particular relevance, and especially include ornamental flowering plants, such as geraniums. Additional preferred plants include leafy green ornamental plants, such as Ficus, palms, and the like, in which longevity of the leaf stem on the plant (delayed abscission) is of particular relevance. Delayed flowering in such plants may also be advantageous. Similarly, other preferred plants include fruiting plants, such as banana and orange, wherein pectin-dissolving enzymes are involved in the abscission process.

The present invention will benefit plants subjected to stress. Stress includes, and is not limited to, infection as a result of pathogens such as bacteria, viruses, fungi, and conditions involving aging, wound healing and soil penetration. Bacterial infections include, and are not limited to, Clavibacter michiganense (formerly Coynebacterium michiganense), Pseudomonas solanacearum and Erwinia stewartii, and more particularly, Xanthomonas campestris (specifically pathovars campestris and vesicatoria), Pseudomonas syringae (specifically pathovars tomato, maculicola). In addition to bacterial infections, other examples of plant viral and fungal pathogens within the scope of the invention include, but are not limited to, tobacco mosaic virus, cauliflower mosaic virus, turnip crinkle virus, turnip yellow mosaic virus; fungi including Phytophthora infestans, Peronospora parasitica, Rhizoctonia solani, Botrytis cinerea, Phoma lingam (Leptosphaeria maculans), and Albugo Candida.

Through continued isolation of mutants of the cascade of enzymes in the plant ethylene signaling pathway it will be possible, in accordance with the present invention, to identify additional genes required for assembly of functional ethylene receptors, and for use as control mechanisms of the plant response to this gaseous hormonal maturation, stress or pathogen regulator. The present invention is further described in the following examples. These examples are not to be construed as limiting the scope of the appended claims.

EXAMPLES Strains and Growth Conditions

The Arabidopsis ecotype Columbia (Col-0) was the parent strain of all mutants and transgenic plants used in the following examples. Triple response screens were performed as described previously by Guzman and Ecker, Plant Cell 2:513-523 (1990). Plant growth in air and ethylene was carried out as described previously by Kieber et al, 1993.

Nucleic Acid Analysis

Total RNA extractions and Northern analyses were performed as described by Reuber et al, Plant Cell 8:241-249 (1996) and by Chao et al, 1997. β-glucuronidase activity was assayed by incubation of the plants with the substrate of the enzyme (X- Glue, 1 mg/ml) in sodium phosphate buffer during 18 h.. cDNA clones corresponding to ERFl were isolated by hybridization of a size-selected cDNA library in λZAPII (Kieber et al, 1993). The probe, corresponding to a fragment of the tobacco EREBP 1 gene, was obtained by PCR amplification using the primers:

EREBPlf: 5' CACGCCATAGACATAATAC 3' (SEQ ID No: 3) and EREBPh: 5' GCTACGATTCCTGTTCCTTCAG 3' (SEQ ID No: 4).

ERF7 genomic sequences were isolated by hybridization of two BAC genomic libraries (TAMU and IGF) (Choi et al, Weeds World 2:17-20 (1995)). The map position of ERFl was obtained by PCR amplification of YAC pools using specific primers. PCR highlighted two YAC clones (CIC12H5 and CIC12H6), both located in the ABI3 contig. Example 1: Characterization of the ERFl gene and its Expression Product Protein synthesis and DNA analysis

Full length ERFl, E1N3 and the EIN3 deletion derivatives were generated by in vitro translation (or cotranslation in the dimerization experiments) using a flexi-rabbit reticulocyte lysate system (Promega™) as described by Solano et al, J. Biol. Chem. 272:2889-2895 (1997). PCR and Klenow labeling of promoter fragments and oligonucleotides, DNA binding reactions and electrophoretic mobility shift assays (EMSAs) were performed as described Solano et al, EMBO J. 14:1773-1784 (1995). The promoter fragments of the Arabidopsis and bean basic-chitinase (CHI) genes containing the GCC box were obtained by Klenow filling of the following overlapping primers: b-CHIforward: 5' GTTGATCACGAACCCGCCGCCTCATATTCATAATTA 3'

(SEQ ID No: 5); b-CHImutant: 5' GTTGATCACGAACCCGTTGTTTCATATTCATAATTA 3' (SEQ ID No: 6); b-CHIreverse: 5' TTTAACTTTAATTATGAATATGA 3' (SEQ ID No: 7); CH5Bforward: 5' CTTCACGCTTGGGAAGCCGCCGGGGTGGGCCCGCAG

3' (SEQ ID No: 8);

CH5Bmutant: 5' CTTCACGCTTGGGAAGTTGTTGGGGTGGGCCCGCAG 3' (SEQ ID No: 9); and

CH5Breverse: 5' AAACCTTTCTGCGGGCCCACCCC 3' (SEQ ID No: 10). Sequences of the mutant versions of EBS used in competition experiments are:

EBSml : 5' GTTGTTTGGGATTCTTCGGGCATGTATCTTGAATCC 3' (SEQ ID No: 1 1) and

EBSm2: 5' GTTGTTTGGGATTCAAGCCCCATGTATCTTGAATCC 3' (SEQ ID No: 12). Plant transformation

A 0.8 kb BamHI-Kpnl fragment of ERFl cDNA was cloned into BamHI-Kpnl- digested pROK2 (Baulcombe, Nature 321 :446-449 (1983)). The C58 strain of Agrobacterium tumefaciens containing the above construct was used to transform the Arabidopsis ecotype Col-0 and the ethylene insensitive mutants ein2-5, ein2-l 7, ein2-26, ein3-l, ein3-3 and ein5-l, by in planta vacuum infiltration (Bechtold et al, C. R. Acad. Sci. Paris Life Sci. 316: 1 194-1199 (1993). Kanamycin resistant (kan^R) Tl plants were selected by plating seeds on MS medium supplemented with 100 μg/ml kanamycin, and transferring kan^R seedlings to soil. Yeast transformation and "two-hybrid" screening Yeast strain Y190 was transformed by the PEG/lithium acetate method as described by Gietz et al, Nucleic Acid. Res. 20:1425 (1992). Growth conditions, screening procedures and filter-lift assay for β-galactosidase activity were performed as described by Kim et al, Proc. Natl. Acad. Sci. USA 94: 11786-1 1791 (1997). GenBank Accession Numbers

GenBank accession numbers for the ERFl cDNA and genomic sequences identified in the present invention are AF076277 and AF076278, respectively. Cloning and characterization of ERFl

To identify targets of the ΕIN3/ΕIL proteins and to examine the role of EREBPs in the ethylene signaling pathway, a PCR-based approach was used to isolate members of the EREBP family in Arabidopsis. Using oligonucleotides complementary to the tobacco EREBPl sequence (Ohme-Takagi et al, 1995), a 597 bp fragment was amplified from tobacco genomic DNA, and this fragment was used to screen an Arabidopsis cDNA library under low stringency.

Among the resulting positive clones, two classes of cDNAs showed high homology to the tobacco EREBP 1/2 and EREBP3/4 genes. Total RNA was isolated from 4 weeks-old Wt Col-0 (W) or ein3-l (M) plants grown in air and exposed to ethylene gas for different times (0 to 48 hours). Thirty μg of total RNA was loaded per lane in Figure 2A and 2C, and 60 μg/lane in Figure 2B.

One gene, called Ethylene-Response-Factorl (ERFl) showed rapid induction in response to ethylene. More importantly, ERFl mRNA began to accumulate after 15 minutes of hormone treatment of plants. Induction of ERFl mRNA was also dependent on the presence of functional ELN3 as shown in Figure 2A.

In order to compare the kinetics of ERFl induction with that of a known ethylene-inducible gene, the same blot was hybridized with PDF 1.2, a member of the defensin gene family (Penninckx et al, 1996). As expected if ERFl is a regulator of these genes, maximal ERFl expression occurred earlier than PDF 1.2 (Figure 2A).

Since overexpression of the ethylene pathway genes E7N3, EIL1 or EIL2 causes activation of all known ethylene response genes and phenotypes, the expression of ERFl was examined. Although the level was somewhat lower than that achieved by exogenous ethylene treatment, ERFl mRΝA showed constitutive high-level expression in 35S::EIN3 -expressing transgenic plants (see Figure 2B), indicating that ΕIΝ3 is sufficient for ERFl expression. Taken together, the results demonstrate that E7N3 is both necessary and sufficient for expression of the early ethylene response gene ERFl, a novel

AP2/EREBP-type DNA binding protein

To confirm that ERFl is a primary ethylene response gene, induction by the hormone=s dependence on protein synthesis was tested using cycloheximide as described by Lam et α/., EMBO J. 8:2777-2783 (1989) and Abel et αl, J. Mol. Biol. 251 :533-549 (1995). Cycloheximide treatment was found to induce the expression of ERFl at least 20 to 50 fold higher than that observed by ethylene treatment, masking the ethylene inducibility (Figure 2C).

ERFl was mapped to chromosome III, in the ABI3 contig, by PCR amplification of YAC pools using ERFi-specific primers. Other than EIN3, none of the known ethylene signaling mutants mapped to this region.

Example 2: ERFl is Downstream Component in Ethylene Gas Signaling Pathway

Previous efforts to understand the hormonal regulation of ethylene-regulated genes in several plant systems led to the identification of two kinds of ethylene response elements (EREs). One type of ERE was found to be responsible for ethylene-regulated expression of genes induced during senescence (Itzhaki et αl, 1994). A second element, the "GCC box" , was identified as being necessary for ethylene inducibility in response to pathogen attack (reviewed by Deikman, 1997). Based on an ability to bind to the GCC element, a family of DNA-binding proteins (EREBPs) was identified in tobacco (Ohme- Takagi et αl, 1995). The fact that these genes were themselves transcriptionally activated by treatment with ethylene suggested that they act as an intermediate step between the EIN3/EIL proteins and downstream effector genes, such as basic-chitinase. To identify targets of ELN3, members of the Arabidopsis EREBP family were cloned and characterized. ERE7 was rapidly induced in response to ethylene gas and constitutively expressed in the presence of the ethylene pathway mutant ctr7. Ethylene induction of ERFl was completely dependent on a functional EIN3 protein, since no expression was detected in the ein3-l mutant. Moreover, transgenic plants overexpressing EIN3 showed high-level expression of ERFl mRNA. The results indicate that EIN3 is both necessary and sufficient for ERFl expression, conclusions which are consistent with ERFl being a direct target of EIN3. The level of ERFl mRNA expression in EIN3 overexpressing plants was somewhat lower than in Ctrl mutants or in ethylene treated wild-type plants. This indicated that although ELN3 is sufficient for ERF7 expression, other factors are required for full ethylene-dependent ERFl induction. Using ΕLN3 as a "bait" in the "two-hybrid" screen, a DNA-binding protein was identified that interacts with EIN3. This protein also bound to the ERF7 promoter in a sequence specific-manner, indicating its role as a partner of ΕIN3 and suggesting its importance to full ERFl expression in response to ethylene.

Loss-of-function mutations have not been reported for any member of the EREBP family. This finding, together with the fact that over 30 of these genes have been identified in Arabidopsis, suggested a functional redundancy among members of the EREBP family. In the case of functionally redundant genes, loss-of-function alleles may not show a phenotype. A clear example of this has been provided by studies of the ethylene receptors in Arabidopsis (Hua and Meyerowitz, Cell (1998)). Implication in the ethylene signaling pathway of each of the five EFRi-related genes was made through the identification (or creation by site-specific mutagenesis) of dominant mutations (Chang et al, Science 262, 539-544 (1993); Hua et al, 1995; Hua et al, Plant Cell, 1998; Sakai et al, 1998). While single loss-of-function mutations in these genes do not exhibit defects in ethylene response, triple and quadruple mutants display constitutive ethylene response phenotypes, revealing that ethylene responses are negatively regulated by the receptors (Hua and Meyerwitz, Cell, 1998).

For this reason, a gain-of-function strategy was used to address the in vivo function of ΕRF1. Gain-of-function mutations obtained by insertional mutagenesis of T- DNA or transposon elements carrying a CaMV 35S promoter (enhancer-trap/gene-trap) have proven to be a powerful tool for assessing the in vivo function of a gene.

Constitutive ERFl expression resulted in seedling and adult phenotypes very similar to those displayed by loss-of-function Ctrl mutants, plants overexpressing ΕIN3 or EIL1 or plants grown in ethylene.

Some significant differences were, however, observed between ELN3 and ERFl overexpressing plants. While ERFl overexpression caused inhibition of hypocotyl and root cell elongation, seedlings lacked an exaggerated apical hook. Consistent with this observation, HOOKLESS1 was not induced in ERF7 transgenic plants. Other ΕRΕBP family members appear to be responsible for activation of these target genes.

Indeed, a transposon-induced gain-of-function mutant (tiny) that constitutively expresses an ΕRΕBP displayed seedling phenotypes reminiscent of a partial ethylene response (Wilson et al, 1996), suggesting that TINY may be a partner of ΕRF1 in ethylene signaling. Alternatively, ΕRF1 may act in concert with other enzymes in the activation of some promoters.

Example 3: Sequence-specific binding of EIN3 in the promoter of ERFl To test whether the nuclear protein EIN3 is capable of DNA-binding, electrophoretic mobility shift assays (EMSA) using in vitro translated EIN3 protein and the 5' promoter region of the ERF7 gene were performed. A 6 kb fragment containing the ΕRF1 promoter was isolated from genomic sequences (BAC FI 1F14) and subcloned into pBluescript™. Five overlapping fragments that covered approximately 1.4 kb upstream of the ERF7 translation initiation site were amplified and radioactively labeled by PCR. As shown in Figure 3 A, a slower migrating band was observed when one of the fragments (-1238 to -950) was incubated with reticulocyte lysates containing ΕIN3. The binding of EIN3 to the -1238 to -950 fragment was not competed by a 500-fold excess of poly-(dldC) or -(dAdT), demonstrating the specificity of the EIN3-DNA interaction. The specific retarded band was reproducibly more intensely in lanes competed with dAdT than with dldC, suggesting that the ELN3 target sequence may be GC-rich.

To further delimit the EIN3 target site, this fragment was subdivided and each subfragment was subjected to binding experiments. Only one of the sub-fragments (- 1213 to -1179) was specifically recognized by EIN3, further confirming its sequence specificity (Figure 3B).

To demonstrate that EIN3 was in fact the protein present in the mobility-shifted band, a series of truncated ELN3 derivatives was generated and subjected to binding and EMSA using the 36 bp ELN3 -binding fragment. A mobility shift that correlated with the molecular weight of each of the truncated proteins was observed, confirming the presence of ELN3 in the protein-DNA complex (Figure 3B). The smallest protein that retained DNA-binding capacity was EIN3Δ269, delimiting the EIN3 -DNA-binding domain to amino acids 1 through 359.

In addition, a mutant version of EIN3 that contained the amino acid substitution encoded by the ein3-3 allele (Lys ⁴⁵ to Asn) was generated by in vitro translation of the corresponding mRNA. The amino acid substitution in the ein3-3 mutant lay within the basic domain III of the EIN3 protein. Interestingly, the mutant ELN3-3 protein was unable to recognize the 36 bp target site (Figure 3B).

Additional evidence that EIN3 is the protein in the complex with DNA was obtained by competition of the EIN3 -DNA-binding using an anti-EIN3 antibody. No mobility shift was observed in the binding reaction mixtures that included the anti-EIN3 antibody. In contrast, addition of preimmune serum had no effect on the gel shift assay (Figure 3C). Immunoblotting of the bandshift gel using anti-EIN3 antibodies further identified EIN3 as the protein in the retarded band, since the antibodies highlighted a band with the same mobility as the slow migrating complex. In EMSA experiments where short DNA molecules were used, the full-length

EIN3 protein produced two mobility shifted bands, whereas its deletion-derivatives retarded only one band. Since several subproducts were obtained in the EIN3 in vitro translation reaction, the upper band apparently corresponded to full-length ELN3 and the lower band to a truncated ELN3 derivative. Additionally, further experiments demonstrated that the source of the ELN3 protein does not affect its ability to bind DNA. As with the in vitro translated protein, Baculovirus-expressed ELN3 also recognized the 36 bp fragment containing the target sequence. Moreover, in this case only one major mobility shifted band was observed in the EMSA. To more precisely define the sequence requirements of EIN3 -binding, scanning mutagenesis of the 36 bp fragment was performed. As seen in Figures 4A and 4B all mutations affecting the affinity of EIN3 for its target site reside within a 28 bp sequence that included two palindromic repeats separated by a central core sequence. Single mutations within the core sequence completely abolished binding, indicating that this sequence is necessary for EIN3 recognition. Mutations that affected both palindromic repeats greatly reduced EIN3 binding, confirming that they are also important determinants of the interaction.

Interestingly, the ELN3 binding site shows significant similarity to sequences present in the promoter regions required for ethylene responsiveness in the tomato E4 (Montgomery et al, Proc. Natl. Acad. Sci. USA 90:5939-5943 (1993)) and LEACOl genes (Blume et al, Plant J. 12:731-746 (1997)), and in the carnation GS77 gene (Itzhaki et al, Proc. Natl. Acad. Sci. USA 91 :8925-8929 (1994)), (Figure 4B). In GS77, a 197 bp promoter fragment containing this sequence was also sufficient to confer ethylene responsiveness to a minimal CaMV 35S promoter in transient assays (Itzhaki et al, 1994).

To further examine the specificity of the binding to its target site, competition experiments were performed using an excess of unlabeled ELN3 Binding Site (EBS), or two mutated versions (EBSml and EBSm2) not recognized by EIN3. See FIGs. 5 A and 5B. Each lane contains 1 nanogram of labeled EBS. As shown in Figure 5A, the formation of the ELN3-EBS complex was more efficiently competed by an excess of unlabelled EBS than by any of the EBS mutant versions, further supporting the finding that the ELN3-EBS interaction is sequence specific. Figure 5B represents a summary of EIN3 structural features and mutants used in EMSA experiments, as adapted from Chao et al, 1997.

Example 4: EIN3 is a Novel DNA-Binding Protein that Regulates Expression of ERFl

Although ELN3 and EIL proteins do not share similarity with any known proteins, their nuclear location, presence of conserved basic domains and acidic regions suitable as binding and activation domains, respectively, characterize their role as transcription factors (Chao et al, 1997). DNA-binding assays using in vitro translated and Baculovirus-expressed EIN3 protein demonstrated that EIN3 binds to specific sequences in the ERF7 promoter. EMS A experiments using truncated forms of the protein or antibodies against ELN3 confirmed the presence of EIN3 in the DNA-protein complex. On the other hand, a mutant protein corresponding to the ein3-3 allele of EIN3 was unable to recognize the target sequence. This mutation consists of a Lys to Asn substitution in the basic domain III, which may form part of the DNA-binding motif.

Two additional proteins that belong to the EIN3/EIL family, EILl and EIL2, were also able to specifically recognize the ELN3 target in the promoter of ERFl. Consistent with this result, EIN3 can be functionally replaced by EILl or EIL2 since overexpression of either of these genes in transgenic plants can complement the ein3-l mutation (Chao et al, 1997). Deletion analysis of EIN3 permitted confirmation that its DNA-binding domain falls within the N-terminal half of the protein. This region is the most conserved among all four members of the family and does not contain any previously known DNA- binding motif. The ELN3/EIL DNA-binding domain will be further characterized by structural analysis of the proteins. Nevertheless, these four proteins (ELN3, EILl, EIL2 and EIL3), along with a fifth more recently identified homolog (EIL4), possess several predicted α-helices, two of them rich in basic amino acids offering a DNA-interaction surface. Scanning mutagenesis of the DNA fragment containing the target site permitted determination of the sequence requirements for the EIN3/EIL interaction. The defined target site included two inverted repeats and is recognized by the protein as a dimer. Interestingly, the EIN3 binding site shares significant identity with sequences within the promoter region of the carnation GS77 gene that has been defined as necessary and sufficient for ethylene responsiveness. The conserved sequences are also present in the promoter regions required for ethylene responsiveness in the tomato E4 and LEACOl genes. This indicates that the EIN3 target site represents a primary ethylene response element (PERE) conserved in different species where there are also orthologs of EIN3. Consistent with this determination, one of the genes containing this element (E4) has been previously identified as a primary ethylene response gene (Lincoln et al, Proc Natl. Acad. Sci. USA 84:2793-2797 (1987)). The GCC element appears to be a secondary ethylene response element (SERE) present only in a subset of the ethylene- regulated genes (e.g., pathogenesis-related genes, HOOKLESS1 and some EREBPs) that are regulated by a subgroup of the EREBP family of proteins. Example 5: EIN3 Recognizes its Target as a Homodimer

The presence of palindromic repeats in the ELN3 target site suggested that EIN3 would interact with its target as a dimer. To address this question, using the approach of

Hope et al, EMBO J. 6:2781-2784 (1987), full length EIN3 and several carboxyl terminal deletion derivatives were translated in vitro, alone or in pair-wise combinations.

The resulting translation or co-translation products were tested for DNA binding to the

EBS. As shown in Figure 6A, in addition to the bands corresponding to the full size

EIN3 and deletion derivatives bound to DNA, a band of intermediate mobility appeared when the co-translation products were used. The intermediate band corresponds to the mobility shift for a heterodimer, confirming that these proteins bind to the EBS as dimers.

Additional evidence that EIN3 has the capacity to form dimers came from screening for ELN3 -interacting proteins using the yeast "two-hybrid" system (Fields et al, Nature 340:245-246 (1989); Durfee et al, Genes Dev. 7:555-569 (1993)). Consistent with EIN3 being a transcriptional activator, fusion of the full size protein with the GAL4 DNA-binding domain (BD) activate transcription of the LacZ reporter gene, indicated that ELN3 possesses activation domains that are functional in yeast. To avoid this activation of the reporter gene, an ELN3 derivative containing amino acids 53 to 257, fused to the GAL4-BD, was used as a "bait." As a "prey," the GAL4-activation domain was fused to an Arabidopsis cDNA library constructed using mRNA from etiolated seedlings (Kim et al, 1997). Yeast strain Y190 transformed with the "bait" construct was subsequently transformed with the "prey" and four million independent transformants were screened for positive interactions, as described by Kim et al. (1997). Twenty-six independent positive clones were obtained. The plasmids were recovered and their cDNAs were sequenced. Among them, six different clones corresponded to EIN3. All positives were re-tested by directly transforming yeast with both the original "bait" and the recovered "prey." Figure 6B shows an example of the interaction with one of these positives that included amino acids 113 to 628 of EIN3. Since the "bait" contains ELN3 residues 53 to 257, the dimerization domain was localized as residing between amino acids 113 and 257. These results also confirmed that interaction of the EIN3 -binding domain with DNA is not required for protein dimerization.

To examine whether other members of the EIN3/EIL family are also able to bind DNA, EMSA experiments were performed using in vitro translated EILl, EIL2 and EIL3 proteins, and a DNA fragment containing the EBS or a mutant version. Consistent with the ability of EILl and EIL2, but not EIL3, to complement the ein3-l mutation in transgenic plants, both EILl and EIL2, but not EIL3, were able to specifically recognize the EBS element (Figure 6C).

To assess whether EIN3 and the EILs were capable of forming heterodimers, DNA-binding experiments using all combinations of co-translated ELN3/EILs proteins were performed. While mobility shifted bands corresponding in position to homodimeric forms of ELN3, EILl and EIL2 were observed, DNA-protein complexes with intermediate mobility were not seen, indicating that these proteins do not form heterodimers.

Example 6: ERFl Is a GCC-Box Binding Protein

The preceding examples demonstrated that EIN3 is a transcriptional activator that is both necessary and sufficient for ERFl expression. Therefore, it was predicted that ERFl would play a role in directing the expression of target genes containing the GCC element. However, at least one EREBP, involved in the regulation of cold and drought response, is known to bind a DNA sequence unrelated to the GCC element (i.e., C-box/ DRE element; Stockinger et al, Proc. Natl. Acad. Sci. USA 94:1035-1040 (1997)).

To determine whether ERFl contained a functional DNA-binding domain, which would be able to interact with the GCC element in a sequence-specific manner, DNA- binding experiments were performed with in vitro translated ERFl protein. Radiolabeled promoter fragments of the ethylene-regulated Arabidopsis basic-chitinase (Samac et al., 1990) and bean chitinase5B genes (Broglie et al, 1989), were incubated with ERFl and analyzed by EMSA. To examine the specificity of the interaction, a mutated version of the promoter fragments were also used, in which the cytosines of the GCC box element were substituted by thymines. As shown in Figure 7, ERFl was able to specifically bind the promoter fragments containing the GCC element, whereas no binding was observed to the mutant sequences. The lower band in each lane containing ERFl and the wild-type element apparently corresponds to a truncated form of ERFl since two major bands were obtained as products of the in vitro translation of ERFl mRNA.

Example 7: Downstream Activation of Ethylene Responses by ERF

To further evaluate the role of ERFl in the ethylene signaling pathway, transgenic plants were constructed which constitutively expressed ERF7 mRNA under control of a CaMV 35S promoter. T2 segregants of these transgenic lines were examined for ethylene response phenotypes.

Out of a total of 26 independent lines, plants from 9 lines displayed phenotypes similar to those observed in the constitutive ethylene response mutant ctr7, or in ΕIN3- or EILl -overexpressing plants. Etiolated 35S::ERF1 seedlings grown in hydrocarbon- free air showed inhibition of root and hypocotyl elongation, typical of the response to treatment with ethylene (Figure 8A-H). However, the apical hook did not display exaggerated curvature typical of an ethylene response. The cotyledons of ERFl - expressing seedlings were still apressed and many were still encapsulated in the seed coat. Consistent with this phenotype, HOOKLESS1, an ethylene response gene required for apical hook curvature (Lehman et al, Cell 85: 183-194 (1996)), was not expressed in ERFl -overexpressing plants. Expression of only a partial seedling triple response phenotype in these lines is consistent with a role for ERFl in mediating a subset of the ethylene responses. ERF7 may act along with other genes, e.g., EREBPs and others, to fully mediate the various seedling responses to ethylene.

As adults, 35 S: .ERFl transgenic plants showed an extreme dwarf phenotype similar to the constitutive ethylene response mutant Ctrl and to ΕIN3/ΕIL1- overexpressing transgenic plants (Figure 9A-G). As in the case of the quadruple ethylene receptor knockout mutant (Hua and Meyerowitz,, Cell, 1998), plants from several ERF1- expressing lines showed extreme inhibition of cell enlargement, and ultimately the plants wilted and died before bolting. To determine whether the "ethylene" morphology displayed by these plants was the consequence of ethylene overproduction, or due to constitutive activation of the signaling pathway, the 35 S:: ERFl gene was also introduced into several mutant backgrounds (ein2-5, ein2-17, ein2-26, ein3-l, ein3-3 and ein5-l) that suppress phenotypes resulting from ethylene overproduction. In all cases, the transgenic plants displayed a morphology indistinguishable from that of 35S..ERF1 -expressing wild-type plants (Figures 9 and 10). Thus, the observed morphology evoked by expression of ERFl was not a consequence of ethylene production; rather, like CaMV 35S::EIN3 expression, the morphology resulted from constitutive activation of the response pathway. Moreover, because there was an absence of the requirement for functional

ELN2, ELN3 or ELN5 proteins for the constitutive activation phenotype, the morphology results provided strong evidence for the downstream location of ERFl .

To confirm whether the observed morphology in the 35S::ERF1 lines was due to activation of ethylene response, the expression of several ethylene-regulated genes was examined. As expected, the ethylene induced accumulation of mRNAs for two ethylene response genes, basic-chitinase and PDF 1.2 was completely blocked in a strong mutant (ein2), or was significantlly reduced in the weak ethylene insensitive mutants (ein3 or ein5) (Figure 10A). In each of five independently derived transgenic ERF1- overexpressing 5 week-old, air grown plants, high level constitutive expression of mRNAs for basic-chitinase and PDF 1.2 was observed (Figure 10A). Total RNA (5 μg) was loaded per lane in the middle and right panels, and 50 μg in the left panel of Figure 10A. Moreover, constitutive expression of chitinase and PDF 1.2 mRNA was observed when the 35S::ERF1 gene was introduced into three different ethylene insensitive mutant backgrounds. The ein2; 35S::ERF1, ein3; 35S::ERF1 and ein5; 35S::ERF1 transgenic lines all showed high level expression of mRNAs for these genes. In the case of ein5-l the lower expression of ERFl in one of the two transgenic lines correlated with the lower expression of PDF 1.2 and basic-chitinase, and with the weaker constitutive ethylene response phenotype.

The effect of 35S::ERF1 expression on a chitinase promoter gene fusion, CH5B.. GUS, was also examined. This well-characterized ethylene-responsive reporter gene has proven to be a reliable marker for ethylene-evoked transcription in bean (Broglie et al, 1989), and Arabidopsis (Chen et al, Plant Physiol. 108:597-607 (1995)).

Three-week-old FI plants derived from crosses between plants carrying the CH5B::GUS reporter gene and ERF7 -overexpressing lines or wild-type plants were grown on agar plates and stained for GUS activity.. As revealed by intense staining in seedlings, high level GUS activity was observed in the presence of 35S:: ERFl, whereas no staining was detected in the control plants (absence of 35S:: ERFl) (Figure 10B). Moreover, introduction of the 35S::ERF1 construct into an ethylene-repressible enhancer-trap reporter line also resulted in inhibition of GUS expression in the absence of ethylene, confirming repressed transcription of the ethylene-regulated gene by ΕRF1 expression.

These results confirm that ΕRF1 expression is sufficient to promote (or repress) transcription of ethylene-regulated target genes in a variety of plant tissues.

In sum, rapid ΕLN3 -dependent induction of ERFl expression in response to ethylene, binding of EIN3 to the ERFl promoter, and constitutive expression of ERFl in E7N3-overexpressing plants support the conclusion that ERF7 is an immediate target of ΕIΝ3. Binding of ERFl to the GCC element in the promoters of ethylene-regulated genes, and constitutive activation of ethylene response genes and phenotypes in both etiolated seedling and adult plants in the ERFl gain-of-function experiments further define ERFl as a downstream ethylene signaling pathway gene. The sequential action of EIN3 (or EILs) and ERFl DNA binding proteins adds a new level of complexity in the regulatory hierarchy of the ethylene-signaling pathway. Thus, the existence of this hierarchy of enzymes in the signaling pathway for ethylene provides a means to finely regulate the complex plant response to this gaseous plant growth regulator/stress signal. The disclosures of each patent, patent application and publication cited or described in this document are hereby incorporated herein by reference, in their entirety. Various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.

Claims

What is claimed is:

1. An isolated nucleic acid encoding a plant ethylene response factor, which is activated by ELN3 or an ELN3-like (EIL) peptide in the plant ethylene signaling pathway, wherein the activated factor binds to a target GCC-box in a secondary ethylene response gene.

2. The nucleic acid according to claim 1, comprising ERFl.

3. The nucleic acid according to claim 2, further comprising mutants, derivatives, homologues or fragments of ERFl, encoding an expression product having ERFl -activity.

4. The nucleic acid according to claim 2, comprising SEQ ID NO: 1.

5. A purified preparation of a polypeptide encoded by the nucleic acid of any of claims 2-4.

6. The polypeptide according to claim 5, comprising ERFland homologues, analogs, derivatives or fragments thereof, having GCC-box binding activity in a target secondary response gene.

7. The polypeptide according to claim 6, comprising SEQ ID NO:2.

8. The polypeptide according to claim 7, wherein ERFl GCC-box binding activity is EIN3- or ETJ-dependent.

9. A recombinant cell comprising the isolated nucleic acid of any of claims 1-4.

10. A vector comprising the isolated nucleic acid of any of claims 1-4.

11. An antibody specific for a plant ERFl polypeptide, and homologues, analogs, derivatives or fragments thereof, having GCC-box binding activity in a target secondary response gene.

12. An isolated nucleic acid sequence comprising a sequence complementary to all or part of the nucleic acid sequence of one of claims 1-4, and to mutants, derivatives, homologues or fragments thereof encoding a GCC-box binding expression product in a target secondary response gene.

13. The nucleic acid according to claim 12 having antisense activity at a level sufficient to regulate, control, or modulate the secondary ethylene response activity of a plant, plant cell, organ, flower or tissue comprising same.

14. A plant, plant cell, organ, flower, tissue, seed, or progeny comprising nucleic acid according to any of claims 1-4 or 12-13.

15. A transgenic plant, the cells, organs, flowers, tissues, seeds or progeny of which comprise the nucleic acid according to any of claims 1-4 or 12-13.

16. A transgenic plant, the cells, organs, flowers, tissues, seeds or progeny of which comprise the recombinant nucleic acid according to claim 9.

17. A transgenic plant, the cells, organs, flowers, tissues, seeds or progeny of which comprise the polypeptide according to any of claims 5-8.

18. An isolated nucleic acid of one of claims 1-4 or 12-13, further comprising a plant ERFl promoter sequence, or a fragment thereof having ERFl promoter activity.

19. A vector comprising the isolated nucleic acid of any of claims 1-4 or 12-13 or 18.

20. The isolated nucleic acid of claim 18, further comprising a reporter gene operably

21. fused thereto, or a fragment thereof having reporter activity.

22. A transgenic plant, the cells, organs, flowers, tissues, seed, or progeny of which comprise a transgene comprising an isolated nucleic acid comprising an ERFl promoter sequence.

23. A method for manipulating in a plant the nucleic acid according to any of claims 1-4 or 12-13 to permit the regulation, control or modulation of the ethylene response in said plant.

24. The method according to claim 22 wherein said regulation, control or modulation initiates or enhances the germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in said plant.

25. The method according to claim 22, wherein said regulation, control or modulation inhibits or prevents the germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in said plant.

26. A method of identifying a compound capable of affecting the ethylene response in the ethylene signaling system in a plant comprising: providing a cell comprising an isolated nucleic acid encoding a plant ERFl sequence, having a reporter sequence operably linked thereto; adding to the cell a compound being tested; and measuring the level of reporter gene activity in the cell, wherein a higher or lower level of reporter gene activity in the cell compared with the level of reporter gene activity in a second cell to which the compound being tested was not added is an indicator that the compound being tested is capable of affecting the expression of a plant ERF7 gene.

27. A method for generating a modified plant with enhanced ethylene response activity as compared to that of comparable wild type plant comprising introducing into the cells of the modified plant an isolated nucleic acid encoding ΕRF1, wherein said ERF7 nucleic acid binds to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.

28. A method for generating a modified plant with enhanced ethylene response activity as compared to that of comparable wild type plant, comprising introducing into ΕIN3- or EIL-defective or deficient cells of the modified plant an isolated nucleic acid encoding EIN3 or EIL, wherein said EIN3 or E7Z nucleic acid activates the ERFl gene, thereby permitting activation of target secondary ethylene response genes of the modified plant.

29. N method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ERFl molecules within the cells of a modified plant by introducing into said cells an isolated nucleic acid encoding a complementary nucleic acid to all or a portion of erf 1, wherein said erf I nucleic acid would otherwise bind to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.

30. A method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ERFl molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ERFl, wherein said ERFl polypeptide would otherwise bind to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.

31. A method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ELΝ3 or EIL molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ELN3 or EIL, wherein said EIN3 or EIL polypeptide would otherwise activate the expression of ERFl, thereby permitting activation of target secondary ethylene response genes of the modified plant.

2. A method for manipulating the expression of ERFl in a plant cell comprising: operably fusing the nucleic acid ERF7 or an operable portion thereof to a plant promoter sequence in the plant cell to form a chimeric DNA, and generating a transgenic plant, the cells of which comprise said chimeric

DNA, where upon controlled activation of the plant promoter, manipulates expression of ΕRF 1.