MXPA01005355A - Ethylene-response-factor1 (erf1) in plants - Google Patents

Abstract

The invention provides an isolated nucleic acid encoding Ethylene Response Factor 1 (ERF1), an early responsive gene, encoding a GCC-box binding protein in the ethylene gas signaling pathway in plants. Also provided and characterized is the peptide ERF1, as well as methods of using ERF1 or its expression product to modulate the response in plants or plant cells to ethylene. Moreover, because ERF1 acts downstream of EIN3 and all previously identified members of the signaling pathway, and because constitutive expression of ERF1 results in the modulation of a variety of ethylene response genes and phenotypes, the invention provides novel and useful methods for regulating the ethylene signaling pathway.

Description

FACTOR 1 RESPONSE TO ETHYLENE IN PLANTS REFERENCE TO RELATED REQUESTS This application claims priority to the provisional application E.U.A. 60 / 109,973, filed on November 25, 1998.

FIELD OF THE INVENTION The invention relates to a factor 1 response to ethylene (EFR1) and its role in the signaling route of ethylene gas in plants. The existence of a hierarchy of enzymes in the biosynthetic and signaling pathways provides a way to finally regulate the complex plant response to ethylene, as a regulator of growth or maturation and / or signal stress or damage.

GOVERNMENT INTERESTS This invention was supported in part by the support of the National Science Foundation No. MCB-95-07166 the government has certain rights in this invention.

BACKGROUND OF THE INVENTION The plant ethylene hormone (C2H) regulates a variety of responses to stress and adaptations of development in plants. This molecule gaseous in well known for its participation in physiological processes as diverse as fruit ripening in senescence, absolution, gemination, 7 cell elongation, sexual determination, defense response to pathogens, wounds, nodulation and determination of cell fate (Abeles et al. (1992) in ? Ethylene in Plant Biology, Academic Press, Inc., New York; Tanimoto et al., Plant J. 8: 943-948 (1995); Penninckx et al., Plant Cell 8: 2309-2323 (1996); O'Donnell et al., Science 274: 1914-1917 (1996); Penmetsa et al., Science 275: 527-530 (1997)). To understand the molecular events that lead to this diversity of plant responses, it is essential to elucidate how these functions modulate the ethylene. 7 15 It is known that a number of biological stresses induce the production of ethylene in plants, including wounds, abscission, infection bacterial, viral or fungal and treatment with effectors, such as preparations with the glycopeptide effector from fungal pathogenic cells. In the case of abscission, a particular layer of cells in a zone 20 located between the base of the leaf peduncle and the stem (abscission zone) responds to a complex combination of ethylene and other endogenous plant growth regulators by a process that, to date, is not completely understood. However, the effect of abscission is the controlled loss of parts of the typically localized plant; the result of which is visible when a leaf or a flower dies, or as a softening or "ripening" of the fruit finally leaving the plant a wound at the point of separation. The ethylene synthetic route has been well characterized (Kende, Plant Physiol., 91: 1-4 (1989)). The conversion of ACC to ethylene is catalyzed by the ethylene-forming enzyme (Spanu et al., EMBO J 10: 2007 (1991)). In a circular closed synthetic route of ethylene, S-adenosyl-1 methionine (SAM) is produced from methionine. Then, in a step limited by speed, SAM is converted to 1-aminocyclopropane-1-carboxylic acid (ACC) by an ACC synthase. In a final step, ethylene is produced from ACC by an ACC oxidase. The synthetic route, therefore, uses multiple ACC synthases and ACC oxidases, creating a cascade of enzymes hierarchy in the biosynthetic pathway and providing a means to regulate the complex plant response. Researchers are just beginning to understand the transduction path of the ethylene signal at the molecular level. To direct the ethylene signaling mechanisms, a molecular / genetic method was applied using the triple response phenotype developed by ethylene in shoots of Arabidopsis thaliana. The morphological changes produced by the continuous exposure of shoots from Arabidopsis to ethylene is known as "the triple response". The recognition of the triple response to the hormone has allowed the identification of a number of components of the ethylene response pathway. Based on the triple response, a dozen Arabidopsis mutants have been isolated in two classes: (Ecker, Science 268: 667-675 (1995); Johnson & Ecker, Annu. Rev. Genetics 32: 227-254 (1998): patent of E.U.A. Nos. 5,367,065; 5,444,166; 5,602,322; 5,650,553; and 5,955,652, each of which is incorporated herein by reference). One class of mutants, the ein mutants (insensitive to ethylene), show reduced or complete insensitivity to the exogenous ethylene. The insensitive group includes the etrl, etr2, ein2, ein3, ein4, ein5 / ain1, and ein7 mutants (Ecker, 1995; McGrath and Ecker, Plant Physiol. Biochem. 36: 103-113 (1998); Sakai et al. , Proc. Nati, Acad. Sci. USA 95: 5812-5817 (1998) Based on analyzes of epistasis, a genetic framework for the action of these genes has been established (Román et al., Genetics 139, 1393-1409 (1995) Sakai et al., 1998.) The ETR1, ETR2 and EIN4 genes act towards the 5 'end of CTR1, while the EIN2, EIN3, EIN5 / AIN1, EIN6 and EIN7 genes act towards the 3' end of CTRL The other class of mutants (constitutive hormone response mutants) exhibit constitutive phenotypes of ethylene response in the absence of exogenously applied hormones.Using antagonists of ethylene activity biosynthesis, this class was further divided into two mutants that exhibit a "constitutive" triple response phenotype as a result of either the overproduction of ethylene no (etol, eto2 and eto3) (Guzman and Ecker, 1990; Kieber et al., Cell 72: 427-441 (1993)), or of the constitutive activation of the pathway (ctrl, constitutive triple response) (Kieber et al., 1993). Late mutants exhibit "ethylene" phenotypes even in the presence of inhibitors of ethylene biosynthesis or receptor binding. Based on the loss-of-function mutation that confers a constitutive response phenotype to ethylene, CTR1 has been identified as a negative regulator of the ethylene response pathway. The CTR1 gene encodes a protein with similarity to the Raf family of protein kinases, which involves a MAP-kinase cascade in the aethylene response pathway (Kieber et al., 1993). Coupling a "bacterial" type receptor and a "Raf-like" protein kinase in the osmo-sensation pathway in yeast is provided by phospho-delayed proteins (Posas et al., Cell 86: 865-875 (1996)). proteins with both structural and functional similarities to response regulators have been identified in Arabidopsis (Imamura et al., Proc. Nati, Acad. Sci. USA 95: 2691-2696 (1998)), the ethylene receptors ETR1 and ERS1 (Chang , Trends Biochem, Sci. 21: 129-133 (1996), Schaller et al., Science 270: 1809-1811 (1995)), can physically interact with CTR1 (Clark et al., Proc. Nati. Acad. Sci. USA 95: 5401-5406 (1998)), thus avoiding an absolute requirement for said intermediaries.It is less understood about the components towards the 3 'end of the ethylene signaling pathway.The cloning and characterization of the EIN3 gene reveals that it encodes a protein located in the nucleus (Chao et al., Cell 89: 1133-1144 (1997); Solano et al., Ge Dev. 12: 3703-3714 (1998)). Although the sequence analysis is unable to discover homology in the previously described proteins, EIN3 shares similarity of amino acid sequence, conserved structural characteristics and genetic function with three proteins similar to EIN3 (EIL). Genetic studies reveal that EIL1 and EIL2 were able to functionally complement the ein3 mutation, suggesting their participation in the ethylene signaling pathway. The high expression levels of EIN3 or EIL1 in wild type or ein2 transgenic mutant plants confer constitutive ethylene response phenotypes at all stages of development, indicating their sufficiency for route activation in the absence of ethylene. The most extensive studies of the various classes of ethylene response genes are secondary response genes whose expression is activated by ethylene in response to attack by pathogens. These include basic chitinases, β1, 3-glucanases, defensins and other proteins related to pathogenesis (PR) (Boller et al., Planta 157: 22-31 (1983); Felix et al., Plant 167: 206-211 (1986); Broglie et al., Plant Cell 1: 599-607 (1989); Ohme-Takagi et al., Plant Mol. Biol. 15: 941-946 (1990)), Samac et al., Plant Physiol. 93: 907-914 (1990); Eyal et al., Plant J. 4: 225-234 (1993); Penninckx et al., 1996). Analyzes of the promoters of several of these genes reveal a common element of response to cis-acting ethylene called the GCC box. It was shown that this element is necessary and sufficient for the regulation of ethylene in a variety of plant species (Eyal et al., 1993, Meller et al., Plant Mol. Biol. 23: 453-463 (1993), Hart et al. ., Plant Mol., Biol. 21, 121-131 (1993), Shinshi et al., Plant Mol. Biol. 27: 923-932 (1995), Sessa et al., Plant Mol. Biol. 27: 923-932. (1995), Ohme-Takagi et al., Plant Cell 7: 173-182 (1995), Sato et al., Plant &Cell Physiology 37: 249-255 (1996)). Efforts to isolate the trans acting factors in tobacco that bind to the GCC box identified a family of proteins called ethylene response element binding proteins (EREBP) (Ohme-Takagi et al., 1995). These novel DNA binding proteins interact in vitro with the GCC box through a domain homologous to that previously observed in the floral homeotic protein APETALA2 (Ecker, 1995, Weigel, Plant Cell 7: 388-389 (1995)). In Arabidopsis, more than thirty genes belonging to this family have been identified in several groups (Wilson et al., Plant Cell 8: 659: 671 (1996); Butther et al., Proc. Nati. Acad. Sci. USA 94 : 5961-5966 (1997), Okamuro ef al., Proc. Nati, Acad. Sci. USA 94: 7076-7081 (1997)) and as a result of the Arabidopsis genome initiative (Bevan et al., Plant Cell 9 : 476-478 (1997), Ecker, Nature 391: 438-439 (1998)). The expression of several members of the EREBP family has been reported to be regulated by ethephon, a compound released by ethylene (Buttner et al., 1997, Ohme-Takagi ef al., 1995), suggesting that these may have an intermediary role in the cascade of activators and receptors in the ethylene signaling pathway. However, evidence for the direct implication of an EREBP in the ethylene signaling pathway in Arabidopsis '- -' "- remained absent until the discovery of the inventors of the present invention, thus, this discovery significantly advances the science and understanding of ethylene biosynthesis and signaling, and offers means to control, modulate or regulate the response to ethylene during plant maturation and development, flowering, fruit ripening, stress response, wounds, pathogens and the like By this improved understanding of the ethylene signaling pathway, the present invention promotes the development of methods for improving the tolerance of plants to stress, wounds or pathogens, as well as to develop easier and more efficient methods to identify plants that tolerate stress or wounds or to pathogens, in addition, by providing an understanding of plant hormones and the mechanisms to control them, and By modulating and regulating its functions, it is possible to significantly improve the quality, quantity and longevity of plant food products, such as fruits and vegetables, ornamental flowers and flowers, and other non-food plant products, such as commercially valuable crops, for example, cotton or flax, or ornamental green plants, thus providing more and better products for the market in both developed and developing countries.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to the cloning and characterization of the ethylene response factor 1 (ERF1), an early response gene, which encodes a GCC box binding protein. The expression of EIN3 is both necessary and sufficient for the transcription of ERF1. In addition, since EIN3 is overexpressed in transgenic plants, the constitutive expression of ERF1 results in the modulation of a variety of genes responsive to ethylene and phenotypes. In addition, EIN3 and EIL have been shown to be novel, sequence-specific DNA binding proteins that bind to a primary response element in the ERF1 promoter. Consistent with the findings in the biochemical studies, genetic analyzes revealed that ERF1 acts towards the 3 'end of EIN3 and all previously identified members of the ethylene gas signaling pathway. The present invention provides an isolated nucleic acid encoding a plant factor responsive to ethylene, which is activated by EIN3 or by an EIN3-like peptide (EIL) in the plant signaling pathway of ethylene, where the activated factor binds to a white GCC box in a secondary ethylene response gene. Also provided is an isolated nucleic acid comprising ERF1, as well as mutants, derivatives, homologs or fragments of ERF1, which encode an expression product having ERF1 activity. It also provides the nucleic acid comprising SEQ ID NO: 1. In addition, the invention provides a purified polypeptide encoded by the nucleic acids identified above. It also provides a purified polypeptide comprising ERF1, as well as homologs, analogs, derivatives or fragments thereof, which have GCC box binding activity in a secondary response to the target. It also provides the polypeptide comprising SEQ ID NO: 2, as well as the polypeptide, wherein the GCC box binding activity of ERF1 is dependent on EIN3 or EIL. The invention also provides a recombinant cell comprising the isolated nucleic acids identified above. It also provides a vector comprising the isolated nucleic acids identified above. The invention further provides a specific antibody to a plant ERF1 polypeptide, and homologs, analogs, derivatives or fragments thereof, which have GCC box binding activity in a target gene secondary to the response. It also provides an isolated nucleic acid sequence comprising a complete complementary sequence or a part of the ERF1 nucleic acid sequence, and mutants, derivatives, homologs, or fragments thereof that encode an expression product that binds to the GCC box in a secondary response gene to the blank. Thus, the invention also provides the nucleic acid having antisense activity at a level sufficient to regulate, control or modulate the secondary ethylene response activity of a plant, plant cell, organ, flower or tissue comprising them. The present invention provides a plant, plant cell, organ, flower, tissue, seed or progeny comprising any of the nucleic acids identified above, including ERF1, wherein the plant cells, organs, flowers, tissues, seeds or progeny include those of a transgenic plant. In addition, it is intended that the invention include transgenic plants, plant cells, organs, flowers, tissues, seeds or progeny comprising the aforementioned recombinant nucleic acids or polypeptides. In addition, the invention provides an isolated nucleic acid, further comprising a plant ERF1 promoter sequence, or a fragment thereof having an ERF1 promoter activity.; as well as a transgenic plant, the cells, organs, flowers, tissues, seeds or progeny which contains a transgene comprising the promoter sequence ERF1. The invention further provides an isolated ERF1 nucleic acid, which also comprises a reporter gene operatively fused thereto, or a fragment thereof having reporter activity. The invention also provides a method for manipulating the ERF1 nucleic acid in a plant to allow the regulation, control or modulation of the ethylene response in said plant. It also provides this method, where regulation, control or modulation results in the initiation or improvement of germination, cell elongation, sexual determination, flower or leaf senescence, floral maturation, ripening of fruit, resistance to insect, herbicide or pathogen, abscission, or response to stress, wounds or pathogens in the plant. In certain embodiments of the invention, the described method of regulation, control or modulation provides for the inhibition or prevention of germination, cell elongation, sexual determination, floral or leaf senescence, floral ripening, fruit ripening, insect resistance, herbicide or pathogen, abscission, or response to stress, wounds or pathogens in the plant. In other embodiments of the invention, the method of regulation, control or modulation described provides the activation or improvement of germination, cell elongation, sexual determination, floral or leaf senescence, floral maturation, fruit ripening, insect resistance, herbicide or pathogen, abscission, or response to stress, wound or pathogens in the plant, the invention also provides a method to identify a compound capable of affecting the ethylene response in the ethylene signaling system in a plant comprising: providing a cell comprising an isolated nucleic acid encoding a plant ERF1 sequence, having a reporter sequence operably linked thereto; add to the cell a compound to be tested; and measuring the level of activity of the reporter gene in the cell, where a higher or lower level of reporter gene activity in the cell compared to the level of reporter gene activity in a second cell in which the compound a being treated has not been added is an indicator that the compound to be tested is capable of affecting the expression of a plant ERF1 gene. In addition, the invention provides a method for generating a modified plant with improved response activity to ethylene compared to wild-type plants comprising the introduction into the cells of the modified plant of an isolated nucleic acid encoding ERF1, wherein said ERF1 nucleic acid binds to the GCC box, therefore activating the secondary ethylene response target genes of the modified plant, in certain embodiments of the invention a method for generating a modified plant with improved ethylene response activity is provided. in comparison with the wild-type plant which comprises introducing within the defective or deficient cells in EIN3 or EIL of the modified plant an isolated nucleic acid encoding EIN3 or EIL, wherein said EIN3 or EIL nucleic acid activates the ERF1 gene, by thus allowing the activation of the target genes of secondary response to ethylene of the modified plant. The invention further provides a method for generating a plant with decreased or inhibited ethylene response activity compared to that of the comparable wild-type plant comprising binding or inhibiting the ERF1 molecules with the cells of the modified plant upon introduction into said plants. cells an isolated nucleic acid encoding a nucleic acid complementary to all or a portion of erfl, wherein said erfl nucleic acid may otherwise bind to the GCC box, thereby activating the plant secondary ethylene response genes of the plant modified. In certain embodiments of the invention there is provided a method for generating a plant with decreased or inhibited ethylene response activity compared to a comparable wild-type plant comprising the binding or inhibition of ERF1 molecules within the cell of a modified plant by introducing into these cells an antibody of all or a portion of ERF1, wherein said ERF1 polypeptide can otherwise be bound to the GCC box, thereby activating the secondary ethylene response target genes of the modified plant. In certain additional embodiments of the invention a method is provided for generating a plant with decreased or inhibited ethylene response activity compared to that of the comparable wild-type plant comprising the binding or inhibition of the EIN3 or EIL molecules within the cells of a modified plant by introducing into the said cells an antibody to all or a portion of EIN3 or EIL, wherein said EIN3 or EIL polypeptide can otherwise activate the expression of ERF1, thereby enabling the activation of the target genes secondary to ethylene of the modified plant. The invention also provides a method for manipulating the expression of ERF1 in a plant cell comprising: operatively fusing the ERF1 nucleic acid or an operable portion thereof to a promoter sequence of the plant in the plant cell to form a DNA chimera , and generating a transgenic plant, the cells of which comprise said DNA chimera, wherein by controlling the activation of the plant promoter, one can manipulate the expression of ERF1. The invention will be fully understood from the following descriptions of preferred embodiments, drawings and examples, all of which are intended to be for illustrative purposes only, and are not intended in any way to limit the invention.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the nuclear events in the ethylene signaling pathway. A model of the transcriptional regulation cascade that mediates the ethylene responses is shown. Figure 2 shows the results of cloning and inducibility of ERF1 by ethylene. Figure 2A represents the Northern blot analysis of ERF1 mRNA expression induced in the presence of ethylene gas and compared to the pressure induced by PDF1.2. Figure 2B exhibits Northern blot analysis of the expression of ERF1 mRNA in plants overexpressing EIN3. Figure 2C exhibits Northern blot analysis of ERF1 expression by induction of cycloheximide. The numbers above the lines indicate the μM concentrations of cycloheximide (cx). Figure 3 sets forth the data showing that EIN3 is a sequence-specific DNA-binding protein. Figure 3A shows the electrophoretic mobility shift assay (EMSA) of the EIN3 protein, translated in vitro, joining the -1238 to -950 fragment of the promoter ERF1. A control protein (control) or untranslated reticulocyte (RL) lysate was used in the indicated lines. Figure 3B shows the EIN3-3 mutant protein of EMSA, EIN3 and several deletion derivatives bind to fragments of -1238 to -1204 (1) and -1213 to -1178 (2) of the ERF1 promoter. Figure 3C shows the competition of the interaction of EIN3 with its target site, the EIN3 binding site (EBS) by the addition of anti-EIN3 antibodies (Ab-EIN3). Pl is established for pre-immune serum. Figure 4 establishes the data to characterize EBS. Figure 4A shows the mutagenesis of EBS examination. The wild type of EBS is shown with the repeated palindromic indicated by arrows. Base changes in the mutants tested are indicated. The points indicate bases similar to the wild type of EBS (EBS Wt). Figure 4B shows the sequence alignment of EBS and a fragment of the promoters of the E4 and GST1 genes (including the ERE). Figure 5 establishes the data to characterize EBS. Figure 5A shows the competence of EIN3-EBS complex formation by the addition of an excess of unlabeled EBS or two versions of mutants, EBSml and EBSm2. No competitor was added in the lines marked as 0. The triangles in black represent quantities without increase of the competitor (20, 60 and 200 nanograms). Figure 5B shows a summary of the structural characteristics of EIN3 and the mutants used in the EMSA experiments.

Figure 6 shows a homo-dimerization of EIN3. Figure 6A exhibits EMSA of total size EIN3 and deletion derivatives attached to EBS. Figure 6B shows the EIN3-EIN3 interactions evaluated by the yeast "double hybrid" system. The yeast cells transformed with the constructions indicated as shown in the upper left illustration, were grown on synthetic complete medium (SC) containing histidine (+ HIS) or in SC medium without histidine (-HIS) and with -aminotriazole 50 mM (3-AT, Sigma) to suppress the basal activity of the his3 reporter gene. The β-gal activity of the colonies grown in -HIS (lacZ) was determined by the filter survey assay. SNF4 / SNF1 were used as a positive control. Colonies from two independent transformation experiments are shown (BD-EIN3a and BD-EIN3b). Figure 6C exhibits the binding of EIL proteins to the target site of EIN3 in the ERF1 promoter. EMSA was carried out using translated EIN3, EIL1, EIL2 and EIL3 in vitro and wild-type EBS (W) or mutant version (M), where the mutant exhibited a mutation at position 17 from G to C, as is shown in Figure 4. Figure 7 shows the data to support ERF1 as a DNA binding protein to the GCC box. Electrophoretic mobility shift assays were carried out using in vitro translated ERF1 protein and promoter fragments from Arabidopsis basic chitinase (b-CHI) and bean chitinase 5B (CH5B). The DNA fragments containing the GCC box or the mutated versions (b-CHIm and CH5Bm) of these same elements were incubated with the control, lysate of untranslated rabbit reticulocytes or those that contained the EIN3 protein. Figure 8 describes the constitutive activation of ethylene response phenotypes in shoots expressing 35S :: ERF1. Transgenic shoots overexpressing as background ERF1 in the wild type (Col-0) and in the mutant ein3 were grown in continuous flow chambers with hydrocarbon free air in agar with or without 10μM ACC. The non-transformed wild-type plants and the e /? 3 mutant plants are also shown for comparison. Figure 9 shows that ERF1 acts towards the 3 'end of EIN2 and EIN3 in the ethylene signaling pathway. Transgenic plants that overexpress ERF1 in the wild type (Col-0), e / V? 2, e / >;? 3-1 and in the background mutants ein3-3 were grown in continuous flow chambers with hydrocarbon free air for 5 weeks. Untransformed wild types, ctr-1 and plants that overexpress EIN3 are shown as a comparison. Figure 10 shows the transcriptional activation of genes responsive to ethylene by ERF1. Figure 10A shows the Northern blot analysis (Total RNA) of the expression of genes induced by ethylene in transgenic lines overexpressing as background ERF1 in Wt (Col-0) and in ethically insensitive mutants. Five independent transgenic lines are shown in Col-0 and 2 independent lines in each of the mutants. The same blot was tested with genes induced by ethylene PDF1.2 and basic chitinase, ERF1 and a charged control probe (rDNA). Figure 10B shows the constitutive activation of the CH5B-GUS reporter gene induced by ethylene in transgenic plants overexpressing ERF1.

DETAILED DESCRIPTION OF THE INVENTION Enzyme cascades are a common theme in gene regulation, present in virtually all organisms from bacteria to humans, and are involved in the regulation of processes as diverse as nitrogen fixation, embryogenesis, cell differentiation, response to pathogens, signs of wounds or extracellular signals, or circadian rhythmicity. The existence of a cascade hierarchy of transcription factors and enzymes in the ethylene signaling pathway, therefore, provides a means to regulate the complex plant response to this gaseous signal of plant growth / stress regulation. The present invention provides for the cloning and characterization of the ethylene response factor 1 (ERF1), an early ethylene response gene, which encodes a GCC box binding protein. The expression EIN3 is both necessary and sufficient for the transcription of ERF1. As the overexpression of EIN3 in transgenic plants, the constitutive expression of ERF1 results in an activation of a variety of ethylene response genes and phenotypes. In addition, EIN3 and EIL have been shown to be novel sequence-specific DNA-binding proteins that bind to the primary element of ethylene response in the ERF1 promoter. u JuAh ißWu Consistent with biochemical studies, genetic analysis reveals that ERF1 acts towards the 3 'end of EIN3 and all previously identified components in the ethylene gas signaling pathway. The sequential action of the DNA binding proteins EIN3 (or EIL) and ERF1 adds a new level of complexity in the regulation of the hierarchy of the ethylene signaling pathway. As seen in the diagram in Figure 1, the binding of ethylene (C2H4) to the active membrane receptors EIN3, and apparently EIL1 and EIL2, through a signaling cascade described elsewhere (Chao et al., 1997 ). EIN3 directs the expression of ERF1 and other fundamental white genes by directing the binding, as a dimer, to the primary ethylene response element (PERE) present in its promoters. Thus, the sequences in the ERF1 promoter serve as an intermediary target of binding to EIN3. Although EIN3 is sufficient and necessary for the expression of ERF1, other factors, e.g., EIL activity, may be required for induction of ERF1 completely dependent on ethylene. Consistent with this observation, HOOKLESS1, which contains a GCC element in its promoter, is not induced in the ERF1 transgenic plants, indicating that ERF1 is responsible for the activation of a subset of white genes that contain the GCC response to ethylene. The sub-population of secondary response genes containing the GCC box of the ethylene signaling pathway, which is activated or modulated by ERF1 of the present invention are referred to herein simply as the "target genes" or "target genes secondary to ethylene "or genes that have" the ability to bind to the GCC box described ". As a subgame is easily identified by one skilled in the art without carrying out experimentation. Following the induction of ethylene or constitutive expression, ERF1 activates the transcription towards the 3 'end of the target genes secondary to ethylene response. ERF1 binds to the GCC (secondary response to ethylene, SERE) box, thus activating the expression of certain secondary ethylene response genes, such as basic quiti? asas and defensinas (PDF1.2). Secondary ethylene response genes are also referred to herein as ethylene-inducible target genes or effector genes in the ethylene signaling pathway. The EREBP family of DNA binding proteins have been identified based on their ability to bind the GCC box, and an element that has been identified as necessary for the inducibility of ethylene in response to a pathogen attack as described by Deikman, P? Ysiol. Plantarum 100: 561-566 (1997). In fact, the interactions between the transcription factors EREBP and bZIP, as well as the synergistic effects of their target sites on the DNA, the GCC box and the G box, have been previously described (Hart et al., 1993; Sessa et al., 1995; Buttner ef al., 1997). However ERF1, although it is a member of the ethylene response cascade, is neither anticipated nor suggested by the known members of the EREBP family. For example, a member of the AP2 / EREBP family of Arabidopsis, AtEBP, is reported to be regulated by ethylene (Buttner et al., 1997), and like ERF1, AtEBP is constitutively involved in ctrl mutants. However, AtEBP does not appear to be a direct target of EIN3 since its expression in response to ethylene is cycloheximide dependent, suggesting a regulatory cascade that exists between members of the EREBP family in which AtEBP acts towards the 3 'end of ERF1. Consistent with this idea, we find that several of the EREBP genes contain in their promoters elements of the GCC box, indicating that their expression is self-regulated or controlled by other EREBP. Thus, the existence for a cascade of transcriptional regulation is not restricted to EREBP involved in ethylene signaling since this has also been inferred in the case of the RAP genes (members of the AP2 / EREBP family), which is not involved Obviously in the response to ethylene (Okamuro et al., 1997). It should be appreciated that the present invention is not limited to the proposed models and mechanisms described herein. It should also be recognized that the models, such as Figure 1, present a purely schematic working model that shows the role of the interactive components of the ethylene signal transduction pathway, and their relationships to ERF1, as well as to each other. Thus, the model is intended to simplify and facilitate the understanding of the invention. Ethylene is an olefin, therefore it is assumed that its receptors require coordination of a metal transition for hormone binding activity. In wild-type plants, ethylene that binds to its receptor inactivates the activity of the ethylene receptors (presumably causing a reduction in histidine kinase activity), and consequently causing the induction of activation through the ethylene response. (derepression) of the signaling route. To identify mutations in novel components of the ethylene gas signal transduction pathway, a selection was initiated for Arabidopsis thaliana mutants that exhibited a triple response phenotype similar to ethylene in response to a potent hormone antagonist. The "triple response" in Arabidppsis consists of three distinct morphological changes in offsprings grown in the dark with exposure to ethylene: 1) inhibition of hypocotyledons and root elongation, 2) radial swelling of the stem and 3) exaggeration of the apical hook. One class of constitutive mutants, ctr, exhibits a constitutive triple response in the presence of ethylene biosynthetic inhibitors, and is affected at or towards the 3 'end of the receptor. Selection includes selection for stem root or elongation and selection for increased ethylene production. By "plant" as used herein, it refers to any plant and any plant of said plant, be it wild, treated, genetically manipulated or recombinant, including transgenic plants. The term broadly refers to any or all parts of the plant, including plant cells, tissue, flower, leaf, stem, root, organ, and the like, and also includes seeds, progeny, and the like, wherein said part is specifically denoted. or not. "Modified plants" are plants in which the wild-type gene or the protein character has been altered. Phenotypic alterations can ameliorate or inhibit a typical wild-type response in or by other plant cells; or there may not be any phenotypic change. As one skilled in the art will recognize, the absolute levels of production of the endogenous ethylene by a plant or plant cell will change with growth conditions. However, in plants "sensitive to ethylene", including wild-type plants or other plants in which the signaling cascade is complete, the secondary ethylene response is activated by ERF1. Said plants or plant cells typically demonstrate a stoppage or decrease in the production of endogenous gas in the presence of high concentrations of the exogenous ethylene. In comparison, an "ethylene insensitive" plant or cell typically continues to produce endogenous ethylene, despite the administration of exogenous ethylene inhibiting amounts. A plant insensitive to ethylene will produce more ethylene or produce it at a higher rate than a wild-type plant after administration of an inhibitory amount of the exogenous ethylene. For purposes of the present invention, the insensitivity of ethylene already includes a total or partial inability to exhibit the triple response in the presence of increased levels of the exogenous ethylene, as can be expected if the ethylene signaling path is interrupted at the plant or plant cell. In these plants insensible to ethylene, the function of the receptor is altered resulting from the blocking or inhibition of the expression of the EIN3 (or EIL) or ERF1 genes that will exhibit a constitutive production of endogenous ethylene, despite the presence of an abundance of exogenous ethylene. The gene corresponding to ERF1 has been cloned as set forth below and the sequence of the cDNA clone is provided as SEQ ID No: 1. However, in view of the descriptions provided, it is understood that other alleles and variations may be available to one skilled in the art. Therefore, additional mutants are also enabled by the present invention to have insertions, deletions, alterations or substitutions within the same motif of the conserved protein, while expressing or regulating the binding activity to the GCC box. The invention should be considered to include the nucleic acids comprising eril, or any mutant, derivative, homologue or fragment thereof, while the latter still encodes an early ethylene response gene which encodes a binding element for the GCC box, and which is capable of activating or modulating the expression of genes secondary to ethylene response in the ethylene signaling pathway. In accordance with the present invention, the nucleic acid sequences include but are not limited to DNA, including and not limited to cDNA and genomic DNA; RNA, including but not limited to mRNA and tRNA, and may include chiral or mixed molecules. Preferred nucleic acid sequences include, for example, the sequences set forth in SEQ ID No: 1, as well as modifications of the nucleic acid sequence, including alterations, insertions, deletions, mutations, homologs and fragments thereof encoding the reaction active of ERF1 or a regulatory protein of the ERF1 type in the ethylene response pathway capable of activating the binding to the GCC-ERF1 box resulting in the modulation of the expression of a secondary response gene to ethylene. The expression of the secondary ethylene response genes is modulated by ERF1. "Modulation" of the expression by ERF1 preferably means activation of the expression, although in the present invention that also means to include the improved expression of the target genes. Depending on the conditions, however, it is also intended to include inhibition or prevention of the expression of the target genes. A "fragment" of a nucleic acid is included within the present invention if it encodes substantially the same expression product as the isolated nucleic acid, or if it encodes a peptide having the ability to bind to the GCC box described. The invention should also consider including peptides, polypeptides or proteins comprising ERF1, or any mutant, derivative, variant, analog, homologue or fragment thereof, which has the ability to bind to the GCC box described in the ethylene signaling pathway. . The terms "protein", "peptides", "polypeptides", and "protein sequences" are used interchangeably within the scope of the first invention, including but not limited to the sequences set forth in SEQUENCE ID NO: 2, the sequence of putative amino acids corresponding to the SEQUENCE ID NO: 1 nucleic acid, as well as those sequences representing mutations, derivatives, analogs or homologs or fragments thereof that have the ability to bind to the GCC box described in the ethylene response pathway . The invention also provides analogs and homologs of proteins, peptides or polypeptides encoded by the gene of interest, preferably ERF1. The "analogues" may differ from naturally occurring proteins or peptides by differences or modifications of the conservative amino acid sequence that do not affect the sequence, or by both. The "homologs" are chromosomal DNA that carries the same genetic block; when carried on a diploid cell there is a copy of the homolog for each parent. For example, conservative amino acid changes can be made, which, although they alter the primary sequence of the peptides, do not normally alter their function. Conservative amino acid substitutions of this type are known in the art, for example, changes within the following groups: glycine and alanine, valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; or phenylalanine and tyrosine. Modifications (which do not normally affect the primary sequence) include chemical derivatizations of the peptides in vivo or in vitro, for example, acetylation or carbonation. Also included are glycosylation modifications, for example, modifications made to the glycosylation pattern of a polypeptide during its synthesis and processing, or additional processing steps. Also included are sequences in which the amino acid residues are phosphorylated, for example, phosphotyrosine, phosphoserine or phosphothreonine. Also included in the invention are polypeptides that have been modified using ordinary molecular biology techniques to improve their resistance to proteolytic degradation or to optimize solubility or to make them more effective as a regulatory agent. Analogs of such peptides include those residues that contain other L amino acids that occur naturally, for example, D-amino acids or synthetic molecules that do not occur naturally. However, the polypeptides of the present invention are not intended to be limited to the products of any specific exemplary process described herein. "Derivative" is intended to include both functional and chemical derivatives, including fragments, segments, variants or analogs of a molecule. A molecule is a "chemical derivative" of another, if it contains additional chemical portions that are not normally part of the molecule. Said portions can improve the molecule's solubility, absorption, biological half-life, and the like, or the toxicity of the molecule can decrease, eliminating or attenuating any undesirable side effects of the molecule, and the like. The portions capable of mediating said effects are described in Remington's Pharmaceutical Sciences (1980). Methods for coupling said portions to a molecule are well known in the art. Included within the meaning of the term "derivatives" as used in the present invention are the "alterations", "insertions" and "deletions" of nucleotides or peptides, polypeptides or the like. A "fragment" of a polypeptide is included within the present invention if it retains santially the same activity as the purified peptide or if it has the ability to bind to the CGG box described. Said fragment of a peptide is also intended to be defined as a fragment of an antibody. A "variant" and "allelic variant or species variant" of a protein refers to a molecule santially similar in structure and biological activity to the protein. Thus, if two molecules have a common activity and can situte each other, they are intended to be "variants", even when the composition or secondary, tertiary or quaternary structure of one of the molecules is not identical to that found in the other, or if the amino acid or nucleotide sequence is not identical. According to the invention, the ERF1 polypeptide and the ERF1 nucleic acid sequences employed in the invention can be exogenous sequences. Exogenous or heterologous, as used herein, denotes a nucleic acid sequence that is not obtained from and would not normally be part of a genetic arrangement of the plant, cell organ, flower or tissue to be transformed, in its non-transformed state . Plants comprising exogenous nucleic acid sequences of ERF1, or eril mutations are encoded by, but not limited to, the nucleic acid sequences of SEQ ID No: 1, including alterations, insertions, deletions, mutations, homologs and fragments of the same. Transformed plant cells, tissues and the like, comprising ERF1 nucleic acid sequences or eril mutations, such as, but limited to, the nucleic acid sequence of SEQ ID NO: 1 which is within the scope of this invention. Transformed cells of the invention can be prepared by employing standard transformation techniques and procedures as set forth in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). By the term "coding nucleic acid" the plant cell and the like wherein the expression of the secondary target cell is modified by the binding to the GCC box as used herein, means a gene encoding a polypeptide having the ability to bind the GCC box described which activates or modulates the expression of secondary response genes to ethylene regulated by ERF1. The term is intended to encompass DNA, RNA, and the like. As described in the following examples, ERF1 genes encode proteins having specific domains located within, for example, in terminal extensions, transmembrane extensions, TMI and TM2, nucleotide binding folds, a putative regulatory domain, and C- terminal. A mutant, derivative, homolog or fragment of the target gene is, therefore also one in which the domains selected in the related proteins share significant homologies (at least about 40% homology) with the same domains in the preferred embodiment of the present invention. It will be appreciated that the definition of such nucleic acids encompasses those genes that have at least about 40% homology. In any of the described domains contained by them under conditions of severity that will be appreciated by one except in the art. In addition, when the term "homology" is used herein to refer to the domains of these proteins, it must be considered to mean homology at both the nucleic acid and the amino acid levels. Significant homology between similar domains in said nucleic acids is considered to be at least about 40%, preferably, the homology between the nucleic acid domains is at least about 50%, more preferably, at least about 60%, even more preferably, of at least about 70%, even more preferably, of at least about 80%, even more preferably, of at least about 90% and more preferably, the homology between the nucleic acid domains similar is around 99%. Significant homology between similar amino acid domains in said protein or polypeptides is considered to be less than about 40%, preferably, the homology between the amino acid domains is less than about 50%, more preferably, less than about 60% , more preferably, less than about 70%, even more preferably, less than about 80%, even more preferably, less than about 90% and more preferably, the homology between similar amino acid domains is about 99 %. According to the present invention, preferably the isolated nucleic acids encode the biologically active ERF1 polypeptide or a fragment thereof of total length or of sufficient length to encode a regulated or active GCC box binding protein capable of activating or modulating the expression of genes secondary to ethylene response. In one embodiment the nucleic acid is at least about 200 nucleotides long. More preferably, it is at least 400 nucleotides in length, even more preferably, at least 600 nucleotides, even more preferably, at least 800 nucleotides, and even more preferably, at least 1000 nucleotides. In another embodiment, preferably, the purified preparation of the isolated polypeptide having the GCC box binding activity described in the ethylene signal system is at least about 60 amino acids in length. More preferably, it is at least 120 amino acids, even more preferably, of at least 300 amino acids, even more preferably, of at least 500 amino acids, and even more preferably, of at least 700 amino acids in length. In an additional embodiment, the polypeptide encodes the full-length ERF1 protein or a regulated version thereof. The invention further includes a vector comprising a gene encoding ERF1. DNA molecules composed of a protein gene or a portion thereof can be operatively linked within an expression vector and introduced into a host cell to enable the expression of these proteins by that cell. Alternatively, a protein can be cloned into viral hosts by introducing the Ahybrid @ gene operably linked to a promoter within the viral genome. The prptein can then be expressed by replicating said recombinant virus in a susceptible host. A DNA sequence encoding a protein molecule can be recombined with a DNA vector according to conventional techniques. When the protein molecule is expressed in a virus, the hybrid gene can be introduced into the viral genome by techniques well known in the art. A) Yes, the present invention encompasses the expression of the desired proteins either in prokaryotic or eukaryotic cells, or viruses that replicate in prokaryotic or eukaryotic cells. Preferably, the proteins of the present invention are cloned and expressed in a virus. Viral hosts for the expression of the proteins of the present invention include viral particles that replicate in prokaryotic hosts or viral particles that infect and replicate in eukaryotic hosts. The methods for generating a vector for administering the isolated nucleic acid or a fragment thereof are well known, and are described for example in Sambrook et al., Above mentioned patent. Suitable vectors include, but are not limited to, unrestrained Agrobacterium tumor-inducing Ti plasmids (e.g., pblNI9) that contain a target gene under the control of a vector, such as the 35S promoter of cauliflower mosaic virus (CaMV). ) (Lagrimini et al, Plant Cell 2: 7-18 (1990)) or its endogenous promoter (Bevan, Nucí.Aids /? Es12: 8711-8721 (1984), adenovirus, bovine papilloma virus, simian virus, If the vector or DNA sequence containing the construct has been prepared for expression, the DNA constructs can be introduced or transformed into an appropriate host.Several techniques can be employed, such as protoplast fusion, calcium phosphate precipitation, electroporation, or other conventional techniques As is well known, viral sequences contain the Ahybrid @ protein gene which can be transformed directly into a suitable host or initially packaged inside a viral particle and then introduced into a host susceptible to infection.

After the cells have been transformed with the recombinant DNA molecule (or in RNA) or the virus or its genetic sequence are introduced into a susceptible host. The cells are grown in medium and selected for appropriate activity. The expression of the sequence results in the production of the protein of the present invention. Methods for generating a plant cell, tissue, flower, organ or fragment thereof are well known in the art, and are described for example in Sambrook et al., Supra. Suitable cells include, but are not limited to, yeast cells, bacteria, mammal, insect cells infected with vaculovirus, and plant cells, with either in vivo or tissue culture applications. Plant cells transformed with the gene of interest are also included for the purposes of producing cells and regenerating plants that have the ability to bind to the GCC box described, thus modulating the expression of the target elements secondary to ethylene response. Suitable combinations of vector and plant will be readily apparent to those skilled in the art and can be found, for example, in Maliga et al., 1994, Methods in Plant Molecular Biology: A Laboratory Manual, Cold Spring Harbor, New York). Plant transformation can be achieved using the Agrobacterium mediated disc transformation methods described by Horsch et al., 1998, Leaf Disc Transformation: Plant Molecular Biology Manual A5: 1). Numerous transformation methods are known in the art to evaluate whether a transgenic plant comprises the desired DNA, and does not need to be reiterated. The expression of the desired protein in eukaryotic host requires the use of eukaryotic regulatory regions. Said regions will include, in general, a sufficient promoter region to direct the initiation of RNA synthesis. Preferred eukaryotic promoters include, but are not limited to, the SV40 early promoter (Benoist et al., Nature (London) 290: 304-310 (1981)); the promoter of the yeast qa! 4 gene (Johriston ef al., Proc.Natl.Acad.Sci. (USA) 79 / 6971-6975 (1982)) and the exemplified promoter PGK1 of pYES3. As is widely known, the translation of eukaryotic mRNA starts at the codon, which encodes the initial methionine. For this reason, it is preferable to ensure that the binding between a eukaryotic promoter and a DNA sequence encoding the desired protein does not contain any codons that are capable of encoding a methionine (ie, AUG). The sequence encoding the desired protein and an operably linked promoter can be introduced into a recipient prokaryotic or eukaryotic cell either as a non-replicating DNA molecule (or RNA, which can either be a linear molecule or, more preferably, as A covalently closed circular molecule Since such molecules are incapable of autonomous replication, the expression of the desired protein can occur through the transient expression of the introduced sequence Alternatively, permanent expression can occur through the integration of the sequence introduced into the host chromosome For the expression of the desired protein in a virus, the hybrid gene operably linked to a promoter is typically integrated into the viral genome, either RNA or DNA, cloning into viruses is well known, and therefore, an expert in the techniques will know numerous techniques to achieve said cloning Cells that have stably integrated the DNA introduced into their chromosomes can be selected by also introducing one or more reporter genes or markers that allow the selection of the host cells that contain the expression vector. The reporter gene or marker can complement an auxotrophy in the host (such as Leu2, or ura3, which are auxotrophic markers common in yeast), resistance to biocides for example antibiotics, or resistance to heavy metals, such as copper, or the like. The selectable marker gene may be either operably linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. The additional elements may also require optional thesis of mRNA. These elements may include processing signals, as well as transcriptional promoter enhancers, and termination signals. The cDNA expression vectors incorporating said elements include those described by Okayama, H., Mol. Cell. Biol. 3280 (1983), and others. In another embodiment, the introduced sequence will be incorporated into a plasmid or viral vector capable of carrying out autonomous replication in the host host cell. Any of a wide variety of vectors may be employed for this purpose. Important factors for selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector can be recognized and selected from those recipient cells that do not contain the vector; the number of copies of the vector which is desired in a particular host; and if it is desired that it be "alternative" to the vector between the host cells of different species. The invention further defines methods for manipulating the nucleic acid in a plant to allow regulation, control or modulation of germination, abscission, cell elongation, sexual determination, floral or leaf senescence, floral maturation, fruit ripening, insect resistance. , or herbicide to pathogen, or stress response in said plant. In a preferred embodiment the method activates or ameliorates the previous responses, while in other preferred embodiments the method inhibits or prevents previous responses. Thus, the methods of the present invention define embodiments in which the binding activity to the GCC box is prevented or inhibited. By "prevention" means the cessation of binding to the GCC box by the secondary response target proteins in the ethylene signaling pathway. By "inhibition" refers to a statistically significant reduction in the amount of GCC box binding activity, or by the amount of expression of target cells responsive to ethylene, or by detectable ERF1 proteins compared to plants, plant cells , organs, or growing tissues without the inhibitor or method described for inhibition. Preferably, blocking or inhibiting ERF1 inhibitor ERF1 reduces binding to the GCC box thereby inhibiting or reducing the expression of genes secondary to ethylene response by at least 20%, more preferably at least 50% current, even more preferably by 80%, or more, and also preferably, in a dose-dependent manner. The effect of said prevention or inhibition can block (desensitize) or inhibit the ethylene response of a plant or plant cell comprising said DNA or protein of the expression product.

According to other preferred embodiments of the invention, once the inhibitors that meet these requirements are identified, the use of assay procedure to identify the manner in which binding to the GCC box or expression of the target gene is inhibited They are particularly useful. Plants that are insensitive to ethylene are tolerant to pathogens and diseases. For the purposes of the present invention, tolerance to disease is the ability of a plant or plant cell to survive stress, infection or injury with minimal damage or reduction in the harvest yield of commercial product. Plants with tolerance to disease may have extensive levels of infection, but little necrosis and little or no injury. Plants or plant cells may also have reduced necrosis and responses to waterlogging and loss of chlorophyll may be virtually absent. In contrast, resistant plants generally limit the growth of pathogens and contain the infection to a localized area with multiple apparently harmless lesions. Similarly, the methods of the present invention are also defined in which the GCC box binding activity is initiated, stimulated or improved if there is a statistically significant increase in the amount of binding to the GCC box or in the amount of expression of GCC box. the white cells of ethylene response, or of the detectable ERF1 protein, detected in comparison with the plants, plant cells, organs, flowers or growing tissues in the improvement or described method of improvement. Preferably, the ERF1 enhancer increases the binding capacity by at least 20%, more preferably at least 50%, even more preferably by 80% or more, and also preferably, in a dose-dependent manner. Once the breeders who meet these requirements are identified, the use of test procedures to identify the manner in which the GCC box is improved are particularly useful. The invention further characterizes an isolated preparation of a nucleic acid that is antisense in orientation to a portion or all of ERF1 of or to a gene encoding a peptide having the ability to bind to the box Vegetable GCC The antisense nucleic acid must be long enough to inhibit the expression of the target gene of interest. The current length of the nucleic acid may vary, depending on the target gene, and the target region within the gene. Typically, said preparation will have at least about 15 contiguous nucleotides, more typically at least 50 or even more than 50 contiguous nucleotides in length. As used herein, a nucleic acid sequence is considered to be antisense when the sequence to be expressed is complementary to, and essentially identical to, the strand of non-coding DNA of the ERF1 gene, but to which it does not encode ERF1. "Complementarity" refers to the complementarity subunit between two nucleic acids, for example, two DNA molecules. When a position in a nucleotide in both molecules is occupied by nucleotides that are normally able to pair with each other, then nucleic acids are said to be complementary to each other. Thus two nucleic acids are complementary when a substantial number (at least 40% or at least 50%, or preferably at least 60%, or more preferably at least 70% or 80% or more preferably at least 90% or at least 99% ) of the corresponding positions in each of the molecules are occupied by nucleotides that are normally coupled to each other (for example, nucleotide pairs A: T and G: C). In even a further aspect of the invention, antibodies are provided which are directed against GCC box binding peptides or polypeptides, such as ERF1, which are capable of binding to the GCC box of secondary response proteins in the ethylene signaling path, therefore blocking or modulating its expression. Said antibody is specific for the entire molecule, its N- or C-terminal, or internal portions. Methods for generating such antibodies are well known in the art. In the embodiment that targets an antibody specific for a plant ERF1 polypeptide, including functional equivalents of the antibody, the term "functional equivalent" refers to any molecule capable of specifically binding to the same antigenic determinant as the antibody, thereby neutralizing the molecule, for example, antibody-like molecules, such as single chain antigen binding molecules.

The invention further includes a transgenic plant comprising an isolated DNA encoding ERF1 or a GCC box binding protein capable of activating the expression of secondary ethylene response genes in the signaling pathway of the plant ethylene. For the cases provided in at least one example of the present invention, a transgenic plant of Arabidopsis comprising a transgene of yeast rescued by the addition of cccl which when expressed confers hapia the plant the ability to recognize the presence of ethylene, a capacity that has been delegated from the original yeast gene. By "transgenic plant" as used herein means a plant, plant cell, tissue, flower, organ, including seeds, progeny and the like, or any part of a plant, comprising a gene inserted therein, whose gene has been manipulated to insert it into the plant cell by recombinant DNA technology. The manipulated gene is designated a "transgene". The "non-transgenic", but substantially homozygous "wild-type" plant as used herein means a non-transgenic plant from which the transgenic plant is generated. The transgenic transcription product can be oriented in an antisense direction as described above. The generation of transgenic plants comprising sense or antisense DNA encoding the GCC box binding molecules such as ERF1, are capable of activating, blocking or modulating the expression of ethylene-inducible white genes, and can be achieved by transformation of plants with a plasmid, liposome, or another vector that encodes the desired DNA sequence. Such vectors can, as described above, include, but not be limited to, the Ti-induced plasmids of unarmored Agrobacterium tumor containing a sense or antisense strand placed under the control of a strong constitutive promoter, such as the CaMV 35S promoter or an inducible promoter. Methods for generating such constructs, plant transformations and plant regeneration methods are well known in the art once the gene sequence is known, for example, as described in Ausubel et al., 1993, Current Protocols in Molecular Biology , Greene &; Wiley, New York). In accordance with the present invention, the plants included within the scope include both upper and lower plants of the plant kingdom. Mature plants, including rosette plants, and shoots are included in the scope of the invention. A mature plant, therefore, includes a plant in any developing state beyond the shoot. A shoot is a very young, immature plant in the early stages of development. Transgenic plants are also included within the scope of the present invention, which have a phenotype characterized by the ERF1 gene or eril mutations, or by the EIN3 gene or ein3 mutations (including eil mutations) that affect the activation of, or expression of the RTF3. Preferred plants of the present invention, which are affected by ERF1 or by binding to the GCC box to modulate the expression of the secondary ethylene response genes in the ethylene sepal system include, but are not limited to, high-yield crop species whose cultivation practices have been perfected (including monocots and dicots, for example, alfalfa, cashew, cotton, peanut, broad bean, French bean, mung bean, pea, walnut, corn, petunia, potato, sugar beet , tobacco, oats, wheat, rye and the like), or modified endemic species. Particularly preferred plants are those from: the family Umbelliferae, particularly of the genus Daucus (particularly carota, carrot) and Apium (particularly the species graveolens sweet, celery) and the like; the Solanacea family, particularly of the genus Lycopersicon, particularly the species esculentum (tomato) and the genus Solanum, particularly the species tuberosum (potato) and melongena (aubergine), and the like, and the genus Capsicum, particularly the species annum (pepper) and Similar; and the Leguminosae family, particularly the genus Glycine, particularly the max species (soybean) and the like; and the Cruciferae family, particularly of the Brassica genus, (particularly the species campestris (turnip), olerácea cv Tastie (pumpkin), olerácea cv Snowball Y (cauliflower) and olerácea cv Emperor (brocóli) and the like, and the Compositae family, particularly the genus Lactuca, and the species satire (lettuce), and the genus Arabid psis, particularly the thaliana (watercress) and the like.From these families, the most preferred are the vegetables with many leaves, for example, the Cruciferae family, especially the genus Arabidopsis, more especially the Thaliana species Particularly preferred plants include flowering plants, such as roses, carnations, chrysanthemums, geraniums and the like in which the longevity of the flower on the stem (delayed abscission) is of particular relevance, and especially includes ornamental flowering plants such as geranium, and additional preferred plants include ornamental green leafy plants such as Ficus. , palms, and the like, in which the longevity of the stem of the leaf in the plant (delayed abscission) s of particular relevance. Delayed flowering in said plants may also be advantageous. Similarly, other preferred plants include fruit plants, such as banana and oranges, wherein enzymes that dissolve peptin are involved in abscission process. The present invention will benefit plants subjected to stress. Stress includes, and is not limited to, infection as a result of pathogens such as bacteria, viruses, fungi, and conditions involving age, scarring and penetration into the soil. Bacterial infections include, and are not limited to, Clavibacter michiganese (formally Coynebacterium michiganense), Pseudomonas solanacearum and Erwm 'ia stewartii, and more particularly, Xanthomonas campestris (specifically patovars campestris and vesicatoria), Pseudomonas syringae (specifically tomato patovars, maculicola) .

In addition to bacterial infections, other examples of viral and fungal plant pathogens within the scope of the invention include, but are not limited to, tobacco mosaic virus, cauliflower mosaic virus, curly turnip virus, mosaic virus, yellow turnip; fungi include Phtophthora infestans, Peronospora parasitica, Rhizoctonia solani, Botrytis cinerea, Phoma lingam (Leptosphaeria maculans), and Albugo candida. Through the continuous isolation of the mutants of the enzyme cascade in the plant ethylene signaling it will be possible, according to the present invention, to identify the additional genes required for the assembly of the functional ethylene receptors, and for the use of the mechanisms of control of the plant response to this regulator of gaseous, stress or pathogenic hormonal maturation. The present invention is further described in the following examples. These examples are not considered as limiting the scope of the appended claims.

EXAMPLES Strains and growth conditions Arabidopis ecotype Columbia (col-0) was the parental strain of all mutant and transgenic plaques used in the following examples. The selection of the triple response was carried out as previously described by Guzman and Ecker, Plant Cell 2: 513-523 (1990). Plant growth in air and ethylene was carried out as previously described by Kieber et al., 1993.

Nucleic acid analysis Total RNA extraction and Northern analysis were carried out as described by Reuber et al., Plant Cell 8: 241-249 (1996) and by Chao et al., 1997. β-glucuronidase activity it was tested by incubation of the plants with the substrate of the enzyme (1 mg / ml of X-GIUCJ) in sodium phosphate buffer for 18 h. The cDNA clones corresponding to ERF1 were isolated by hybridization of a cDNA library selected by size in? ZAPII (Kieber et al., 1993). The probe, which corresponds to a fragment of the tobacco EREBP1 gene, was obtained by PCR amplification using the primers: EREBPIf: CACGCCATAGACATAATAC 3 '(SEQ ID No: 3) and EREBPI r: GCTACGATTCCTGTTCCTTCAG 3' (SEQ ID No: 4) .

The genomic sequence of ERF1 was isolated by hybridization of two BAC genomic libraries (TAMU and IGF) (Choi et al., Weeds World 2; 17-20 (nineteen ninety five)). The position of the ERF1 map was obtained by PCR amplification of the YAC sets using specific primers. PCR showed two YAC clones (CICI2H5 and CICI2H6), both located in ABI3 contig.

EXAMPLE 1 Characterization of the ERF1 gene and its expression product Protein synthesis and DNA analysis of ERF1, full length EIN3 and the deletion derivative E /? / 3 were generated by in vivo translation (or co -duction in the dimerization experiments) using a flexi system of rabbit reticulocyte lysate (Promega ™) as described by Solano et al., J. Biol. Chem. 272: 2889-22895 (1997). The fragments of the promoter and oligonucleotides labeled by f ^ CR and Klenow, DNA binding reactions and the electrophoretic change assays (EMSA) were carried out as described Solano et al., EMBO J. 14: 1773 -1784 (1985). The Arabidopsis promoter fragments and bean basic chitinase (CHI) genes containing the GCC box were obtained by Klenow filling of the following superimposed primers: b-CHI forward 5 ' GTTGATCACGAACCCGCCGCCTCATATTACATAATTA 3 '(SEQ ID No: 5); b-CHI mutant: 5 ' GTTGATCACGAACCCGTTGTTTCATATTCATAATTA 3 '(SEQ ID No. 6); b-reverse CHI: 5 'TTTAACTTTAATTATGAATGTGA 3' (SEQ ID No: 7); CH5B forward. 5' CTTCACGCTTGGGAAGCCGCCGGGGTGGGCCCGCAG 3 '(SEQ ID NO: 8); CH5B mutant 5 ' CTTCACGCTTGGGAAGTTGTTGGGGTGGGGCCCGCAG 3 '(SEQ ID NO: 9); and CH5B reversed: 5 'AAACCTTTCTGCGGGCCCACCC 3' (SEQ ID No: 10) The sequences of the mutant versions of EBS were used in the competition experiments that are: EBSml: 5 'GTTGTTTGGGATTCTTCGGGCATGTATCTTGAATCC 3' (SEQ ID No: 11) and EBSm2: 5 ' GTTGTTTTGGGATTCAAGCCCCATGTATCTTGAATCC 3 '(SEQ ID No: 12).

Plant transformation A BamHI-Kpnl fragment of 0.8 kb ERF1 cDNA was cloned into pROK2 digested with BamHI-Kpnl (Baulcombe, Nature 321: 446-449 (1983)). The C58 strain of Agrobacterium tumefaciens containing the aforementioned construction was used to transform the Col-0 ecotype of Arabidopsis and the ethylene insensitive mutants ein2-5, e? N2-17, ein2-26, ein3-1, ein3-3 and ein5-1, by vacuum infiltration in plant (Bechtold ef al., CR Acad. Sci Paris Life Sci. 316: 1194-1199 (1993).) Kanamycin-resistant T1 plants (kanR) were selected by seeds planted on MS medium supplemented with 100 μg / ml kanamycin, and the shoots were transferred to ground with kanR.

Yeast Transformation and "Double Hybrid" Selection Yeast strain Y190 was transformed by the PEG / lithium acetate method as described by Gietz et al., Nucleic Acid. R s. twenty: 1425 (1992). Growth conditions, selection procedures and filter removal assay for β-galactosidase activity were carried out as described by Kim et al., Proc. Nati Acad. Sci. USA 94: 11786-11791 (1997).

GenBank accession number The GenBank accession numbers for the ERF1 cDNA and the genomic sequences identified in the present invention are AF076277 and AF076278, respectively.

Cloning and characterization of ERF1 To identify targets for EIN3 / EIL proteins and to examine the role of EREBP in the ethylene signaling pathway, a PCR-based method was used to isolate members of the EREBP family in Arabidopsis. Using oligonucleotides complementary to the sequence EREBP1 (Ohme-Takagi et al., 1995), and a 597 bp fragment was amplified from tobacco genomic DNA, and this fragment was used to select a low-severity Arabidopsis cDNA library. . Among the clones that tested positive, two classes of cDNA showed high homology to the EREBP1 and EREBP3T4 genes in tobacco. Total RNA was isolated from 4-week-old Wt Col-0 (W) or ein3-1 (M) plants that grew in air and were exposed to ethylene gas at different times (0 to 48 hours). 30 μg of total RNA was loaded per line in Figure 2A and 2C, and 60 μg / line in Figure 2B. A gene, called factor 1 response to ethylene (ERF1) showed rapid induction in response to ethylene. More importantly, RNA m ERF1 began to accumulate after 15 minutes of hormonal treatment of the plant. The induction of ERF1 mRNA was also dependent on the presence of functional EIN3 as shown in Figure 2A. In order to compare the kinetics of the induction of ERF1 with that of the inducible gene of the known ethylene, the same blot was hybridized with PDF1.2, a member of the defensin gene family (Penninckz ef al., 1996). As expected if ERF1 is a regulator of these genes, the highest expression of ERF1 occurred earlier than PDF1.2 (Figure 2A). Since overexpression of the ethylene route genes EIN3, EIL1, or EIL2 causes the activation of all known ethylene response genes and phenotypes, the expression of ERF1 was examined. Although the levels were somewhat lower than those achieved by the exogenous ethylene treatment, the ERF1 mRNA showed a high level of constitutive expression in the transgenic plants expressing 35S :: EIN3- (see figure 2B), indicating that EIN3 is sufficient for the expression of ERF1. Taken together, these results demonstrate that EIN3 is both necessary and sufficient for the expression of early response ERF1 genes to ethylene, a novel DNA-binding protein type AP2 / EREFP. To confirm that ERF1 is a primary gene for ethylene response, induction by hormone dependence on protein synthesis was evaluated using cycloheximide as described by Lam ef al., EMBO .8.2777-2783 (1989) and Abel et al. ., J. Mol. Biol. 251: 533-549 (1995). Treatment with cycloheximide was found to induce the expression of ERF1 at least 20 to 50 times higher than those observed by the ethylene treatment, masking ethylene inducibility (Figure 2C). ERF1 was mapped to chromosome III, in AB13 by PCR amplification of YAC pools using primers specific for ERF1. Unlike EIN3, none of the known ethylene signaling mutants mapped in this region.

EXAMPLE 2 ERF1 is a component towards the 3 'end in the ethylene gas signaling path Previous efforts to understand the hormonal regulation of genes regulated by ethylene in several plant systems led to the identification of two types of ethylene response elements (ERE). It was found that one type of ERE is responsible for the ethylene-regulated expression of the genes induced during senescence (Itzhaki et al., 1994). A second element, the "GCC box", was identified as being necessary for the inducibility of ethylene in response to a pathogen attack (reviewed by Delkman, 1997). Based on the ability to bind the GÓC element, a family of DNA binding proteins (EREBP) was identified in tobacco (Ohme-Takagi et al., 1995). The fact that these genes were also activated transcriptionally by treatment with ethylene suggests that these act as an intermediate step between EIN3 / EIL proteins and effector genes towards the 3 'end, such as basic chitinase. To identify EIN3 targets, family members EREBP from Arabidopsis were cloned and characterized. ERF1 was rapidly induced in response to the ethylene and constitutive gas expressed in the presence of the ethylene cirl route mutant. The induction of ERF1 by ethylene was completely dependent on a functional EIN3 protein, since there was no detectable expression in the ein3-1 mutant.

In addition, 'transgenic plants that overexpress EIN3 showed high levels of expression of ERF1 mRNA. The results indicate that EIN3 is both necessary and sufficient for the expression of ERF1, conclusions that are consistent with ERF1 being a direct target of EIN3. The level of expression of ERF1 mRNA in plants overexpressing EIN3 was somewhat lower than ctrl mutants or in other wild-type plants treated with ethylenei This indicates that although EIN3 is sufficient for the expression of ERF1 other factors are required for an induction Complete of ERF1 dependent on ethylene. Using EIN3 as a "hook" in the "double hybrid" selection, a DNA binding protein that interacts with EIN3 was identified.

This protein also binds to the ERF1 promoter in a specific sequence manner indicating its role as an EIN1 partner and suggesting its importance for the total expression of ERF1 in response to ethylene. Mutations of loss of function have not been reported for any member of the EREBP family. This finding, together with the fact that more than 30 of these genes have been identified in Arabidopsis, suggests functional redundancy among members of the EREBP family. In the case of functionally redundant genes, alleles of loss of function can not show a genotype. A clear example of this has been provided by the ethylene receptors in Arabidopsis (F (ua and Meyerowitz, Cell (1998).) The implications on the ethylene signaling pathway for each of the five genes related to ETR1 were made through of identification (or creation by site-specific mutagenesis) of dominant mutations (Chang et al., Science 262, 539-544 (1993); Hua ef al., 1995; Hua et al., Plant Cell, 1998; Sakai et al., 1998). Although the unique loss of function mutations in these genes do not exhibit defects in the ethylene response, triple and quadruple mutants exhibit consecutive phenotypes of ethylene response, revealing that responses to ethylene are negatively regulated by the receptors (Hua and Meyerwitz, Cell, 1998) For this reason, a gain-of-function strategy was used to direct the function of ERF1 in vivo, the mutations to gain function obtained by insertational mutagenesis of the T-DNA or elements transposone s that carry a 35S CaMV promoter (trap-enhancer / trap-gene) have proven to be powerful tools for evaluating the in vivo function of a gene.

The constitutive expression of ERF1 results in sprouts and adult phenotypes very similar to those exhibited by cfl loss-of-fusion mutants, plants that over-express EIN1 or EIL1 or plants grown in ethylene. Some significant differences were, however, observed between plants overexpressing EIN3 and ERF1. Although overexpression of ERF1 causes inhibition of the elongation of the hypocotyledon of the root cell, the suckers lack an exaggerated apical hook.

Consistent with this observation, HOOKLESS1 was not induced in the ERF1 transgenic plants. Other members of the EREBP family appear to be responsible for the activation of these target genes.

In fact, a mutant that has gained function induced by a transposon (minimal) that constitutively expresses a genotype n sprouts that exhibit EREBP reminiscent for a partial response to ethylene (Wilson et al., 1996), suggesting that MINIMUM can be a companion of ERF1 in ethylene signaling. Alternatively, ERF1 can act in concert with other enzymes in the activation of some promoters.

EXAMPLE 3 Binding of sequence-specific EIN3 in the ERF1 promoter To test whether the EIN3 nuclear protein is capable of binding to DNA, the electrophoretic mobility shift assays (EMSA) were carried out using translated EIN3 protein in vitro and the 5 'promoter region of the ERF1 gene. A 6 kb fragment containing the ERF1 promoter was isolated from paired genomic sequences (BAC F11 F14) and subcloned into pBluesajipt ™. Five overlapping fragments covering approximately 1.4 kg towards the 5 'end of the ERF1 translation start site were actively amplified and radiolabelled by PCR. As shown in Figure 3A, a slower migration band was observed when one of the fragments (-1238 to -950) was incubated with reticulocyte lysates containing EIN3. The binding of EIN3 to the fragment of -1238 to -950) was not completed by a 500-fold excess of poly- (dldC) or - (dAdT), demonstrating the specificity of the DNA-EIN3 interaction. The specific retarded band was more intensely reproducible in lines competent with dAdT than with dldC, suggesting that the white sequence EIN3 may be rich in GC. To further delimit the white site of EIN3 this fragment was subdivided and each subfragment underwent binding experiments. Only one of these subfragments (-1213 to -1179) was specifically recognized by EIN3, further confirming its sequence specificity (Figure 3B). To demonstrate that EIN3 was indeed the protein present in the mobility shift band, a series of truncated Eir ^ l3 derivatives were generated and subjected to binding and to EMSA using an EIN3 binding fragment of 36 bp a change of mobility that correlated ópn the molecular weight of each of the truncated proteins, confirming the presence of EIN3 in the DNA-protein complex (Figure 3B). The smallest protein retaining DNA binding capacity was EIN3? 269, the EIN3-DNA binding domain of amino acid 1 was demarcated to 359. In addition, a mutant version of EIN3 containing the amino acid substitution encoded by the ein3- allele 3 (Lys245 to Asn) was generated by in vitro translation of the corresponding mRNA. The amino acid substitution in the ein3-3 mutant falls within the basic domain III of the EIN3-3 protein. Interestingly, the mutant protein EIN3-3 was unable to recognize the target site of 36 bp (Figure 3B). Further evidence that the EIN3 protein is the complex with the DNA was obtained by competition of the DNA-EIN3 binding using an anti-EIN3 antibody. No mobility test was observed in the binding reaction mixture that included the anti-EIN3 antibody. In contrast, the addition of pre-immune serum had no effect on the change in gene mobility (Figure 3 ^). The immunoblot of the gel with the changing band using anti-EIN3 antibodies also identified EIN3 as the protein in the retarded band, since the antibodies indicated a band with the same mobility as the slow migration complex. In the EMSA experiments where the short DNA molecules were used, the full-length EIN3 protein produced two different mobility bands, while its delayed deletion derivatives only produced one. Since several by-products were obtained in the translation reaction of EIN3 in vitro, the upper band apparently corresponds to full-length EIN3 and the lower band to a truncated EIN3 derivative. Additionally, additional experiments showed that the source of EIN3 proteins does not affect their ability to bind WüN. As well as the in vitro translated protein, the EIN3 expressed in Baculovirus also recognizes the 36 bp fragment containing the target sequence. In addition, in this case only one band of changing mobility was observed in the EMSA. To further define the sequence requirements for EIN3 binding, the selection mutagenesis of the 36 bp fragment was carried out. As seen in Figures 4A and 4B, all mutations that affect the affinity of EIN3 for its target site reside within a 28 bp sequence that includes two palindromic repeats separated by a central core sequence. Unique mutations within the core sequence completely abolished the binding, indicating that this sequence is necessary for recognition of EIN3. Mutations that affect the palindromic repeats severely reduce the binding to EIN3, confirming that they are also important in determining the interaction. Interestingly, the EIN3 binding sites show significant similarity to the sequences present in the promoter region required for the ethylene response in tomato E4 (Montgomery et al., Proc. Nati, Acad. Sci. USA 90: 5939-5943 ( 1993)) and genes LEAC01 (Blume et al., Plánt J. 12: 731-746 (1997)), and in the GST1 gene of the carnation (Itzhaki ef al., Proc. Nati. Acad. Sci. USA 91: 8925 -8929 (1994)), (Figure 4B). In GST1, a 197 bp promoter fragment containing this sequence was also sufficient to confer ethylene response to a minimal 35S CaMV promoter in transient assays (Itzhaki et al., 1994). To further examine the specificity of the binding to this target site, the competition experiments were carried out using an excess of unlabeled EIN3 at the binding site (EBS), or two mutated versions (EBSml and EBSm2) not recognized by EIN3. See figures 5A and 5B. Each line contains a nanogram of marked EBS. As shown in Figure 5A, the formation of the EIN3-EBS complex was more efficiently competed by an excess of unlabeled EIN3-EBS than by any eg mutant versions of EBS, further supporting the findings that the EBS-EIN3 interaction is sequence specific. Figure 5B depicts a summary of the structural characteristics of EIN3 and of the mutants used in the EMSA experiments, as adapted from Chao et al., 1997.

EXAMPLE 4 EIN3 is a novel DNA binding protein that regulates the expression of ERF1.

Although the EIN3 and EIL proteins do not share similarity with any other known protein, their nuclear localization, the presence of conserved basic domains and acid regions suitable for the binding and activation domain, respectively, characterize their role as transcription factors (Chao ef al. , 1997). DNA binding assays using EIN3 protein translated in vitro and expressed in Baculovirus demonstrates that it binds to the specific sequences in the ERF1 promoter. EMSA experiments using truncated forms of the protein or antibodies against EIN3 confirm the presence of EIN3 in the DNA-protein complex. On the other hand, a mutant protein corresponding to the ein3-3 allele of EIN3.I was unable to recognize the target sequence. This mutation consists of a substitution of Lys to Asn in the basic domain III, which can be part of the DNA binding motif. Two additional proteins that belong to the EIN3 / EIL family, EIL1 and EIL2 were also able to specifically recognize the EIN3 target in the ERF1 promoter. Consistent with this result, EIN3 can be functionally replaced by EIL1 or EIL2 since overexpression of any of these genes in the transgenic plants can complement the mutation of ein3-1 (Chao et al., 1997). Deletion analyzes of EIN3 allow confirmation that this DNA binding domain falls within the N-terminal half of the protein. This region is the most conserved among all four members of the family and does not contain any previously known DNA binding motif. The EIN3 / EIL DNA binding domain will be further characterized by the structural analysis of the proteins. However, these four proteins (EIN3, EIL1, EIL2 and EIL3), together with a fifth homologue more recently identified (EIL4), have several predicted helices, two of them rich in basic amino acids that offer a surface of interaction with DNA . The mutagenesis of selection of the DNA fragment containing the target site allows the determination of the sequence requirements of the EIN3 / EIL interaction. The defined white site includes two inverted repeats that are recognized by the protein as a dimer. Interestingly, the EIN3 binding site shares significant identity with the sequences within the promoter region of the carnation GST1 gene which has been defined as necessary and sufficient for the response to ethylene. The conserved sequences are also present in the promoter regions required for the response to ethylene in tomato E4 and LEAC01 genes. This indicates that the EIN3 target site represents a primary ethylene response element (PERE) conserved in different species where you are also an EIN3 orthologian. Consistent with this determination, one of the genes containing these elements (E4) has previously been identified as a primary response gene to ethylene (Lincoln et al., Proc. Nati, Acad. Sci. USA 84: 2793-2797 (1987 )). The GCC element seems to be a secondary response element to ethylene (SERE) present only in a subset of the genes that regulate ethylene, (for example, genes related to pathogenesis, HOOKLESS1 and some EREBP) that are regulated by a subpopulation of proteins of the EREBP family.

EXAMPLE 5 EIN3 recognizes its target as a homodimer The presence of palindromic repeats in the white EIN3 site suggests that EIN3 can interact with its target as a dimer. To address this question, using the method of Hope et al., EMBO J. 6: 2781 j-2784 (1987), full-length EIN3 and several carboxy-terminal deletion derivatives were translated in vitro, together or in pairwise combinations . The resulting translation or co -duction products were tested for binding to EBS DNA. As shown in Figure 6A, in addition to the bands corresponding to full length EIN3 and the deletion derivatives attached to DNA, an intermediate mobility band appears when the co-produced products are used. The intermediate band corresponds to a change in mobility for a heterodimer, confirming that these proteins bind to EBS as dimers. Additional evidence that EIN3 has the ability to form dimers comes from the selection for the EIN3 interaction proteins using the yeast "double hybrid" system (Fields et al., Tature 340: 245-246 (1989)).; Dufree et al., Genes Dev. 7: 555-569 (1993)). Consistent with EIN3 being a transcriptional factor, the fusion of the full size protein with the GAL4 / DNA binding domain of reporter gene (BD) transcription activation indicates that LacZ possesses activation domains that are functional in yeast. To avoid this activation of the reporter gene, an EIN3 derivative containing amino acids 53 to 257, fused to GAL4-BD, was used as a "hook". As a "prey" the GAL4 activation domain was fused to an Arabidopsis cDNA library constructed using mRNA from etiolated sprouts (Kim et al., 1997). Yeast strain Y190 transformed with the "hook" construct was subsequently transformed with the "prey" and four million independent transformants were selected for positive interactions, as described by Kim et al. (1997).

Twenty-six independent positive clones were obtained. The plasmids were recovered and their cDNAs were sequenced. Among them, six different clones that correspond to EIN3. All positives were reproduced by transformation directly with yeast with both the original "hook" and the "prey" recovered. Figure 6b shows an example of the interaction with one of these positive ones which includes amino acids 113 to 628 of EIN3. Since the "hook" contains residues 53 to 257 of EIN3, the dimerization domain was located as a resident among the amino acids 113 and 257. These results also confirm that the interaction of the EIN3 binding domain with DNA is not required for the dimerization of the protein. To examine whether other members of the EIN3 / EIL family were also capable of binding DNA, EMSA experiments were carried out using translated EIL1, EIL2 and EIL3 proteins in vitro, and a DNA fragment containing EBS or a mutant version. Consistent with the ability of EIL1 and EIL2, but not of EIL3, to complement the eln3-1 mutation in transgenic plants, both EIL1 and EIL2, but not EIL3, were able to specifically recognize the EBS element (Figure 6C). To evaluate whether EIN3 and EIL were capable of forming heterodimers, DNA binding experiments were carried out using all combinations of EIN3 / EIL proteins produced. Although the bands of changing mobility that correspond in position to homodimeric forms of EIN3, EIL1 and EIL2 were observed, DNA-protein complexes with intermediate mobility were not observed, indicating that these proteins do not form heterodimers.

EXAMPLE 6 ERF1 is a binding protein of the GCC box The preceding examples demonstrate that EIN3 is a transcriptional activator that is both necessary and sufficient for the expression of ERF1. Therefore, it is predicted that ERF1 may play a role in directing the expression of the target genes that contain the GCC element. However, at least one EREBP involved in the regulation of the cold and drought response is known to bind to a DNA sequence unrelated to the GCC element (ie, C-box / DRE element, Stockinger et al., Proc. Nati, Acad. Sci. USA 94: 1035-1040 (1997)). To determine whether ERF1 contained a functional DNA binding domain, which could be able to interact with the GCC element in a specific sequence manner, DNA binding experiments with translated ERF1 protein were carried out in vitro. The fragments of the radiolabelled promoter of the Arabidopsis basic chitinase that regulates ethylene (Sámac et al., 1990) and the bean chitinase 5B genes (Broglieet al., 1989), were incubated with ERF1 and analyzed by EMSA. To examine the specificity in the interaction a mutant version of the promoter fragments was also used, in which the cytokines of the GCC box element were replaced by thymines. As seen in Figure 7, ERF1 was able to bind specifically to the promoter fragments containing the GCC element, while no binding was observed in the mutantps sequences. The lower band in each line contained ERF1 and the wild-type element apparently corresponds to a truncated form of ERF1 since two major bands were obtained as products of the translation of the ERF1 mRNA in vitro.

EXAMPLE 7 Activation towards the 3 'end of the response to ethylene by ERF To further assess the role of ERF1 in the ethylene signaling pathway, transgenic plants constitutively expressing ERF1 mRNA under the control of a promoter were constructed. 35S CaMV. The T2 segregants of these transgenic lines were examined for the ethylene response phenotypes. Out of a total of 26 independent lines, plants from 9 lines exhibited phenotypes similar to those observed in the constitutive ctrl mutants of ethylene response, or in plants that overexpressed EIN3 or EIL1. The etiolated shoots 35S :: ERF1 grown in hydrocarbon free air showed inhibition of the elongation of the root and the hypocotyledon, typical of the response to treatment with ethylene (Figure 8A-H). However, the apical hook did not exhibit an exaggerated curvature typical of an ethylene response. The cotyledons of the shoots that express ERF1 were still closed and many were still encapsulated in the seed coatings. Consistent with this phenotype, HOOKLESS1, an ethylene response gene required for the curvature of the apical hook (Lehn? An et al., Cell 85: 183-194 (1996)), was not expressed in plants overexpressing ERF1. The expression of only one triple response phenotype in the partial shoots in these lines is consistent with a role of ERF1 in mediating a subpopulation of the ethylene response. ERF1 can act together with other genes, for example, EREBP and others, to completely remove the various responses of offsprings to ethylene. As adults, the 35S :: ERF1 transgenic plants show an extreme phenotype of dwarfs similar to the constitutive ctrl mutants of ethylene response and to the transgenic plants overexpressing EIN3 / EIL1 (Figure 9A-G). As in the case of the quadruple ethylene knock-out mutant (Hua and Meyerowitz, Cell, 1998), multi-line plants expressing ERF1 show extreme inhibitions of cell elongation, and finally the plants wither and die before the premature production of flowers and seeds. To determine if the "ethylene" morphology exhibited by these plants was the consequence of the overproduction of ethylene, or due to a constitutive activation of the signaling pathway, the 35S :: ERF1 gene was also introduced into several background mutants. (ein2-5, ein2-17, ein2-26, ein3-1, ein3-3 and ein5-1) that suppress the phenotype resulting from the overproduction of ethylene. In all cases, the transgenic plants exhibit a morphologically indistinguishable form from the wild-type plants expressing 35S :: ERF1 (figures 9 and 10). Thus, the observed morphology evoked by the expression of ERF1 was not a consequence of ethylene production; rather, as the expression of CaMV 35S :: EIN3, the morphology results from the constitutive activation of the response pathway. In addition, because there is an absence of the requirements for the functional proteins EIN2, EIN3 or EIN5 for the constitutive activation of the phenotype, morphology results provide strong evidence for localization towards the 3 'end of ERF1. To confirm if the morphology observed in the 35S :: ERF1 lines was due to an activation of the ethylene response, the expression of several genes regulated by ethylene was examined. As expected, ethylene induces the accumulation of mRNA for two genes responsive to ethylene, basic chitinase and PDF1.2 that were completely blocked in a strong mutant (ein2), or that were significantly reduced in the weak mutants insensitive to ethylene ( ein3 or ein5) (Figure 10A). In each of the five independent transgenic derivatives overexpressing ERF1 of 5 weeks of age, plants grown in air were observed, with high constitutive levels of mRNA expression for basic chitinase and PDF1.2 (Figure 10A). Total RNA (5 μg) was loaded per line in the middle and right panels, and 50 μg in the left panel of Figure 10A. In addition, the constitutive expression of chitinase and mRNA of PDF1.2 was observed when the 35S :: ERF1 gene was introduced into three different background mutants insensitive to ethylene. All the transgenic lines ein2; 35S :: ERF1, ein3; 35S :: ERF1 and ein5; 35S :: ERF1 showed high levels of mRNA expression for these genes. In the case of ein5-1, the low expression of ERF1 in one of the two transgenic lines correlates with the lower expression of PDF1.2 and basic chitinase, and with the lower constitution of the ethylene response phenotype. The effect of the expression of 35S :: ERF1 on a fusion gene to the chitinase promoter, CH5B :: GUS, was also examined. This well-characterized ethylene response reporter gene proved to be a suitable marker for transcription evoked by ethylene in beans (Broglie et al., 1989), and Arabidopsis (Chen et al., Plant Physiol. 108: 597-607 (1995 ) 1 Three-week-old F1 plants derived from crosses between plants carrying the CH5B :: GUS reporter gene and lines overexpressing ERF1 or wild-type plants were grown on agar plates and stained for GUS activity As revealed by intense staining in the shoots, high levels of GUS activity were observed in the presence of 35S :: ERF1, while there was no detectable staining in the control plants (absence of 35S :: ERF1) (Figure 10B In addition, the introduction of the 35S :: ERF1 construct into a trap reporter line with ethylene repressible improver also results in the inhibition of GUS expression in the absence of ethylene, confirming the repressed transcription of g in regulated by ethylene by the expression of ERF1. These results confirm that the expression of ERF1 is sufficient to promote (or repress) the transcription of white genes regulated by ethylene in a variety of plant tissues. In sum, the rapid induction of EIN3 expression of ERF1 in response to ethylene, the binding of EIN3 to the ERF1 promoter, and the constitutive expression of ERF1 in plants that overexpress EIN3 supports the conclusion that ERF1 is an intermediate target of EIN3. The binding of ERF1 to the GCC element in the promoters of genes regulated by ethylene, and the constitutive activation of the ethylene response genes. and the phenotypes in both the etiolated suckers and the adult plants in the gain-of-function experiments of ERF1 also define ERF1 as a gene for the ethylene signaling path to the 3 'end. The sequential action of EIN3 (or ElLs) and ERF1 DNA binding proteins adds a new level of complexity in the hierarchy of regulation of the ethylene signaling pathway. Thus, the existence of this hierarchy of enzymes in the ethylene signaling pathway provides a means to finely regulate the response of complex plants to this plant growth regulator / stress signal.

The description of each patent, patent application and publication cited or described in this document are incorporated herein by reference, in their entirety. Various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Said modifications are also intended to fall within the scope of the appended claims.

Claims (32)

1. NOVELTY OF THE INVENTION CLAIMS 1. - An isolated nucleic acid encoding an ethylene response factor in plants, which is activated by EIN3 or an EIN3-like peptide (EIL) in the plant ethylene signaling pathway, where the activated factor binds to a White GCC box in a secondary ethylene response gene.
2. 2. The nucleic acid according to claim 1, further characterized in that it comprises ERF1.
3. 3. The nucleic acid according to claim 2, further characterized in that it comprises the mutants, derivatives, homologs or fragments of ERF1, which encode an expression product having ERF1 activity.
4. 4. The nucleic acid according to claim 2, further characterized in that it comprises SEQ ID NO: 1.
5. 5. A purified preparation of a polypeptide encoded by the nucleic acid as claimed in any of claims 2-4.
6. 6. The polypeptide according to claim 5, further characterized in that it comprises ERF1 and homologs, analogs, derivatives or fragments thereof, which have GCC box binding activity in a secondary response target gene. 7 -.
7. 7 - The polypeptide according to claim 6, further characterized in that it comprises SEQ ID NO: 2.
8. 8. The polypeptide according to claim 7, further characterized in that the binding activity to the ERCC GCC box is dependent on EIN3 or EIL.
9. 9. A recombinant cell comprising the isolated nucleic acid as claimed in any of claims 1-4.
10. 10. A vector comprising the isolated cloned nucleic acid is claimed in any of claims 1-4.
11. 11. An antibody specific for a plant ERF1 polypeptide, and homologs, analogs, derivatives or fragments thereof, characterized in that it has GCC box binding activity in a secondary response target gene.
12. 12. An isolated nucleic acid sequence comprising a sequence complementary to all or part of a nucleic acid sequence as claimed in one of claims 1-4, and to mutants, derivatives, homologs or fragments thereof encoding an expression product for binding to the GCC box in a secondary response white gene.
13. 13. The nucleic acid according to claim 12, further characterized by having antisense activity at a level sufficient to regulate, control, or modulate the secondary ethylene response activity of a plant, plant cell, organ, flower or tissue comprising the same.
14. 14. - A plant, plant cell, organ, flower, tissue, seed, or progeny characterized in that it comprises nucleic acid as claimed in any of claims 1-4 or 12-13.
15. 15. A transgenic plant, cells, organs, flowers, tissues, seeds or progeny characterized in that it comprises the nucleic acid according to any of claims 1-4 or 12-13.
16. 16. A transgenic plant, cells, organs, flowers, tissues, seeds or progeny characterized in that it comprises the recombinant nucleic acid as claimed in claim 9.
17. 17.- A transgenic plant, cells, organs, flowers, tissues, seeds or progeny characterized in that it comprises the corpium polypeptide is claimed in any of claims 5-8.
18. 18. An isolated nucleic acid according to any of claims 1-4 or 12-13, further characterized in that it comprises a promoter sequence ERF1 in plants, or a fragment thereof having promoter activity ERF1.
19. 19. A vector characterized in that it comprises isolated nupleic acid as claimed in any of claims 1-4 or 12-13 or 18.
20. 20. The isolated nucleic acid according to claim 18, further characterized in that it comprises an operable replenishing gene.
21. 21. - The merger of the previous one, or a fragment of it that has reporter activity.
22. 22.- A transgenic plant, cells, organs, flowers, tissues, seeds or progeny characterized in that it comes a transgene coming an isolated nucleic acid coming a promoter sequence ERF1.
23. 23. A method for manipulating in a plant the one claimed in any of claims 1-4 to allow the regulation, control or modulation of the response to ethylene in said plant.
24. 24. The method according to claim 22, further characterized in that said regulation, control or modulation initiates or improves germination, cell elongation, sexual determination, floral or leaf senescence, floral maturation, fruit ripening, insect resistance , herbicide or pathogen, abscission, or stress, wound or pathogen response in said plant.
25. 25. The method according to claim 22, further characterized in that said regulation, control or modulation inhibits or prevents germination, cell elongation, sexual determination, floral or leaf senescence, floral maturation, fruit ripening, insect resistance , herbicide or pathogen, abscission, or stress, wound or pathogen response in said plant.
26. 26. - A method for identifying a compound capable of affecting the ethylene response in the ethylene signaling system in a plant characterized in that it comprises, providing a cell comprising an isolated nucleic acid encoding a plant ERF1 sequence, having a sequence reporter operatively to it; add to the cell a compound to be tested; and measuring the level of activity of the reporter gene in the cell, wherein a higher or lower level of reporter gene activity in the cell compared to the level of reporter gene activity in a second cell in which the compound to be tested was not added is an indicator that the compound to be tested is capable of affecting the expression of a plant ERF1 gene.
27. 27. A method for generating a modified plant with improved ethylene response activity compared to the comparable wild-type plant comprising introducing into the cells of the modified plant an isolated nucleic acid encoding ERF1, wherein said acid nucleic ERFl binds to the GCC box, thereby activating the secondary ethylene response genes of the modified plant.
28. 28.- A method for generating a modified plant that improves its ethylene response activity in comparison with the comparable wild-type plant, which comprises introducing into defective or defective cells in EIN3- or EIL- or the modified plant a nucleic acid isolated coding for EIN3 or EIL, wherein said EIN3 or EIL nucleic acid activates the ERF1 gene, thus allowing the activation of the target genes secondary to ethylene response of the modified plant.
29. 29. A method for generating a plant whose decreased or inhibited activity of response to ethylene compared to that of the comparable wild type plant characterized in that it comprises the binding or inhibition of the ERF1 molecules within the cell of a modified plant upon introduction within said cells an isolated nucleic acid encoding a nucleic acid complementary to all or a portion of eril, wherein said erfl nucleic acid can otherwise be bound to the GCC box, thereby activating the secondary response genes to ethylene of the modified plant.
30. 30.- A method to generate a plant whose activity diminished or inhibited response to ethylene compared to a comparable wild type plant characterized in that it comprises joining or inhibiting the ERF1 molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ERFpl, wherein said ERF1 polypeptide can otherwise bind to the GCC box, thereby activating the secondary ethylene response target genes of the modified plant.
31. 31.- A method to generate a plant whose activity diminished or inhibited response to ethylene compared to a comparable wild-type plant characterized in that it comprises joining or inhibiting the EIN3 or EIL molecules within the cell of a modified plant by introducing into said cells an antibody to all or a portion of EIN3 or EIL, wherein said EIN3 or EIL polypeptide may otherwise activate the expression of ERF1, thereby enabling the activation of the target genes secondary to ethylene response of the modified plant.
32. 32. A method for manipulating the expression of ERF1 in a plant cell characterized in that it comprises: operatively fusing the nucleic acid ERF1 or an operable portion thereof or a promoter sequence of the plant in the plant cell to form a chimeric DNA, and generating a transgenic plant, the cells of which comprises said chimeric DNA, wherein after the controlled activation of the plant promoter, the expression of ERF1 is manipulated.