JPH07222587A - New cephalosporin c acylase and its production - Google Patents

Abstract

PURPOSE:To obtain a new acylase, having a high enzymic activity, capable of catalyzing reaction from GL-7ACA into 7ACA (7-aminocephalosporanic acid) and useful for producing the 7ACA. CONSTITUTION:This variant type cephalosporin C (CC) acylase has an amino acid sequence of a precursor before being processed into an alpha- and a beta-subunits in a host cell is expressed by an amino acid sequence of the formula, A1-316-X1- A318-704-X2-A706-773 (A1-316 is the same amino acid sequence as that of Thr1 to Leu316 of the natural type cephalosporin C acylase; A318-704 is the same amino acid sequence as that of Leu318 to Thr704 thereof; A706-773 is the same amino acid sequence as that of GJy706 to Ala773 thereof; X1 and X2 each is Tyr or other amino acids; when X1 is Tyr, X2 is an amino acid other than Tyr), e.g. the variant type CC acylase Y317L in which the Tyr at the 317th position is replaced with Leu. The variant type CC acylase can be prepared according to a recombinant DNA technique, a polypeptide synthetic method, etc.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a novel cephalosporin C acylase (hereinafter referred to as CC acylase). More specifically, it relates to a novel mutant CC acylase, a gene encoding the same, an expression vector containing the gene, a microorganism transformed with the expression vector, and a method for producing the mutant CC acylase. Furthermore, the present invention relates to a method for producing a cephalosporin compound using the culture of the above transformant or a treated product thereof.

[0002]

2. Description of the Related Art CC acylase generally uses cephalosporin C as 7-aminocephalosporanic acid (7-ACA).
It is an enzyme that hydrolyzes into. To date, three enzymes, cephalosporin C acylases SE83, N176 and V22, have been found as enzymes classified as CC acylases, and their amino acid sequences are shown in the Journal of Ferme.
ntation and Bioengineering, Vol.72, p232-243 (199
It is disclosed in 1). In this document, the numbering of the amino acid sequence of CC acylase begins with the methionine group at its N-terminal site.

However, in the present specification, the numbering of the amino acid sequence of CC acylase begins with the threonine group adjacent to the N-terminal methionine group (see Sequence Listing below). This is because the methionine at the N-terminal part of the α-subunit of the mature CC acylase obtained by expressing the CC acylase gene in a prokaryote is usually eliminated by a host cell enzyme (for example, aminopeptidase etc.), This is because it becomes a mature CC acylase having a threonine group as the N-terminal amino acid.

[0004] The above-mentioned document also discloses the production of natural CC acylase by recombinant DNA technology. The expressed CC acylase is processed intracellularly to consist of α-subunit and β-subunit. It is known to be the active form.

[0005]

The object of the present invention is to provide a novel mutant CC acylase, a DNA encoding the same, an expression vector containing the DNA, a transformant into which the vector is introduced, and the transformant. It is intended to provide a method for producing a mutant CC acylase by culturing. Another object of the present invention is to provide a method for producing a cephalosporin compound using the culture of the above transformant or a treated product thereof.

[0006]

Means for Solving the Problems As a result of intensive studies conducted by the present inventors to obtain a CC acylase having higher enzyme activity, the desirable properties, especially GL-7ACA, were obtained.
The present inventors have completed the present invention by successfully producing a mutant CC acylase having a high catalytic ability (enzyme activity) from 1 to 7ACA.

That is, the present invention relates to a novel mutant CC acylase having the following characteristics. (1) A mutant CC acylase in which tyrosine at the 317th amino acid sequence of natural CC acylase is substituted with another amino acid such as leucine. (2) A mutant CC acylase in which tyrosine at the 705th amino acid sequence of natural CC acylase is substituted with another amino acid such as leucine. (3) A mutant CC acylase having one or two point mutations selected from the above (1) to (2).

In other words, the mutant CC acylase is
The precursor form before being processed into α-subunits and β-subunits can be represented by the following formula. A1-316-X1-A318-704-X2-A706-773 In the formula, A1-316 represents Th of the natural CC acylase.
It shows the same amino acid sequence as the amino acid sequence from r1 to Leu316. A318-704 shows the same amino acid sequence as the amino acid sequences of Leu318 to Thr704 of natural CC acylase. A706-773 shows the same amino acid sequence as Gly706 to Ala773 of the natural CC acylase. X1 represents Tyr or other amino acid, and X2 represents Tyr or other amino acid. However, when X1 is Tyr, X2 is Ty
It is an amino acid other than r. The present invention also provides the compound of the formula
Mutant C in which 1 is Leu and / or X2 is Leu
Regarding C acylase.

In this specification, the following nomenclature, which is widely used by academic societies in this field, is adopted for the nomenclature of individual mutant CC acylases. That is, the mutant CC acylase in which the tyrosine residue at position 705 of the natural CC acylase is replaced with leucine is designated as mutant CC acylase Y705L. Here, Y means the one-letter code of the substituted tyrosine (amino acid) residue, 705 means the substitution position of the amino acid sequence of natural CC acylase, and L means leucine ( Other amino acids). As another example, for example, the mutant CC acylase Y317L means a mutant CC acylase in which the tyrosine residue at position 317 of the amino acid sequence of natural CC acylase is replaced with a leucine residue. The mutant CC acylase Y317L / Y705L means a mutant CC acylase in which the tyrosine residues at positions 317 and 705 of the amino acid sequence of natural CC acylase are replaced with leucine residues.

The amino acid sequence of the mutant CC acylase of the present invention having such characteristics and D encoding the same
Specific examples of the nucleotide sequence of NA are shown in the sequence listing below.
SEQ ID NO: 1 shows the nucleotide sequence of the DNA encoding the precursor of mutant CC acylase Y317L expressed in the plasmid pTNY317L and the amino acid sequence deduced therefrom. SEQ ID NO: 2 contains the plasmid pTN
Mutant CC acylase Y705 expressed by Y705L
The nucleotide sequence of DNA encoding the precursor of L and the amino acid sequence deduced therefrom are shown.

The mutant CC acylase of the present invention can be prepared by a conventional method such as recombinant DNA technology or polypeptide synthesis method.

When the recombinant DNA technique is used, the novel CC acylase of the present invention is prepared by culturing a host cell transformed with an expression vector containing a DNA encoding the amino acid sequence in a medium, It can be prepared by collecting CC acylase.

The details of this process will be described below. Examples of the host cell include microorganisms such as bacteria (eg, Escherichia coli, Bacillus subtilis), yeasts (eg, Saccharomyces cerevisiae), animal cell lines and cultured plant cells). Preferable microorganisms include bacteria, in particular strains belonging to the genus Escherichia (for example, E. coli JM109 ATCC 53323, E. coli HB101).
ATCC 33694, E. coli HB101-16 FERM BP-1872, E. col
i 294 ATCC 31446), yeast, especially Saccharomyces
Strains belonging to the genus (eg Saccharomyces cerevisiae A
H22), animal cells (eg mouse L929 cells, Chinese hamster ovary (CHO) cells, etc.) and the like.

When a bacterium, particularly E. coli, is used as a host cell, the expression vector generally includes at least a promoter-operator region, a start codon, a DNA encoding the amino acid sequence of the CC acylase of the present invention, a stop codon, a terminator region and a replicable unit. Composed of.
When yeast or animal cells are used as host cells, the expression vector preferably contains at least a promoter, a start codon, a signal peptide, a DNA encoding the amino acid sequence of the CC acylase of the present invention, and a stop codon. Enhancer sequences, 5 ′ and 3 ′ untranslated regions of the CC acylase of the present invention, splicing junctions, polyadenylation sites and replicable units can also be incorporated into expression vectors.

The promoter-operator region includes a promoter, an operator and a Shine-Dalgarno (SD) sequence (for example, AAGG). Preferably the promoter-operator region is a conventionally used promoter-operator region (eg E. col.
i PL-promoter and trp-promoter) and a CC acylase N-176 chromosomal gene promoter.

In the case of S. cerevisiae, promoters for expressing the novel CC acylase of the present invention in yeast include TRP1 gene, ADHI or ADHII gene, and acid phosphatase (pH05) promoter. Examples of the promoter for expressing the CC acylase of the present invention in mammalian cells include SV40 early promoter or late promoter, HTLV-LTR-promoter, mouse metallothionein I (MMT) -promoter, vaccinia-promoter and the like. .

An example of a suitable initiation codon is methionine codon (ATG).

Examples of the signal peptide include signal peptides of other commonly used enzymes (natural t-PA signal peptide, natural plasminogen signal peptide) and the like.

The DNA encoding the amino acid sequence of the novel CC acylase of the present invention can be prepared by a conventional method. For example, a DNA synthesizer is used to synthesize a part or all of the DNA, and / or a transformant [eg, E. coli JM109 (pCCN176-2) FER
M BP-3047], a suitable vector (eg p
The complete DNA sequence encoding the native CC acylase inserted into CCN176-2) is prepared by a suitable method, for example, a suitable enzyme (eg, restriction enzyme, alkaline phosphatase, polynucleotide kinase, DNA ligase, DN).
In addition to treatment with A polymerase, etc., conventional mutagenesis methods [eg, cassette mutagenesis [Tokunaga, T. et al., Eur. J. Bi.
Ochem. Vol.153, p445-449 (1985)], PCR mutation method [Higuchi, R et al., Nucleic Acids Res. Vol.16, p7351-7]
367 (1988)], Kunkel method [Kunkel, T. A. et al., Me.
thods Enzymol. Vol. 154, p367 (1987), etc.].

Examples of stop codons include commonly used stop codons (eg, TAG, TGA, etc.).

Examples of the terminator region include natural and synthetic terminators (for example, synthetic fd phage terminator).

A replication-competent unit is a DN having the ability to replicate its entire DNA sequence in a host cell.
Compound A refers to natural plasmids, artificially modified plasmids (eg, DNA fragments prepared from natural plasmids) and synthetic plasmids. A preferred plasmid is the plasmid pBR322 in E. coli, or its artificial modification (pBR3
DNA fragment obtained by treating 22 with an appropriate restriction enzyme) is yeast 2μ plasmid or yeast chromosomal DNA in yeast, or plasmid p in mammalian cells.
RSVneo ATCC 37198, plasmid pSV2dhfr ATCC 3714
5, plasmid pdBPV-MMTneo ATCC 37224, plasmid
Examples include pSV2neo ATCC 37149.

Examples of the enhancer sequence include the enhancer sequence of SV40 (72b.p.) and the like.

As the polyadenylation site, SV
For example, 40 polyadenylation sites are exemplified.

The splicing junction site is SV4
0 splicing junction sites and the like are exemplified.

The expression vector can be prepared by ligating a promoter, a start codon, a DNA encoding the amino acid sequence of the CC acylase of the present invention, a stop codon and a terminator region in a continuous and circular manner to an appropriate replicable unit (plasmid). At this time, if desired,
Appropriate DNA fragments (eg, linkers, other restriction sites, etc.) can also be used by a conventional method (eg, digestion with a restriction enzyme, ligation using T4 DNA ligase).

Transformants (transfectants) can be prepared by introducing the above-mentioned expression vector into host cells.
Introduction of an expression vector into a host cell [transformation (transfection)] is known in the art (for example, in the case of E. coli, Kushn
er method, in the case of mammalian cells, calcium phosphate method, microinjection, etc.) can be used.

The novel CC acylase of the present invention can be produced by culturing a transformant containing the expression vector prepared as described above in a nutrient medium.

The nutrient medium includes carbon sources (eg glucose, glycerin, mannitol, fructose, lactose) and inorganic or organic nitrogen sources (eg ammonium sulfate, ammonium chloride, casein hydrolysates, yeast extract, polypeptone, bacto). Tryptone, beef extract, etc.). If desired, other nutritional sources [eg, inorganic salts (eg, sodium diphosphate or potassium diphosphate, dipotassium hydrogen phosphate, magnesium chloride, magnesium sulfate, calcium chloride), vitamins (eg, vitamin B1)] , Antibiotics (eg ampicillin, kanamycin)]
May be blended. For the culture of mammalian cells, Dulbecco's Modifi containing fetal bovine serum and antibiotics was used.
ed Eagle's Minimum Essenntial Medium (DMEM) is often used.

Cultivation of the transformant (transfectant) is usually pH 5.5 to 8.5 (preferably pH 7 to 7.5), 18
It is carried out at -40 ° C (preferably 20-30 ° C) for 5-50 hours.

When the novel CC acylase of the present invention is present in the culture medium of the culture, the novel CC acylase can be obtained as follows. That is, the obtained culture is filtered or centrifuged to obtain a culture filtrate (supernatant), and the CC acylase of the present invention is isolated according to a conventional method generally used for purifying and isolating a natural or synthetic protein from the culture filtrate. Separate and purify. Isolation and purification methods include
Examples include dialysis, gel filtration, affinity column chromatography using an anti-CC acylase monoclonal antibody, column chromatography on a suitable adsorbent, high performance liquid chromatography and the like.

On the other hand, when the novel CC acylase is present in the periplasm or cytoplasm of the transformed transformant, the CC acylase of the present invention can be obtained, for example, by the following method. First, cells are collected by a conventional method such as filtration and centrifugation, and the cell wall and / or cell membrane of the cells are treated with, for example, ultrasonic waves and / or lysozyme to obtain cell debris. Next, the obtained cell debris is dissolved in an appropriate aqueous solution (for example, 8M urea aqueous solution, 6M guanidinium salt aqueous solution), and the CC-asease of the present invention is isolated and purified from the solution by a conventional method as exemplified above. is there.

The invention further comprises the formula:

[0034]

[Chemical 3]

(Wherein R ¹ represents acetoxy, hydroxy or hydrogen, R ² represents an acyl carboxylate), or a salt thereof is used as a novel CC of the present invention.
Contacting with a culture of a microorganism transformed with an expression vector containing a DNA encoding an acylase or a treated product thereof, the formula:

[0036]

[Chemical 4]

The present invention provides a method for producing the compound (I) represented by the formula (wherein R ¹ has the same meaning as defined above) or a salt thereof.

Examples of the carboxylate acyl represented by R ² include aliphatic, aromatic or heterocyclic carboxylate acyl, and suitable examples thereof include an amino group, a carboxy group, a C1-C6 alkanoylamino group, C1 to C which may have one or two suitable substituents selected from the group consisting of benzamide group, thienyl group and the like.
6 is alkanoyl.

Suitable salts of compound (I) and compound (II) include alkali metal salts (for example, sodium salt,
Potassium salt, lithium salt).

In the present invention, the treated product means a supernatant (filtrate) obtained by centrifuging or filtering the culture when CC acylase activity is present in the culture, and the above-mentioned purification treatment. Is obtained. Further, when CC acylase activity is present in the cells of the culture host,
For example, the following substances obtained by treating a culture are referred to.

(1) Live cells: isolated from the culture by a conventional method such as filtration or centrifugation. (2) Dry cells; obtained by drying the living cells of (1) above by a conventional method such as freeze-drying or vacuum drying. (3) Cell-free extract; live cells of the above (1) or dried cells of the above (2) are subjected to a conventional method (eg, autolysis of cells using an organic solvent, crushing of cells using alumina, sea sand, etc. , Or by treating the cells with ultrasonic waves). (4) Enzyme solution; obtained by purifying or partially purifying the cell-free extract of (3) above by a conventional method (for example, column chromatography). (5) Immobilized cells or enzymes; the cells of (1) or (2) above or the enzyme of (4) above can be prepared by a conventional method (for example,
(Method using acrylamide, glass beads, ion exchange resin, etc.)

The production of compound (I), which comprises contacting compound (II) of the present invention with CC acylase of the present invention,
It can be carried out in an aqueous medium such as water or a buffer. That is, the production of compound (I) is usually carried out by dissolving or suspending the culture or a treated product thereof in an aqueous medium containing compound (II) such as water or a buffer solution.

The compound (I) can be produced by appropriately selecting the pH, the concentration of the compound (II), the reaction time and the reaction temperature depending on the properties of the culture to be used or the treated product thereof. pH is usually 6 to 10, preferably pH 7
-9, the reaction temperature is usually 5-40 ° C, preferably 5-37.
The reaction temperature is usually 0.5 to 50 hours.

The concentration of the compound (II) as a substrate in the reaction mixture can be suitably selected within the range of 1 to 100 mg / ml.

Compound (I) thus produced
Is purified and isolated from the above reaction mixture by a conventional method.

In the following examples, plasmids, enzymes such as restriction enzymes, T4 DNA ligase, and other substances are commercially available and can be used by conventional methods. The procedures used for cloning DNA, transforming host cells, culturing transformants, collecting new CC acylase from the culture, etc. are well known to those skilled in the art, or from the literature. It can be adopted.

[0047]

EXAMPLES AND EXPERIMENTAL EXAMPLES The following examples are given for the purpose of explaining the present invention, and the present invention is not limited thereto.

Example 1 Synthesis of oligodeoxyribonucleotides SO-Y317L and SO-Y705L DNA oligomer SO-Y317L (5'CGAACT
GCTCTAGAAGGAGATCGTGG 3 ′) was synthesized using a 392A type DNA synthesizer (manufactured by Applied Biosystems). The DNA was converted into CPG (cont
Rolled pore glass) The polymer support was liberated with 28% ammonia water, and then heated at 60 ° C. for 9 hours to remove all protecting groups. The reaction mixture was evaporated under reduced pressure under vacuum and the residue was washed with TE buffer [10 mM Tris-HCl (pH
7.4) -1 mM EDTA] was dissolved in 200 μl.
The obtained crude DNA solution was subjected to reverse phase HPLC [column; COS
MOSIL C18, 4.6 mm x 150 mm (Nacalai Tesque), eluent; A: 0.1 M triethylammonium acetate buffer (pH 7.2-7.4), B: acetonitrile, gradient; start: A (100%) , End: A (60%)
+ B (40%), 25 min linear gradient, flow rate;
1.2 ml / min]. The eluate containing the target DNA oligomer was collected and evaporated under reduced pressure under vacuum. Dissolve the purified DNA in 200 μl of TE buffer, and use until -2
Stored at 0 ° C.

DNA oligomer SO-Y705L (5 '
GCAGGGCAGCCCTGGGTGCCTTAAGC
CGCTACGTCT 3 ') was synthesized and purified by the same method as described above.

Example 2 Preparation of expression vector of natural CC acylase N176 under control of trp promoter (1) Construction of ampicillin resistant expression vector pCC002A of natural CC acylase N176: (i) Construction of pCC001A: plasmid pCCN17
6-3 (1.0 μg) [JOURNAL OF FERMENTATION AND
BIOENGINEERING, Vol. 72, p235 (1991), and the plasmid pCCN176-2 (this was prepared according to a conventional method using E. coli).
JM109 (pCCN176-2) FERMBP-3
The method for preparing this plasmid is described in (1) available from H.E.
Digested with dIII and the 2.9 kb fragment carrying the entire coding region of CC acylase N176 was isolated by agarose gel electrophoresis. On the other hand, mutant t
-PA expression vector pTQiPAΔtrp
(1.0 μg), [this is a transformant E. coli HB101-16 (pTQiPAΔt
rp) FERM BP-1870. The preparation method thereof is described in European Patent Application Publication No. 302456]] to XmaI and Xh.
digested with oI and the larger DNA (5113bp, Xm
aI / XhoI DNA fragment) was isolated.

On the other hand, the synthetic oligomer CT-1 (5'-CCGGGTGTGTTACACCAA
GGTTACCAACTACTAGTAGACTGGATT
CGTGACAACATGCCGACCGTGA), CT-2 (5'-AGCTTCACGGTCGCGCATG
TTGTCACGAATCCAGTCTAGGTTAGT
TGGTAACCTTGGTGTACACAC), TR-1 (5'-AGCTTGTCCCTCGAGATC)
AATTAAAGGCTCCTTTTTGGAGCCTT
TTTTTTTTTG), and TR-2 (5'-TCGACAAAAAAAAAAGGG.
CTCCAAAAGGAGCCTTTATAATTGATC
(TCGAGGACA) is phosphorylated with T4 polynucleotide kinase to give T4
XmaI / SalI ligated using DNA ligase
A DNA fragment (114bp) was prepared. This DNA fragment was used to obtain the previously obtained XmaI / XhoI
Binds to DNA fragment (5113 bp) and pT
QiPAdtrp was prepared.

Next, this pTQiPAdtrp (1.0
μg) was digested with EcoRI and HindIII. 4.3 carrying the resulting trp promoter, part of the t-PA coding region (Cys92 to Trp113), and the copy sequence of the fd phage central terminator.
The kb DNA was isolated. 50 mM Tris-HCl, 10 m
M MgCl ₂ , 10 mM dithiothreitol and 1 m
In 40 μl of ligation buffer consisting of MATP,
In the presence of T4 DNA ligase (300 units, manufactured by Takara Shuzo), the previously obtained 2.9 kb DNA fragment and the 4.3 kb DNA fragment were mixed to give 1
Binding was performed at 6 ° C for 5 hours. Using the conjugate, E.
E. coli JM109 was transformed. The desired plasmid pCC00 from one of the transformants resistant to ampicillin.
1A was obtained and its properties were examined by restriction enzyme mapping.

(Ii) Construction of pCC002A The plasmid pCC001A obtained in (i) contains a part of the t-PA gene (Cys92 to Trp113) between the trp promoter and the acylase gene. To remove this region, pCC001A (1.0 μg) was added to C
6.1 kb D obtained by digestion with laI and MluI
The NA fragment was isolated. On the other hand, pCCN176-
3 (1 μg) was digested with MluI and Sau3AI,
18 that encodes the acylase between Asp7 and Arg71
A 9 bp DNA was isolated. Synthetic DNA oligomer 00
2a and 002b (0.5 nmol each, see Table 1)
To T4 polynucleotide kinase (1.5 units,
Using Takara Shuzo, a buffer (kination buffer; 5)
0 mM Tris-HCl, 10 mM MgCl ₂ , 10 mMD
TT, 1.0 mM ATP) at 37 ° C. for 1 hour for phosphorylation, and the reaction mixture was heated at 55 ° C. for 20 minutes to inactivate the enzyme. The resulting mixture is
18 treated in the presence of T4 DNA ligase in 20 μl of ligation buffer for 3 hours at 15 ° C.
9 bp Sau3AI / MluI DNA was mixed and ligated. The resulting conjugate was 6.1 kb ClaI /
T4 DNA ligase (300 units) with addition of MluI DNA fragment and addition of the mixture
Was incubated for 16 hours at 4 ° C. The resulting conjugate was used to transform E. coli JM1
09 was transformed. From one of these transformants,
The desired plasmid pCC002A, an expression vector for CC acylase N176, was isolated and characterized by restriction enzyme mapping.

[0054]

[Table 1]

(2) Kanamycin resistant CC acylase N
Construction of pCK002, an expression vector of 176. Plasmid pCC002A was transformed with DraI (Toyobo Co., Ltd.).
Made). The resulting mixture was treated with phenol to remove the enzyme and precipitated with ethanol. The recovered DNA was suspended in 20 μl of ligation buffer, mixed with phosphorylated EcoRI linker (2 μg, Pharmacia), and mixed with T4 DNA ligase (300
(Unit) at 4 ° C. for 16 hours. The reaction mixture was extracted with phenol and precipitated with ethanol. The recovered DNA is digested with EcoRI,
The resulting 5.6 kb DNA lacking the ampicillin resistance gene was isolated by agarose gel electrophoresis. On the other hand, plasmid pAO97 (1 μg) [this was used as transformant E. coli JM109 (pAO9
7) It can be obtained from FERM BP-3772 by a conventional method. ] Was digested with EcoRI, and as a result, 1.2 kb DNA which is a kanamycin resistance gene was isolated. The 1.2 kb Eco with T4 DNA ligase (300 units) in 50 μl of ligation buffer.
RI DNA was reacted at 16 ° C. for 2 hours and ligated to 5.6 kb EcoRI DNA. Using the conjugate, E. E. coli JM109 was transformed to obtain the desired plasmid pCK002 carrying the kanamycin resistance gene as an antibiotic marker.

Example 3 Construction of pCK013 which is a high expression vector of CC acylase N176 (1) Construction of pCC013A (i) Construction of pCC007A Plasmid pCC001A was transformed with EcoRI and MluI.
Digested with and the resulting 6.4 kb DNA fragment was isolated by agarose gel electrophoresis. The recovered DNA was pre-phosphorylated with synthetic DNA oligomers 007a and 007b (0.5 μg each, Table 1).
(See reference) was treated with T4 DNA ligase (300 units) at 16 ° C. for 5 hours for ligation. The resulting mixture was used to transform E. E. coli JM109,
The desired plasmid pCC007A was obtained.

(Ii) Construction of pCCNt013 Plasmid pCC007A (1.0 μg) was digested with ClaI and BamHI, and the resulting 6.1 kb DNA was 5
% Polyacrylamide gel electrophoresis. The DNA was synthesized into synthetic oligomers 013a and 013b (0.
5 μg, each of which is phosphorylated. (See Table 1) was ligated with T4 DNA ligase (300 units). E. coli with the ligation mixture. coli
JM109 was transformed with the desired plasmid pCCNt
013 was isolated from ampicillin resistant transformants.

(Iii) Construction of pCC013A The plasmid pCCNt013 was digested with BamHI and MluI, and the resulting 6.1 kb DNA was isolated. On the other hand, pCC002A (1.0 μg) was digested with MluI and Sau3AI to obtain a 189 bp DNA fragment. The obtained DNA was digested with T4 DNA ligase (300 units) to obtain a 6.1 kb BamHI.
Ligated to the DNA fragment of E./MluI and the ligation mixture was used to E. coli JM109 was transformed.
From one of the ampicillin-resistant transformants, an AT-rich NH2-terminal DNA sequence (natural CC acylase N1
The desired plasmid pCC013A, having an amino acid sequence identical to that of 76) was isolated.

(2) Construction of pCK013 which is a kanamycin resistant expression vector of natural CC acylase N176 (i) Construction of pΔN176 Plasmid pCK002 (1.0 μg) was digested with AatII (manufactured by Toyobo Co., Ltd.) to obtain The treated DNA was treated with T4 DNA ligase (150 units) for self-ligation. With such a ligation mixture E. coli J
M109 was transformed to obtain the desired plasmid pΔN176 carrying a unique AatII restriction enzyme cleavage site.

(Ii) Construction of pCK013 Plasmid pΔN176 (1.0 μg) was digested with AatII, and linearized DNA was treated with a bacterial alkaline phosphatase (1 unit, manufactured by Takara Shuzo Co., Ltd.) in 100 mM Tris-HCl buffer (pH 8. 0) in 42 ° C. for 1 hour. The dephosphorylated DNA was isolated and labeled with T4 D
2.5 kb from pCC013A using NA ligase
Of AatII DNA. E. coli with the ligation mixture. E. coli JM109 was transformed to obtain the desired plasmid pCK013 carrying a kanamycin resistance gene as a marker.

Example 4 Point mutation of the DNA encoding CC acylase N176 by the Kunkel method (1) M of DNA encoding CC acylase N176
Subcloning into 13 phage (i) Preparation of mp19pfu62 The plasmid pCC013A was cloned into SmaI and HindII.
Digested with I and isolated a 1565 bp DNA encoding CC acylase N176 Pro277 to Ala773. The DNA was ligated to M13mp19 digested with SmaI and HindIII using T4 DNA ligase and the ligation mixture was used to transform E. coli JM1
09 was transformed. The desired RFDNA mp19pfu62 was isolated from one of the plaques and characterized by restriction enzyme mapping. The prepared phage solution was stored at 4 ° C until use.

In the same manner as described above, 1164 bp HpaI / Eco47III DNA derived from pCC013A and H
RF DNAmp18p183 was prepared from 7250 bp M13mp18 digested with incII.

(Ii) Single-stranded U-mp19pfu62-S
Preparation of S (Kunkel, TA et al., Methods Enzyml. 15
4, 367): E. coli CJ236 (dut
-, Ung-, F ') (manufactured by Bio-Rad Laboratories) were single colonies of chloramphenicol (30
37 in 2 ml of 2XTY broth containing 100 μg / ml)
Culturing was performed at 16 ° C for 16 hours. 30 μg of cells (0.1 ml)
2XTY containing / ml chloramphenicol
It was transferred to broth (50 ml), and the culture was continued at 37 ° C.
When the absorbance at 600 nm reached 0.3, the culture was supplemented with a phage solution of mp19pfu62 (MOI <0.
2) was added and the culture was continued for another 5 hours. The obtained culture was centrifuged at 4 ° C. and 17,000 × g for 15 minutes, and then the supernatant was centrifuged again. The resulting supernatant (30
ml) at room temperature for 30 minutes RNase (150 μg / m
l, treated with Sigma), was added 7.5ml of PEG solution (20% polyethylene glycol 8,000 solution of 3.5 M NH ₄ OAc). Centrifuge (17,000)
Xg, 15 minutes, 4 ° C.), the residue was treated with 300 mM NaCl.
l, 100 mM Tris-HCl (pH 8.0) and 0.1 m
The cells were suspended in 200 μl of a buffer solution containing M EDTA. 200 μl of phenol and phenol /
Extraction with 200 μl of CHCl ₃ (1/1) followed by CH
It was washed twice with Cl ₃ (200 μl). In the solution, 7.
5M NH ₄ OAc (100 μl) and ethanol (600
μl) was added to precipitate the phage DNA. The DN
A was collected by centrifugation and ice-cooled 90% ethanol 700μ
It was washed with 1 and dried under vacuum. Purified single-stranded U-
DNA (U-mp19pfu62mp18-SS) T
Suspended in 20 μl of E buffer and stored at 4 ° C. until use. Single-stranded U-DNA (U
-Mp18p183) was also prepared in the same manner as described above.

(2) Preparation of RF DNA encoding mutant CC acylase Y705L (i) Phosphorylation of oligodeoxyribonucleotide DNA oligomer SO-Y705L (1.84 μg, about 167 pmol) was added to T4 polynucleotide kinase (4.5%). Unit, manufactured by Takara Shuzo Co., Ltd., using 50 mM Tris-HCl (pH 7.8), 10 mM MgCl ₂ , 20 m
Phosphorylation was carried out by treatment in 30 μl of a ligation buffer consisting of M dithiothreitol (DTT), 1 mM ATP and 50 μg / ml bovine serum albumin (BSA) at 37 ° C. for 1 hour.

(Ii) Annealing reaction 10 mM Tris-HCl (pH 8.0), 6 mM MgCl 2
_In 9 μl of a buffer consisting of ₂ and 40 mM NaCl, the phosphorylated oligomer (i) (1 μl, about 5.6 pmol) was used as template U-mp19pfu62-SS.
(0.10 pmol, about 250 ng). The mixture is heated at 70 ° C. for 5 minutes, then 3 minutes over 40 minutes.
It cooled at 0 degreeC and stood at 0 degreeC.

(Iii) Double-stranded DNA in vitro
Synthesis of the obtained annealing solution (10 μl) was added to a synthesis buffer [200 mM Tris / HCl (pH 8.0) -40 mM
MgCl ₂ ] 1 μl, 5 mM dNTP (dATP, d
CTP, dGTP and dTTP) 1 μl, T4 DN
A ligase (300 units, Takara Shuzo) and T4
Mixed with DNA polymerase (10 units, Pharmacia). The mixture on ice for 5 minutes, 25 ° C. for 5 minutes,
Further, the cells were sequentially incubated at 37 ° C. for 90 minutes. 10 mM Tris-HCl (pH 8.0) and 10 mM
The reaction was stopped by adding 90 μl of buffer consisting of EDTA.

(Iv) E. Transformation of E. coli JM109 The synthetic DNA solution (3 μl) obtained in (iii) was transformed with E. coli. co
li JM109 was added to competent cells (200 μl), and the cells were incubated on ice for 30 minutes to obtain transformants. On the other hand, E. coli JM10
Nine single colonies were cultured in L broth (2 ml) for 16 hours. The culture (0.1 ml) was transferred to fresh L broth (2 ml) and further cultured for 2 hours to obtain an indicator cell. Transformed cells (200μ
1) to H-Top agar (1% by adding indicator cells (200 μl) and preheating them at 55 ° C.)
Bactrypton, 0.8% NaCl, 0.8% agar)
Mixed with 3 ml. The cell-agar mixture was placed on an H plate (1% bactotryptone, 0.5% NaCl, 1.5%).
% Agar) and the plates were incubated at 37 ° C. for 16 hours.

(V) RF DN obtained from the transformant
Characteristics of A. E. E. coli JM109 single colony 2XT
It was cultured for 16 hours in 2 ml of Y broth (1.6% bactotryptone, 1% yeast extract, 0.5% NaCl).
The culture (0.1 ml) was added to fresh 2XTY broth (2 m
1), and further cultured for 2 hours. Bamboo toothpicks (15 cm) from the plaques on the plate prepared in step (iv)
The toothpicks were immediately transferred to the 2XTY broth which had been previously cultured. Culturing was continued at 37 ° C. for 5 to 6 hours. The culture 1
The cells were collected by centrifuging ml at 10,000 rpm for 15 seconds at room temperature, and the resulting supernatant (R in the next experiment
The phage solution used for large scale preparation of F DNA) was stored at 4 ° C until use. The obtained cells are G
It was suspended in 100 μl of TE buffer solution [50 mM glucose, 25 mM Tris-HCl (pH 8.0), 25 mM EDTA], and alkali-SDS solution (0.2 N NaOH, 1%) was added.
SDS) gently mixed with 200 μl and high salt buffer (3M KOA) using a Vortex ™ mixer.
c, 3M AcOH). The resulting mixture was centrifuged at 10,000 rpm for 5 minutes at room temperature. The obtained supernatant (400 μl) was treated with 300 μl of isopropyl alcohol, and the mixture was centrifuged at 10,000 rpm for 5 minutes.
Centrifuge for minutes. The upper layer (300 μl) was separated and mixed with 600 μl of ethanol. Centrifuge the mixture (1
(10,000 rpm, 5 minutes), the obtained precipitate was washed with 500 μl of ice-cold 70% ethanol, dried under vacuum, and suspended in 50 μl of TE buffer containing 1 μg / ml of RNase (manufactured by Sigma). , RF DNA mp19
A pfu62Y705L solution was obtained. A portion (10 μl) of the RFDNA solution was used for restriction endonuclease mapping with AflII. This is because the DNA oligomer SO-Y705L intentionally contains an AflII recognition site in its sequence in order to investigate mutations.

(3) Preparation of RF DNA Encoding Mutant CC Acylase Y317L Mutant RF DNA (named p183Y317L) was prepared as single-stranded U-DNA of mp18p183 in the same manner as in the above method.
(As template) and primer SO-Y317L.

Example 5 Construction of Expression Vector (1) Construction of pTNY705L (FIG. 3) RF DNA (mp19pfu62) obtained in Example 4
Y705L) (10 μg) was added to NcoI (5 units, Toyobo Co., Ltd.) and PstI (5 units,
Digested with Toyobo Co., Ltd. Obtained 1271 bp
DNA fragment of was isolated from the digestion mixture by 0.8% agarose gel electrophoresis. On the other hand, pCK0
13 (10 μg) to PstI (5 units) and Nc
Digested with oI (5 units, Toyobo Co., Ltd.), 55
A 19 bp DNA fragment was isolated. 1271b
The p and 5519 bp NcoI / PstI DNA were ligated in 20 μl of ligation buffer at 4 ° C. for 16 hours. E. coli with the ligation mixture. coli
JM109 was transformed. The desired plasmid, designated pTNY705L, was isolated from one of the kanamycin resistant transformants and characterized by restriction endonuclease digestion (FIG. 1).

(2) Construction of pTNY317L (FIG. 4) RF DNA (mp18p183Y) obtained in Example 4
317L) (10 μg) was added to NcoI (5 units, Toyobo Co., Ltd.) and MluI (5 units,
Digested with Toyobo Co., Ltd. The resulting 872 bp DNA fragment was isolated from the digestion mixture by 0.8% agarose gel electrophoresis. On the other hand, pCC01
3A (10 μg) with MluI (5 units) and Nc
Digested with oI (5 units, Toyobo Co., Ltd.), 53
A 78 bp DNA fragment was isolated. 872bp
And 5407 bp NcoI / MluI DNA were ligated in 20 μl of ligation buffer at 4 ° C. for 16 hours under condition 0. E. coli with the ligation mixture. coli
JM109 was transformed. The desired plasmid, designated pTNY317L, was isolated from one of the ampicillin-resistant transformants and digested with restriction endonucleases to
The characteristics were investigated (Fig. 2).

Example 7 DNA Sequence of Mutant Acylase (1) Sequence of pTNY705L Using a 373A type DNA sequencer (manufactured by Applied Biosystems), Dye Deoxy ^{™ was} directly used.
It was decided by law. DNA oligomer S1 (CGGGGC
TGCTGAATCCGGCT, coding strand: nucleotide numbers 2028-2047) and A1 (CAT
CGGCACCATCGCACAGT, reverse strand: nucleotide numbers 2269-2250) was used as a primer.
The determined sequence was in agreement with what was expected. (2) Sequence of pTNY317L The sequence of pTNY317L was determined in the same manner as above.

Example 8 Recombinant E. Culture of E. coli (1) E. coli culture of E. coli JM109 / pTNY317L. coli JM109 to pTNY317L (1m
E. coli obtained by transforming E. coli JM109
/ 50 μg of pTNY317L glycerol stock
/ Ml 100 ml L broth containing ampicillin (1% bactotryptone, 0.5% yeast extract, 0.5% Na
Cl, pH 7.4) and the mixture was incubated at 30 ° C. for 8 hours. 20 ml MS broth (1.2% bactotryptone, 2.4% yeast extract, 1.25% glycerol, 0.11% leucine, 0.11%) containing 50 μg / ml ampicillin was added to the culture (0.2 ml). Proline, 0.
11% isoleucine, 1.25% K ₂ HPO ₄ , 0.
38% KH ₂ PO ₄ , 50 μg / ml thiamine / hydrochloric acid, 2 mM MgSO ₄ · 7H ₂ O, 0.2 mM Ca
Cl ₂ .2H ₂ O, 0.05 mM FeSO ₄ .7H ₂
O) and the mixture was incubated at 30 ° C. for 16 hours.
The resulting culture (3.4 ml) was treated with 2% M9CA containing 1% glycerol and 25 μg / ml ampicillin.
Broth (2% casamino acid, 1.52% Na ₂ HPO ₄
・ 12H ₂ O, 0.3% KH ₂ PO ₄ , 0.1% N
H ₄ Cl, 0.05% NaCl, 2 mM MgSO _{4
· 7H 2 O, 0.2mM CaCl 2} · 2H 2 O, 50
μg / ml thiamine / hydrochloric acid, pH 7.2), and the mixture was incubated at 20 ° C. with vigorous shaking (35
0-400 rpm / min). At the 8th hour, 3-indoleacrylic acid was added to the culture so that the final concentration was 20 μg / ml, and the culture was continued for another 40 hours. 20 ml of the obtained culture was subjected to 7,000 rpm at 4 ° C.
Collect the cells by centrifuging for 5 minutes at
It was suspended in 20 ml of a buffer solution (pH 8.0) and crushed by ultrasonic treatment. The crushed product was centrifuged at 4 ° C. and 15,000 rpm for 20 minutes to remove insoluble substances. The obtained supernatant was stored at 4 ° C. to obtain CC acylase activity and GL-7A.
It was used to measure CA acylase activity and also to prepare purified mutant CC acylase Y317L.

(2) E. coli JM109 / pTN
Culture of Y705L E. coli JM109 to pTNY705L (1m
E. coli obtained by transforming E. coli JM109
/ 50 μg of pTNY705L glycerol stock
/ Ml Kanamycin-containing 100 ml L broth (1% bactotryptone, 0.5% yeast extract, 0.5% Na
Cl, pH 7.4) and the mixture was incubated at 30 ° C. for 8 hours. 20 ml MS broth (1.2% bactotryptone, 2.4% yeast extract, 1.25% glycerol, 0.11% leucine, 0.11%) containing 50 μg / ml ampicillin was added to the culture (0.2 ml). Proline, 0.
11% isoleucine, 1.25% K ₂ HPO ₄ , 0.
38% KH ₂ PO ₄ , 50 μg / ml thiamine / hydrochloric acid, 2 mM MgSO ₄ · 7H ₂ O, 0.2 mM Ca
Cl ₂ .2H ₂ O, 0.05 mM FeSO ₄ .7H ₂
O) and the mixture was incubated at 30 ° C. for 16 hours.
The obtained culture (3.4 ml) was treated with 2% M9CA broth (2% casamino acid, 1.52% Na ₂ HPO ₄ ···) containing 1% glycerol and 25 μg / ml ampicillin.
12H ₂ O, 0.3% KH ₂ PO ₄ , 0.1% NH
₄ Cl, 0.05% NaCl, 2 mM MgSO ₄ ·
7H ₂ O, 0.2 mM CaCl ₂ · 2H ₂ O, 50μ
g / ml thiamine / hydrochloric acid, pH 7.2), and the mixture was incubated at 20 ° C with vigorous shaking (350).
~ 400 rpm / min). At the 8th hour, 3-indoleacrylic acid was added to the culture so that the final concentration was 20 μg / ml, and the culture was continued for another 40 hours. 20 ml of the obtained culture was centrifuged at 4 ° C. and 7,000 rpm for 5 minutes to collect cells, which were suspended in 20 ml of TE buffer (pH 8.0) and disrupted by ultrasonication. The crushed material was kept at 4 ° C and 15,000 rpm for 20
Insoluble material was removed by centrifugation for minutes. 4 times the obtained supernatant
CC acylase activity and GL-7ACA
It was used to measure acylase activity and also to prepare purified mutant CC acylase Y705L.

Example 9 Purification and properties of CC acylase (1) Purification of mutant N176CC acylase Y705L E. coli obtained from 20 ml of culture was purified. coli JM109
Ammonium sulphate (4.18 g, final concentration: 35% saturation) was added to the / pTNY705L disruption (20 ml) and the mixture was stirred at room temperature for 20 minutes. Centrifuge the resulting mixture (20 ° C, 15,000 rpm, 20 minutes)
The supernatant was collected and treated with ammonium sulfate (5.56).
g, final concentration: 75% saturation). Centrifuge (20 ℃, 15.0
(00 rpm, 20 minutes) to collect the precipitate,
It was dissolved in 5 ml of 00 mM Tris-HCl (pH 9.0).
The resulting solution was dialyzed twice at 4 ° C. against 4 liters of 100 mM Tris-HCl buffer. The dialysate obtained was Millex-HV ^™ (0.45 μm, Millipore).
And then purified by high performance liquid chromatography [column; TSKgel ^™ DEAE TOYOPEA
RL-5PW (Tosoh), eluent; A: 20 mM Tris-HCl (pH 8.0), B: 0.5 M NaCl-Tris-HCl (pH 8.0), gradient; Start: A (80
%) + B (20%), end (after 30 minutes): A (50
%) + B (50%), flow rate; 1.0 ml / min]. The main peak eluted with about 0.16M NaCl solution was collected and dialyzed against 4 liters of Tris-hydrochloric acid (pH 9.0) to obtain pure mutant N176CC acylase Y70.
5 L was obtained.

The purified mutant N176CC acylase Y705L acylase was applied to a reverse phase HPLC column [COSM
OSIL 4.6 mm x 50 mm (made by Nakarai Tesque),
Eluent; A: 0.05% trifluoroacetic acid (TFA),
B: 0.05% TFA containing 60% acetonitrile, gradient; start: A (40%) + B (60%), end (after 20 minutes): A (0%) + B (100%)], and dodecyl sulfate. It was analyzed by sodium-polyacrylamide gel electrophoresis (SDS-PAGE). The purity of the acylase thus obtained is determined by HPLC and SDS-P.
It was about 95% by AGE. Mutant N176CC
The acylase Y317L was also purified and analyzed in the same manner as described above.

(2) Measurement of specific activity (i) GL-7ACA acylase activity GL-7 preincubated at 37 ° C. for 10 minutes
200 μl of ACA solution [0.15M Tris-HCl (pH
8.7) and the pH was readjusted to 8.7 with 1N NaOH. 20 μm each of the mutant N176CC acylase Y317L or the mutant N176CC acylase Y705L purified in Example 9 (1).
1 was added and the mixture was incubated at 37 ° C. for 5 minutes. The reaction was stopped by adding 220 μl of 5% acetic acid. The resulting mixed solution was centrifuged (at room temperature, 10,000 rpm for 5 minutes), and the supernatant was used to measure the production of 7ACA by each mutant CC acylase.

HPLC conditions: column; TSKgel ODS-80 TMCTR
4.4 mm I.D. D. × 100 mm (manufactured by Tosoh Corporation), eluent: 5% (w / v) ammonium acetate-containing 3% (v
/ V) acetonitrile, flow rate; 1.0 ml / min, injection amount: 10 μl, detector; 254 nm Note that one unit is GL-7ACA at 37 ° C. for 1 minute.
Was defined as the enzyme activity capable of producing 1.0 μmol of 7ACA. The results are shown in Table 2.

[0079]

[Table 2]

(2) Determination of amino terminal sequence of mutant CC acylase (i) Isolation of both chains of CC acylase N176: Purified mutant N176CC acylase Y705L was purified by reverse phase HP
Attached to LC [column; COSMOSIL 5C4
(4.6 mm ID × 35 mm, manufactured by Nacalai Tesque), eluent; linear gradient of 60% from 0.05% acetonitrile initial concentration 36% to 20% in 0.05% TFA, flow rate; 1.0 ml / min] . Mutant N176CC acylase Y705L has about 48% of β chain and α chain, respectively.
And eluted with about 51% concentration of acetonitrile. Collect each eluate, freeze-dry and
A (β) chain was obtained. Similarly, the amino acid terminal of the mutant N176CC acylase Y317L was also determined.

(Ii) Determination of amino terminal sequence The amino terminal sequence of the α (β) chain was determined by a gas phase sequencer 470A (manufactured by Applied Biosystems) and confirmed to be the same as expected.

[0082]

INDUSTRIAL APPLICABILITY The mutant CC acylase of the present invention is a novel enzyme which has a high enzymatic activity and catalyzes the reaction of GL-7ACA to 7ACA, and is useful for the production of 7ACA. Further, according to the present invention, it is possible to provide an expression system that expresses the mutant CC acylase in high yield and a method for efficiently producing 7ACA using the mutant CC acylase.

[0083]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 2325 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Sequence features Characteristic symbols: CDS Location: 4. ． 2322 Method for determining feature: E Symbol representing feature: mutation Location: 952. ． 954 Method of characterizing: E sequence ATG ACT ATG GCA GCT AAT ACG GAT CGC GCG GTC TTG CAG GCG GCG CTG 48 Met Thr Met Ala Ala Asn Thr Asp Arg Ala Val Leu Gln Ala Ala Leu -1 1 5 10 15 CCG CCG CTT TCC GGC AGC CTC CCC ATT CCC GGA TTG AGC GCG TCG GTC 96 Pro Pro Leu Ser Gly Ser Leu Pro Ile Pro Gly Leu Ser Ala Ser Val 20 25 30 CGC GTC CGG CGC GAT GCC TGG GGC ATC CCG CAT ATC AAG GCC TCG GGC 144 Arg Val Arg Arg Asp Ala Trp Gly Ile Pro His Ile Lys Ala Ser Gly 35 40 45 GAG GCC GAT GCC TAT CGG GCG CTG GGC TTC GTC CAT TCG CAG GAC CGT 192 Glu Ala Asp Ala Tyr Arg Ala Leu Gly Phe Val His Ser Gln Asp Arg 50 55 60 CTT TTC CAG ATG GAG CTG ACG CGT CGC AAG GCG CTG GGA CGC GCG GCC 240 Leu Phe Gln Met Glu Leu Thr Arg Arg Lys Ala Leu Gly Arg Ala Ala 65 70 75 GAA TGG CTG GGC GCC GAG GCC GCC GAG GCC GAT ATC CTC GTG CGC CGG 288 Glu Trp Leu Gly Ala Glu Ala Ala Glu Ala Asp Ile Leu Val Arg Arg 80 85 90 95 CTC GGA ATG GAA AAA GTC TGC CGG CGC GAC TTC GAG GCC TTG GGC GTC 336 Leu Gly Met Glu Lys Val Cys Ar g Arg Asp Phe Glu Ala Leu Gly Val 100 105 110 GAG GCG AAG GAC ATG CTG CGG GCT TAT GTC GCC GGC GTG AAC GCA TTC 384 Glu Ala Lys Asp Met Leu Arg Ala Tyr Val Ala Gly Val Asn Ala Phe 115 120 125 CTG GCT TCC GGT GCT CCC CTG CCT GTC GAA TAC GGA TTG CTC GGA GCA 432 Leu Ala Ser Gly Ala Pro Leu Pro Val Glu Tyr Gly Leu Leu Gly Ala 130 135 140 GAG CCG GAG CCC TGG GAG CCT TGG CAC AGC ATC GCG GTG ATG CGC CGG 480 Glu Pro Glu Pro Trp Glu Pro Trp His Ser Ile Ala Val Met Arg Arg 145 150 155 CTG GGC CTG CTT ATG GGT TCG GTG TGG TTC AAG CTC TGG CGG ATG CTG 528 Leu Gly Leu Leu Met Gly Ser Val Trp Phe Lys Leu Trp Arg Met Leu 160 165 170 175 GCG CTG CCG GTG GTC GGA GCC GCG AAT GCG CTG AAG CTG CGC TAT GAC 576 Ala Leu Pro Val Val Gly Ala Ala Asn Ala Leu Lys Leu Arg Tyr Asp 180 185 190 GAT GGC GGC CGG GAT TTG CTC TGC ATC CCG CCG GGC GCC GAA GCC GAT 624 Asp Gly Gly Arg Asp Leu Leu Cys Ile Pro Pro Gly Ala Glu Ala Asp 195 200 205 CGG CTC GAG GCG GAT CTC GCG ACC CTG CGG CCC GCG GTC GAT GCG CTG 672 Arg Leu Glu Ala As p Leu Ala Thr Leu Arg Pro Ala Val Asp Ala Leu 210 215 220 CTG AAG GCG ATG GGC GGC GAT GCC TCC GAT GCT GCC GGC GGC GGC AGC 720 Leu Lys Ala Met Gly Gly Asp Ala Ser Asp Ala Ala Gly Gly Gly Ser 225 230 235 AAC AAC TGG GCG GTC GCT CCG GGC CGC ACG GCG ACC GGC AGG CCG ATC 768 Asn Asn Trp Ala Val Ala Pro Gly Arg Thr Ala Thr Gly Arg Pro Ile 240 245 250 255 CTC GCG GGC GAT CCG CAT CGC GTC TTC GAA ATC CCG GGC ATG TAT GCG 816 Leu Ala Gly Asp Pro His Arg Val Phe Glu Ile Pro Gly Met Tyr Ala 260 265 270 CAG CAT CAT CTG GCC TGC GAC CGG TTC GAC ATG ATC GGC CTG ACC GTG 864 Gln His His Leu Ala Cys Asp Arg Phe Asp Met Ile Gly Leu Thr Val 275 280 285 CCG GGC GTG CCG GGC TTC CCG CAC TTC GCG CAT AAC GGC AAG GTC GCC 912 Pro Gly Val Pro Gly Phe Pro His Phe Ala His Asn Gly Lys Val Ala 290 295 300 TAT TGC GTC ACC CAT GCC TTC ATG GAC ATC CAC GAT CTC CTT CTA GAG 960 Tyr Ser Val Thr His Ala Phe Met Asp Ile His Asp Leu Leu Leu Glu 305 310 315 CAG TTC GCG GGG GAG GGC CGC ACT GCG CGG TTC GGC AAC GAT TTC GAG 1008 Gln P he Ala Gly Glu Gly Arg Thr Ala Arg Phe Gly Asn Asp Phe Glu 320 325 330 335 CCC GTC GCC TGG AGC CGG GAC CGT ATC GCG GTC CGG GGT GGC GCC GAT 1056 Pro Val Ala Trp Ser Arg Asp Arg Ile Ala Val Arg Gly Gly Ala Asp 340 345 350 CGC GAG TTC GAT ATC GTC GAG ACG CGC CAT GGC CCG GTT ATC GCG GGC 1104 Arg Glu Phe Asp Ile Val Glu Thr Arg His Gly Pro Val Ile Ala Gly 355 360 365 GAT CCG CGC GAT GGC GCA GCG CTC ACG CTG CGT TCG GTC CAG TTC GCC 1152 Asp Pro Arg Asp Gly Ala Ala Leu Thr Leu Arg Ser Val Gln Phe Ala 370 375 380 380 GAG ACC GAT CTG TCC TTC GAC TGC CTG ACG CGG ATG CCG GGC GCA TCG 1200 Glu Thr Asp Leu Ser Phe Asp Cys Leu Thr Arg Met Pro Gly Ala Ser 385 390 395 ACC GTG GCC CAG CTC TAC GAC GCG ACG CGC GGC TGG GGC CTG ATC GAC 1248 Thr Val Ala Gln Leu Tyr Asp Ala Thr Arg Gly Trp Gly Leu Ile Asp 400 405 410 415 CAT AAC CTC GTC GCC GGG GAT GTC GCG GGC TCG ATC GGC CAT CTG GTC 1296 His Asn Leu Val Ala Gly Asp Val Ala Gly Ser Ile Gly His Leu Val 420 425 430 CGC GCC CGC GTT CCG TCC CGT CCG CGC GAA AAC GGC TG G CTG CCG GTG 1344 Arg Ala Arg Val Pro Ser Arg Pro Arg Glu Asn Gly Trp Leu Pro Val 435 440 445 CCG GGC TGG TCC GGC GAG CAT GAA TGG CGG GGC TGG ATT CCG CAC GAG 1392 Pro Gly Trp Ser Gly Glu His Glu Trp Arg Gly Trp Ile Pro His Glu 450 455 460 GCG ATG CCG CGC GTG ATC GAT CCG CCG GGC GGC ATC ATC GTC ACG GCG 1440 Ala Met Pro Arg Val Ile Asp Pro Pro Gly Gly Ile Ile Val Thr Ala 465 470 475 AAT AAT CGC GTC GTG GCC GAT GAC CAT CCC GAT TAT CTC TGC ACC GAT 1488 Asn Asn Arg Val Val Ala Asp Asp His Pro Asp Tyr Leu Cys Thr Asp 480 485 490 495 Cys His Pro Pro Tyr Arg Ala Glu Arg Ile Met Lys Arg Leu Val Ala 500 505 510 AAT CCG GCT TTC GCC GTC GAC GAT GCC GCC GCG ATC CAT GCC GAT ACG 1584 Asn Pro Ala Phe Ala Val Asp Asp Ala Ala Ala Ile His Ala Asp Thr 515 520 525 CTG TCG CCC CAT GTC GGG TTG CTG CGC CGG AGG CTC GAG GCG CTT GGA 1632 Leu Ser Pro His Val Gly Leu Leu Arg Arg Arg Leu Glu Ala Leu Gly 530 535 540 GCC CGC GAC GAC TCC GCG GCC GAA GGG CTG AGG CAG ATG CTC GTC GCC 1680 Ala Arg Asp Asp Ser Ala Ala Glu Gly Leu Arg Gln Met Leu Val Ala 545 550 555 TGG GAC GGC CGC ATG GAT GCG GCT TCG GAG GTC GCG TCT GCC TAC AAT 1728 Trp Asp Gly Arg Met Asp Ala Ala Ser Glu Val Ala Ser Ala Tyr Asn 560 565 570 575 GCG TTC CGC AGG GCG CTG ACG CGG CTG GTG ACG GAC CGC AGC GGG CTG 1776 Ala Phe Arg Arg Ala Leu Thr Arg Leu Val Thr Asp Arg Ser Gly Leu 580 585 590 GAG CAG GCG ATA TCG CAT CCC TTC GCG GCT GTC GCG CCG GGC GTC TCA 1824 Glu Gln Ala Ile Ser His Pro Phe Ala Ala Val Ala Pro Gly Val Ser 595 600 605 CCG CAA GGC CAG GTC TGG TGG GCC GTG CCG ACC CTG CTG CGC GAC GAC 1872 Pro Gln Gly Gln Val Trp Trp Ala Val Pro Thr Leu Leu Arg Asp Asp 610 615 620 GAT GCC GGA ATG CTG AAG GGC TGG AGC TGG GAC CAG GCC TTG TCT GAG 1920 Asp Ala Gly Met Leu Lys Gly Trp Ser Trp Asp Gln Ala Leu Ser Glu 625 630 635 GCC CTC TCG GTC GCG TCG CAG AAC CTG ACC GGG CGA AGC TGG GGC GAA 1968 Ala Leu Ser Val Ala Ser Gln Asn Leu Thr Gly Arg Ser Trp Gly Glu 640 645 650 655 GAG CAT CGG CCG CGC TTC ACG CAT CCG CTT GCC ACG CAA TTC CCG GCC 2016 Glu His Arg Pro Arg Phe Thr His Pro Leu Ala Thr Gln Phe Pro Ala 660 665 670 TGG GCG GGG CTG CTG AAT CCG GCT TCC CGT CCG ATC GGT GGC GAT GGC 2064 Trp Ala Gly Leu Leu Asn Pro Ala Ser Arg Pro Ile Gly Gly Asp Gly 675 680 685 GAT ACC GTG CTG GCG AAC GGG CTC GTC CCG TCA GCC GGG CCG CAG GCG 2112 Asp Thr Val Leu Ala Asn Gly Leu Val Pro Ser Ala Gly Pro Gln Ala 690 695 700 ACC TAT GGT GCC CTG TCG CGC TAC GTC TTC GAT GTC GGC AAT TGG GAC 2160 Thr Tyr Gly Ala Leu Ser Arg Tyr Val Phe Asp Val Gly Asn Trp Asp 705 710 715 AAT AGC CGC TGG GTC GTC TTC CAC GGC GCC TCC GGG CAT CCG GCC AGC 2208 Asn Ser Arg Trp Val Val Phe His Gly Ala Ser Gly His Pro Ala Ser 720 725 730 735 GCC CAT TAT GCC GAT CAG AAT GCG CCC TGG AGC GAC TGT GCG ATG GTG 2256 Ala His Tyr Ala Asp Gln Asn Ala Pro Trp Ser Asp Cys Ala Met Val 740 745 750 CCG ATG CTC TAT AGC TGG GAC AGG ATC GCG GCA GAG GCC GTG ACG TCG 2304 Pro Met Leu Tyr Ser Trp Asp Arg Ile Ala Ala Glu Ala Val Thr Ser 755 760 765 CAG GAA CTC GTC CCG GCC TGA 2325 Gln Glu Leu Val Pro Ala 770

SEQ ID NO: 2 Sequence length: 2325 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Sequence features Characteristic symbols: CDS Location: 4. ． 2322 Method for determining feature: E Symbol representing feature: mutation Location: 2116. ． 2118 Method of characterizing: E sequence ATG ACT ATG GCA GCT AAT ACG GAT CGC GCG GTC TTG CAG GCG GCG CTG 48 Met Thr Met Ala Ala Asn Thr Asp Arg Ala Val Leu Gln Ala Ala Leu -1 1 5 10 15 CCG CCG CTT TCC GGC AGC CTC CCC ATT CCC GGA TTG AGC GCG TCG GTC 96 Pro Pro Leu Ser Gly Ser Leu Pro Ile Pro Gly Leu Ser Ala Ser Val 20 25 30 CGC GTC CGG CGC GAT GCC TGG GGC ATC CCG CAT ATC AAG GCC TCG GGC 144 Arg Val Arg Arg Asp Ala Trp Gly Ile Pro His Ile Lys Ala Ser Gly 35 40 45 GAG GCC GAT GCC TAT CGG GCG CTG GGC TTC GTC CAT TCG CAG GAC CGT 192 Glu Ala Asp Ala Tyr Arg Ala Leu Gly Phe Val His Ser Gln Asp Arg 50 55 60 CTT TTC CAG ATG GAG CTG ACG CGT CGC AAG GCG CTG GGA CGC GCG GCC 240 Leu Phe Gln Met Glu Leu Thr Arg Arg Lys Ala Leu Gly Arg Ala Ala 65 70 75 GAA TGG CTG GGC GCC GAG GCC GCC GAG GCC GAT ATC CTC GTG CGC CGG 288 Glu Trp Leu Gly Ala Glu Ala Ala Glu Ala Asp Ile Leu Val Arg Arg 80 85 90 95 CTC GGA ATG GAA AAA GTC TGC CGG CGC GAC TTC GAG GCC TTG GGC GTC 336 Leu Gly Met Glu Lys Val Cy s Arg Arg Asp Phe Glu Ala Leu Gly Val 100 105 110 GAG GCG AAG GAC ATG CTG CGG GCT TAT GTC GCC GGC GTG AAC GCA TTC 384 Glu Ala Lys Asp Met Leu Arg Ala Tyr Val Ala Gly Val Asn Ala Phe 115 120 125 CTG GCT TCC GGT GCT CCC CTG CCT GTC GAA TAC GGA TTG CTC GGA GCA 432 Leu Ala Ser Gly Ala Pro Leu Pro Val Glu Tyr Gly Leu Leu Gly Ala 130 135 140 GAG CCG GAG CCC TGG GAG CCT TGG CAC AGC ATC GCG GTG ATG CGC CGG 480 Glu Pro Glu Pro Trp Glu Pro Trp His Ser Ile Ala Val Met Arg Arg 145 150 155 CTG GGC CTG CTT ATG GGT TCG GTG TGG TTC AAG CTC TGG CGG ATG CTG 528 Leu Gly Leu Leu Met Gly Ser Val Trp Phe Lys Leu Trp Arg Met Leu 160 165 170 175 GCG CTG CCG GTG GTC GGA GCC GCG AAT GCG CTG AAG CTG CGC TAT GAC 576 Ala Leu Pro Val Val Gly Ala Ala Asn Ala Leu Lys Leu Arg Tyr Asp 180 185 190 GAT GGC GGC CGG GAT TTG CTC TGC ATC CCG CCG GGC GCC GAA GCC GAT 624 Asp Gly Gly Arg Asp Leu Leu Cys Ile Pro Pro Gly Ala Glu Ala Asp 195 200 205 CGG CTC GAG GCG GAT CTC GCG ACC CTG CGG CCC GCG GTC GAT GCG CTG 672 Arg Leu Glu Al a Asp Leu Ala Thr Leu Arg Pro Ala Val Asp Ala Leu 210 215 220 CTG AAG GCG ATG GGC GGC GAT GCC TCC GAT GCT GCC GGC GGC GGC AGC 720 Leu Lys Ala Met Gly Gly Asp Ala Ser Asp Ala Ala Gly Gly Gly Ser 225 230 235 AAC AAC TGG GCG GTC GCT CCG GGC CGC ACG GCG ACC GGC AGG CCG ATC 768 Asn Asn Asn Trp Ala Val Ala Pro Gly Arg Thr Ala Thr Gly Arg Pro Ile 240 245 250 255 CTC GCG GGC GAT CCG CAT CGC GTC TTC GAA ATC CCG GGC ATG TAT GCG 816 Leu Ala Gly Asp Pro His Arg Val Phe Glu Ile Pro Gly Met Tyr Ala 260 265 270 CAG CAT CAT CTG GCC TGC GAC CGG TTC GAC ATG ATC GGC CTG ACC GTG 864 Gln His His Leu Ala Cys Asp Arg Phe Asp Met Ile Gly Leu Thr Val 275 280 285 CCG GGC GTG CCG GGC TTC CCG CAC TTC GCG CAT AAC GGC AAG GTC GCC 912 Pro Gly Val Pro Gly Phe Pro His Phe Ala His Asn Gly Lys Val Ala 290 295 300 TAT TGC GTC ACC CAT GCC TTC ATG GAC ATC CAC GAT CTC TAT CTC GAG 960 Tyr Ser Val Thr His Ala Phe Met Asp Ile His Asp Leu Tyr Leu Glu 305 310 315 CAG TTC GCG GGG GAG GGC CGC ACT GCG CGG TTC GGC AAC GAT TTC GAG 1008 G ln Phe Ala Gly Glu Gly Arg Thr Ala Arg Phe Gly Asn Asp Phe Glu 320 325 330 335 CCC GTC GCC TGG AGC CGG GAC CGT ATC GCG GTC CGG GGT GGC GCC GAT 1056 Pro Val Ala Trp Ser Arg Asp Arg Ile Ala Val Arg Gly Gly Ala Asp 340 345 350 CGC GAG TTC GAT ATC GTC GAG ACG CGC CAT GGC CCG GTT ATC GCG GGC 1104 Arg Glu Phe Asp Ile Val Glu Thr Arg His Gly Pro Val Ile Ala Gly 355 360 365 GAT CCG CGC GAT GGC GCA GCG CTC ACG CTG CGT TCG GTC CAG TTC GCC 1152 Asp Pro Arg Asp Gly Ala Ala Leu Thr Leu Arg Ser Val Gln Phe Ala 370 375 380 GAG ACC GAT CTG TCC TTC GAC TGC CTG ACG CGG ATG CCG GGC GCA TCG 1200 Glu Thr Asp Leu Ser Phe Asp Cys Leu Thr Arg Met Pro Gly Ala Ser 385 390 395 ACC GTG GCC CAG CTC TAC GAC GCG ACG CGC GGC TGG GGC CTG ATC GAC 1248 400 405 410 415 CAT AAC CTC GTC GCC GGG GAT GTC GCG GGC TCG ATC GGC CAT CTG GTC 1296 His Asn Leu Val Ala Gly Asp Val Ala Gly Ser Ile Gly His Leu Val 420 425 430 CGC GCC CGC GTT CCG TCC CGT CCG CGC GAA AAC GGC TGG CTG CCG GTG 1344 Arg Ala Arg Val Pro Ser Arg Pro Arg Glu A sn Gly Trp Leu Pro Val 435 440 445 CCG GGC TGG TCC GGC GAG CAT GAA TGG CGG GGC TGG ATT CCG CAC GAG 1392 Pro Gly Trp Ser Gly Glu His Glu Trp Arg Gly Trp Ile Pro His Glu 450 455 460 GCG ATG CCG CGC GTG ATC GAT CCG CCG GGC GGC ATC ATC GTC ACG GCG 1440 Ala Met Pro Arg Val Ile Asp Pro Pro Gly Gly Ile Ile Val Thr Ala 465 470 475 AAT AAT CGC GTC GTG GCC GAT GAC CAT CCC GAT TAT CTC TGC ACC GAT 1488 Asn Asn Arg Val Val Ala Asp Asp His Pro Asp Tyr Leu Cys Thr Asp 480 485 490 495 TGC CAT CCG CCC TAC CGC GCC GAG CGC ATC ATG AAG CGC CTG GTC GCC 1536 Cys His Pro Pro Tyr Arg Ala Glu Arg Ile Met Lys Arg Leu Val Ala 500 505 510 AAT CCG GCT TTC GCC GTC GAC GAT GCC GCC GCG ATC CAT GCC GAT ACG 1584 Asn Pro Ala Phe Ala Val Asp Asp Ala Ala Ala Ile His Ala Asp Thr 515 520 525 CTG TCG CCC CAT GTC GGG TTG CTG CGC CGG AGG CTC GAG GCG CTT GGA 1632 Leu Ser Pro His Val Gly Leu Leu Arg Arg Arg Leu Glu Ala Leu Gly 530 535 540 GCC CGC GAC GAC TCC GCG GCC GAA GGG CTG AGG CAG ATG CTC GTC GCC 1680 Ala Arg Asp Asp Ser Al a Ala Glu Gly Leu Arg Gln Met Leu Val Ala 545 550 555 Trp Asp Gly Arg Met Asp Ala Ala Ser Glu Val Ala Ser Ala Tyr Asn 560 565 570 575 GCG TTC CGC AGG GCG CTG ACG CGG CTG GTG ACG GAC CGC AGC GGG CTG 1776 Ala Phe Arg Arg Ala Leu Thr Arg Leu Val Thr Asp Arg Ser Gly Leu 580 585 590 GAG CAG GCG ATA TCG CAT CCC TTC GCG GCT GTC GCG CCG GGC GTC TCA 1824 Glu Gln Ala Ile Ser His Pro Phe Ala Ala Val Ala Pro Gly Val Ser 595 600 605 CCG CAA GGC CAG GTC TGG TGG GCC GTG CCG ACC CTG CTG CGC GAC GAC 1872 Pro Gln Gly Gln Val Trp Trp Ala Val Pro Thr Leu Leu Arg Asp Asp 610 615 620 GAT GCC GGA ATG CTG AAG GGC TGG AGC TGG GAC CAG GCC TTG TCT GAG 1920 Asp Ala Gly Met Leu Lys Gly Trp Ser Trp Asp Gln Ala Leu Ser Glu 625 630 635 GCC CTC TCG GTC GCG TCG CAG AAC CTG ACC GGG CGA AGC TGG GGC GAA 1968 Ala Leu Ser Val Ala Ser Gln Asn Leu Thr Gly Arg Ser Trp Gly Glu 640 645 650 655 GAG CAT CGG CCG CGC TTC ACG CAT CCG CTT GCC ACG CAA TTC CCG GCC 2016 Glu His Arg Pro Arg Phe Thr His Pro Leu Ala Thr Gln Phe Pro Ala 660 665 670 TGG GCG GGG CTG CTG AAT CCG GCT TCC CGT CCG ATC GGT GGC GAT GGC 2064 Trp Ala Gly Leu Leu Asn Pro Ala Ser Arg Pro Ile Gly Gly Asp Gly 675 680 685 GAT ACC GTG CTG GCG AAC GGG CTC GTC CCG TCA GCC GGG CCG CAG GCG 2112 Asp Thr Val Leu Ala Asn Gly Leu Val Pro Ser Ala Gly Pro Gln Ala 690 695 700 ACC CTG GGT GCC TTA AGC CGC TAC GTC TTC GAT GTC GGC AAT TGG GAC 2160 Thr Leu Gly Ala Leu Ser Arg Tyr Val Phe Asp Val Gly Asn Trp Asp 705 710 715 AAT AGC CGC TGG GTC GTC TTC CAC GGC GCC TCC GGG CAT CCG GCC AGC 2208 Asn Ser Arg Trp Val Val Phe His Gly Ala Ser Gly His Pro Ala Ser 720 725 730 735 GCC CAT TAT GCC GAT CAG AAT GCG CCC TGG AGC GAC TGT GCG ATG GTG 2256 Ala His Tyr Ala Asp Gln Asn Ala Pro Trp Ser Asp Cys Ala Met Val 740 745 750 CCG ATG CTC TAT AGC TGG GAC AGG ATC GCG GCA GAG GCC GTG ACG TCG 2304 Pro Met Leu Tyr Ser Trp Asp Arg Ile Ala Ala Glu Ala Val Thr Ser 755 760 765 CAG GAA CTC GTC CCG GCC TGA 2325 Gln Glu Leu Val Pro Ala 770

[Brief description of drawings]

FIG. 1 is a diagram showing a restriction enzyme map of a mutant CC acylase Y705L expression vector pTNY705L.

FIG. 2 is a view showing a restriction enzyme map of an expression vector pTNY317L of mutant CC acylase Y317L.

FIG. 3: Plasmids pCK013 and mp19pfu62
It is a figure which shows the procedure of constructing the expression vector pTNY705L from Y705L.

FIG. 4: Plasmids pCC013A and mp18p183
It is a figure which shows the procedure of constructing the expression vector pTNY317L from Y317L.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI technical display location C12R 1:19)

Claims (7)

[Claims] 1. A precursor amino acid sequence before being processed into α-subunits and β-subunits in a host cell has the formula: A1-316-X1-A318-704-X2-A706-773 ( In the formula, A1-316 represents an amino acid sequence identical to the amino acid sequence of Thr1 to Leu316 of natural cephalosporin C acylase, and A318-704 represents the amino acid sequence of Leu318 to Thr704 of natural cephalosporin C acylase. The amino acid sequence identical to the sequence is shown.
773 is Gly of natural cephalosporin C acylase
The same amino acid sequence as the amino acid sequence from 706 to Ala773 is shown. X1 represents Tyr or other amino acid, and X2 represents Tyr or other amino acid. However, when X1 is Tyr, X2 is an amino acid other than Tyr. ), A mutant cephalosporin C
Acylase. 2. X1 is Leu and / or X2 is Le.
The mutant cephalosporin C acylase according to claim 1, which is u. 3. A DNA encoding the mutant cephalosporin C acylase according to claim 1 or 2. 4. An expression vector containing the DNA according to claim 3. 5. A host cell transformed with the expression vector according to claim 4. 6. The mutant cephalo according to claim 1 or 2, wherein the host cell according to claim 5 is cultured in a medium, and the mutant cephalosporin C acylase is collected from the resulting culture. Method for producing sporin C acylase. 7. The formula: A compound (II) represented by the formula (wherein R ¹ represents acetoxy, hydroxy or hydrogen. R ² represents an acyl carboxylate) or a salt thereof, which is a transformed host cell culture. Alternatively, by contacting the treated product, the compound of the formula: (In the formula, R ¹ has the same meaning as above.) A compound (I) or a salt thereof is obtained, and a process for producing the compound (I).