AU637317B2 - Gene and gene product for preparing beta-lactam compounds - Google Patents

Abstract

Gene and gene product of a key enzyme which is novel because of its structure and multivalent functionality, and catalyses the last stage of the biosynthesis of penicillin G and penicillin V.

Description

DPI DATE 03/11/89 AOJP DATE 30/11/89 APPLN. JD 33626 89b PCT NUMBER PCT/EP89/00374 )BER DIE

INTE

INTE

Internationale Patertkiassiikation 4 (11) Internationale Veriiffentiichungsnummer: WO 89/0982 1 C12N 15/00, 9/84, 1/00 Al (43) Internationales Ver6ffentlichungsdatum: 19. Oktober 1989 (19.10.89) (21) Internationales Aktenzeicheu: PCT/EP89/00374 (74) AnwAlte: KLEINE DETERS, Johannes usw. Sandoz AG, Patentabteilung, CH-4002 Basel (CR).

(22) Internationales Anmeldedatum: 7. April 1989 (07.04.89) (81) Restimmungsstaaten: AU, DR, FI, RU, JP, KR, US.

Prioritatsdaten: A 922/88 8. April 1988 (08.04.88) AT A 1806/88 13. Juli 1988 (13.07.88) AT Verdffentlicht A 220 1/88 8. September 1988 (08.09.88) AT Mit internaronalem Redierchenbericht.

(71) Anmelder (fir alle Bestimmungsstaaten ausser US): BIO- CHEMIE GESELLSCHAFT M.B.R. [AT/AT]; A--6250 Kundi (AT).

(72) Erfinder;und Erfinder/Anmelder (nur fur US) KNAUSEDER, Franz [AT/AT]; Oberndorf 306, A-6322 Kirchbiehl (AT).

LEITNER, Ernst [AT/AT]; Daxerfeld 5, A-6250 Kundi PALMA, Norbert [IT/AT]; Kleinsbill 127, A-6250 Breitenbach WEBER, Gerhard [DE/AT]; A-6322 Unterlangkampfen 437 (AT).

(54) Title: GENE AND GENE PRODUCT FOR PREPARING P-LACTAM COMPOUNDS (54) Bezeichnung: GEN UND GENPRODUKT ZUR HERSTELLUNG VON J-LACTAMVERPJNDUNGEN (57) Abstract Gene and gene product of a key enzyme which is novel because of its structure and multivalent functionality, and catalyses the last stage of the biosynthesis of penicillin G and penicillin V.

(57) Zusammenfassung Die Erfindung betrifft Gen und Genprodukt eines in seiner Struktur und multivalenten Funktionalitdt neue SchiOsselenzyms, welches die letzte Stufe der Biosynthese von Penicillin G und Penicillin V katalysiert.

4

I'

This invention relates to the enzyme penicillinacytransfer-ase (PAT) -nd DA sequences coding for it.

The PAT enzyme is invxolved in the last step of penicillin biosynthesis; that is the transacylation of -somenicillin or- the cleav-age of isopenicillin N to 6-amincoeicillanic acid (6-A2-A0 a-nd its acylatio. to -:emni cillin, in accordanuce with the reaction scheme which illustr-ated in Fig. 9. During these reactions, the L-aminoadipic. ac-d side chain of isopenicillin N is excchanged for phezyl- or phenoxcyacatic acid, and these side chain acids enter the reaction as acyl-coenzyme A-comnouvnds (Fawcett er 1975; Biochem. 151, 741- 746). The PAT enzyme can also catalyze acyl exchange within v-arioIus -Denicillins.

The importance of PAT for the biosynthesis of penicillin G or V is verified by obsetvations made by Brunner et al. %'Eon e-Seyler's Z. Physiol. Chem. 349,- 95-103, 196S), Spencer (Biocbhem. Biophys. Res. Conmun. 31, 170-175, 1.968), Catenback and Briinsberg (Acta Ch~em. Scand.

22, 1059-1061, 1968), Spencer and Maunq (Biochem. J. 118, 29-30, 1970), IMeesschaert. et al. Antibiotics 33, 722-730, 1980)/, Kogeka: et al. (Indian LT. of Biochem. and 2 5 Biophys. 20, 208-212, 1983), Fraderikcsen et al. (Biotecbn.

Letters 6, 549-554, 1984), Abraham (in R~eglation of Secondary Metabolite Formation, RXlei-nkauf6 et al., ec~s., Proceedings of the 1.6t!% Workshop Conf~erences Hoechst, c-racht Castle, 1.2.58,Vol. 16, WainheiLm, p. 115-132, t t~ 30 1986), Luengo et a'L. Antibiotics 39, 1565-1573 and 1754-1759, 1986), as well as Alvarez et al.. (Antimicrob.

Agents and Chemotherapy 31, 1675-62197 etc, osw.26, 493-500, 1972) in raw extrauts of P. chr.soeng but is found in all penicillin-orming fungi although it 1 is encountered to a greater extent in nenicillin strains having high svnthesis canacity rather than in low-Droducing strains (Pruess and Johnison, J. Bact. 94, 502-1508, 1967) PAT is intracellular localised.

Several enzymes involved in 1ac-taz biosynthesis have been isolated in. pure -form amd characterised according to their structure. Sizmilarly, the coding regions for several of these enzymes have been isolated, sequenced, incor-orat-ed into expression vectors, and (eg. the isopenicill4in N svrnthetase from Cenhalos-oorium acremonium: Samson et Nature 318, 191-194, 1935; Saldwin et 7. Antibiotics 40(5), 652-659,. 1987; EP 200 425, Eli Lilly, 1985; the iso-oan.-c11in N svnthetase from Penicillium, c'nrvsorenun: Carr et al., Gene 48, 217-266, 1986; EP 225 128, Eli Lilly, 1985; the expa=-dase from Cephalosiori-um acremonium: Samson et al., Biotacbhn. 5, 1207-1214, 1987; as well as several enzymes from Streptomyces clayulicrerus which catalyze P-lactam biosvnthesis: ER 233 715, Beecham, 1986). The tranisformation of a P-1actam producing microorganism, carried out with such expression vectors, aas also been described (Skatrud et al., Curr. Genet.

12(5), 337-:348, 1987). Zot-ever, until this invention, the PAT enzyme could not be isolated in pure form and 25 characterised accord-ing to its structure and properties because of its extreme instability. The PAT enzyme has no~w been isolated and characterised and 'Yhe DNA sequence r,-oding for it has been secraenced.

Accordingly this invention provides a me e coding for the enzyme penicilhimacyl-transferase in purified and isolated fom.

Preferably the MMA molecule cods. fo~th'A=injthat has the A-ino acid sequence set out in example 16.

The DM1. molecule may include nucleotides 162 to 197, 35 262 to 436, 505 to 6.56 and 726 to 1436 of the DNIL sequence sot out in example 15. Preferably th.e DX& molecule -v 0 0 00 0 0900 0 00 00 0 94 4 0 0 0009 00 00 0 0 0& 40 0 0 4 00 40 0 0 0 0 0 0 0000 0* O 0 00 00 0 00 0 00 0 00*4 0 0 0 0 000* 0 09 00 0 00 0 qo. 4 *0 0 0 0 0 ±N~44&C

V

-3includes nucleotides 162 to 1436 of the sequence set out in example The DNA molecule may further comprise the nucleotide sequences that cause the transcription and translation of the P. chysogenum PAT gene. These nucleotide sequences may originate from P. chrysogenum or be from another source. In addition, these nucleotide sequences may comprise the nucleotides between the isopenicillin N synthetase, which terminates at position 1G6, and PAT, which starts at position 1603 of the sequences set out in example 18. The DNA molecule may also include the isopenicillin N synthetase sequence.

The invention also provides a vector which contains a DNA molecule, preferably DNA, as defined above.

In another aspect the invention provides host cells preferably p-lactam producing microorganisms containing the vector. These host cells may be used to produce PAT.

Therefore invention also provides a process for the production of enzyme penicillinacyl-transferase (PAT), comprising cultivating cells containing a vector which contains a DNA molecule as defined above and isolating the expressed Z AT.

In yet another aspect the invention provides a process for the production of penicillin which comprises cultivating a penicillin prodacing host cell that carries a vector as defined above. Preferably the host cell P. chysogenum or another plactam-producing microorganism. More preferably the process of the invention allows for a host cell which expresses the PAT gene at higher levels, preferably much higher levels than normal. This leads to increased penicillin production. The penicillin can then be isolated and used in the production of pharmaceuticals.

Protein sequencing is known according to Laursen, Methods Enzymology 344-359 (1972). It is similarly a present state of the art to localise the genes coding for proteins (Rothstein et al., Cold Spring Harbor Symposia on Quantitative Biology, Vol. XLV, 99-105, 1981) and to sequence them (Maxam and Gilbert, Methods Enzymology 65, 499-560, 1980). The attained coupling of a gene 'Lo a strong, optionally inducible promoter is known according to Pribnow, Biolog. Regulation and Development, Vol. 1, 231-277, Plenum Press No. 4 (Goldberger et al., 1979).

The PAT enzyme is thiol-dependent, highly unstable and slightly acidic. It is formed in increasing amounts 930225,q:\oper\jmw,33626sub.1,3 4 4r, 'enicillin-Forrin- s-trains of Penjcillium chrsogenum during 40 to 100 hours fermentation. Tt catalyses r-he acyl transfer of coenzv;me -z activated fermentative side chains acyl-coenzyme A-compo-unds ot the hydrophobic substances phenoxyacetic acid, pbheny2acetCic acid, hexanoic acid, octaroic acid etc.) to matural penicillins iso-penicillin IN, penicillin V, nencil-J.Lin G, 6-LTA etc.) also catalyses ac-y! transfer of natural penicillins among one anotter, i.e.

during the acyl tra--sffer -WhIch o~erates by way of an acyl enzyme complex. Duri4ng this acyl transfer, the natural penicillins funation both as an acyl donator and as an acyl acceptor, while the coenzyme A activated hydrophobic precursor compounds only enter th~e enzymatic reac-tion as an acy! donators. Since the acy. transfer takes place in Pn aqueous medium, water as a nuoleophile also Competes with the acyl enzymae com-plex, whereby tte acy. donators which are rich in energyv can be simply cleaved hydrolytically. Thus, 6-APA, the P3-lactam nucleus of natural oeniciltlins is always found in th"e culture br~th of venicillin fermentations.

Detection of PAT mlay take place using conventional.

methods of analysis, such as radio-active, microbiological.

or chromatographic test methods. The following three the 6-APA-phenoxyacetyl-coenzyme A-acyl trans ieras e activity of PA:7, which catal-yses the enzymatic reaction G-APA phenoxyacetyl-coenzyme A -4 penicillin V coenzyme A a) Detection of penicil-1lin V by microbiological agar diffusion test with specifically product-sensitive test strains, e..g.

4 0 ^-_juuiratiiiiT-im* 5 micrococcus luteus ATCC 9341 has antibacterial sensitivity towards penicillin which is more than three decimal powers greater than towards 6-APA.

b) When using S 35-labelled 6-APA (enzymatically from S penicillin G) detection of extractable S 35-penicillin V in the 0-counter.

c) Detection of extracted penicillin V using HPLC.

The enzymatic transacylation reaction is effected in microtitre plates with the following mixture: 6-APA (2.5 mg/ml in the reaction buffer) 20 uI PaCoA (ca. 15-20 mg/ml in bidist. water) 30 #1 enzyme or reaction buffer (0.1 M phosphate 150 pi buffer pH 7.8 incl. 1 mM DTT) Immediately, or at various times within a one hour stationary incubation period, 20 p 1 of aliquot was respectively taken, then diluted in the same microtitre plate 1:5 with 50% aqueous ethanol stopping of the enzyme reaction) or 1:5 with 5 U/ml penicillinase -lactam control), and tested for penicillin V in the agar diffusion test on test plates which have been seeded with micrococcus luteus ATCC 9341 or twith the lactam-supersensitive strain pseudomonas aeruginosa BC 248 (seeding rate antibiotic medium 1 of DIFCO, 50 pl per well, incubation 15 hours at 37°C).

At various times, aliquots are taken from the enzymatic transacylation preparation (same mixture as above with 2 ml total voume), then extracted 1:1 with diisopropylether at pH 2.0 (HCI), I the organic phase evaporated off with nitrogen, the residue re- S suspended in the same volume of reaction buffer and tested for 'penicillin V by HPLC (conditions as for PaCoA content determination, but with an eluant of 40% methanol and 60% 0.01 M TBAS in 0.025 M phosphate buffer pH 1 1

F

S/*y 6

~I

Ui Ur 14 Retention times (min) phenoxyacetic acid penicilloic acid G penicilloic acid V penicillin G penicillin V 3-desacetoxycephalosporin V cephalosporin V 1.10 1.62 1.92 3.00 4.92 2.46 3.24 The other activities of the multispecific PAT enzyme may similarly be determined by HPLC, whereby 0.001 M TBAS in 0.025 M phosphate buffer pH 7.0 is used solely as the eluant for the orp polar substrates vesp- -products.

Retention times (min) isopenicillin N 6-APA DTT red.

DTT oxid.

1.67 4.00 2.41 4.60 Isopenicillin N can be recovered from precursorless penicillin fermentations using adsorber resin (DIAION HP 20) and reverse phase chromatography (Nucleosil C 18, 10 pm).

Depending on the enzyme preparation, attention must be paid especially to the choice of indicator reaction, with which the actual activity of the multispecific biosynthesis enzyme is to be detected. For example, it is not especially purposeful to use 6-APA-phenoxyacetyl-coenzyme A acyltransferase activity as the indicator reaction for PAT in the raw extract, since disturbing activities present in this raw enzyme preparation both rapidly hydrolyse phenoxyacetyl-coenzyme A PaCoA) and penicillin V, and also acylate 6-APA with the rich-in-energy side chain derivative PaCoA to penicillin V, which e.g. known proteolytic enzymes such as chymotrypsin catalyse. These interfering activities however are clearly differentiated from the actual thiol-dependent PAT. They have e.g. different chromatographic elution behaviour, stability profile and inhibition pattern.

I 7 These interfering disturbing activities explain on the one hand the very low specific PAT activity previously found in raw preparations (about 1-10 pU/mg protein), as well as similarly the discovery which appears as a paradox, that the 6-APA-PaCoA-acyltransferase activity in the raw extract increases greatly as enzyme dilution increases, up to a maximum activity. An essential factor in the detection of PAT is the presence of reducing compounds, such as dithiothreitol or 0-mercaptoethanol, which activate *.sep stabilise the highly oxidation-sensitive SH-enzyme.

The high instability to temperature of PAT similarly makes enzyme purification considerably more difficult. For example, a freshly i prepared enzyme preparation loses the entire thiol-dependent i 6-APA-PaCoA acyltransferase activity after one hour's stationary Sincubation at 370C, despite the presence of various stabilisers 5 mM dithiothreitol 5% sorbitol 0.1 mM phenylmethanesulphonyl fluoride). It is therefore fitting to carry out all purification work in a cooling laboratory at 4 0 C with protection against oxidation. Coarse, pre-purified enzyme solutions can be frozen (-196"C, -20°C) for several weeks in the presence of stabilisers without any noticeable loss of activity, whereby however several freeze-exchange steps immediately disactivate the PAT activity. Ammonium sulphate precipitates are similarly more or less stable for a few days resp. weeks at 40C in the presence of the said stabiliser mixture.

From young, penicillin-positive penicillin mycelium, the purification'process for PAT used in the invention yields, after mycelium decomposition, nucleic acid precipitation, protein precipitation, hydrophobic interaction- and affinitychromatography, relatively stable, at least 50% active, enzyme or preparations, as are necessary for enzyme-kinetic .ep. proteinchemical characterisation. Working up to a relatively storable protein precipitation may be carried out using conventional purification processes, e.g. by cell decomposition with a highy° g g s A Ar i~ V W/ 8 pressure homogenizer or glass ball-mill or nucleic acid precipitation with cetyltrimethylammonium bromide, streptomycin sulphate or protamine sulphate. For protein precipitation, ammonium sulphate is suitable, among others, whereby a saturation is sufficient to precipitate all the detectable PAT activity. Starting with the ammonium sulphate precipitate, the thiol-dependent PAT is bonded to phenylsepharose CI 4 B by hydrophobic interaction, and after removing over 90% of the ballast protein, the product is eluted with an aqueous stabiliser solution of low ion strength, concentrated by a 10kD cut off ultrafiltration membrane and further purified preferably by affinity chromatography or alternately by a gel filtration step (Ultrogel Aca 54) by anion exchanger chromatography (DEAEsepharose FF) or adsorption chromatography (hydroxylapatite) to form an at least 50% active enzyme preparation, which corresponds to a concentration factor of ca. 1000, based on the ammonium sulphate precipitate.

The usual macroporous carrier materials such as sepharose, cellulose, polymer materials, stabilised silica gel, aluminium oxide etc., may be used as the affinity matrix. Suitable affinity Sligands, which are bonded to the carrier by a C 2 to C10 spacer or without a spacer covalently or by hydrophobic, or ionogenic reciprocal action, are preferably acyl- or amino-$lactam compounds. Binding of these ligands to the spacer or the matrix must be effected such that the binding site at the ligand remains accessible to the enzyme to be purified. In accordance with the invention, an especially strong purifying effect is shown in particular by affinity matrices with terminal amino-spacers such as AH-sepharose 4 B or ,HMD-Ultrogel Aca 34, to which are bonded, by means of N-ethoxycarbonyl-2-ethoxy-l,2- Sdihydroquinoline (EEDQ), ligands such as natural penicillins, preferably 6-APA, penicillin V or penicillin G or 'analogous stable 3-desacetoxycephalosporin compounds such as 7-amino-3desacetoxycephalosporanic acid (7-ADCA) or '#-phenoxyacetamidoor 7-phenylacetamido-3-desacetoxycephalosporanic acid (3-des- _'ioo zB t :B -9acetoxycephalosporin V and Thus, the amino-o-lactam affinity matrices may be produced from the corresponding phenylacetamido- O-lactam matrices without expensive protecting-group technology with soluble penicillin G-acylase of E. coli.

The required microorganisms for enzyme production are cultivated in the usual nutrient media for penicillin formation. suitable constituents of nutrient media are all substrates which are generally employed for cultivating fungi. in addition to these nutrients, additives which promote growth of the microorganisms and increase PAT activity can be used in an appropriate combination. Additives are e.g. magnesium sulphate, sodium chloride, calcium carbonate, phosphates and similar inorganic salts, as well as growth substances, vitamins and trace elements.

By adding various inductors, preferably phenoxy- r~.e.'phenylacetic acid and their derivatives or analogues, the achieved enzyme titre can be considerably increased.

Culture takes place predominantly tebe-r-s-under aerobic conditions at a temperature in the range of 15 to 350C and at a pH value of between 4 and 8. The time taken for the culture broth to reach maximum enzyme activity depends on the type of microorganism used, and the optimum time for cultivation is therefore preferably evaluated separately for each individual strain. in general, the duration of cultivation ranges from preferably 2 to days. For transacylation, the culture broth ee an active secondary preparation prepared therefrom can be used. Examples of such active secondary preparations are the unmodified -*easp C,--C permeabilised cells which have been recovered from the culture broth and washed; cell-free extracts which are obtained by means of physical, chemical and enzymatic treatment of the mycelium (for example the cell homogenates which are obtained by decomposition or by ultrasound treatment of the mycelium, and cell lysates which are formed by treatment with surface-active substances or enzymes); partially or wholly purified preparations of the desired enzyme, which are obtained by purifying the cell-

RAI,

T

10 free extracts with the aid of conventional enzyme purification methods, for example by salting uut, by fractional precipitation, by dialysis, by gel filtration, by ion exchange-, adsorption- and affinity-chromatography; stabilised PAT preparations which are or obtained in such a way that the enzyme 49er. the unmodified -e ap.

permeabilised cells are immobilised either physically or chemically with high-molecular-weight carrier substances that are insoluble in water, by means of adsorption, covalent formation, cross-linking, enclosure or encapsulation.

or Enzymatic sapt physiochemical characterisation of the aboveresulting enzyme concentrates may take place using classic methods such as chromatography, electrophoresis, research regarding substrate specificity, N-terminal sequencing, pH and temperature profile for activity and stability, studies of activation, inhibition and stabilisation etc.

There exist numerous methods of isolating genes. A general review is given in the books of watson et al. (Rekombinierte DNA Eine Einfuhrung, Heidelberg, 1983) and Winnacker (Gene und Klone Eine Einfuhrung in die Gentechnologie, Weinheim, 1984). In the case of the pat-gene (gene for the enzyme PAT), it appears most significant to use synthetic DNA-probes, since the necessary amino acid sequences exist. A DNA sequence based on the genetic code can be derived from the amino acid sequence of polypeptide 1 of PAT, and the corresponding oligonucleotides can be chemically synthesized. Figure 5 shows the arrangement of the amino acid radicals 2 to 22 of polypeptide 1 of PAT. Since 2, 3, 4 or codons are assigned to a few amino acids, there results a nucleotide sequence as given under the amino acid sequence. The section which corresponds to amino acid residues 16 to 21 would be e.g.

especially suitable, since here only 16 different gene sequences are possible. These 16 oligonucleotides, which are complementary to the RNA, can be synthesized as four mixtures each with four oligonucleotides (oligonucleotide mixtures 1, 2, 3 and 4 in figure More certain identification of the gene is probably oy ofh"s""D""""el ra Xs X S The basic application efrred to in paragraph 3 of this Declaration were 4. The basic application. made in a Convention country in respect of the invention the subject the first application.......... mad n a of the application. day f November 1989 natu. Declared at Basle 9th Insert place and dte of ignatu. Declared at Basle IthiCHEMIE Gesellschaft o embe.

Signature of declarant(s) (no attestation required) Nota ti l 1 alterations. duly authorized signa ores DAVIES COLLISON, MELBOURNE and ANBERRA 11 not possible with these oligonucleotides, since further DNA sequences occur in the genom of penicillium chryscgenum, which are very similar to these DNA sequences. Differentiation between these varying DNA sequences can be very complicated. It is therefore advisable to have a further oligonucleotide available as a tracer sequence.

The strategy of isolating genes using DNA probes is discussed by Lathe Mol. Biol. 183, 1-12, 1985). Fo:: example, if information is known about the frequency of certain codons or certain dinucleotide series, a longer DNA sequence can be synthesized. For penicillium chrysogenum, such information is nc' available. In spite of this, in order to obtain a longer oligonucleotide as a probe, the available oligonucleotides can be used as a sequencing primer: the enzyme reverse transcriptase can synthesize a DNA stra:ad which is complementary to a given RNA, but only when a suitable starter molecule primer) is present.

In the case described, oligonucleotide mixtures 1 to 4 can be used as primer. It is thus possible to sequence only the pat mRNA, although numerous other mRNAs are present in the preparation. The sequencing reaction is carried out in the presence of base-specific chain-breaking reagents (dideoxynucleoside triphonphates). Thus, numerous extended oligonucleotides are produced, the gel-electrophoretic analysis of which allows the determination of the base series of a DNA which is complementary to the pat mRNA. The advantage of this method is th .t the sequence information obtained allows the direct synthesis of new oligonucleotides. In addition, it is very significant that this sequence must conform with the sequence which is derived from the amino acid sequence, and thus ensures that a pat-specific sequence does in fact exist.

The actual isolation of the gene may then be effected from a gene bank. A gene bank is a collection of recombinant DNA vectors which respectively contain a small part of the DNA of penicillium chrysogenum (in the case of a X-EMBL3 gene bank, this is ca.

I 110 120 ASPCyCysThrThrAlTyrCysGnLeuProAsnGlyAl&LeuClrly lnAsnT-P 130 AspPhePheSAlaTLhrLysGluAsnLCul leArgLuThrl leArClnAlaGlYL 150 160 proThrtleLysPhelleThrOluAIaGlyleleeGlYLYsalGlyPeAsnSerAla 170 180 GlyVal alvlAsnTyrAsnAalauMisLeuGInGlyLeuArgProThrGIyV&l

?T

/2 12 0.05% per recombinant molecule). By means of plaque hybridisation, X-clones can be isolated, and these hybridise with the radioactively labelled DNA probe. A physical map can be prepared from the DNA of these clones. Such a restriction map indicates the arrangement of restriction endonuclease intersection sites which may serve as an aid to orientation. Using DNA hybridisation techniques, it is possible to determine with which part region of the DNA the DNA probes hybridise. The corresponsing part fragments are incorporated into plasmid- or bacteriophage- vector molecules and further characterised by molecular-genetic methods.

Cloning of a DNA segment into the vector M13spl9 then allows the determination of the DNA sequence, whereby the pat-specific DNA probe can be used as primer. Further sequencing of the DNA enables the coding part of the gene and the amino acid sequence of PAT derived therefrom to be ascertained. The alreadydetermined amino acid part sequences may supply the required information.

Based on the DNA sequence information, the pat-Gen of penicillium chrysogenum can be incorporated into an expression vector, which allows good expression of the PAT into well known expression organisms (Reznikoff and Gold, Maximizing Gene Expression, Boston, 1986). So as to make precise construction possible, in which the ATG comes exactly into the position of the E.coli starting codon, a Ncol intersection site can be introduced by site directed mutagenesis. Prior to this however, a complete cDNA clone must be isolated from a corresponding gene bank. Example 19 (see also Fig. 7) describes the details of construction of the plasmid pBC2001. In order to do this, there is first of ll cloning of the DMA fragment from a pat-cDNA-clone into M13mpl9.

Thus, there is available a single-strand DNA which is used for the site directed mutagenesis to introduce the Ncol intersection site; in addition, a HindIII intersection site which is necessary for cloning. The plasmid pBC2001 is produced when the Ncol-Hind- III-fragment is incorporated into the vector pKK233-2. It contains effective signals for expression in E.coli (ptrc, 1 13 ernBTlT2) and an ampicillin-resistance gene (bla), as E.coli selection index.

The DNA of the pat-gene can be incorporated into vectors which permit transformation of penicillium chrysogenum or other 0-lactam-producing microorganisms. Since transformants frequently contain the introduced DNA in several copies Kolar et al.), stronger expression of the gene is possible, which can lead to increased penicillin formation. Example 20 describes the construction of the plasmid p8C2002, which can be used for the transformation of penicillium chrysogenum. pBC2002 (see also lis ze-n Fig. 8) contains the complete penicillium chrysogenum pat gene on a 4.8kb Sall restriction fragment, which has been incorporated into the modified vector pHS103. The phleomycin resistance gene (ble) allows selection in penicillium chrysogenum; the ampicillin resistance gene (bla) allows selection in E.coli.

Furthermore, manipulation of the DNA is possible. The exchange of promoter segments can similarly improve the transcription in penicillium chrysogenum. Site directed mutagenesis of the ATGs can increase the translation in penicillium chrysogenum. The exchange of special amino acid radicals by site directed or fragment specific undirected but gene-specific -mutagenesis make it possible to isolate special mutants which change the stability of the enzyme or its activity or specifity.

Screening of randomly or non-randomly selected microorganisms in which the DNA of such organisms is examined for specific hybridisation with radio-active pat DNA is also an obvious use of the isolated DNA segment. The result of such screening may be strains which previously produced unknown 0-lactams, or strains which contain the PAT-similar enzymes but have other properties.

The DNA of the present invention was isolated from penicillium chrysogenum. The procedure is described in examples 10 to 13 and is illustrated by figs. 4, 5 and 6. Starting from the aaino acid 14 sequence of polypeptide 1 of PAT (fig. four oligonucleotides were synthesized (fig. 5: oligonucleotide mixtures 1 to 4, fig. 6C), which are used as a sequencing primer (example 11). The first 29 bases of the sequence thus determined (fig. 6D) conform with the postulated pat mRNA sequence (fig. 6B). As a result of this information, a 30mer was synthesized (fig. 6E), which was used as a radioactive probe for isolating a X-clone from the penicillium chrysogenum gene bank (examples 12 and 13). After subcloning into M13 vectors, the DNA was sequenced (fig. 6F). The first 77 bases of this sequence conform with bases 35 to 111 of the sequence which is complementary to mRNA (fig. 6D). The connections between these individual sequences demonstrate that the pat-gene has in fact been isolated.

The PAT has a molecular weight of ca. 38,000 D. From an average amino acid molecular weight of 110 D, a size of 1100 bp can be estimated for the coding part of the gene. Since genes of filamentary fungi usually contain only few, and then small, introns (Ballance, Yeast 2,229 1986), it may be assumed that the complete gene lies on the described DNA molecule, and that control regions are similarly present in complete form.

The following examples illustrate the invention without limiting it. In the examples, the abbreviations ml 1, mg, g, rpm, DS, WV% and U stand for millilitres, litres, milligrams, grams, revolutions per minute, dry substance, weight/volume percent and international enzyme unit (1 international enzyme unit 1 puol substrate/min). The parts by weight are related to parts by volume as g to ml, the temperature is given in degrees celsius.

Characterisation of the products was carried out using the following techniques: high-power thin-layer chromatography (HPTLC), high-pressure liquid chromatography (HPLC), ultraviolet spectrophotometry infrared spectrometry (IR) and nuclear magnetic resonance (NMR). The numbers added to the strain names listed in the examples correspond to the registered strain symbols of thooe culture collections in which the strains are «-nrr- W M 15 I filed as such, e.g. for ATCC (American Type Culture Collection, Rockville, Maryland, USA).

Production and analysis of phenoxyacetyl-coenzyme A (PaCoA): Principle: coenzyme A phenoxyacetic acid chloride 4 PaCoA 901 mg of CoA are dissolved whilst cooling with ice in 15 ml of bidistilled water and set at pH 7.0 with sodium hydroxide (2.56 ml 1 N NaOC and 1.60 ml 0.5 N NaOH). Subsequently, a total of 235 mg of phenoxyacetic acid chloride are added in portions with vigorous stirring, and the pH value is kept at 7.0 (1.8 ml 1 N NaOH). After stirring for one hour whilst cooling with ice, the solution is extracted three times, each time with 40 ml of diethylether, at pH 2.0 (6 resp. 1 N HC1), then the aqueous phase is neutralised with NaOH, the residual ether is removed at room temperature in a rotary evaporator, the mixture is gassed for a short time with nitrogen, then diluted 1:50 with bidistilled water, made into ampoules in portions of 500 pl, and frozen in liquid nitrogen. Analysis is effected using HPLC, whireby phenylacetyl-coenzyme A (PeCoA) is used as the standard.

HPLC system: column: integrator: flow rate: detection: eluant: evaluation: sample 400 #g/ml PeCOA 200 HP 1090 Liquid Chromatogram (Hewlett Packard) Hypersil ODS 5 pm, C 18, 150x200 mm Model 3392 (Hewlett Packard) ATT 3 0.5 ml/min 230 nm 35% methanol 0.01 M tetrabutylammonius sulphate (TBAS) in 0.025 M phosphate buffer pH

I

4 I i retention time (min) 9.41 9.68 area 8466900 4105400 height 210692 107689 L seqence et o inexample16 that has the amino acd sequence set out ine S: The DNI.molecule may include nucleOtides 6 o 197, The DR& seISencee 262 to 436, 505 to 656 and 726 to 1436 of t s ence oerby t DX&AMolecule s~st out in example 15. p.f ably th oleul 0 1* 16 100 9.88 2092100 54990 PaCoA stock soln. 1:200 10.53 1966600 47737 PaCoA stock soln. 1:50 10.68 7850700 172983 PaCoA stock soln. 1:40 10.47 10389000 222475 Area integration 19.2 mg PaCoA/ml height evaluation 16.8 mg PaCoA/ml average value 4 18.0 mg PaCoA/ml Example 1: Preparation of the enzymatically active biomass: The contents of an ampoule with lyophilised spores of penicillium chrysogenum P2 ATCC 48271 are suspended in 8 ml of medium A (composition per litre: 15 g lactose, 0.11 g nitrogen from Cornsteep Liquor, 5 g Witte peptone, 4 g NaC1, 0.5 g MgSO 4 .7H 2 0, 0.6 g KH 2

PO

4 5 mg FeC1 3 .6H 2 0, 2 mg CuSO 4

.SHO

2 0, the total ad 1000 ml with distilled H 2 0, pH 4.85, sterilisation: 20 mins. at 1200). A 2 1 Erlenmeyer flask with 225 ml barley is seeded with 2 ml of this spore suspension. Prior to filling, the barley is washed with water until clear, left to swell in medium A for to 30 minutes, filtered over a sieve and dried for ca. one hour on filter paper, subsequently filled to 225 ml in a 2 1 Erlenmeyer flask, then sterilised three times at 1000 for ca. one hour at one-day intervals, and prior to seeding dried for 2 days at 40 to 450. After seeding with spores, the Erlenmeyer flask is shaken for a short time, then incubated for approximately 8 days at 24 1 and 60 10% relative humidity.

After this stationary incubation period, the fungi spores are resuspended for 3 to 5 minutes at 140 rpm with 250 ml 0.9% NaCl 0.1% Tween 80 on a vertical agitator. After the further addition of 250 ml 0.9% NaCl solution (without Tween 80), the spore suspension is sterilely decanted into a 1 1 seeding canister. I 2 1 Erlenmeyer flasks each with 200 ml medium B (composition per liter: 9 g potassium phenoxy acetate, 150 g lactose monohydrate, J 2.25 g nitrogen as pharmamedia, 10.5 g (NH 4 2

SO

4 4 g Na 2

SO

4 4)I _...jVVy V, uU, wUV). the attained coupling or a gene o a strong, optionally inducible promoter is known according to Pribnow, Biolog. Regulation and Development, Vol. 1, 231-277, Plenum Press No. 4 (Goldberger et al., 1979).

The PAT enzyme is thiol-dependent, highly unstable and slightly acidic. It is formed in increasing amounts 930225,q:\ oper\jmw,33626sub. 1,3 7 !i i q *j: 17 g KH 2

PO

4 10 ml animal oil (lard oil), 25 g CaCO 3 the total ad 1000 ml with distilled H 2 0; pH 6.5, sterilisation: 20 mins. at 1200) are each respectively seeded with 8 ml of this seeding material which can be stored at 4V for ca. one month, and then agitated for three days at 25 10 at 260 rpm. After this agitating incubation, 1820 g of enzymatically active biomass is harvested. The penicillin titre is 1.9 g penicillin V per litre pulp.

Example 2: Production of an enzymatically active raw enzyme preparation: 1786 g of moist mycelium 220 g DS), obtained in example 1, are resuspended in 3.5 1 0.1 M phosphate buffer pH 7.5 including 5 mM dithiothreitol (DTT), 0.1% Triton X 100 and 0.1 mM phenylmethanesulphonyl fluoride (PMSF), and homogenised continuously whilst cooling to 2/30 in a glass ball mill (600 ml steel miling container with 510 ml 500-750 pm glass pearls, rotary speed 2000 rpm, 0.1 mm friction gap width, flow rate 30 1/hour, forward motion 2 to return motion brine cooling with forward motion -20/8* and return motion The homogenate is subsequently centrifuged for 30 minutes at 15,000 rpm and at the supernatant mixed at 0* with 0.5 WV% cetyl trimethylammonium bromide (CTAB) and stirred for 30 minutes. The precipitated nucleic acid is separated by centrifugation (10 minutes, 15,000 rpm, the supernatant brought to 50 WV% saturation by adding solid ammonium suphate, and held at 4V over night in order to complete protein precipitation. The precipitate is then centrifuged, washed with cold saturated ammonium sulphate solution, and after adding 5 WV% sorbitol, 5 mM DTT, 2 mM EDTA and 0.1 mM PMSF, is stored at 4' until the next chromatograp"v step. Decomposition seepi the two precipitation steps take place using protein determination (Bradford) activity determination (microbiological detection of 6-APA-PaCoA-acyltransferase activity with the lactam-supersensitive strain pseudomonas aeruginosa BC 248). The values found are listed in Table 1.

re 7? 1'

N

'AV

u eaLcln V by microbiological agar diffusion test with specifically product-sensitive test strains, e.g.

i I I c r ii 1 i. h C P 5~ r 18 970-9757/WA Example 3: Microbiological detection of transacylation activity or penicillin V cleavage activity in the enzyme preparation AA-precipitate with or without the addition of inhibitors: The raw enzyme preparation produced as described in example 2 is tested as follows in the microbiological agar diffusion test for transacylation of 6-APA or isopenicillin N with PaCoA and cleavage of potassium penicillin V with or .without the addition of an inhibitor: test organism: test medium: test plate: sample: incubation: enzyme: RP Z: micrococcus luteus ATCC 9341/BC 85, 0.5% seeding antibiotic medium 1 (DIFCO), 110 ml Nunc 243x243x18 mm 50 pj per well (6 mm diameter) 370, 15 hours AA-precipitate (produced as described in example 1 ml centrifuged (20,000 rpm/10 mins.), supernatant discarded, pellet resuspended in 20 ml RP Z.

0.1 M phosphate buffer pH 7.5 1 mM DTT 10 mM MgC12 Cl IL c CC

C

A. Transacylation/acylation Preparation in microtitre plates: substrate 6-APA or isopenicillin N (2.5 mg/ml) PaCoA (ca. 15 mg/ml) enzyme resp. RP Z with or without inhibitor 10 ul 15 ul 75 jul Inhibitor: a) without inhibitor control) b) 2 mM iodoacetamide c) 2 mM PMSF Immediately and or after 7, 30 and 60 minutes incubation time, 20 pl aliquots are taken from the preparations, diluted with 50% ethanol (enzyme reaction stops) and tested for penicillin content in the agar diffusion test.

i i 19 Transacylation of isopenicillin N 28 36) with PaCoA (HH 0 Mm) Isopeni- a) b) c clln N cs 7' 30' 60' s 7' 30' 60' a 7' 30' No. 28 22.5 25.5 26.0 23,0 21.1 20.8 18.3 14.7 22.7 24.7 25.7 20.7 N0. 36 27.0 28.3 30.8 28.7 25.2 25.0 23.8 22.1 26.3 27.2 27.7 26.7 Isope.cln N h tV/mi Penicn V h Pl/r 25 12.5 20 1.5 1.0 0.5 0.25 No. 28 20 16,5 12.4 25.3 24.0 21.7 17.8 9.7 No. 36 24.5 22.1 18.4 Acylation of 6-APA with PaCoA in dependence on e'nzyme dilution 1:10 1:50 1:100 7' 30' 80' u 7' 30' 60' 30' 60' s 7' 30' 18.3 24,4 24.3 15.7 18.6 25.4 28.5 25.4 1.0 24.2 30.7 30.7 14.5 21.3 26.7 27.0 1:500 1:1000 Penlcn v h ui/md 7' 30' 60' 7' 30' 60' 2.0 1.5 1.0 0.5 0.26 14.8 17.8 20,6 22.8 0 9.6 10.5 11.1 25.3 24.0 21.7 17.8 9.7 B. Penicillin V cleavage Preparation in microtitre plates: potassium penicillin V 100 ug/ml 0.1 M phosphate buffer pH 7.5 15 ul or enzyme 4 c.se. RP Z inhibitor) 75 p1l a) without inhibitor control) b) 2 mM iodoacetamide c) 2 mM ethylmaleinimide d) 2 mM PMSF e) RP Z Cleavage of potassium penicillin V (NH 0 mm) in the presence of various inhibitors a) b) cl d) a 7' 30' 60' 7' 30' Y 7' 30' 60' a 7' 30' 25.7 218 0 0 25.7 23,1 0 0 25.0 23.0 0 0 25.3 0 0 0 PA-ss.PnicWi v h pai/rd -roAssacyfc.ho fo" Loa0rIoA a 7' 30' 60' 2.0 1,5 1.0 0.5 0.25 6-APA PaCoA-* 7' 30' 26.8 25.8 26.2 26.4 27,4 24.7 23.4 18.4 11.9 17.0 23.2 26.9 Z5.9 et gNT Joe 'i r:r i:lr-. i: 20 Example 4: Activation, inhibition, stabilisation and pH profile of PAT: The PAT-ammonium sulphate precipitate produced as described in example 2 is diluted 1:10 with 0.1 M reaction buffer, in the presence of various activators resp. inhibitors or stabilisers, and tested for 6-APA-PaCoA acyltransferase activity immediately or orsfwep after one-day incubation at 40 ~spj 2 0° in the microbiological test model. The results are summarised in Table 2.

Example 5: Temperature stability of PAT: The PAT-ammonium sulphate precipitate produced as described in example 2 is diluted 1:20 with 0.1 M phosphate buffer pH or including l|r-espr10 mM DTT, then rigorously centrifuged, the supernatant undergoes stationary incubation at -1960, +200 and +370, and is tested for 6-APA-PaCoA acyltransferase activity immediately rasp-,after 1, 4, 26 and 120 hours in the microbiological test model. The results are listed in Table 3.

Example 6: Purification of PAT by means of hydrophobic interaction chromatography on phenyl sepharose C1-4B (HIC flow) and affinity chromatography on 6-APA-AB-sepharose 4 B (affinity flow): i 240 g of the ammonium sulphate precipitation obtained as described in example 2 are dissolved i.i 2000 ml of 50 mM phosphate buffer pH 7.5 including 1 M (NH 4 2

SO

4 and 1 mM DTT, and added in a laboratory cooling chamber at +40 to a BP 113-column with 200 ml equilibriated phenyl sepharose C1-4B. The column is subsequently washed at a flow rate of 50 ml/min with 3 base volumes of 50 mM phosphate buffer pH 7.5 including 1 M (NH 4 2

SO

4 and 1 mM DTT, then the ballast protein is removed with a further 2 base volumes of 50 mM phosphate buffer pH 7.5 including 1 mM DTT, then the PAT-enzyme is eluted with 3 base volumes of deionised water (E-H 2 0) including 1 mM DTT, the active fractions

UC

i 21 are concentrated to a tenth of the volume in a Pellicon cassette system using a polysulphone ultrafiltration membrane with a cut off of 10 kD, stabilised with 1 WV% sorbitol, 5 mM DTT, 2 mM EDTA and 0.1 mM PMSF and frozen at -200 until the next chromatography step. The microbiologically established 6-APA-PaCoA-acyltransferase activity and the total protein content of the individual fractions comprising one base volume are summarised in the following table: Mobiologica PAT4cMty m H aM'PC ot Pseudomons Warugnos DC 248 H29( protlSrdOad I I(m I IHsade I soma I so mln 1 1 Penase r: 19R 4 24 5483 PL 150/1 17 is 0 230 PL 150/2 1 Is 0 1o2 PL 150/3 14 15 0 98 PL 150/4 0 0 0 2750 PL 150/S 0 0 0 390 PL 150/4 h-avc 15 0 52 P% 1501 it 0 Us PL 150/ 0 0 0 M The active retentate of the HIC fraction is thawed under careful conditions on the next day and added to a K 26/40 Pharmacia column with 50 ml affinity matrix 6-APA-AH-sepharose 4 B, which was produced by coupling penicillin G to AH-sepharose 48 (Pharmacia) with EEDQ according to the LKB-record "Practical guide for use in affinity chromatography and related techniques", Reactifs IBF-Societe Chimique Pointet-Girard, France 1933, page 133, and by subsequently cleaving the phenylacetic acid with soluble penicillin G-amidase of E.coli. The column is then eluted at 40 at a flow rate of 3 mi/min. with the following media: AL 278/1: 12 base volumes 50 mM phosphate buffer pH 7.5 1 mM DTT 0.1 M NaC1 AL 278/2: 3 base volumes of the same buffer 1 mM DTT 0.1 M NaCl 1 mM 6-APA AL 278/3: 6 base volumes of the same buffer 1 mM DTT 1 M NaC1 22 1 mM 6-APA PAT activity eluted in fraction 278/2 with the specific eluant 6-APA is concentrated to one tenth of the volume in the Minitan cassette system using a polysulphone-UF-membrane with a cut off of 10 kD, mixed again with the stability mixture 1 WV% sorbitol, mM DTT, 2 mM EDTA and 0.1 mM PMSF, and deep-frozen in portions.

The substrate specifity of this enzyme preparation which is at least 50% pure, determined by HPLC, is recorded in Table 4.

Example 7: Chromatofocussing of the PAT enzyme preparation produced by affinity chromatography on Mono P/Pharmacia (Chromatofocussing AL 310); A L ml portion of the PAT enzyme preparation, which is purified as.described in example 6 by means of affinity chromatography and concentrated, is thawed carefully, then undergoes buffer exchange over an equilbriated PD 10 sephadex G 25 finished column for mM bis tris/HC1 buffer pH 6.3, is then added to a 4 ml FPLC Mono P finished column which is equilibriated with the same buffer, subsequently immediately eluted at a flow rate of 60 ml/hour with 100 ml of a 1:10 diluted polybuffer 74 set at pH 4.0, then fractionated peak-wise and the fractions undergo analysis, either in original form or aqp, concentrated ten times by Centricon by means of RPC, SDS-gradient polyacrylamide gel electrophoresis, isoelectric focussing based on immobiline, and gel filtration.

Fig. 1 shows the elution profile of the PAT-enzyme on the Mono P.

The multifunctional enzyme is split into at least three isoelectric forms (PAT 310/3, PAT 310/4 and PAT 310/5). These enzyme variants with different charges may illustrate either true isoenzymes or different redox forms of the same enzyme.

As can be seen from Fig. 2, the thiol-dependent PAT of penicillium chrysogenum breaks down under the denaturizing conditions of APC (column Biorad Hi Pore RP 304 250x4.6 mm; 1 i. |g^H l 23 HPLC-parameters: 0.5 ml/min, 45 bar, 280 nm, 400, 25#1 injection volume; linear gradient between eluant A: 35% aqueous acetonitrile with 0.01% trifluoroaetic acid and eluant B: 80% aqueous acetonitrile with 0.01% trifluoroaetic acid, 30 minutes) into one polypeptide 1, and depending on the iso- 'or ,':edox-variant, into one or *two variably hydrophobic polypeptide variants 2a and 2b.

In SDS-gradient polyacrylamide gel electrophoresis (see Fig. 3a, conditions according to Laemmli, Nature 227, 680-685, 1970; however gradient gel with 8-20% the PAT-enzyme breaks down into two polypeptides of varying size, with MW of about 30 and 8 kD. Using RPC and subsequent SDS-gradient-PAGE, it may be demonstrated that polypeptide 1 firstly eluted in the RPC is identical with the ca. 30 kD component, and the two stronger retained, hydrophobic polypeptides 2a and 2b are identical with the 8 kD component. Such multidimensional analysis may further show that the small polypeptides 2a and 2b on the SDS-gradient- PAGE have the same migration, while the larger, ca. 30 kD polypeptide 1 of the basic iso- or redox-variant migrates more .quickly than the corresponding polypeptide 1 of the more acidic form.

During the isoelectric focussing (IEF) based on ampholine (see fig. 3b, methodic execution according to LKB Application Note 1804), the active affinity pool shows three bands lying close together with an isoelectric point at 5.1.

In the narrow pH range of the highly solvent IEF based on immobiline (see fig. 3c, methodic execution according to LKB 'Application Note 1819), the PAT-variants separated by chromatofocussing have pi-values of 5.15, 5.06 and 5.32.

When determining the MW by gel filtration, on Superose 12 of Pharmacia (eluant: 0.1 M phosphate buffer, pH 7.5 including 1 mM DTT, 0.4 ml/min) a MW of 36.5 kD is determined, or .on the TKS-

:I

,y fr W i I:il-- L I i~i 24 G2000 SW of LKB (the same eluant with 0.5 ml/min) a MW of 38 kD is determined, which correlates well with the sum of the two denaturizing polypeptides 1 and 2.

Example 8: N-terminal sequencing of polypeptides 1 and 2a, as well as 2b: A further portion (2 mg protein) of the PAT-enzyme preparation, which is purified by affinity chromatography as described in example 6, is separated twice by RPC after careful thawing (the same column and conditions as given in example 7, but with a flatter increasing gradient: min/% B 0/0, 8/0, 20/12, 25/12, 30/100, 33/100, 36/0, 40/0), the fractions lyophilised with polypeptides 1, as well as 2a and 2b, and N-terminal sequenced in the protein-sequenator. Under the denaturising conditions of RPC or SDS-gradient- PAGE the native PAT enzyme is broken down into two polypeptides of varying size: polypeptide 1 with the amino acid sequence 1 and molecular weight of about 30 kD (SDS-PAGE) and polypeptide 2 with the amino acid sequence 6 with the molecular weight of about 8 kD (see fig. 2 and Both polypeptides are characterized by amino acid sequence date I I

CIIII

i S CI It *I CI

C

I I I t I I Polypeptide 1 Poiypeptide 2 N-terminal amino acid sequence 1, MW (SDS-PAGE): ca. 30 .kD, amino acid sequence Cys 103-Leu 357 N-terminal amino acid sequence 6, MW (SDS-PAGE): ca. 8 kD, amino acid sequence Met 1-Gly 102 The protein subunits are sequenced to provide information to enable the design of probes for use in the selection and cloning of the DNA sequences encoding PAT.

Once cloned, the gene can be expressed in a host cell such that penicillin is produced by the cell.

-24A- N-terminal amino acid sequence: kD unit polypeptide 1: part sequence 1 1 5 10 1s52 Thr-Thr-Ala-Ty:'--Cys-GIn-Leu.Pfo-Asn-Gy-Ala-Lu-Gn-Gly-Gln-Aan-Trp-Asp- he.

30 35 37 Phfp-Ser-Ala-Thr-LysGu-Asn-Lue-Arg---_-__-Glrn---Gly- 8 kD unit I polypeptide 2a: part sequence 6 1 5 10 is Met-Lou-His-li -Lou-Cys-Gln-G y-Thr-3ro-Phe lu--lle-Gty-Tyr-Giu-Hls-Gty-Ser-Ala- 30 14 Ate-Lys-Ala-VaHle-Aa-Arg-Ser-Ile-Asp-Phe-Ala-VaI-Asp- 8 kD unit 11 polypeptid. 2b: part sequence 6 10 i5 Met-Lou-His-l-Leu-Cys-Gln-Gly-Thr-Pro-Ph-Gu-41o-ey-Tyr-Glu-Hlsu-Gly-Sor-Afa- 30 35 Aa-Lys--VaI-4le-Ala-Ar-_-Il-Asp-Pho-Aia-VaI-Asp-Leu-_:-_-Gy--.Thr- As in the SDS-gradient-PAGE, the small popypeptides 2a and 2b which have differing retention in the RPC are not differentiated in the sequenced molecule section.

(tit 4 1 L t C A -970-9757/WA Example 9: Sequencing of proteolytic peptide fragments of polypeptide 1 and 2: A lyophilised fraction of polypeptide 1 or 2 which is produced as described in example 8 is enzymatically cleaved according to J.M.Wilkinson (Practical Protein Chemistry A Handbook, edited by A.Darbre, 1986) with trypsin, or -lysyl-endopeptidase, individual peptide fragments are isolated by RPC and sequenced in the protein-sequenator. The following amino acid (AA) partial sequences (AA-part) are obtained, among others: AA--part sequence 2 (tryptic peptide fragment of polypeptide 1): 1 5 10 13 Gly-Ala-Thr-Leu-Phe-Asn-Ile-Ile-Tyr-Asp-iis-Ala-Arg- AA-part sequence 3 (tryptic peptide fragment of polypeptide 1): 1 5 P ro-Thr-Asn-Pro-Asp-Glu-Met-Phe-Val-Met-Arg AA-part sequence 4 (tryptic peptide fragment of polypeptide 1): 1 5 Glu-Leu-Asp-Pro-Leu-Pro-Asp-Se r-Trp-Asn-Arg AA-part sequence 5 (tryptic peptide fragment of polypeptide 1): 1 5 Met-Glu-Phe-Leu-_-Asp-Gly-Phe-Asp-Gly-Thr-Lys ~*.*AA-part sequence 7 (tryptic peptide fragment of polypeptide 1): 10 14 i. .:Ile-Ala-Leu-Glu-Ser-Thr-Ser-Pro-Ser-Gln-Ala-Tyr-Asp-Arg AA-part sequence 8 (tryptic peptide fragment~ of polypeptide 1): *~Val-Gly-Phe-Asn-Ser-Ala-Gly-Val-Ala-Val-Asn-Tyr-Asn-Ala-Leu-His 25 10 Leu-Gln-Gly-Leu-Arg-Pro-Tnr-Gliy-Va.l-Pro-Ser-His-Ile-Ala-Leu-Arg AA-artsequence 9(tryptic peptide fragment of polypeptide 2): 1~ 5 8 as Thr-Glu-Phe-Ala-Tyr-Gly-Leu-Lys Ai 0N 26 6 -970-9757/WA AA-part sequence 10 (tryptic peptide 1 Tyr-Tyr-_-Glu-Ile-Arg AA-part sequence 11 (tryptic peptide fragment of polypeptide 2): fragment of polypeptide 2): Trp-Pro-Lys AA-part sequence 12 (tryptic peptide fragment 1 5 Se r-Ile-Asp-Phe-Ala-Val-Asp--Leu-Ile-Arg AA-part sequence 13 (tryptic peptide fragment 1 5 Asp-Val-Se r-Glu-Ile-Val-Met-Leu-Asn-Thr-Arg AA-part sequence 14 (tryptic peptide fragment of polypeptide 2): of polypeptide 2): of polypeptide 2):

I

I

PT

t

CC

II

A.

CC

4 4.

Gin-Va 1-Leu-Se r-Gln-Leu-Gly-Arg AA-part sequence 15 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 1 Cys-Gln-Gly-Thr-P ro-Phe-Glu AA-part sequence 16 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 1 5 Tyr-Tyr-Glu-Glu-Ile-Arg-Gly-I le-Ala-Lys AA-part sequence 17 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 1 5 10. Gln-Val-Leu-Ser-Gln-Leu-Gly-Arg-Val-Ile-Glu-Glu-Arg-_-Pro-Lys AA-part sequence 18 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 1 5 10 Gly-Ala-Glu-Arg-Asp-Val-Ser-Glu-Ile-Val-Met-Leu-Asn-Thr-Arg AA-part sequence 19 (trypti c peptide fragment of polypeptide 2): Ala-Val-Ile-Ala-Arg (HPTLC), high-pressure liquid chromatography (HPLC), ultraviolet spectrophotometry infrared spectrometry (IR) and nuclear magnetic resonance (NMR). The numbers added to the strain names listed in the examples correspond to the registered strain symbols of thoce culture collections in which the strains are 27 970-9757/WA AA-part sequence 20 (tryptic peptide fragment of polypeptide 2): 1 Lys-Thr-Asp-Glu-Glu-Leu-Lys AA-part sequence 21 (tryptic peptide fragment of polypeptide 2): 1 4 Gly-Ile-Ala-Lys AA-part sequence 22 (tryptic peptide fragment of polypeptide 2): 1 Val-Ile-Glu-Glu-Arg AA-part sequence 23 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 1 5 Asn-Thr- -Thr-Glu-Phe-Ala-Tyr-Gly-Leu-Lys AA-part sequence 24 (tryptic peptide fragment of polypeptide 2): 1 3 Ala-Ala-Arg Example 10: Isolation of poly(A)+RNA from mycelium of Penicillium chrysogenum: A spore suspension of Penicillium chrysogenum P2/ATCC 48271 is incubated in an agitator at 250 rpm for about 70 hours at 250 in Erlenmeyer flasks (each of 1000 ml) each containing 100 ml of CDS-medium (for 1 1 CDS-medium, in accordance with autoclave treatment, there are mixed: 900 ml solution A: 3 g NaNO 3 0.5 g MgSO 4 .7H 2 0, 0.5 g KC1, 0.1 g FeSO 4 .2H 2 0, 5 g yeast extract, 10 g casein peptone, 20 g saccharose, pH 5.8 and 100 ml solution B: 250 mM K 2

HPO

4

/KH

2

PO

4 pH 12 Erlenmeyer flasks (each of 1000 Sml) each containing 300 ml CDLP-medium (composition as CDSmedium, but instead of 20 g saccharose, 150 g lactose/l and 50 ml 10% phenoxyacetic acid [dissolved in water, pH 7.5 set with KOH]) W are each seeded with 30 ml of the preculture and incubated in the agitator at 250 rpm for 40 hours at 250. The mycelium is filtered using a Buchner funnel, washed briefly with TE (10 mM tris/HCl, pH 8.1, 1 mM EDTA) and pulverised in liquid nitrogen to a fine powder. This powder is suspended in lysis buffer (5 M guanidine 28 monothiocyanate, 10 mM EDTA, 50 mM tris/HCl, pH 7.5, 8% 0-mercaptoethanol) (3 ml lysis buffer per g moist mycelium mass) and stirred for 1 hour at room temperature. Isolation of the total RNA takes place according to a described method (Cathala et al., DNA 2, 329-335, 1983). 60 g of moist mycelium mass enables about 18 g of raw-RNA to be isolated. This is precipitated with ethanol and stored at -700. Concentration of the poly(A) RNA takes place by means of oligo (dT) cellulose-affinity chromatography, as is described in Maniatis et al., Molecular Cloning, Cold Spring Harbor, 1982. For this purpose, the raw-RNA is centrifuged, dried and dissolved in water. After chromatography, fractions containing the poly(A) RNA are again precipitated with ethanol and stored at -700. The soundness of the poly(A)+RNA is tested by gel electrophoresis in the presence of glyoxal (Maniatis et and the concentration by UV-absorption.

Example 11: Partial sequencing of RNA coding for the enzyme PAT: On the basis of the genetic code, a DNA-sequence is derived from the amino acid sequence of polypeptia 1 of PAT (example 8) (fig. A range of 17 bp, which allows a minimum number of different sequences, is selected for the synthesis of oligonucleotide mixtures. 4 mixtures of 4 different oligonucleotides, which are complementary to the intended strand and thus also to the RNA, are synthesized (oligonucleotide mixtures 1, 2, 3 and 4 in fig. These oligonucleotides are enzymatically phosphorylated and thus radioactively labelled (Maniatis et al).

150 ng oligonucleotides are incubated with 16 units of polynucleotide kinase for 30 minutes at 37°, in 12 p1 reaction preparation (50 mM tris/HCl, pH 9.5, 10 mM MgCl 2 5 mM DTE, glycerol) with 250 pCi ATP (Amersham PB 10218). 10 pg of the poly(A) RNA (example 10) in 250 mM KC1, 10 mM tris/HCl, pH 8.3 are mixed with 2 p# 32-P-labelled oligonucleotide mixture in a ml reaction container. The mixture is heated for 2 minutes to 750 and then warmed for 45 minutes at 50. To each of 4 Eppendorf containers are added 3.3 pl reaction buffer (24 mM tris/HCl, pH

I

29 8.3, 16 mM MgC1 2 8 mM DTE, 0.4 mM dATP, 0.8 mM dGTP, 0.4 mM dCTP, 0.4 mM dTTP, 6 units reverse transcriptase and in addition each has 1 p# 1 mM dATP or 1 p# 1 mM dGTP or 1 p 1 1 mM dCTP or 1 #l 1 mM dTTP. After the addition of 2 1p poly(A)+RNA-oligonucleotide mixture, the contents of the Eppendorf container are centrifuged for a short time and heated for 45 minutes at The reaction is terminated by adding 2 p# stop-buffer (99% formamide, 0.3% bromophenol blue, 0.3% xylene-cyanol) and boiling for three minutes. 4 pl of each sample ir applied to a 8% polyacrylamide/urea gel and opened up for 2.5 hours at 40 W (Sequi Gen, Biorad). Thereafter, the gel is placed for 20 minutes in methanol, 5% acetic acid, and dried for 1 hour at 800. The cooled gel is wrapped in domestic foil. An X-ray film (Kodak XOmat AR) is applied for 20 hours. The sequence that can be read from this X-ray film is reproduced: 20 30 40 50 -CCATTrrTAATGACAATAGGACTOGTGCATCATCOCroCTrCACCCCTAT 80 90 100 110 OCAAATTCCGTOCGOGTATTAAGCATGACAATCTCGGAGACATCGCGICA-3' Positions 1 to 29 are complementary to the DNA-sequence, which is derived from the amino acid sequence of polypeptide 1 of the PAT (fig. 5, 6D). An oligonucleotide which embraces the first nucleotides of this sequence is synthesized.

Example 12: Construction of a genomic gene bank of penicilliu chrysogenua: DNA is isolated from the mycelium of a penicillium chrysogenum culture (example 10) washed in CDS-medium. The mycelium is pulverised in liquid nitrogen, then added to 1% sarcosyl, 0.1 M .i EDTA, pH 8, 100 #g proteinase K/ml (1 g mycelium/25 ml) and agitated for 48 hours at 37'. The mixture is extracted three times with phenol, and after adding 0.1 parts by volume of 3 M I sodium acetate pH 5.2, is precipitated with ethanol. CsCl-EtBr jcentrifugation is subsequently carried out (Raniatis et and after extraction with isoamylalcohol and dialysis on TE, the t 30 concentration is determined by UV absorption. In addition, the DNA is tested by agarose-gelelectrophoresis. 300 mg penicillium chrysogenum DNA is cleaved in 5 U Sau3A (BRL) for 60 minutes at 370 in 10 mM tris/HCl, pH 7.5, 10 mM MgC1 2 1 mM DTE, 50 mM NaC1.

The extent of cleavage is tested on agarose-gel. It is desirable for a large part of the DNA to be of the size between 10 and kb. The DNA is then applied to two NaCl gradients (produced by freezing and then thawing 2 Beckmann-SW28.1 ultracentrifuging tubes with 20% NaC1 in TE [10 mM tris/HCl, pH 8.0, 1 mM EDTA]) and is centrifuged for 16 hours at 14,000 rpm in the ultracentrifuge in the rotor SW 28.1. The contents of the tube are fractionated. Fractions with DNA greater than 10 kb are combined and dialysed on TE. After concentrating the DNA (500 it is purified with X-EMBL3-DNA (Frischhauf et al., J.Mol.Biol. 170, 827-832, 1983) which has been cleaved with BamHl and EcoRl. After adding 0.5 U T4-DNA-ligase, it is then ligated over night at 16" in 30 mM tris/HCl, pH 7.5, 10 mM MgC1 2 10 aM DTE, 2.5 mM ATP (DNA concentration 200 ug/ml, vector to penicillium chrysogenum- DNA in molar ratio The ligation mixture is packed in vitro with the assistance of protein extracts ("packaging mixes", Maniatis et The resultant X-lysates are titrated on the indicator strain NM539 (Frischhauf et 106 pfu are obtained.

Example 13: Isolation of X-clones which hybridise with a PATspecific oligonucleotide: 40,000 recombinant phages of the penicillius chrysogenum gene 4 bank in X-EMBL3 (example 12), with the strain NM538 (Frischhauf et al.) are discharged onto 90 mm TB-plates in 0.7% agarose (TB medium contains 10 g bacto-trypton and 5 g NaCl per litre, the pH of 7.5 is set with NaOH). Two impressions of these plates are made on nylon filter (Amersham Hybond N-filter). After UV-fixing of the DNA, these filters are used for hybridisation. The described in example 11, whose sequence is complementary to the DNA-sequence which is from the amino acid sequence of polypeptide 1 of the PAT, is radioactively labelled (T4-polynucleotide-kinase 4 -31reaction as in example 11). Hybridisation is carried out for about 20 hours at 370 in 6XSSPE (lXSSPE is 0.15 11 NaCI, 10 mm NaH 2 PO 4 1 mN EDTA, pH 30% formamide, 5x Denhard, 0.1% SOS, 100 pg/mi herring sperm DNA, 0.1 mM ATP, 3 ng/al 32-P-labelled oligonucleotide. The filters are then washed three times for minutes at room temperature in 2xSCC (lxSCC is 0.3 M NaCl, 0.03 M sodium *citrate, pH 0.1% SDS, and then three times for 20 minutes at 560 in lxSCC, 0.1% SOS, and after drying are autoradiographed. Regions in the agarose layer of the original plate, which correspond to positive hybridisation signals on the X-ray film, are taken out with a sterile Pasteur pipette and resuspended in SM-buffer (5.8 g NaCi, 2 g M1gS0 4 *7B 0 and 50 ml 1 m1 tris/HCl, pH An appropriate dilution with NM 538 as indicator strain is again discharged onto TB-plates. The phages on these plates are transferred onto nylon filter and hybridised as described above. The corresponding recombinant X-phages arek isolated from plaques which give positive signals for the second time. The purified DNA of these phages is used for restriction analysis and southern hybridis~ation. In'addition, subcloning is carried out in plasmids (pUC 12, Messing, Methods Enzymol. 101, 1983) and 113-vectors (Ml3mpl8, 1113mp19, Norrander et al., Gene 26, 101, 1983). Sequencing of a Ml3mpl9-subclone with the oligonucleotide gives the following sequence: 20 30 40 -CATCACOGG~CTCCTrGACCCGTATOCAATrCCoroCGcoTArAoC 70 so 90 100 ATCACAATCTCOGAGACATCGCOTTC -,cCCcTIrGAATACCTGGTrr 110 120 130 140 150 i TrcCCCCTcATCOTCACCATTOTacAGAAAATTACAAAGACCAA 160 170 180 190 200 CGGCACTCACCGCO&AATCTCCTCQTAGTATrrGOCATC1rrrCCMGATC-*3' NUCleotides 35 to 111 of the DNA sequence, which were ascertained using RNA (example 11), conform with nucleotides 1 to 77 of this DNA sequence (fig. 6F).

-32 Example 14: DNA sequence of the PAT gene: in fig. 4, the position of this DNA sequence is marked by two horizontal lines 1 corresponding to the first nucleotide and 1972 to the last.

20 30 40 so 60 GTTOATOTCCCATCAOTG;TCATGCTATGGTCCCAGATTGTGCrACOCTATAMTCTCAATOCcA 90 100 110 120 130 140 GCCCTOCATGATCATCCCCAOOACOCCOOncArTCOTCA=cAOOC=AGrrACCC 150 160 170 180 190 200 210 ATCTTCCOACCCGCAGCAOAAATGCTTCACATCCTCTOTCAAOOCACTCcC TrGAAOTAAGOTCCTOCAC 220 230 240 250 260 270 280 :CAATACCACATTrT=CCTTCTAATCTTCCATTCTCACCTATCCAATCOCACC-AACATOCT= 290 300 310 320 330 340 350

CTCCTCCAAACCGTCATAOCCAGAACATTCACTCCCTCATCTCATCCAGCAAAACAAGAA

380 370 380 390 400 410 420 GACC0ACGAACACTM=ACA0TACTCIC0CAACTCO0CGT GAAAOCCCAATAC 430 440 450, 460 470 480 490k TACiGAGAATCOCCOTGAOTrOCCACTTCCGTCTTCCTACATTCTOACCAATGCTACCOATAC 500 510 520 530 540 550 500 570 580 590 800 610 20 630 ACOC.AATTTGCATACOGCTCAAC00CA0CCCGTGATGCCACCACTOCCTAITCAACrrCCAMATG 640 650 660 670 680 690 700 GAaCC CAGGGCCAACTOATTACGTrToAGATTACCTTcCATTrrTCCATCoT 710 720 730 740 750 760 770 OCGCCCACTAA7TTVOTTGTTCAAUL a aa.. C=CACCAMAOAAACCTATCCGrAACOATCCGT 780 790 800 810 820 830 840 CAGGCCOACTCCC*CCATCLAATCATAACCAC?0CAATCATC0MGCr0CATrAACA0TO 850 860 870 880 890 900 910 CCGOTCGCCOTCAATTACAACOCCCTTCACCTTCAACGTCTTCGACCCACCOOAOTICrCGCATAT 920 930 940 950 960 970 TGCCCTCCrGCATA0C0CTC0u~AA0CACLLCTCCTCCCAGCCTATACCOATC~r0GACAAGGCC0A 990 1000 1010 1020 1030 1040 1050 ATOCGCCCAGCOCrrrTATCATGTGCAATGGOCACGOCATrrCGQITYCAAATCTCCCCACCA -33 970-9757/WA 1060 1070 1080 1090 1100 1110 1120

GCATCCGMAAGCAGGTGCTCGACGCGAATGGTAGGATOGTGCACAOCAACCACTGCITTCTTCAOCACGO

1130 1140 1150 1160 1170 1180 1190 CAAAAATGAGAAAGAGCTCGATCCCTTAccGGACTCATGOAATCGCCACCAGCGTATGGAGTTcCTCCTC 1200 1210 1220 1230 1240 1250 1260 GACGGGTTCOACGGCACCAAACAGCICA'rrTCCCAGCTCTGGGCCGACOAAGACAAI-TATCCCTI-AGCA 1270 1280 1290 1300 1310 1320 1330 TCTGCCGCGCTTACGAGGAOGGCAAGAGCAGAGGcGCGACTCTG'rrCAATATCATCTAOGACCATGCCCG 1340 1350 1360 1370 1380 1390 1400 TAGAGAGGCAACGGTGCGGCTrGGC CGGCCGACCAACCCTGATOAGATG=TGTCATGCGG11'ACGAG 1410 1420 1430 1440 1450 1460 1470 GAGOACGAGAGOTCTGCGCTCAACGCCAGGCT'1TAAGGCTCTTCATGACOAGCCAATOCATCTTTGTA 1480 1490 1500 1510 1520 1530 1540

TOTAGCTTCAACCOACTCCGTOTTCACTTCTTCGCCCOCACTGCCTACCOTTTGTACCATCTGACTCATA

1550 1560 1570 1580 1590 1600 1610 TAAATGTCTAGCCCCTACCTACACTATACCTAAOGGOAGAAOCGTACAGTGATTrAACGTACGCGCCTAT 1620 1630 1640 1650 1660 1670 1680 AGTAcCCCGATCTCTAGATAGAACAT'rAGTAGAGATTAGGATGCCTAACTAA=~AACTTGAGCATTGT ii1690 1700 1710 1720 1730 1740 1750 CCCGTTCATATTGAiilECATCCATTATACACTCTTAATCGI'CCCGTAGAACCONATATATACOAC :::1760 1770 1780 1790 1800 1810 1820 CATAGGGTGTGCACAACAGGCT.CCTCTGCTTGGCCGTACTAAGCTATATAl'CTACACGGCCAAT 1830 1840 1850 1860 1870 1880 1890

ACTCAATGTGCCCTTAGCACCTAAGCCGCACTCTAGGGTAAGTGCGGTGATATAGTGAGMAGTTTA

1900 1910 1920 1930 1940 1950 1960 1970

GACAGGGTCGAC

Example 15: DNA sequence of the PAT gene: In this DNA sequence, the coding range was established by a j comparison of the experimentally determined amino acid partial seqeneswith the coding capacity of this DNA sequence. It is thu shwnthat three introns are present in this gene. They were additionally identified by intron-extron consensus sequences i (Rambosek and Leach, Critical Reviews in Biotechnology 6, 357-393, 1987).

-34- 20 3m~ 40 so 60 GTTGATGTCCCATCAGGcATCTATGTCCCAGATTroGOrcACCOCAATATAAATCTCACCATCA 90 100 110 120 130 140 GT CCrcCcTGCATOATCATCCCCACGOACCCCG?1-rGTCATCTCCGTCAGCCAGGTCTTGMACcC 150 160 170 180 190 200 210 ATCTTCCOACCCGCAOCAGAAATGCTTCACATCCTCTTCAAGOCACTCCCT-rOAAGTAAGTOCTGCAC Me tLeuHisI leLeuC i slnClyThrPro~he~lu 220 230 240 250 260 270 280 TGMTACCAGAr1rCCTrCTOAA'rTCCGAGTrCTOACCTCATCCAGATC~oOCTACGAACATGGCT Ile~lyTyr~luHis~lyS 290 300 310 320 330 340 350 CrCTGCCAAACCCGATAGCCAGAAGCATTOACTTCGcCCGTCGATCTCAT~CCACGOAAAACGAAGAA erAlaAlaLysAlaVal1leAl&ArgSerIIOASDPheAlSV&IAspLeuIISleOgyLY3ThrLysLy 380 370 380 390 400 410 420

GACOOACGAAOAGCTTAAACAOCTACTCTCGCAACTOOOCGCTATCAOAAAGATOOCCAAATAC

eThrAsp~luCluLeuLyslnValLeuSr~llLeu~lyArV1ileou1uAr1'rpProLY3Tyr 430 440 450 460 470 480 490

TACOAAGGAGATTCCOOTOAGTOCCACTTCGGTCTTCCTACATTTCTCACCAATCCTGACCOATGAC

Tyrolu~luileArgO 500 510 520 530 540 550 560 cccccAAAAAccAGc;TATrOCAAACGGCoCTAACGCGATCTCTCCGAGATTGTCATGCTAATACCCC lyI leAlaLyaOlyAlaOluArgA~pValSerOlu! leValMetLeUA~nThrArg 570 580 590 600 610 620 630 ACWAA IT ATACGCCCAAGWcAOCCCOTGATGOCTroCACCACTOCCTATTGTCAACTTCCAATG ThroluPheAlTyrGlyLeuLysAlA&AragA~p~lyCysThrThrAlTYrCYSCflLeuProAfl 640 650 660 670 680 690 700 GCCCTCCAGOCAAACTCGOATCTACGTTAACAGATMACCTCTCA1TATTCCATCOAATrr lyAlaLeuGln~lyGlnAsnTrpA~p 710 720 730 740 750 760 770 GcoccacTAATTccPhepharr r lmrc ysouAAnAGAeulleGACArg TC GT 0C0C0ACTA~flG0TICflC..t& a iL r.lJChrCMA0AsACCTGArC00TMC0tCC0T 780 ?90 800 810 820 830 840 CACGCC0GACTCCCACCATCAAATTCATAACCGA00CTG0AATCATC0CAAMGGTT100ATrrTCA0'T0 olnla~lyLeuProThrlIeLysPhelleThroluAlaolyl lelle~lyLyValGlyPhAsflSerA 850 860 870 880 890 900 910 ccGGoGToccQTcAArACAACCCC-rACCTcAAGTCTrCACCCACCCA'TCT CGcATIT 1aO.IyVa lA1SValAsnTyrA~flaLeuHI13LeuClnflyLeuArgProThrGlyVa IProSerHiIZI 920 930 940 950 960 970 980 TCCCCTCCGCATACCTCGAAA0CACTCTCCTCCCAGCCTATACC0CATCGT00A0CAA0C 0

CGA

eAl aLettArgl leAlaLeu~luSerThrSerProSerGlflAlaTyrApArII6VAlUC~lflyolY 990 1000 1010 1320 1030 1040 1050

ATGCCGCCAOCOCTTTTATCATCTCCCAATGOOCACCAGGCCAOITOGMAATCTCCCCCACCA

MetAlaAlaSerAlaPhe lleMetVal~lyAsnGlyHisCluAlaPheOlyLau~luPheSerProThrS 1080 1070 1080 1090 1100 1110 1120 rOCATCCGAAA0CAOTCCACCCAATOTAGOATCTCACACCAACCACTCTGCTTCAGCAC00 er IeArgLysClnValLeuApAaASn~lyArgMetValHisThrAniCyaLuLeuGln~is01 1130 1140 1150 1160 1170 1180 19 CAMAATAAAAACTCACCCTACCCGACTCAT0ATCCCACCAOCCTAT00ACTCCTCCTC yLysAanOluLysOluLeuAspProLeuProAspSerTrpAsnArgisGlnArg~e t~luPhoeauLeu 1200 1210 1220 1230 1240 1250 1280 GACG0GTTC0ACCCCACCAAACAGOCCAT!GCCCACCTCT0GCCC0ACC0M0ACATTATCCCTITAGCA A,1y PheASPOG yThrLy sG InA I PheAl aG I LeuTrPA1 &Aap01uA~pAanTyr ProPheSer I 1270 1280 1290 1300 1310 1320 1330 TCTGCCOCOCTrACOAOGOCAAAGCACACOCOrACTCTOTTCMATATCATCTACCACCATCCO I eCY3ArgAl &TyrGl luC uyLY 3SerArgGlyA IaThrLeuPheAsn I Ie I TyrApHi 3Al 1340 1350 1380 1370 1380 1390 1400 TAGAGA00CAACG0TGCCTTC0CCGCC0ACCAACCCTGATGAAT'Tr0TCr0C0TMAC0AC gArCluAlaThrVa lArCLeuC lyArgProThrAsnProAsp1 uMetPheVa1UetArPheA$ pOlu 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 T0TACCTTCAACC0ACTCCGTCTCACTTCTTCCCCCACTGCCTACCTY(TACCATVTACrCATA 1550 1580 1570 1580 1590 1600 1610 TAAATOTCACCCCTACCTACACTATACCTAACGAAGAAMOCCTAGAOTGATrAACCGTACCOCCTAT 1620 153C 1640 1650 1660 1670 1880 AGTACCCCGATTCTAATAGACATTACTACAGArrA00ATOCCTAACrAATTTAACT0ACATF0TL 1690 1700 1710 1720 1730 1740 1750A CCCGMrATATrATTCATCCATTATACACTCrAATCOTCCOaAAAXCONATATATACGAC 1760 1770 1780 1790 1800 1810 1820 CATACOrTTOAGACACOCrCCTCTOCrrOOCCTACrrAOCTATATATCTACACOCCAAT 1830 11840 1850 1160 1870 1880 1890 ACTCAATOTOCrrTAGCACCTAAOGCCACTCTAGGOAACOOOTATATAGTAGMOCTI 1900 1910 1920 1930 1940 1950 1960 OACTGAAGACAOCATATCACOCGTACCCTOCACCGTACCTACTACCTTCAATATCACTC1TTCACOATG 1970

GACAGTCGAC

-r 36 970-9757,'WA Example 16: Amino acid sequence of PAT, derived from the DNA sequence: This piu.ypeptide has a molecular weight of 40,000 D. If it is cleaved between amino acid radical 102 and 103, two polypeptides are obtained: One polypeptide with 11,500 D and the N-terminal amino acid sequence of polypeptide 2; all peptide fragments may be found again in this amino acid sequence (AA part sequences 9 to 24). This is thus the "8kD component of PAT".

one polypeptide with 28,500 D and the N-terminal amino acid sequence of polypeptide 1; all peptide fragments may be found again in this amino acid sequence (AA part sequences 2, 3, 4, 7, This is thus the "3OkD component of PAT".

MetLeuHis IleLeuCysolnolyThrProPheOlul leGlyTyr~luHi s~lySerAla AlaLysAlaVal IleAlaArgSerlleAspPheAlaValAspLeulleArgOlyLysThr Srl l-asu.sThrArpl~u~uyGlhraleu~e7la~yr~ly~eugya1IIla~lau 110 120 AspolyCysThrThrAlaTyrCysolnLeuProAsnOlyAlaLeuolnolyolnAsnTrp 130 140 AspPhePheSerAlaThrLysGluAsnLeulleArgLeuThrlleArgGlnAlaGlyLeu 4150 160 ProThrIleLysPheIleThroluAlaolyIleIleGlyLysvallyPheAsnSerAla t170 180 GlyValAlaValAsnTyrAsnAlaLeuHi sLeu~lnGlyLeuArgProThr~lyValPro 190 200 SerHislleAlaLeuArglleAlaLeuoluSerThrSerProSerolnAlaTyrAspArg 210 220 I IeVa IGluGl1nGlIyG 1yMetWlaAlIaSe rA IaPhe 11eMeWaI GyA snG yH i sC.u S230 240 AlaPheGlyLeuGluPheSerPrOThrSerIleArgLyslnValLeuAspAlaAsnGly by the cell.

-4N 37- 970-9757/WA 250 260 ArgMetValHi sThrAsnHi sCysLeuLeucInHi s~lyLysAsnGluLysGluLeuAsp 270 280 ProLeuProAspSerTrpAsnArgHi sGlnArgMetGluPheLeuLeuAspGly~heAsp 290 300 0I yThrLysG1 nAl aPheAI aGlnLeuTrpAl aAspGI uAspAsnTyrProPheSerI 1 e 310 320 CysArgAlaTyr~luGluGJlyLysSerArgGlyAlaThrLeuPheAsnlelleTyrAsp 330 340 H isAI aArgArgGl uAl aThrValArgLeuG1 yArgProThrAsnProAspol umetPhe 350 ValMetArgPheAspGluGluAspGluArgSerAlaLeuAsnAlaArgLeu Example 17: Comparison of the amii~o acid sequence of PAT derived from the DNA with the experimentally determined amino acid sequences: 3OkD unit/polypeptide 1 (N-terminal amino acid sequence) 2 ThrThrAlaTyrCysGllLeuProAsflGlyAlaLeuGlnGlyGlnAn'.TrpAspPhePhe 104 ThrThrAlaTyrCysGflnLeuProAsflGlyAlaLeuGllGi-'Gln.AsnTrpAspPhePhe 22 SerAlaThrLysGluAsnLeulleArg 124 SerAlaThrLysGluAsnLeulleArg 132 AA part sequence 2 (tryptic peptide fragment of polypeptide 1): 1 GlyAlaThrLeuPheAsnIleIleTyrAspHiSAlaArg 13 311 GlyAlaThrLeuPheAsnIleIleTyrAspHisAlaArg 323 RA part sequence 3 (tryptic peptide fragment of polypeptide 1): 1 r'rsnrAplue,4ale~g1 13 ProThrAsnProAspGlu~etPheVal'etArg 113 AA part sequence 4 (tryptic peptide fragment of polypeptide 1): yC) 38 -970-9757/WA 1GluLeuAspProLeuProAspSerTrpAsflArg 1 258 GluLeuAspProLeuProAspSerTrPAsflArg26 AA part sequence 5 (tryptic peptide fragment of polypeptide 1): 1 IMetGluPheLeu AspGlyPheAspGlyThrLys 12 272 MetGluPheLeuLeuASpGlyPheAspGlyThrLys 283 AA part sequence 7 (tryptic peptide fragment of polypeptide 1): tAae~ue~re~oe~nl~rs~g1 18 IleAlaLeuGluSerThrSerProSerGlflAlaTyrAopArg 140 AA part sequence 8 (tryptic peptide fragment of polypeptide 1): 1 ValGlyPheAsniSe rAlaGlyVa1AlaVa1AsnTyrASflAlaLeuHi sLeuGlnGlyLeu 155 Va1GlyPheAsnSerAlaGlyVa1AlaVa1AsrITyrAsnAlaLeuHisLeuGlnGlyLeu 21 ArgProThrGlyValProSerHiSIleAlaLeuArg 32 175 ArgProThrGlyValProSerHisIleAlaLeUArg 186 8kD unit I/polypeptide 2a 1 MetLeuHisIleLeuCysGlflGlyThrProPheGluIleGlyTyrGluHisGlySerAla 1 MetLeuHisIleLeuCysG1T1GlyThrProPheGluIleGlyTyr-4luHisGlySerAla 8DAlaLysAlaValIleAlaArgSerIleAspPheAlaValAsp 34 AlaLysA1&'~a1IeAaArgSerIleAspPheAlaVa1Asp 34 8Dunit II/polypeptide 2b :.n~a1 MetLeuHisIleLeyCysGlflGlyThrProPheGlulleGlyTyrGluHisGlySerAla 1 MetLeuHisIleLeuCysGlflGlyThrProPheGluIleGlyTyrGluHiSGlySerAla4 AlaLys valIleAlaArgIleAspPheAlaValAspLeu GlyThr 4f

RK

v- 39 -970-9757/WA AA part sequence 9 (tryptic peptide fragment of polypeptide 2): 11 ThrGluPheAlaTyrGlyLeuLys 8 ThrGluPheAlaTyrGlyLeuLys 97 I AA part sequence 10 (tryptic peptide fragment of polypeptide 2): 11 TyrTyrAnyGlulleArg 6 65 TyrTyrGluGluIleArg AA part sequence 11 (tryptic peptide fragment of polypeptide 2): 11 TrpProLys 3 62 TrpProLyS 64 AA part sequence 12 (tryptic peptide fragment of polypeptide 2): 1 SerlleAspPheAlaValAspLeulleArg 28 SerlleAspPheAlaValAspLeulleArg 37 AA part sequence 13 (tryptic peptide fragment of polypeptide 2): AApr eunc 4(r i petd frgmn of polypeptide 2): 1 GlnValLeuSerGlnLeuGlyArg 8 49 GlnValLeuSerGlnLeuGlyArg 56 __AA part sequence 15 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 6 CysGlnGlyThrProPheGlu 12 1 CysGlnGlyThrProPheGlu 7 1 Ala-val-Ile-Ala-Arg 970-9757/WA AA part sequence 16 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): TyrTyrGluGluIleArgGlyIleAlaLys 74 1 TyrTyrGluGluIleArgGlyIleAlaLys AA part sequence 17 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): 49 GlnValLeuSerGlnLeuGlyArgVal~leGluGluArgTrpProLys 64 0 GlnValLeuSerGlnLeuGlyArgValIleGluGluArg .ProLys 16 AA part sequence 18 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): GlyAlaGluArgAspValSerGluIleVal4etLeuAsflThrArg 89 1 GlyAlaGluArgAspValSerGluIleValMetLeUAsnThrArg AA part sequence 19 (tryptic peptide fragment of polypeptide 2): 23 AlaValIleAlaArg 27 1*1 AlaValIleAlaArg AA part sequence 20 (tryptic peptide fragment of polypeptide 2): 421 1..r~pl~u~uy 48 1.

1 Lys AspGluGluLeuLys 7 CAA part sequence 21 (tryptic peptide fragment of polypeptide 2): 71 GlylleAlaLys 74 *1 GlyllAlaLys 4 agitator at 250 rpm for 40 hours at 250. The mycelium is filtered using a Bilchner funnel, washed briefly with.TE (10 mM tris/HCl, pH 8.1, 1 mM EDTA) and pulverised in liquid nitrogen to a fine powder. This powder is suspended in lysis buffer (5 M guanidine 41 970-975 7/WA AA part sequence 22 (tryptic peptide fragment of polypeptide 2): Valil eGluGluArg Val IleGluGlUArg AA part sequence 23 (peptide fragment of polypeptide 2 with lysyl-endopeptidase): AsnThrArgThrGluPheAlaTyrGlyLeuLys AsnThr- ThrGluPheAlaTyrGlyLeuLys C C C C

CC

IC

C'

C C I C (CCC CC C Ct C C C poly(A)'RNA (example 10) in 250 mM KC1, 10 mM tris/HC1, pH 8.3 are mixed with 2 #l 32-P-labelled oligonucleotide mixture in a ml reaction container. The mixture is heated for 2 minutes to 750 and then warmed for 45 minutes at 500. To each of 4 Eppendorf containers are added 3.3 pl reaction buffer (24 mM tris/HC1, pH 42 970-9757/WA Summary: AA part sequence position of AA in the sequence derived from N-terminal AA sequence 30 kD unit/polypeptide 1 N-terminal AA sequence 8 kD N-terminal AA sequence 8 kD unit/polypeptide unit/polypeptide peptide fragment i

I.

AA part sequence polypeptide 1): AA part sequence polypeptide 1): AA part sequence polypeptide 1): AA part sequence polypeptide 1): AA part sequence polypeptide 1): AA part sequence polypeptide 1): AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence AA part sequence 3 (tryptic peptide fragment of 4 (tryptic peptide fragment of 5 (tryptic peptide fragment of 7 (tryptic peptide fragment of 8 (tryptic peptide fragment of 9 (tryptic fragment of polypeptide 2): 2 (tryptic

AA-

the DNA 104-113 1- 34 1- 311-323 333-343 258-268 272-283 187-200 155-186 90- 97 65- 62- 64 28- 37 79- 89 49- 56 6- 12 65- 74 49- 64 75- 89 23- 27 42- 48 71- 74 57- 61 87- 97 (tryptic fragment of polypeptide (tryptic fragment of polypeptide (tryptic fragment of polypeptide (tryptic fragment of polypeptide (tryptic fragment of polypeptide (lysyl-e. of polypeptide 2): (lysyl-e. of polypeptide 2): (lysyl-e. of polypeptide 2): (lysyl-e. of polypeptide 2): (tryptic fragment of polypeptide (tryptic fragment of polypeptide (tryptic fragment of polypeptide (tryptic fragment of polypeptide (lysyl-e. of polypeptide 2): 2): 2): 2): 2): 2): 2): 2): 2): 2): 43 970-9757/WA Example 18: part sequence of a DNA fragment which lies between the gene for isopenicillin N synthetase (ips) and the gene for

PAT:

This sequence begins with "GGATCC", the recognition sequence of the restriction enzyme BamHl, which lies in the ips gene. The last 34 (C-terminal) codons of this gene are shown; they have been identified by comparison with the published DNA sequence (Carr et al., Gene 48, 257-266, 1986)..After an intermediate region, position 1 of the pat-DNA sequence follows at 1442. This DNA part sequence is marked in fig. 4 This DNA part sequence is important, since it proves the narrow coupling between ips- and pat-gene, and because all essential control elements for transcription and translation of the patgene lie on this fragment.

20 30 40

GGATCCTAGCAAGGAAGACGGCAAGACCGATCAGCGGCCAATCTCGTACG

AspProSerLysGluAspGlyLysThrAspGlnArgProlleSerTyrG 70 80 90 100

GCGACTATCTGCAGAACGGATTAGTTAGTCTAATCAACAAGAACGGCCAG

lyAspTyrLeuGlnAsnGlyLeuValSerLeulleAsnLysAsnGlyGln 110 120 130 140 150

ACATGAAAGGGCCCATGGATGGGACCGGGATGGAAATCCCGGACTCTGAG

ThrEnd NNNNNNNNNNNNNNNN 1250 bp NNNNNNNNNNNNNNNNNNNNNNN 1I' 1410 1420 1430 1440 1450

CAAGACTAGGCGGATGCAGCAGGGATACTCGAGGTGCCCCAGTTGATGTC

1460 1470 1480 1490 1500

CCATCAGTGTCATGCTATGGTCCCAGATTGGTGGCTACGGCAATATAAAT

'I r 1510 1520 1530 1540 1550

CTCAGCATGCAGTTCCGCCTGCATGATCATCCCCAGGACGCCGTTTGTCA

1560 1570 1580 1590 1600

TCTCCGTCAGCCAGGTCTCAGTTGTTTACCCATCTTCCGACCCGCAGCAG

1610 1620 1630 1640

AAATGCTTCACATCCTCTGTCAAGGCACTCCCTTTGAAGTA

MetLeuHislleLuCysGlnGlyThrProPheGlu iA>~ k'4 f i 44 Example 19: Construction of the plasmid pBC2001 and expression of the pat-gene in E.coli: a) Construction of a cDNA gene bank of penicillium chrysogenum: S pg of the poly(A)+-RNA, the isolation and purification of which are described in example 10, are reacted using reverser transcriptase with an oligo dT-primer in the presence of the four desoxynucleoside triphosphates to form a complementary singlestranded DNA. A double-stranded molecule is formed therefrom by means of the enzyme RNaseH and DNA polymerase (Gubler and Hoffman, Gene 25, 263, 1983). After adding appropriate EcoRl adaptors, for which purpose the enzymes polynucleotide kinase and T4-DNA ligase are used, a linear, double-stranded cDNA is obtained, which can be built into cloning vectors. For these reactions, a commercial cDNA synthesis kit (Fa. Pharmacia) is favourably used. It contains the most important enzymes and the adaptor oligonucleotide. The reaction is carried out in accordance with the manufacturer's instructions. The doublestranded cDNA thus synthesized, with EcoRl ends, is cloned into the vector gtlO (Huynh et al., DNA cloning, Glover, D.M. ed., Oxford, 1, 49, 1985). 80 p 1 of the cDNA preparation is mixed with 16 pl of gt0l-DNA (8 pg), which has previously been cleaved with EcoRl and treated with alkaline phosphatase (Maniatis et al.).

After adding 3 pl 3 M sodium acetate (pa 5.2) and 250 1l ethanol, the mixture is precipitated for 20 hours at -200 and subsequently dissolved in 60 #1 of 10 mM tris-HC1 (pH 1 mM EDTA.

Ligation is effected at 12" for 20 hours in 66 mM tris-HCl (pH 1 mM spermidine, 10 mM MgCl 2 15 mM dithiothreitol, 0.2 mg/ml BSA, 0.5 mM ATP, by adding 6 U T4-DNA ligase. The ligation mixture is packed in vitro with protein extracts ("packaging mix") and plated with the E.coli strain C600hfl (Huynh et The necessary methods are described (Maniatis et In such a test, more than 5.105 plaques may be obtained.

45 b) Isolation of the pat-specific cDNA clones and subcloning in M13mpl9.

Plaque hybridisation is carried out as described in example 13, using about 40,000 plaques of the penicillium chrysogenum cDNA gene bank. The E.coli strain C600hfl (Huynh et al.) is used as the indicator strain. After partial cleavage with EcoR1, the DNA of the recombinant gtl0-phages is ligated with EcoRl-cleaved M13mpl9-RF-DNA and transfixed. Individual clones of recombinant M13mpl9-RF-DNA are identified and confirmed by restriction mapping.

c) Site-directed mutagenesis of the DNA of the recombinant Ml3mpl9 clone to insert a Ncol intersection site.

A 41mer oligonucleotide with the following sequence is synthesized: 5'-TCCGACCCGCAGCAGCCATGGTTCACATCCTCTGTCAAGGC-3' The DNA sequence has altered compared with the DNA sequence of the pat-cDNA, in that a Ncol intersection site is obtained, which encloses the ATG corresponding to the N-terminal methionine radical. To the right are 20, to the left 15 nucleotides identical to the pat-cDNA sequence. 5 pmol of the phosphorylated oligonucleotide and 0.5 pmol of the single-stranded M13mpl9-DNA are mixed and heated in 10 #1 20 mM tris-HC1 (pH 10 mM MgC1 2 50 mM NaC1, for 5 minutes at 65" and for 20 minutes at 420. Treatment with Klenow polymerase, T4-DNA-ligase and Slnuclease is effected according to Eghtedarzadeh and Henikoff (Nucl. Acids Res. 14, 5115, 1986): 10 pl solution with 2 units Klenow polymerase and 3 units T4-DNA-ligase in 20 mM tris-Cl (pH 10 mM MgCl2, 10 mM dithiothreitol, 0.8 mM of each of the four dNTPs, 1 mM ATP, for 1 hour at 420. The reaction is stopped by adding EDTA (final concentration 25 mM) and is heated for minutes to 70(. After precipitation with ethanol, the pellet is dissolved in 10 pi tris-HC1 (pH 1 mM EDTA. After adding 46 #1 30 mM potassium acetate (pH 0.25 M NaCl, 1 mM ZnC1 2 glycerol, 7 units S1 nuclease, incubation is effected for minutes at room temperature. After transfection of an appropriate E.coli strain JM101; Yanisch-Perron et al., Gene 33, 103, 1985) with the reaction preparation, and isolation of RF-DNA, the changed DNAs can be identified by cleavage with Ncol.

d) Cloning of the Ncol-HindIII fragment with the pat cDNA into the plasmid pKK233-2.

The RF-DNA of the recombinant M13 clone, which contains the pat cDNA with the inserted Ncol intersection site, is cleaved with Ncol and HindIII. The plasmid pKK233-2 (Amann and Brosius, Gene 183, 1985) is similarly cleaved with Ncol and HindIII.

Ligation of the two DNAs takes place for 20 hours at 140 in 66 mM tris-HC1 (pH 1 mM spermidine, 10 mM MgC1 2 15 mM dithiothreitol, 0.2 mg/ml BSA, 0.5 mM ATP, with the addition of 2 U T4- DNA-ligase. After transformation of an appropriate E.coli strain JM83; Yanisch-Perron et al., Gene 33, 103, 1985), individual plasmid-DNAs are isolated and characterised by restriction mapping. The plasmid which contains the Ncol-HindIII restriction fragment with the pat cDNA in the plasmid pKK233-2 is called pBC2001.

c) Expression of the pat-gene in E.coli E.coli RB791 (Amann and Brosius, Gene 40, 183, 1985) is transformed with pBC2001. 50 ml LB medium (per litre: 10 g bacto tryptone, 8 g NaCl, 5 g yeast extract; pH 7.5 is set with NaOH) is seeded with an individual colony of the strain RB791(pBC2001) and agitated at 200 rpm at 370 until an optical density of has been attained (measured at 600 nm). 5 ml of a 0.1 M IPTG (isopropyl-0-D-thiogalactoside) are added. Agitation is subsequently effected at 200 rpm for 3 hours at 37*. The cells are then centrifuged (10 minutes, 5000 rpm, 200 Beckmann 47 and worked up for identification of the protein expressed in E.coli. This identification may be effected by SDS polyacrylamide gel-electrophoresis of the E.coli total protein, by Western-Blot using PAT-specific antibodies or by enzymatic detection.

Example 20: Transformation of the pat-gene for penicillium chrysogenum a) Construction of the plasmid pBC2002: The plasmid pHS1O3 (Kolar et al., Gene 62, 127, 1988) is totally cleaved with EcoRl and ligated again in the presence of ECORl- Sall-cleaved M13mpl9-RF-DNA (66-m' tris-HCl (pH 1 mM spermidine, 10 mm MgCl 2 15 mM dithiothreitol, 0.2 Mg/ml BSA, MM ATP, adding 2 U T4-DNA-ligase at 14* for 20 hours). After transformation, a plasmid is available which is suitable for the cloning of Sall fragments. This plasmid is cleaved with Sall, just as a recombinant plasmid wkth a 4.8 hqt5all fragment with %5zen .s i the complete pat-gene 1 (see excample 13). After ligation and transformation, a'plasmid can be identified, which consists of the modified pHS1O3 and the 4.8 kb Sall fragment with the pat-gene; this plasaid is called pBC2002.

b) isolation of penicillium chrysogenum protoplasts and transformation: 2 ml of a dense spore suspension of penicillium chrysogenum P2/ATCC are added to 200 al of sterile minimum medium for penicillium chrysogenum in a 1 1 Erlenmeyer flask (per litre: 3 g NaNO 3 0 0.5 g MgSO 4 *7H 2 0, 0.5 g KCl, 10 mg Feso 4 '7H 2 0, 20 g saccharose, 13 g KH 2 PO 4 and 1 ml trace element mixture (for 100 ml: 0.1 g FeSO 4 .7H 0, 0.9 g ZnSO 4 .7H 0, 0.04 g CuSO,5" 0, 0.01 g MnSQ 4

H

2 0, 0.01 g H 3 BO 30 0.01 g N& 2 H PO 4 .2H 2 0) and agitated at 250 rpm for 20 hours at 250. isolation and purification of the protoplasts takes place according to Yelton et al. (Proc. Natl. Acad. Sci. 81, 1470, 1984).

KA. I o~ r 48 The mycelium is centrifuged off and washed twice in 0.9 M NaCl and resuspended in 20 ml 0.9 M NaC1 with 5 mg/ml novozyme 234.

Incubation at 30° for 1.5 hours. The reaction preparation is centrifuged (Beckman cooling centrifuge JS 7.5, 1500 rpm, 200, minutes). The protoplast pellet is washed twice with 0.9 M NaCl and then once in 1.0 M sorbitol, 50 mM CaCI2. The protoplasts are resuspended in 0.2 ml 1.0 M sorbitol, 50 mM CaC1 2 (about 0.5 to 5.108 protoplasts/ml).

ug pBC2002 in 10 mM tris-HCl (pH 1 mM EDTA are used for transformation and added to the protoplast suspension. 12.5 pi polyethylene glycol (BDH), 10 mM tris-HCl pH 7.5, 50 mM CaCl 2 (sterile-filtered) are added. Incubation for 20 minutes in ice.

ml of 12.5 p1 25% polyethylene glycol (BDH), 10 mM tris-HCl (pH 50 mM CaCI 2 (sterile-filtered) are added; the mixture is incubated for 5 minutes at 200. After adding 1 ml 0.9 M NaC1, mM CaC1 2 thorough mixing takes place, and the mixture is added to 3 ml of minimum medium with 0.5% agar and 20 pg phleomycin/ml The transformation preparations are plated onto minimum medium plates (minimum medium as described above, with 1.6% agar and 20 pg phleomycin/ml).

DNA which is isolated from various colonies can be characterised by southern hybridisation with radioactively-labelled pat-DNA. Of the transformants, those which contain several copies of the patgene due to multiple integration occurrences are discovered. Such strains are subsequently tested by test fermentations for increased penicillin formation.

I

m&(2LQ of fkot-dtef-Adet chry~oje-i P' 2 IAT(CC- L..22.71 du. rckLti 1-01-a I Protein Mitroblologlco. 6-APA-PaCoA-Acyktraflsferase-Acf-Ieu 4 y of vo= Inv I-ohl lmnviri ImvnHH 0 or% BC 248 i't.reiSA.0 LccX4p. Inv) 11 .SI'T .,d~lhde S-v T t: 10 1:50 3' 30+ fftfcd 30 30 30' 3' 1t-t43 Penass Penase ,me Penase8 <eli4l~tp.JI b-fiGv4aiI 0 4900 676 0.138 0 0 0 0 0 0 0 0 0 Type KDL1 (1766 g Utm a 220 g OS In 3.5311 0.1 M Phosphate b'ffer 3 20776 4.24 Frc 18.0 0 0 24.4 0 0 0 pH4 7.5 5 mM# OTT 0.1% TritoX 100.* 0.1 mMAPMSF 600 nW idccl FmiiA4l cc..iltincr 510 rmt 500-750 jan O~waae.rt 60 25431 5.19 tr. 17.9 0 I-c- 27.0 0 0 15.7 0 2.O~r,~4'6.7 mIsec) rco wdI&0.J a 90 29204 5.96 IS.7- 22.0 0 13.8 29.9 0 0 15.5 0 (lowrl -30 3m Team~. 013- Temp. coolivj f 6r-20I-86C 120 29302 5.98 17.1 0 0 24,8 0 0 0 0 SriT af 0ce-4vctttc -c id-erc;e* 4650 12927 2.78 14.4 26.0 0 0 25.8 0 0 0 0

CTAV

1-jfi -rcp~e 22.8 27.4 2840 184 2.2 0 1.1 SO WV Anafwnoi,at4 i) P'rior o.thodsly tesdan^5 Ike untdhd-t4 ljj.p .100MpICS L~indercyJ bLtffer ck.j 4Jucf 14) lo '.tiAS ofp.~v~~ cd t- v~.A0 r-tA!C.~ttj V ~.1AI ,M so w#Apie iFe"k 4* k-I u ts- P&Q01c- I4VA f" T t I Q1iTr) (INkDL-5.

4 precCistuK P3c4at fQ Ac~ch4Iy I-Q0,4 wo H 0. M.if 4)-l &pZ.IC 4,,t IN.,fr -rT 1.5 d~a~ ~Table It- ce. c Fi..viF-1 cf PlhLomi- At~-c~a cl PL~ In te pe,4.-nce. On F-Pe3rC'KrCe p j3 VcL v ue Steb 11e Ec(I v eI~m j alIty24h.t +4*C 1 24 h. a I- Macoaiogk~c. 6-APA-PaCoA Acykhth ach.vFy (mmv HH 0o.i Stabft~ahcv (aLthd ii~ Micrococcus Momeu ATrCC 93411BC £mme4 30' p30 i4med 30' 3Oi. %.-iite 30' PeninsPenso Penase .aae-I'd- ixddji-ve 11 15.5 0- 0 0 I1mM OTT 23.5 37.1 0 0 0 15 38 0 10 mM OTT 22.7 39.0 0 16.6 36 0 16 33 0 10mM* B-ME 15.4 27.8 0 0 t 0 I rA(A 28.3 0 10mM* Mqa 2 9.8 17.1 0 0 Vrc 0 18.5 15 0 2mM* EDTA 0 16.0 0 0 0 ImM OTT 10 mM MgCI, 26.9 36.7 0 0 t-ce, 0 12.2 37 0 2mM EDTf, 10 rnM M;&I 16.3 25.4 0 0 14.8 0 1-rckce 23 0 SorblU* ImMDOTT 2LM EDTA mMPMSF 26.0 38.6 0 0 1-o 0 11.3 33 0 5% Sogkui+ImcM OTT ImM PMSF 25.5 36.6 0 0 I-,-oc 0 16.8 38 0 ph-proft 0. 1 M HEPES pH 7.5 1 mM OTT 26.6 37.3 0 0 irroo.fe 0 12.5 33.5 0 0. 1 MUNH 2

PO

4

IN&

2 HW9 4 pH 6.0 +1I mM OTT 0 17.3 0 0 0 0. a 2 -PO N& 2 HPn IPH 7.0 IMMDTT 22.1 32.7 0 0 11.2 0 0 29.3 0 0. 1 MNaW 2 POjINe- H 2 P0 4 pH8.0 I1mM OTT 33.0 35.0 0 0 13 0 17 36.5 0 0. 1 M TA9HCI p48.0* ImMDOTT 14.3 19.6 0 0 0 0 0 16 0 0. 1 M TPASIHO pH80.0. +mMDATT 0 FI-i-cc 0 0 o WIW0~t~,Afj atihV 22.6 33.6 0 rrc tr~ccf 0 11.6 34 0 2mM PMSF 22.1 32.2 0 0 0 13.8 27 0 +2mM# DIPFP 22.6 34.5 0 0 (-Crock 0 10 35 0 2mrM2.2-Bpyrdyl 0 0 0 0 0 2 mU HydrOxyuA4ilu-vL n. 34.5 0 0 12 0 13.5 3a 0 2 mM o-Ptinnatrowc 18.9 29.9 0 F"\L.L VC~ 0 11 33 0 2mfMN-Ethyknakoftnick 0 0 0 0 0 *2mM IodacetwALj~ 0 0 0 0 0 2 mMA 4-Hydroxymwrw-Na-bonzoate- 19.4 32.3 0 0 11.6 0 12.2 39 0 Tres t- 1ImmeiA 17~~t 2T h 40C 24 h. Mkrob4ogkc~l '6-APA-PaCoA Transacykd-.c.- oad-i,i ~y (rnrnHH4 0 stStaoniC~dh Micrococcus batous ATCC 9341/13C iwc4 30* 30+ i~mmeJ 30' 30* 1 me 30* Penase eaePns Stbftho c odi-t 21.5 33.4 0 0 cracti 0 15.2 38 0 5% Sorbitrl 23.3 34.1 0 0 12.2 0 16.3 38 0 20% Saibitol 21.9 34.2 0 0 12 0 15.2 37 0 ImM PMSF 22.0 33.7 0 0 I--mcc 0 15 40 0 1% MSA gtace 20.0 0 0 0 0 0 18 0 10% Glycerol 22.0 33.1 0 0 11.5 0 15.2 38 0 6 manntA~ 24.0 36.2 0 0 0 16. 8 38 0 100 jag 6-APAIrrd 26.8 35.4 0 15 24 0 17.2 38 0 jig md Penicillin V Standard nwn HH 0 e O C 2 27.4 24.7 23.4 18.4 0.26 11.

DTT dui-o~hoi -1wC -206C +4C RT 37C (mM) JF -lobll0rcal 5-APA-PaCoA Transacyklh-icLha-y Imm NH 0 Micrococcus liutus ATCC 9341IBC 85) snClbc hon M3a+ I ietd 30 30+ I-mmed 30- P0ts 30' p "3 ,t-vme4 30 30 30' 30nam8 Penacei 30nas enase,0 Immt4 14 40 .0 14 40 0 14 40 0 14 40 0 14 40 0 1h 14 36 0 ttorce 38 0 1rvcce- 38 0 10 37 0 0 [-opct 0 1 4 h 12 37 0 17 36 0 12 36 0 0 16 0 0 0 0 26 h 17 33 0 17 35 0 110 32 0 r 14 0 0 0 0 120 h 26 32 0 23 34 0 10 -roctf 0 0 0 0 0 0 0 IMAhe1 4h 26 h 120 h 24 40 0 35 0 18 32 0 24 40 0 11 35 0 12 34 0 17 34 0 28 32 0 24 40 0 14 34 0 11 32 0 11 27 0 0 0 24 40 0 13 34 0 11 28 0 0 FrpsL.L 0 0 0 0 24 40 0 0 17 0 0 0 0 0 0 0 0 0 :0 I"' n m rn ,a (D m

I--

00 9 l< i in 00o I, I-, 0101 001 in ini 00 0

I,

q Q c, G,

II

(00( Eflzyile: rS-prec.p~f /I:Im PpH- I- d an-. ^5 1 rrfu. s ,SI"T O&A tM sI-crc'.-~y ?0l P(rH 7. encudmncj I ceip JOi~M tTT

I-

-rc*.ble Subst-..-0rt s.If Ity r 1 rt I-i e PAI T1-cciPel c I I I v (h ryiooje-u. ~2 IT(c 21 subtrate-. Ic4~ Q-tfg zyAme I de wm,?d hy iPCLL JmtJlmg Protein) Acyl c-(40c.- Acylonator Al 27612 Wsopeuikm W PACOA Periccb~ V 146 IgopwkNcn N P*CoA Perdcbi G 6-APA P&CoA Pokln V 393 6-APA P*CoA Ponlcbt G 329 7-ADCA PmCoA 3-Demac.ooxy- 49 cophalosporin V 7-ACA PaCoA Cephalosporhn V 0 Cophalosporin C P&CoA Cophaloaporin V 0 Porde~1 G 0 Pentic~ib V Pencon V PSOoA Ponii G 99 H420 Isopeniclin N 6-APA IS0 H0Ponlclkn V 6-APA Ponicoh G 6-APA 17 1420 7-Glutari1-APA 6-APA 106 ~i I i W 54 The figures illustrate the following: Fig. 1: Purification of thiol-dependent PAT from penicillium chrysogenua P2/ATCC 48271 Chromatofocussing of affinity-chromatographically produced PATenzyme preparation Al 278/2 on Mono P AL 310 column: base volume: eluant buffer: sample: sample volume: paper feed: flow: o.d.: fractions: Pharmacia Mono P 4 ml A: 25 mM bis TRIS-buffer pH 6.3; HC1 B: 10 ml polybuffer 74/100 ml pH 4.0; HCl affinity sample AL 278/2 1 ml buffer exchange for buffer a, 2 ml of which charged 30 cm/h 60 ml/h 0.1; 280 nm; see labelling Fig. 2: Purification of thiol-dependent PAT of p. chrysogenua P2/ATCC 48271 RPC (MN Nucleosil 300-5/C 4 of fractions 3-5 from AL310/chromatofocussing of the active pool AL 278/2 (following affinity chromatography) on Mono P Fig. 3: Electrophoretic characterisation of thiol-dependent PAT of penicillium chrysogenum P2/ATCC 48271 Gradient SDS-polyacrylamide gel electrophoresis and isoelectric or focussing on ampholine (pH 3.5 9.5) reep r-immobiline (pH 4.5 of AL 310/chromatofocussing of the affinity-chromatographically produced PAT-enzyme preparation AL 278/2 on Mono P.

Fig. 4: Restriction map of penicillium chrysogenum, which embraces the pat-gene.

Restriction maps are approximate reproductions of restriction intersection sites in DNA molecules. The distances shown of the restriction intersection sites are proportional to the actual distances, but the distances actually observed may differ from these. Not all restriction intersection sites are given, further intersection sites may be present throughout.

A sequence of examples 14 and B sequence of example 18 Fig. 5: Arrangement and sequence of the chosen oligonucleotide mixture Fig. 6: Schematic illustration of the relationships between the sequenced regions the oligonucleotides the polypeptide 1 of PAT and the sequence of the coding DNA-strand (B) derived therefrom.

D sequence of example 11, F sequence of example 13, G part of the sequence of example 14 and Fig. 7: Construction of the plasmid pBC2001.

Starting with the DNA of a complete pat-cDNA clone (top lines), the two EcoRl fragments are cloned into vector M13mpl9. A Ncol intersection site is inserted using an oligonucleotide. The Ncol- HindIIl-fragment is then built into the expression vector pKK233-2.

EcoRl, HindIII, Ncol indicate the intersection sites of the corresponding enzymes; mcs multiple cloning site of M13mpl9; p trc trp-lac fusion promotor of pKK233-2; rrnBTlT2 transcription terminator of pKK233-2; bla ampicillin resistance gene of pKK233-2.

56 Fig. 8: The plasmid pBC2002 Construction of this plasmid starts with pHS103 (Kolar et al.), which contains a fusion of the aspergillus nidulans promoter p gdp (promoter of the glycerol aldehyde phosphate dehydrogenase gene) with the phleomycin resistance gene (ble). The ampicillin resistance gene (bla) serves as a selection mark in E.coli. In pHS103, the 4.8 kg Sail iragment is built in with the penicillium chrysogenum pat-gene. Sail, EcoR1 are the intersection sites of the corresponding restriction enzymes.

Fig. 9: Reaction scheme, according to which the penicillin acyl transferase (PAT) catalyses the transacylation of isopenicillin N oC rvosL its cleavage to 6-APA, as well as the acylation thereof to penicillin.

'h 0 Lj|

WCI

Claims (3)

1. 2. A IM mol1ecule according to claim I whic h codes =Tor the PAT enzyme that has the amino acid sequence: io MLeuHisIeLcCysXnly'-%h-P?rheoluI1 eGly~y01lu~i;.s1y~erhl& AlaLy3A2&ValileA18Ar-gSerZleAspPheAl.aV&a.SpLeuI 1eArgOlyLysThr LysysT--Asplu01LeLysCnV.lLeuSerGlnLeu~lyA.-gV&1I leGluilu ArgTrpProLysrST~yrY0u02U1 eA--gOGylle.C aLysGlyA2.aGl1U 100 Sc~ul~leteA h5r-rl~eka~rl~uyA1.A1 aArg 110 120 ASPOlyCysThrmThrA aTyrCysC~nLeuProAsflyAlaLeuOltG1llAb-1T 130 140 ASpPhePhaeSrA&Th-rLysG1uAzfLeueUI rMg~euihri 3eArg3. nAlaGlyLeu 160 ProTh~leLysPeeTr~1uA&01yleeGYLYsVaGyPhAsSerAla 170 380 ~A *190 200 Se~is01uG3.nOuyryNlA1MauSerah--er~eetvaO3yAsna~yriscAu-
2. 23.0 220 230 240 AlaPheGWLuGuheSerProTheleArLysGava1Leu~zPA3.atsnGly 250 2 270 .280 PzrOLuPrOA~SSerTpAsnArgHis01nArgMstC1 uPheLeuLeuAspGlyPheAsp 290 300 CY3SArKA.&TQ1G1u~lG1YLYS3OrAEg~1YAl&ThLuPheA.~ 320leyrs 330 340ay~s H13A18~gAXrgG1UA2&ThrV&1rLeuO3YArg.0roThAsnProAJ; umetph. V~iet~c~hASGIUlu~p~l~3 l~un~Lr~u -58 3. A DNA molecule according to claim 1 which comprises nucleotides 162 to 197, 262 to 436, 505 to 656 and 726 to 1436 of the following sequence: 2020 30 40 so 60 90 i03 i:0 120 130 140 G":TCCC-CCTC-C.%Tr.A-CATCcCCAGC-ACGCCGTTTGTCATCTCI--GTCALGCCAGGTCT:CAGTTGTTTACCC 150 160 170 IS0 190 200 210 %TCTTCCl3ACCGA' _;AT~TcLCTCC(-CG.ATCTTA;Gt'CTCGA 220 230 240 2300 270 280 T-)ATACCAGATT-'flCCTTCTW TC-7CCC-AGTTC:GACCTC.ATCCAG.ViCC-GTCACTCC 290 300 310 320 330 340 350 CT-:Ck--C(T-TGC( ACIC;CTGCTC..CcATCCCQAGGC-AA.~AAr'G1-A 360 370 380 390 400 410 420 C*AC C--C.t*CATT._AAG..TTCC;:.:-CGCCTACAOAG TGCAUA 430 440 450 460 470 480 490 T~(Aa-rA-.ccG:~zrCATCGLCTC7CTTCGA~x.4CZ.CGTA Soo 510 520 530 540 550 560 570 550 590 S00 610 620 630 640 650 660 670 680 690 .700 GAGCCCTCCAGGCCAACZGATGTAC0TZ. AAGATTiTACCTCC CATT ~!TCCATCG-AATTT 710 720 730 740 750 760 770 CALGGCCGACTCCCACCATC.TCATACCACTC-AZCATCGC-C-AGGTTGATTTAACACv~ K5080870 880 890 900 910 920 930 940 950 966 970 980 A ~~TGCCCTCCGCAT.GCGCTCG"GCACTCTCCTTCCCGGCCTTGACCGATCGTGGAC-CAAGTGCGIA 9"GG 1000 1010 1020 1030 1040 i050 2060 1070 100 090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 4444CAAATC-XGAV GAGCTCGATCCCTTACCcGACTCATLGGAATCGCCACCAGCGTALTGGAGTTCCTCCTC 1. 200 121-0 1220 1730 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 T.CTGCCGCGCQ:kCAGACGCGAGCG.GGCGCGACTCTGTCAATATCATCTACC;ACCAGCCCG 1.340 1350 13 60 1370 1380 1390 1400 TA-gGGCACGGrOTOCCCCG.C3%CTA(AAOTGCTC7TTAG~ Sj -59 1410 1420 1430 1440 1450 1460 1470 GA GGAC rGAGAGGTCT-G CTCAACGCC L*C"'C;.WTTCT~kG%-C-LGAC'r. GTA i480 1490a 1500 1510 1520 1530 1540 TGTAkGCTC.;:CCGACTCCTCTTCCTCTTCGC CCGCACTrGCCTACCGTTTGTA CCATCTGAkCTCATA 1550 i560 1570 1580 1590 1600 1610 TAJ.AATGTCTAGCCCC'TAC C'ACACTATCCTJGGCC AGACGTAAG;,CLTAACGTAxCc~GrCCTA±T 1520 L630 1640 1650 1660 1670 1580 )%7ACCACC~AAACTT CT GLG%-AGTCCT~A.;,%TTA.CTTG7%GCATTGT 1690 1700 1710 1720 1730 1740 1750 CCGTA&ATATTALCZIAA:CCTN LC-TCCG;, IACGAzTLAGL 1760 1770 17550 1790 1800 1810 1320 CAI.-CT-CCA-AA:CCCTCGCT-TGCCTkTAGTTTLTT6AGC A-; 1830 1840 1850 1860 1870 1880 1890 ;LTATT-CCT.CCA-CCGATT CG-AGGG3GGTT'GjGG.GCT- 1.900 1910 1920 1930 1940 1950 1960 C-ATGAGCGATTCCGCGTTCCCTGCACCGCCTACTACCTTCATCACTCTTCAGATG 1970 G-ACA~C--GTCGAC, 4. A DNA molecule according to claim 3 which comprises nucleotides 162 to 1436 of the sequence given in claim 3. A DNA according to any one of claims 1 to 4, comprising the following sqec:10 20 30 40 sequence. GGATCCTAGCA-AGGAAGACGGCAAGACCGATCAC CAATCTCGTACG AspProserLysGIUAspGlYLysThrAspGlnJ, .vProI leSerTyrG GCGACTATCTGCAGA.ACGGATTAGTTAGTCTAATCAACAAGAACGCCAG lYAspTyrLeuGlnAsnGlyLeuValgerLeul leAsnLysAsnGlyGln 110 120 130 140 150 ACATGAAAGGGCCCATGGATGGGACCGGGATGGAAATCCCGGACTCTGAG ThrEnd 4' NNNNNNNNNNNNNNNN 1250 bp NNNNNNNNNNNNNNNNNNNNNNN 251410 1420 1430 1440 1450 CAAGACTAGGCGGATGCAGCAGGGATACTCGAGGTGCCCCAGTTGATGTC 1460 1470 1480 1490 1500 CCATCAGTGTCATGCTATGGTCCCAGATTGGTGGCTACGGCA.TATAT 1510 1520 1530 1540 1550 CTCAGCATGCAGTTCCGCCTGCATGATCATCCCCAGGACGCCGTTTGTCA 1560 1570 1580 1590 1600 TCTCCGTCAGCCAGGTCTCAGTTGTTTACcATCTTccGAcccGCAGCAG 1610 1620 1630 1640 6- AAATGCTTCACATCCTCTGTCAJAGGCACTCCCTTTGAAGTA Mat~u~i-.e uCysGlnGlyThrProPheGlu- 4 'U
3. 93022-5,q:\oper\jmw33626sub. 1,59I wherein NN 1250 bp NN represents the nucleotide sequence 151 to 1399 of the PAT DNA sequence from PRnillium chrysogenum as herein defined. 6. A DNA molecule according to claim 3 or claim 4 further comprising nucleotide sequences which cause the transcription and translation of the P. chgenonrn PAT gene. 7. A DNA molecule according to claim 3 or claim 4 further comprising, at the end, the nucleotides between the isopenicillin N synthetase, which terminates at position 106, and PAT, which starts at position 1603 of the sequence: t0 20 30 40 GGA'%TCCTC-C.C<-CAC-Acc--.CGACCGATCAGCG4CAATCTCGTAC pProSerLyrsG2uAeGlyLys~b:AS;GI gprOXeTY G 70 80 90 100 GCGCTATCTC-CAG;L4CCCXCrGTTAG7ATCCtTM2,GA,,MCA;AC 1YAspTyr-ereuG G2.yLeVaSerLeuIeAs nysAsnGIvan 3D110 120 130 0 150 K~h'NTh~shNrlN~MnC 2250 bp Nh N1hNNN inN 2 1410 1420 i430 1440 1450 GCIGACTA=GC GGACCCG CAGCMGiTTXCT C OAC-GTGCCCCAGT5T AT.TC 1460 1470 i4a0 1490 1500 4 20 CCATCGTGTC'GCT% GGTCCCTTOGTCT~- 152.0 1520 1530 .540 1550 CTCAGCATGCAGT CCGCC C-CAGX .TCCCCAGGACGC CGTTTGTCCA 1560 1570 150 is5s0 CTCCGTCGCC,-r-CGTCC;.GTTGTTCCCTTCCACCCGC. 16Y0 1620 1630 150 'J-ATOCTTCACTCCTCTGTCAC-CACTCCCTT~r,-kGTA in which NN..NN 1250 bp NN..NN represents the corresponding DNA sequence of Penicillium chrysogen.Mbetween the sequences coding for isopenicillin N synthetase and PAT. 930225,q:\oper\jmw,33626sub.1, 60 *1 61 8. A DNA molecule according to claim 1 which comprises the following sequence: 20 30 40 50 so 3 CC A-TTOGAAL- ,Lr*'CMTAGC-CA0GO-LCACCATCACGOWC~rCC7T TA CC CC0TAt 9090 100 120 OCAAAMT7CTC00GTATT.AAGCAT0.A.CAATCr1CGGAGACACCGTrCA- 3 9. A DNA molecule according to claim 1 which comprises the following sequence: '0 '20 30 40 so 70 so 20 zoo 120 130 210 150 LTCGCO0TCAT(:-CGtC-CATT C T A AkTcTA GGAJ. CC M 180 170 1SO 290 200 G;TGGCACMCCCMCLCCCCTA=CTA. CCA-TCTZTCGAT C-3' A DNA molecule according to any one of claims I to 4 and 6 to 8 including a DNA sequence encoding isopenicillin N synthetase. 11. A DNA molecule according to claim 10 comprising the S-d1I fragment of Fig. 4 herein containing the DNA encoding isopenicillin N synthetase and PAT. 12. A DNA molecule according to claim 1 and substantially as described in this specification with reference ~o the drawings and examples. 13. to 12. A vector which contains a DNA molecule according to any one of claims 1 14. A vector according to ciaim 13 which is plasmid pBC2001. A vector according to claim 13 containing further genes which allow selection of the vector in p-lactam producing micro-organisms. 16. A vector according to claim 15 which is the plasmid pBC2002. 930?225,qq\opcr\jmw33626sb. 1,61 -7 ._iL ~l ij. iiiiii~i. IICL_1-ir~;~)/I~RII~I_~C~ I -62 17. A vector according to claim 13 and substantially as described in this specification with references to example 19 and figure 7 or example 20 and figure 8. 18. Cells containing a vector according to any one of claims 13 to 17. 19. A p-lactam producing microorganism transformed with a vector according to any one of claims 13 to 17. 20. A process for the production of enzyme penicillinacyl-transferase (PAT), comprising cultivating cells according to claim 18 or claim 19 and isolating the expressed PAT. 21. A process for the production of penicillin which comprises cultivating a penicillifi producing host cell that carries a vector according to any one of claims 13 to 17. 22. A process for increasing penicillin production of a penicillin producing host cell comprising transforming said host cell with the vector according to any one of claims 13 to 17 and culturing said host cell. 23. Penicillin when produced by a process of claim 21 or claim 22. Dated this 25th day of February, 1993 BIOCHEMIE GESELLSCHAFT mbH by its Patent Attorneys DAVIES COLLISON CAVE 930225,q:\oper\jmw,33626sub.1,62 00 CC O~ticaldensit 280n CC 0 VI Ln. aCD Fig-.ire 2: neutral PAr-Isovariant pi 5,15 5,17 (Immobiline) AL 310/4 '-tCA dtc PAT-Isovarlant pl 5,06 5,07 (Immobillne) AL 310/5 basic. PAT-4sovarlant( p1 5.32 (Immobillne) AL 3 10/3 tR4 Figure 3: 3a: Gradient SOS-PAGE (8-20% T) I 1 3b: Ampholine (pH 3,5 I I I III III lit 3c: Immbline (pH 4.5 I) rr rd yMtoI 278/2 2 Low-MW-Std. 66. 45. 31. 22. 14 kO 3 AL 310/7 pH-evo.5e of 4 AL 310/6 6.0 4.0 AL 310/S 6 AL 310/4 A 25 mM bis-TRIS/HC1 pH 6.3 7 AL 310/3 7 Po31 ylb r 74 10%lg pH 8 AL 310/2 9 AL 310/1 Low-MW-Std. 66. 45. 31. 22. 14 kO I pi-Std. Parmacla I-a+ (9.30: 6.65: 6.45: 8.15: 7.35: 6,85: 6,55: 5.85: 5,20: 4.55: 3.501 2 AL 276/2 3 C--arnhy*ai titliI. prc I hvt ymbo I om!31n I AL 2712 At11y ctwTatogr.. 6-APA-AH-Seph. 2 AL 310/S 3 AL 310/4 Clwomaftofocuv m 4 AL 310/3 S Carboan- hydrass 7 Figure 4: EcoRi Xho I BamHl BamH I Sall SallI EcoR I XhoI 8amH I 1972 Sal I EcoR I Xho I BamH I Sal I BamH I SalI EcoR I BamH I 1 kbI Figure 10 15 ThrThrAlaTyrCyiClnLeuProAsnGlyAlaLeuG n~l yGlnA--nT1-PA~pPhePheSer -ACNACNOCNTATflGTCAAkCTNCCNAATGGGCNkCTNCAAGGNCAAAATTGGTITfl'AGT-3 00 G MflcTA G.C C C C C G 0 TCN 3 -TGCTGACGGATAACAGTTGAAGGTTTACC GGfTACCCTAAAAAA-5 C GTT1-rAACCCTAAAAAA C C GTMGrACCCTGAAAA.A C C GTTTTAACCCTGAAA-AA C G Amino,%cdse,%e PolypepLidrl 01 igonut-Ieotide- r1,yt-url 1 Oligonucleoi*irf-ure 2 Oligonucleotide m:iuuoe3 01 igOnUcleoidd Nar.e 4 Figure 6: ill 202 F I7zzzzzznz 396 G521 591 631 mpm Figure 7 EcoRi EcORi T EcoRi EcoRi EcoRI Hindll pat c l EcoRi EcoRI cl indlii Nol incaq EcoRi EcoRi Hindll inca Nocol pat rrnBTlT2 p8032001 ~trc bla -7 Figure 8: Sall p p EcORI U U 11 I' it U LI 1~j A 'ii Figure 9: Isopeniejillin N cO.C. I 4 PENNILUN- ACYLTRANSFERASE Acyl-Coenzyme-A Penicillim. CoenzymeA