JPH0898686A - Variant type cephalosporin c acylase and its production - Google Patents

Abstract

PURPOSE: To obtain the subject new enzyme having a specific amino acid sequence as a form of a precursor before processing into α-subunit and β-subunit in a host cell and capable of decomposing cephalosporin C into 7- aminocephalosporanic acid. CONSTITUTION: This cephalosporin C acylase is a new variant type enzyme in which an amino acid sequence as a precursor form before processing into α-subunit and β-subunit in a host cell is expressed by formula I (A1-169 is same amino acid sequence as an amino acid sequence from Thr1 to Phe169 of natural cephalosporin C acylase; A171-773 is same amino acid sequence as an amino acid sequence from Len171 to Ala773 of natural cephalosporin C acylase; X1 is an amino acid other than Lys) and hydrolyzes cephalosporin C of formula II (R1 is a cetoxy, OH, H; R2 is a carboxy acyl) to 7-aminocephalosporanic acid of formula III. The cephalosporin C acylase is obtained by manifesting a gene in which 170th amino acid of natural type enzyme gene is changed in the host cell.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a novel cephalosporin C acylase (hereinafter referred to as CC acylase). More specifically, it relates to a novel mutant CC acylase, a gene encoding the same, an expression vector containing the gene, a microorganism transformed with the expression vector, and a method for producing the mutant CC acylase. Furthermore, the present invention relates to a method for producing a cephalosporin compound using the culture of the above transformant or a treated product thereof.

[0002]

2. Description of the Related Art CC acylase generally uses cephalosporin C as 7-aminocephalosporanic acid (7-ACA).
It is an enzyme that hydrolyzes into. To date, three enzymes, cephalosporin C acylases SE83, N176 and V22, have been found as enzymes classified as CC acylases, and their amino acid sequences are shown in the Journal of Ferme.
ntation and Bioengineering, Vol.72, p232-243 (199
It is disclosed in 1). In this document, the numbering of the amino acid sequence of CC acylase begins with the Met group at its N-terminal site.

However, in the present specification, the numbering of the amino acid sequence of CC acylase starts from the Thr group adjacent to the Net-terminal Met group (see SEQ ID NO: 1 in the Sequence Listing).
This is because the Met at the N-terminal part of the α-subunit of the mature CC acylase obtained by expressing the CC acylase gene in a prokaryote is usually eliminated by a host cell enzyme (for example, aminopeptidase etc.), N
This is because it becomes a mature CC acylase having a Thr group as a terminal amino acid.

[0004] The above-mentioned document describes that a natural CC acylase produced by recombinant DNA technology produces GL-7ACA acylase activity [7-β- (4-carboxybutanamide) -cephalosporanic acid from 7-aminocephalosporanic acid. Refers to activity. ] Is also disclosed.

[0005]

The object of the present invention is to provide a novel mutant CC acylase, a DNA encoding the same, an expression vector containing the DNA, a transformant into which the vector is introduced, and the transformant. It is intended to provide a method for producing a mutant CC acylase by culturing. Another object of the present invention is to provide a method for producing a cephalosporin compound using the culture of the above transformant or a treated product thereof.

[0006]

Means for Solving the Problems The present inventors have conducted extensive studies to obtain a CC acylase having a high enzyme activity, particularly a high enzyme activity for GL-7ACA, and as a result, a novel CC having such desirable properties has been obtained. The production of acylase was successful and the present invention was completed.

That is, the present invention relates to a novel mutant CC acylase having the following characteristics. Natural CC
A mutant CC acylase in which Lys at the 170th amino acid sequence of acylase is substituted with another amino acid. In other words, the mutant CC acylase of the present invention can be represented by the following formula as a precursor form before being processed into α-subunit and β-subunit. A1-169-X1-A171-773 (In the formula, A1-169 is Thr1 of natural CC acylase.
1 to Phe169 have the same amino acid sequence. A171-773 is Le of natural CC acylase
It shows the same amino acid sequence as the amino acid sequence from u171 to Ala773. X1 is an amino acid other than Lys. The present invention also provides a mutant C wherein X1 is Gln in the above formula.
Regarding C acylase.

The following three letters of the alphabet used in the present specification mean a natural L-amino acid: (Gly)
Glycine, (Ala) alanine, (Val) valine,
(Leu) leucine, (Ile) isoleucine, (Se
r) serine, (Thr) threonine, (Asp) aspartic acid, (Glu) glutamic acid, (Asn) asparagine, (Gln) glutamine, (Lys) lysine,
(Arg) arginine, (Cys) cysteine, (Me
t) methionine, (Phe) phenylalanine, (Ty
r) tyrosine, (Trp) tryptophan, (His)
Histidine, (Pro) proline.

In this specification, the following nomenclature, which is widely used by academic societies in this field, is adopted for the nomenclature of individual mutant CC acylases. That is, the mutant CC acylase in which the Lys residue at position 170 of the amino acid sequence of the natural CC acylase is replaced with Gln is a mutant C acylase.
C acylase K170Q, where K means the one-letter code of the Lys residue to be replaced, 170 means the substitution position of the amino acid sequence of the natural CC acylase, and Q
Means a one-letter symbol for Gln in which the Lys residue is substituted.

The amino acid sequence of the mutant CC acylase of the present invention having such characteristics and D encoding the same
Specific examples of the nucleotide sequence of NA are shown in the sequence listing below.
SEQ ID NO: 1 shows the nucleotide sequence of DNA encoding a precursor of mutant CC acylase K170Q, which can be expressed in plasmid pCKK170Q, and the amino acid sequence deduced therefrom.

The mutant CC acylase of the present invention can be prepared by using a method commonly used by those skilled in the art such as recombinant DNA technology and polypeptide synthesis method.

When the recombinant DNA technology is used, the mutant CC acylase of the present invention is prepared by culturing a host cell transformed with an expression vector containing a DNA encoding its amino acid sequence in a medium, Can be prepared by collecting the mutant CC acylase.

The details of this process will be described below. Examples of the host cell include microorganisms such as bacteria (eg, Escherichia coli, Bacillus subtilis), yeasts (eg, Saccharomyces cerevisiae), animal cell lines and cultured plant cells). Preferable microorganisms include bacteria, in particular strains belonging to the genus Escherichia (for example, E. coli JM109 ATCC 53323, E. coli HB101).
ATCC 33694, E. coli HB101-16 FERM BP-1872, E. col
i 294 ATCC 31446), yeast, especially Saccharomyces
Strains belonging to the genus (eg Saccharomyces cerevisiae A
H22), animal cells (eg mouse L929 cells, Chinese hamster ovary (CHO) cells, etc.) and the like.

When a bacterium, particularly E. coli, is used as a host cell, the expression vector generally includes at least a promoter-operator region, a start codon, a DNA encoding the amino acid sequence of a mutant CC acylase, a stop codon, a terminator region and a replicable unit. Composed of.
When yeast or animal cells are used as host cells, the expression vector preferably contains at least a promoter, a start codon, a signal peptide and a DNA encoding the amino acid sequence of mutant CC acylase, and a stop codon. Enhancer sequences, 5 ′ and 3 ′ untranslated regions of mutant CC acylases, splicing junctions, polyadenylation sites and replicable units can also be incorporated into expression vectors.

The promoter-operator region includes a promoter, an operator and a Shine-Dalgarno (SD) sequence (for example, AAGG). Preferably the promoter-operator region is a conventionally used promoter-operator region (eg E. col.
i PL-promoter and trp-promoter) and a CC acylase N-176 chromosomal gene promoter.

In the case of S. cerevisiae, the promoter for expressing the mutant CC acylase in yeast includes TRP1 gene, ADHI or ADHII gene, and acid phosphatase (PH05) gene promoter. The promoter for expressing the mutant CC acylase in mammalian cells includes SV40 early promoter or late promoter, HTLV-LTR-promoter, mouse metallothionein I (MMT) -promoter, vaccinia-promoter and the like.

Suitable start codons include the methionine codon (ATG).

The signal peptides include signal peptides of other commonly used enzymes (natural t-PA signal peptide, natural plasminogen signal peptide) and the like.

The DNA encoding the amino acid sequence of the mutant CC acylase of the present invention can be prepared by a conventional method. For example, a DNA synthesizer is used to synthesize a part or all of the DNA, and / or a transformant [eg, E. coli JM109 (pCCN176-2) FER
M BP-3047], a suitable vector (eg p
The complete DNA sequence encoding the native CC acylase inserted into CCN176-2) is prepared by a suitable method, for example, a suitable enzyme (eg, restriction enzyme, alkaline phosphatase, polynucleotide kinase, DNA ligase, DN).
In addition to treatment with A polymerase, etc., conventional mutagenesis methods (eg, cassette mutagenesis [Tokunaga, T. et al., Eur. J. Bi.
Ochem. Vol.153, p445-449 (1985)], PCR mutation method [Higuchi, R et al., Nucleic Acids Res. Vol.16, p7351-7]
367 (1988)], Kunkel method [Kunkel, T. A. et al., Me.
thods Enzymol. Vol. 154, p367 (1987), etc.]).

The stop codon includes a commonly used stop codon (eg, TAG, TGA, etc.).

The terminator region includes a natural or synthetic terminator (eg, synthetic fd phage terminator).

A replication-competent unit is a DN having the ability to replicate its entire DNA sequence in a host cell.
Compound A refers to natural plasmids, artificially modified plasmids (eg, DNA fragments prepared from natural plasmids) and synthetic plasmids. A preferred plasmid is the plasmid pBR322 in E. coli, or its artificial modification (pBR3
DNA fragment obtained by treating 22 with an appropriate restriction enzyme) is yeast 2μ plasmid or yeast chromosomal DNA in yeast, or plasmid p in mammalian cells.
RSVneo ATCC 37198, plasmid pSV2dhfr ATCC 3714
5, plasmid pdBPV-MMTneo ATCC 37224, plasmid
Examples include pSV2neo ATCC 37149.

The enhancer sequence includes the enhancer sequence of SV40 (72b.p.).

As the polyadenylation site, SV
Forty polyadenylation sites are included.

The splicing junction site is SV4
0 splicing junctions are included.

A promoter, a start codon, a DNA encoding the amino acid sequence of the mutant CC acylase of the present invention,
The stop codon and the terminator region can be ligated continuously and circularly to an appropriate replicable unit (plasmid), and if desired, by a conventional method (eg, digestion with a restriction enzyme, ligation using T4 DNA ligase). A suitable DNA fragment (eg, linker,
An expression vector can be obtained by using other restriction sites).

The host cell is transformed (transfected) with the above-mentioned expression vector. Transformation (transfection) can be performed by a conventional method (eg, Kushner method for E. coli, calcium phosphate method for mammalian cells, microinjection, etc.) to obtain a transformant (transfectant). .

In order to produce the mutant CC acylase in the process of the present invention, the thus obtained transformant containing the above expression vector is cultivated in an aqueous nutrient culture solution.

The nutrient medium includes carbon sources (eg glucose, glycerin, mannitol, fructose, lactose) and inorganic or organic nitrogen sources (eg ammonium sulfate, ammonium chloride, casein hydrolysates, yeast extract, polypeptone, bacto). Tryptone, beef extract, etc.). If desired, other nutritional sources [for example, inorganic salts (for example, sodium or potassium diphosphate, dipotassium hydrogen phosphate, magnesium chloride, magnesium sulfate, calcium chloride), vitamins (for example, vitamin B1), Antibiotics (eg, ampicillin, kanamycin, etc.) may be added to the medium. Dulbecco 'with fetal bovine serum and antibiotics for culturing mammalian cells
s Modified Eagle's Minimum Essenntial Medium (DME
M) is often used.

Cultivation of the transformant (transfectant) is usually pH 5.5 to 8.5 (preferably pH 7 to 7.5), 18
It is carried out at -40 ° C (preferably 20-30 ° C) for 5-50 hours.

When the mutant CC acylase thus produced is present in the culture medium, the culture is filtered or centrifuged to obtain a culture filtrate (supernatant). The mutant CC acylase is a commonly used method for purifying and isolating a natural or synthetic protein from the culture filtrate (for example, dialysis, gel filtration, affinity column chromatography using anti-CC acylase monoclonal antibody, suitable Column chromatography on various adsorbents, high performance liquid chromatography, etc.).

When the produced mutant CC acylase is present in the periplasm and cytoplasm of the transformed transformant, the cells are collected by filtration and centrifugation, and the cell wall and / or cell membrane of the cells are subjected to, for example, sonication. And / or treatment with lysozyme to obtain cell debris.
The cell debris is treated with a suitable aqueous solution (eg, 8M urea aqueous solution,
6M guanidinium salt solution). The mutant CC acylase can be purified from the aqueous solution by a conventional method as exemplified above.

The invention further comprises the formula:

[0034]

[Chemical 3]

(Wherein R 1 represents acetoxy, hydroxy or hydrogen, R 2 represents an acyl carboxylate), or a salt thereof is used as a mutant C of the present invention.
Contact with a culture of a microorganism transformed with an expression vector containing a DNA encoding C acylase or a treated product thereof to give a compound of the formula:

[0036]

[Chemical 4]

The present invention provides a method for producing the compound (I) represented by the formula (wherein R 1 has the same meaning as defined above) or a salt thereof.

Examples of the carboquinate acyl represented by R 2 include an aliphatic, aromatic or heterocyclic carboxyl acyl, and suitable examples thereof include an amino group, a carboxy group, a C1-C6 alkanoylamino group and benzamide. C1 to C which may have one or two suitable substituents selected from the group consisting of groups and thienyl groups and the like.
6 is alkanoyl.

Suitable salts of compound (I) and compound (II) include alkali metal salts (for example, sodium salt,
Potassium salt, lithium salt).

If the CC acylase activity is usually present in the transformed cells, examples of the substance obtained by treating the culture (hereinafter referred to as the treated substance) are as follows.

(1) Live cells: isolated from the culture by a conventional method such as filtration or centrifugation. (2) Dry cells: Obtained by drying the live cells of (1) above by a conventional method such as freeze-drying or vacuum drying. (3) Cell-free extract; live cells of (1) above or (2) above
The dried cells can be obtained by disrupting the dried cells by a conventional method (for example, autolyzing the cells with an organic solvent, crushing the cells with alumina, sea sand, or treating the cells with ultrasonic waves). (4) Enzyme solution; obtained by purifying or partially purifying the cell-free extract of the above (3) by a conventional method (for example, column chromatography). (5) Immobilized cells or enzymes: The cells of (1) or (2) above or the enzyme of (4) above are immobilized by a conventional method (for example, a method using acrylamide, glass beads, ion exchange resin, etc.). It is prepared by

The reaction consisting of contacting the compound (II) of the present invention with an enzyme can be carried out in an aqueous medium such as water or a buffer. That is, usually the compound (II)
Is carried out by dissolving or suspending the culture or a treated product thereof in an aqueous medium such as water or a buffer solution containing

The suitable pH of the reaction mixture, the concentration of compound (II), the reaction time and the reaction temperature may vary depending on the properties of the culture used or its treated product. Generally, the reaction is pH 6-10, preferably pH 7-9, 5-40.
It is carried out at 0 ° C, preferably 5 to 37 ° C for 0.5 to 50 hours.

The concentration of the compound (II) as a substrate in the reaction mixture can be suitably selected within the range of 1 to 100 mg / ml.

Compound (I) thus produced
Is purified and isolated from the above reaction mixture by a conventional method.

In the following examples, plasmids, enzymes such as restriction enzymes, T4 DNA ligase, and other materials are commercially available and used according to conventional methods. DNA
The procedures used for the cloning of E. coli, transformation of host cells, cultivation of transformants, collection of CC acylase from the culture, etc. are well known to those skilled in the art,
Alternatively, it can be adopted from the literature.

[0047]

The following examples are given for the purpose of explaining the present invention more specifically, and the present invention is not limited thereto.

Example 1 Preparation of expression vector of natural CC acylase N176 under control of trp promoter (1) Construction of ampicillin resistant expression vector pCC002A of natural CC acylase N176: (i) Construction of pCC001A: plasmid pCCN17
6-3 (1.0 μg) [JOURNAL OF FERMENTATION AND
BIOENGINEERING, Vol. 72, p235 (1991), and the plasmid pCCN176-2 (this was prepared according to a conventional method using E. coli JM1
09 (pCCN176-2) (available from FERM BP-3047) has been described] and digested with EcoRI and HindIII to carry all coding regions of CC acylase N176. The .9 kb fragment was isolated by agarose gel electrophoresis. On the other hand, pTQiPAΔtrp (1.0 μm) which is an expression vector of mutant t-PA
g), [this is the transformant E. co
liHB101-16 (pTQiPAΔtrp) FER
It can be obtained from MBP-1870. For its preparation method, see European Patent Application Publication No. 302456.
Described in No.] was digested with EcoRI and HindIII. A 4.3 kb DNA carrying the resulting trp promoter, part of the t-PA coding region (Cys92 to Trp113), and the copy sequence of the fd phage central terminator was isolated. T4 DNA ligase (300 units, in 40 μl of ligation buffer consisting of 50 mM Tris-HCl, 10 mM MgCl ₂ , 10 mM dithiothreitol and 1 mM ATP)
DNA of 2.9 kb previously obtained in the presence of Takara Shuzo
The fragment and the 4.3 kb DNA fragment were mixed and ligated at 16 ° C. for 5 hours. Using the conjugate, E. E. coli JM109 was transformed. From one of the transformants resistant to ampicillin, pCC001A
The desired plasmid, designated as, was obtained and characterized by restriction enzyme mapping.

(Ii) Construction of pCC002A The plasmid pCC001A obtained in (i) contains a part of the t-PA gene (Cys92 to Trp113) between the trp promoter and the acylase gene. To remove this region, pCC001A (1.0 μg) was added to C
6.1 kb D obtained by digestion with laI and MluI
The NA fragment was isolated. On the other hand, pCCN176-
3 (1 μg) was digested with MluI and Sau3AI,
18 that encodes the acylase between Asp7 and Arg71
A 9 bp DNA was isolated. Synthetic DNA oligomer 00
2a and 002b (0.5 nmol each, see Table 1)
To T4 polynucleotide kinase (1.5 units,
Using Takara Shuzo, a buffer (kination buffer; 5)
0 mM Tris-HCl, 10 mM MgCl ₂ , 10 mMD
Phosphorylation in TT, 1.0 mM ATP) at 37 ° C. for 1 hour, the reaction mixture was heated at 55 ° C. for 20 minutes to inactivate the enzyme. The resulting mixture was mixed with 20 μl of ligation buffer in the presence of T4 DNA ligase at 15 ° C. for 3 hours at 189 bp of Sau obtained above.
The 3AI / MluI DNA fragment was mixed and ligated. To the resulting conjugate, 6.1 kb ClaI / M
The luI DNA fragment was added and the mixture was incubated at 4 ° C. for 16 hours in the presence of additional T4 DNA ligase (300 units). The resulting conjugate was used to transform E. E. coli JM109 was transformed. The desired plasmid pCC002A, which is an expression vector for CC acylase N176, was isolated from one of these transformants, and its characteristics were examined by restriction enzyme mapping.

[0050]

[Table 1]

(2) Kanamycin resistant CC acylase N
Construction of pCK002, an expression vector of 176. Plasmid pCC002A was transformed with DraI (Toyobo Co., Ltd.).
Made). The resulting mixture was treated with phenol to remove the enzyme and precipitated with ethanol. The recovered DNA was suspended in 20 μl of ligation buffer, mixed with phosphorylated EcoRI linker (2 μg, manufactured by Pharmacia), and incubated with T4 DNA ligase (300 units) at 4 ° C. for 16 hours. The reaction mixture was extracted with phenol and precipitated with ethanol. 4. The recovered DNA was digested with EcoRI and the resulting ampicillin resistance gene was deleted.
A 6 kb DNA was isolated by agarose gel electrophoresis. On the other hand, plasmid pA097 (1 μg) [this was used as transformant E. coli JM109 (pAO97)
It can be obtained from FERM BP-3772 by a conventional method. ] Was digested with EcoRI, and as a result, 1.2 kb DNA which is a kanamycin resistance gene was isolated. T4 DNA ligase (30 μl) in 50 μl of ligation buffer
0 unit), the 1.2 kb EcoRI
The DNA is reacted at 16 ° C. for 2 hours and then 5.6 kb Eco
It was attached to RI DNA. Using the conjugate, E. co
liJM109 was transformed with the desired plasmid p carrying the kanamycin resistance gene as an antibiotic marker.
CK002 was obtained.

Example 2 Construction of pCK013 which is a high expression vector of CC acylase N176 (1) Construction of pCC013A (i) Construction of pCC007A Plasmid pCC001 obtained in Example 1 (1) (i)
A was digested with EcoRI and MluI and the resulting 6.4 kb DNA fragment was isolated by agarose gel electrophoresis. Synthesized DNA oligomers 007a and 0, which have been phosphorylated in advance, on the recovered DNA.
07b (0.5 μg each, see Table 2) was treated with T4 DNA ligase (300 units) at 16 ° C. for 5 hours for binding. The resulting mixture was used to transform E. coli
Transformation of JM109 with desired plasmid pCC00
7A was obtained.

(Ii) Construction of pCCNt013 Plasmid pCC007A (1.0 μg) was digested with ClaI and BamHI, and the resulting 6.1 kb DNA was 5
% Polyacrylamide gel electrophoresis. The DNA was synthesized into synthetic oligomers 013a and 013b (0.
5 μg, each of which is phosphorylated. (See Table 2) was ligated with T4 DNA ligase (300 units). E. coli with the ligation mixture. coliJM
109 and transformed into the desired plasmid pCCNt01.
3 was isolated from ampicillin resistant transformants.

[0054]

[Table 2]

(Iii) Construction of pCC013A The plasmid pCCNt013 was digested with BamHI and MluI, and the resulting 6.1 kb DNA was isolated. On the other hand, pCC002 obtained in Example 1 (1) (ii)
A (1.0 μg) was digested with MluI and Sau3AI to obtain a 189 bp DNA fragment. The resulting DNA was ligated to the 6.1 kb BamHI / MluI DNA fragment using T4 DNA ligase (300 units) and the ligation mixture was used to E. coliJ
M109 was transformed. From one of the ampicillin-resistant transformants, the desired plasmid pCC013A having the AT-rich NH ₂ -terminal DNA sequence (encoding the same amino acid sequence as the amino acid sequence of native CC acylase N176) was isolated.

(2) Construction of pCK013 which is a kanamycin resistant expression vector of natural CC acylase N176 (i) Construction of pΔN176 Plasmid pCK002 obtained in Example 1 (2)
(1.0 μg) was digested with AatII (manufactured by Toyobo Co., Ltd.) and treated with T4 DNA ligase (150 units) for self-ligation of the obtained DNA. With such a ligation mixture E. E. coli JM109 was transformed to obtain the desired plasmid pΔN176 carrying a unique AatII restriction enzyme cleavage site.

(Ii) Construction of pCK013 Plasmid pΔN176 (1.0 μg) was digested with AatII and the linearized DNA was treated with a bacterial alkaline phosphatase (1 unit, manufactured by Takara Shuzo Co., Ltd.) in 100 mM Tris-HCl buffer (pH 8.0). ), And was treated at 42 ° C. for 1 hour. The dephosphorylated DNA was isolated and labeled with T4DN
A ligase was used to ligate to the 2.5 kb AatII DNA fragment from pCC013A. E. coli with the ligation mixture. E. coli JM109 was transformed to obtain a desired plasmid pCK013 carrying a kanamycin resistance gene as a marker.

Example 3 Point mutation of the DNA encoding CC acylase N176 by the Kunkel method (1) M of the DNA encoding CC acylase N176
Subcloning into 13 phage (i) Preparation of mp18p183 Plasmid pCC01 obtained in Example 2 (1) (iii)
3A was digested with HpaI and Eco47III, CC
A 1162 bp DNA encoding Thr1 to Ala374 of acylase N176 was isolated. The DNA is
To M13mp18 digested with HincII, T4DN
A. ligase was used to ligate and the ligation mixture was used to transform E.
E. coli JM109 was transformed. The desired RF DNA mp18p183 was isolated from one of the plaques and characterized by restriction enzyme mapping. On the other hand, a phage solution was prepared from the medium fraction (containing phage particles) excluding the cells, and the obtained phage solution was stored at 4 ° C until use.

(Ii) Single-stranded U-mp18p183-SS
(Kunkel, TA et al., Methods Enzyml. 154,
367): E. coli CJ236 (dut-, un
g-, F ') (Bio-Rad Laboratories) single colony was chloramphenicol (30 μg / m
1) in 2 ml 2XTY broth at 37 ° C, 16
Cultured for hours. The cells (0.1 ml) were transferred to fresh 2XTY broth (50 ml) containing 30 μg / ml chloramphenicol and the culture was continued at 37 ° C. 600
When the absorbance at nm reached 0.3, the culture was mp
18p183 phage solution (MOI <0.2) was added, and the culture was continued for further 5 hours. 4 of the resulting culture
After centrifugation at 17,000 xg for 15 minutes at 0 ° C, the supernatant was centrifuged again. The resulting supernatant (30 ml) was treated with RNase (150 μg / ml, Sigma) for 30 minutes at room temperature, and 7.5 ml of PEG solution (3.5 M) was added.
NH ₄ OAc 20% polyethylene glycol 8,000
0 solution) was added. Centrifuge (17,000 xg, 15
Min, 4 ° C.), the residue is treated with 300 mM NaCl, 100 m
M Tris-HCl (pH 8.0) and 0.1 mM EDTA
Was suspended in 200 μl of a buffer solution consisting of 200 μl of phenol and phenol / CHCl were added to the resulting solution.
₃ (1/1) 200 μl extraction followed by CHCl
_It was washed twice with ₃ (200 μl). To the solution, 7.5M
NH ₄ OAc (100 μl) and ethanol (600 μl
1) was added to precipitate the phage DNA. The DNA
Were collected by centrifugation and 700 μl of ice-cold 90% ethanol
Washed with and dried under vacuum. Purified single-stranded U-
DNA (U-mp18p183-SS) in TE buffer 2
Suspended in 0 μl and stored at 4 ° C until use.

(2) Preparation of RF DNA encoding mutant CC acylase K170Q (i) Oligodeoxyribonucleotide SO-K170
Synthesis of Q DNA oligomer SO-K170Q (5'AGCGCC
AGCATGCGCCAGAGCTTGGAACCACA
C3 ′) was synthesized using a 392A type DNA synthesizer (manufactured by Applied Biosystems). The DNA
From CPG (controlled pore glass) polymer support 2
It was liberated with 8% aqueous ammonia and then heated at 60 ° C. for 9 hours to remove all protecting groups. The reaction mixture was evaporated under reduced pressure under vacuum, and the residue was dissolved in 200 μl of TE buffer [10 mM Tris-HCl (pH 7.4) -1 mM EDTA]. The obtained crude DNA solution was subjected to reverse-phase HPLC [column; COSMOSIL C18, 4.6 mm x 150 mm (Nacalai Tesque), eluent; A: 0.1 M triethylammonium acetate buffer (pH 7.2-7.4), B: acetonitrile, gradient; start: A (100%), end: A
(60%) + B (40%), linear gradient for 25 minutes, flow rate; 1.2 ml / min]. The eluate containing the target DNA oligomer was collected and evaporated under reduced pressure under vacuum.
The purified DNA was dissolved in 200 μl of TE buffer and stored at −20 ° C. until use.

(Ii) Phosphorylation of oligodeoxyribonucleotides DNA oligomer SO-K170Q (about 167 pmo
l) using T4 polynucleotide kinase (4.5 units, manufactured by Takara Shuzo), 50 mM Tris-HCl (pH
7.8) 10 mM MgCl ₂ , 20 mM dithiothreitol (DTT), 1 mM ATP and 50 μg / m
Phosphorylation was carried out at 37 ° C. for 1 hour in 30 μl of a ligation buffer containing 1 bovine serum albumin (BSA).

(Iii) Annealing reaction 10 mM Tris-HCl (pH 8.0), 6 mM MgCl 2
_The oligomers phosphorylated in (ii) (1 μl, about 5.6 pmol) were templated U-mp18p183-SS in 9 μl of a buffer consisting of ₂ and 40 mM NaCl.
(0.10 pmol, about 250 ng). The mixture is heated at 70 ° C. for 5 minutes, then 3 minutes over 40 minutes.
It cooled at 0 degreeC and stood at 0 degreeC.

(Iv) Double-stranded DNA in vitro
Synthesis of the obtained annealing solution (10 μl) was added to a synthesis buffer [200 mM Tris / HCl (pH 8.0) -40 mM
MgCl ₂ ] 1 μl, 5 mM dNTP (dATP, d
CTP, dGTP and dTTP) 1 μl, T4 DNA
Ligase (300 units, Takara Shuzo) and T4DN
Mixed with A polymerase (10 units, Pharmacia). The mixture was sequentially incubated on ice for 5 minutes, 25 ° C. for 5 minutes, and 37 ° C. for 90 minutes.
10 mM Tris-HCl (pH 8.0) and 10 mM E
The reaction was stopped by adding 90 μl of buffer consisting of DTA.

(V) E. Transformation of E. coli JM109 3 μl of the synthetic DNA solution obtained in (iv) was transformed into E. coli. c
It was added to competent cells (200 μl) of oliJM109, and the cells were incubated on ice for 30 minutes to obtain transformants. On the other hand, E. coliJM109
Single colony of was cultured in L broth (2 ml) for 16 hours. The culture (0.1 ml) was transferred to fresh L broth (2 ml) and further cultured for 2 hours to obtain an indicator cell. Transformed cells (200μ
1) to H-Top agar (1% by adding indicator cells (200 μl) and preheating them at 55 ° C.)
Bactrypton, 0.8% NaCl, 0.8% agar)
Mixed with 3 ml. The cell-agar mixture was placed on an H plate (1% bactotryptone, 0.5% NaCl, 1.5%).
% Agar) and the plates were incubated at 37 ° C. for 16 hours.

(Vi) RF DN obtained from the transformant
Characteristics of A. E. 2XTY single colony of E. coli JM109
Broth (1.6% bactotryptone, 1% yeast extract,
Cultured in 2 ml of 0.5% NaCl) for 16 hours. The culture (0.1 ml) was replaced with fresh 2XTY broth (2 ml).
And further cultured for 2 hours. The plaques on the plate prepared in step (iv) were picked up with a bamboo toothpick (15 cm), and the toothpick was immediately transferred to the previously cultured 2XTY broth. Culturing was continued at 37 ° C. for 5 to 6 hours. 1 ml of the culture
Cells were collected by centrifugation at 10,000 rpm for 15 seconds at room temperature, and the supernatant (RF D in the next experiment
The phage solution used for large-scale preparation of NA) was stored at 4 ° C. until use. GTE the cells
Buffer solution [50 mM glucose, 25 mM Tris-HCl (p
H8.0), 25 mM EDTA] 100 μl, and suspended in an alkali-SDS solution (0.2 N NaOH, 1%
SDS) gently mixed with 200 μl and high salt buffer (3M KOA) using a Vortex ™ mixer.
c, 3M AcOH). The resulting mixture was centrifuged at 10,000 rpm for 5 minutes at room temperature. The obtained supernatant (400 μl) was treated with 300 μl of isopropyl alcohol, and the mixture was centrifuged at 10,000 rpm for 5 minutes.
Centrifuge for minutes. The upper layer (300 μl) was separated and mixed with 600 μl of ethanol. Centrifuge the mixture (1
(10,000 rpm, 5 minutes), the obtained precipitate was washed with 500 μl of ice-cold 70% ethanol, dried under vacuum, and suspended in 50 μl of TE buffer containing 1 μg / ml of RNase (manufactured by Sigma). , RF DNA mp18
A p183K170Q solution was obtained. A portion (10 μl) of the RFDNA solution was used for restriction endonuclease mapping with SphI. This is because the DNA oligomer SO-K170Q intentionally contains an SphI recognition site in its sequence to investigate mutations.

Example 4 Expression vector pCKK170Q
Construction of RF DNA (mp18p183K) obtained in Example 3
170Q) (10 μg) was digested with MluI (5 units, Toyobo Co., Ltd.) and BstBI (5 units, New England Biolabs Co., Ltd.). The obtained 582 bp DNA fragment was added to 0.8
% Of the agarose gel and isolated from the digestion mixture. On the other hand, pCK013 obtained in Example 2 (2)
(10 μg) with MluI (5 units) and BstB
Digested with I (5 units) and the 5697 bp DNA fragment was isolated. Ml of 582bp and 5697bp
Add uI / BstBI DNA to ligation buffer 20
Ligation was performed in 4 μl for 16 hours at 4 ° C. E. coli with the ligation mixture. E. coli JM109 was transformed. From one of the kanamycin resistant transformants, pC
The desired plasmid, designated KK170Q, was isolated and characterized by restriction endonuclease digestion (see Figure 1).

Example 5 Mutant CC acylase K170
DNA sequence encoding Q The sequence of pCKK170Q was directly determined by the Dye Deoxy ^™ method using a 373A type DNA sequencer (manufactured by Applied Biosystems). The determined sequence was in agreement with what was expected. The pCKK1
Mutant CC acylase K170Q that can be expressed in 70Q
The nucleotide sequence of the DNA encoding the precursor of and the amino acid sequence deduced therefrom is shown in SEQ ID NO: 1 in the sequence listing.

Example 6 Transformant (E. coli JM
109 / pCKK170Q) culture E. Transformation of E. coli JM109 with pCKK170Q
The transformant E. coli JM10
9 / pCKK170Q glycerol stock (1m
l), 100 μl containing 50 μg / ml ampicillin
Broth (1% bactotryptone, 0.5% yeast extract,
0.5% NaCl, pH 7.4) and the mixture is
It was cultured at 30 ° C. for 8 hours. 5 times the culture (0.2 ml)
20 ml MS broth containing 0 μg / ml ampicillin
(1.2% bactotryptone, 2.4% yeast extract,
1.25% glycerol, 0.11% leucine, 0.1
1% proline, 0.11% isoleucine, 1.25%
K₂HPO_Four, 0.38% KH₂PO_Four, 50 μg /
ml thiamine / hydrochloric acid, 2mM MgSO_Four・ 7H₂O,
0.2 mM CaCl₂・ 2H₂O, 0.05 mM F
eSO_Four・ 7H₂O), and the mixture at 30 ° C for 1
Cultured for 6 hours. The obtained culture (3.4 ml) was added to 1
% Glycerol and 25 μg / ml ampicillin
2% M9CA broth (2% casamino acid, 1.52%
Na₂HPO_Four・ 12H₂O, 0.3% KH ₂P
O_Four, 0.1% NH_FourCl, 0.05% NaCl,
2 mM MgSO_Four・ 7H₂O, 0.2 mM CaCl
₂・ 2H₂O, 50 μg / ml thiamine / hydrochloric acid, pH
7.2) and shake the mixture vigorously at 20 ° C.
While culturing (350-400 rpm / min). 8
At the hour, the final concentration of 3-indole acrylic acid was 20
Add to the culture so that it becomes μg / ml, and further 40 hours
The culture was continued. 20 ml of the obtained culture is 4
By centrifuging at 7,000 rpm for 5 minutes at ℃,
Collect cells and use it in 20 ml TE buffer (pH 8.0)
And suspended by sonication. The crushed material is 4
Insoluble substances by centrifugation at 15,000 rpm for 20 minutes at ℃
Was removed. The resulting supernatant was stored at 4 ° C and used for GL-7
For measuring ACA acylase activity and for mutant C
It was used to prepare C acylase K170Q.

Example 7 Purification and properties of acylase (1) Purification of mutant CC acylase K170Q E. coli obtained from 20 ml of the culture. coliJM109 /
Ammonium sulfate (4.18 g, final concentration: 35% saturated) was added to the crushed product of pCKK170Q (20 ml), and the mixture was stirred at room temperature for 20 minutes. Centrifuge the resulting mixture (20 ° C, 15,000 rpm, 20 minutes)
The supernatant was collected and treated with ammonium sulfate (5.56).
g, final concentration: 75% saturation). Centrifuge (20 ℃, 15.0
(00 rpm, 20 minutes) to collect the precipitate,
It was dissolved in 5 ml of 00 mM Tris-HCl (pH 9.0).
The resulting solution was dialyzed twice at 4 ° C. against 4 L each of 100 mM Tris-HCl buffer. The dialyzed product obtained is M
illex-HV ^™ (0.45 μm, Millipore) and purified by high performance liquid chromatography [column; TSKgel ^™ DEAE TOYOPEARL-
5PW (Tosoh), eluent; A: 20 mM Tris-hydrochloric acid (pH 8.0), B: 0.5 M NaCl-Tris-hydrochloric acid (pH 8.0), gradient; Start: A (80%) +
B (20%), end (after 30 minutes): A (50%) + B
(50%), flow rate; 1.0 ml / min]. About 0.16
The main peak eluted with the M concentration of NaCl solution was collected and dialyzed against 4 L of 20 mM Tris-hydrochloric acid (pH 9.0) to purify the mutant CC acylase K170Q.
Got

The purified CC acylase K170Q was applied to a reverse phase HPLC column [COSMOSIL 4.6 mm × 50].
mm (manufactured by Nacalai Tesque), eluent; A: 0.05% trifluoroacetic acid (TFA), B: 0.05% TFA containing 60% acetonitrile, gradient; start: A (40
%) + B (60%), end (after 20 minutes): A (0%)
+ B (100%)], and sodium dodecyl sulfate-
Polyacrylamide gel electrophoresis (SDS-PAGE)
Was analyzed. CC acylase K thus obtained
The purity of 170Q was about 95% by HPLC and SDS-PAGE.

(2) Measurement of GL-7ACA acylase specific activity GL-7 preincubated at 37 ° C. for 10 minutes
200 μl of ACA solution [0.15M Tris-HCl (pH
8.7) 10 mg / ml, and the pH was readjusted to 8.7 with 1N NaOH].
1 was added and the mixture was incubated at 37 ° C. for 5 minutes. The reaction was stopped by adding 220 μl of 5% acetic acid. The resulting mixed solution was centrifuged (at room temperature, 10,000 rpm for 5 minutes), and the supernatant was used for 7A.
The production of CA was measured. HPLC conditions: column; TSK
gel ODS-80 TMCTR 4.4 mm x 10
0 mm (manufactured by Tosoh Corporation), eluent; 3% (v / v) acetonitrile containing 5% (w / v) ammonium acetate, flow rate;
1.0 ml / min, injection volume; 10 μl, detector 254
nm 1 unit at 37 ° C for 1 minute with GL-7ACA
Was defined as the activity capable of producing 1.0 μmol of 7ACA. As a result, the activity of the mutant CC acylase K170Q of the present invention was 130% as compared with 100% of the activity of the natural CC acylase N176, and it was confirmed that the GL-7ACA acylase activity was improved.

(3) Determination of amino terminal sequence of mutant acylase (i) Isolation of both chains of CC acylase K170Q: Purified mutant CC acylase K170Q was subjected to reverse phase HPLC [column; COSMOSIL 5C ₄ ( 4.6m
m × 35 mm, manufactured by Nacalai Tesque), eluent: 0.05
A linear gradient of 60% in 20 minutes from an initial concentration of acetonitrile of 36% in TFA, flow rate; 1.0 ml / mi
n]. The β and α chains of CC acylase K170Q are
It was eluted with acetonitrile at concentrations of about 48% and about 51%, respectively. The eluates were collected and freeze-dried to obtain α-chain and β-chain of acylase.

(Ii) Determination of amino-terminal sequence The amino-terminal sequences of the α chain and β chain were determined by a gas phase sequencer 470A (manufactured by Applied Biosystems) and confirmed to be the same as expected.

[0074]

INDUSTRIAL APPLICABILITY The present invention can provide a mutant cephalosporin C acylase having a high GL-7ACA acylase activity, an expression system for expressing the enzyme in high yield, and a method for producing the enzyme.

[0075]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 2325 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Sequence features Characteristic symbols: CDS Location: 4. ． 2322 Method for determining feature: E Feature symbol: peptide Location: 4. ． 2322 Method for determining characteristic: S Character for expressing characteristic: mutation Location: 170 Method for determining characteristic: Sequence ATG ACT ATG GCA GCT AAT ACG GAT CGC GCG GTC TTG CAG GCG GCG CTG 48 Met Thr Met Ala Ala Asn Thr Asp Arg Ala Val Leu Gln Ala Ala Leu -1 1 5 10 15 CCG CCG CTT TCC GGC AGC CTC CCC ATT CCC GGA TTG AGC GCG TCG GTC 96 Pro Pro Leu Ser Gly Ser Leu Pro Ile Pro Gly Leu Ser Ala Ser Val 20 25 30 CGC GTC CGG CGC GAT GCC TGG GGC ATC CCG CAT ATC AAG GCC TCG GGC 144 Arg Val Arg Arg Asp Ala Trp Gly Ile Pro His Ile Lys Ala Ser Gly 35 40 45 GAG GCC GAT GCC TAT CGG GCG CTG GGC TTC GTC CAT TCG CAG GAC CGT 192 Glu Ala Asp Ala Tyr Arg Ala Leu Gly Phe Val His Ser Gln Asp Arg 50 55 60 CTT TTC CAG ATG GAG CTG ACG CGT CGC AAG GCG CTG GGA CGC GCG GCC 240 Leu Phe Gln Met Glu Leu Thr Arg Arg Lys Ala Leu Gly Arg Ala Ala 65 70 75 GAA TGG CTG GGC GCC GAG GCC GCC GAG GCC GAT ATC CTC GTG CGC CGG 288 Glu Trp Leu Gly Ala Glu Ala Ala Glu Ala Asp Ile Leu Val Arg Arg 80 85 90 95 CTC GGA ATG GAA AAA GTC TGC CGG CGC GAC TTC GAG GCC TTG GGC GTC 336 Leu Gly Met Glu Lys Val Cys Arg Arg Asp Phe Glu Ala Leu Gly Val 100 105 110 GAG GCG AAG GAC ATG CTG CGG GCT TAT GTC GCC GGC GTG AAC GCA TTC 384 Glu Ala Lys Asp Met Leu Arg Ala Tyr Val Ala Gly Val Asn Ala Phe 115 120 125 CTG GCT TCC GGT GCT CCC CTG CCT GTC GAA TAC GGA TTG CTC GGA GCA 432 Leu Ala Ser Gly Ala Pro Leu Pro Val Glu Tyr Gly Leu Leu Gly Ala 130 135 140 GAG CCG GAG CCC TGG GAG CCT TGG CAC AGC ATC GCG GTG ATG CGC CGG 480 Glu Pro Glu Pro Trp Glu Pro Trp His Ser Ile Ala Val Met Arg Arg 145 150 155 CTG GGC CTG CTT ATG GGT TCG GTG TGG TTC CAG CTC TGG CGC ATG CTG 528 Leu Gly Leu Leu Met Gly Ser Val Trp Phe Gln Leu Trp Arg Met Leu 160 165 170 175 GCG CTG CCG GTG GTC GGA GCC GCG AAT GCG CTG AAG CTG CGC TAT GAC 576 Ala Leu Pro Val Val Gly Ala Ala Asn Ala Leu Lys Leu Arg Tyr Asp 180 185 190 GAT GGC GGC CGG GAT TTG CTC TGC ATC CCG CCG GGC GCC GAA GCC GAT 624 Asp Gly Gly Arg Asp Leu Leu Cys Ile Pro Pro Gly Ala Gl u Ala Asp 195 200 205 CGG CTC GAG GCG GAT CTC GCG ACC CTG CGG CCC GCG GTC GAT GCG CTG 672 Arg Leu Glu Ala Asp Leu Ala Thr Leu Arg Pro Ala Val Asp Ala Leu 210 215 220 CTG AAG GCG ATG GGC GGC GAT GCC TCC GAT GCT GCC GGC GGC GGC AGC 720 Leu Lys Ala Met Gly Gly Asp Ala Ser Asp Ala Ala Gly Gly Gly Ser 225 230 235 AAC AAC TGG GCG GTC GCT CCG GGC CGC ACG GCG ACC GGC AGG CCG ATC 768 Asn Asn Trp Ala Val Ala Pro Gly Arg Thr Ala Thr Gly Arg Pro Ile 240 245 250 255 CTC GCG GGC GAT CCG CAT CGC GTC TTC GAA ATC CCG GGC ATG TAT GCG 816 Leu Ala Gly Asp Pro His Arg Val Phe Glu Ile Pro Gly Met Tyr Ala 260 265 265 270 CAG CAT CAT CTG GCC TGC GAC CGG TTC GAC ATG ATC GGC CTG ACC GTG 864 Gln His His Leu Ala Cys Asp Arg Phe Asp Met Ile Gly Leu Thr Val 275 280 285 CCG GGC GTG CCG GGC TTC CCG CAC TTC GCG CAT AAC GGC AAG GTC GCC 912 Pro Gly Val Pro Gly Phe Pro His Phe Ala His Asn Gly Lys Val Ala 290 295 300 TAT AGC GTC ACG CAT GCC TTC ATG GAC ATC CAC GAT CTC TAT CTC GAG 960 Tyr Ser Val Thr His Ala Phe Met Asp Ile H is Asp Leu Tyr Leu Glu 305 310 315 CAG TTC GCG GGG GAG GGC CGC ACT GCG CGG TTC GGC AAC GAT TTC GAG 1008 Gln Phe Ala Gly Glu Gly Arg Thr Ala Arg Phe Gly Asn Asp Phe Glu 320 325 330 335 CCC GTC GCC TGG AGC CGG GAC CGT ATC GCG GTC CGG GGT GGC GCC GAT 1056 Pro Val Ala Trp Ser Arg Asp Arg Ile Ala Val Arg Gly Gly Ala Asp 340 345 350 CGC GAG TTC GAT ATC GTC GAG ACG CGC CAT GGC CCG GTT ATC GCG GGC 1104 Arg Glu Phe Asp Ile Val Glu Thr Arg His Gly Pro Val Ile Ala Gly 355 360 365 GAT CCG CGC GAT GGC GCA GCG CTC ACG CTG CGT TCG GTC CAG TTC GCC 1152 Asp Pro Arg Asp Gly Ala Ala Leu Thr Leu Arg Ser Val Gln Phe Ala 370 375 380 GAG ACC GAT CTG TCC TTC GAC TGC CTG ACG CGG ATG CCG GGC GCA TCG 1200 Glu Thr Asp Leu Ser Phe Asp Cys Leu Thr Arg Met Pro Gly Ala Ser 385 390 395 ACC GTG GCC CAG CTC TAC GAC GCG ACG CGC GGC TGG GGC CTG ATC GAC 1248 Thr Val Ala Gln Leu Tyr Asp Ala Thr Arg Gly Trp Gly Leu Ile Asp 400 405 410 415 CAT AAC CTC GTC GCC GGG GAT GTC GCG GGC TCG ATC GGC CAT CTG GTC 1296 His Asn Leu Val Al a Gly Asp Val Ala Gly Ser Ile Gly His Leu Val 420 425 430 CGC GCC CGC GTT CCG TCC CGT CCG CGC GAA AAC GGC TGG CTG CCG GTG 1344 Arg Ala Arg Val Pro Ser Arg Pro Arg Glu Asn Gly Trp Leu Pro Val 435 440 445 CCG GGC TGG TCC GGC GAG CAT GAA TGG CGG GGC TGG ATT CCG CAC GAG 1392 Pro Gly Trp Ser Gly Glu His Glu Trp Arg Gly Trp Ile Pro His Glu 450 455 460 GCG ATG CCG CGC GTG ATC GAT CCG CCG GGC GGC ATC ATC GTC ACG GCG 1440 Ala Met Pro Arg Val Ile Asp Pro Pro Gly Gly Ile Ile Val Thr Ala 465 470 475 AAT AAT CGC GTC GTG GCC GAT GAC CAT CCC GAT TAT CTC TGC ACC GAT 1488 Asn Asn Arg Val Val Ala Asp Asp His Pro Asp Tyr Leu Cys Thr Asp 480 485 490 495 TGC CAT CCG CCC TAC CGC GCC GAG CGC ATC ATG AAG CGC CTG GTC GCC 1536 Cys His Pro Pro Tyr Arg Ala Glu Arg Ile Met Lys Arg Leu Val Ala 500 505 510 AAT CCG GCT TTC GCC GTC GAC GAT GCC GCC GCG ATC CAT GCC GAT ACG 1584 Asn Pro Ala Phe Ala Val Asp Asp Ala Ala Ala Ile His Ala Asp Thr 515 520 525 CTG TCG CCC CAT GTC GGG TTG CTG CGC CGG AGG CTC GAG GCG CTT GGA 1632 Leu Ser Pro His Val Gly Leu Leu Arg Arg Arg Leu Glu Ala Leu Gly 530 535 540 GCC CGC GAC GAC TCC GCG GCC GAA GGG CTG AGG CAG ATG CTC GTC GCC 1680 Ala Arg Asp Asp Ser Ala Ala Glu Gly Leu Arg Gln Met Leu Val Ala 545 550 555 TGG GAC GGC CGC ATG GAT GCG GCT TCG GAG GTC GCG TCT GCC TAC AAT 1728 Trp Asp Gly Arg Met Asp Ala Ala Ser Glu Val Ala Ser Ala Tyr Asn 560 565 570 575 GCG TTC CGC AGG GCG CTG ACG CGG CTG GTG ACG GAC CGC AGC GGG CTG 1776 Ala Phe Arg Arg Ala Leu Thr Arg Leu Val Thr Asp Arg Ser Gly Leu 580 585 590 GAG CAG GCG ATA TCG CAT CCC TTC GCG GCT GTC GCG CCG GGC GTC TCA 1824 Glu Gln Ala Ile Ser His Pro Phe Ala Ala Val Ala Pro Gly Val Ser 595 600 605 CCG CAA GGC CAG GTC TGG TGG GCC GTG CCG ACC CTG CTG CGC GAC GAC 1872 Pro Gln Gly Gln Val Trp Trp Ala Val Pro Thr Leu Leu Arg Asp Asp 610 615 620 GAT GCC GGA ATG CTG AAG GGC TGG AGC TGG GAC CAG GCC TTG TCT GAG 1920 Asp Ala Gly Met Leu Lys Gly Trp Ser Trp Asp Gln Ala Leu Ser Glu 625 630 635 GCC CTC TCG GTC GCG TCG CAG AAC CTG ACC GGG CGA AGA GC TGG GGC GAA 1968 Ala Leu Ser Val Ala Ser Gln Asn Leu Thr Gly Arg Ser Trp Gly Glu 640 645 650 655 GAG CAT CGG CCG CGC TTC ACG CAT CCG CTT GCC ACG CAA TTC CCG GCC 2016 Glu His Arg Pro Arg Phe Thr His Pro Leu Ala Thr Gln Phe Pro Ala 660 665 670 TGG GCG GGG CTG CTG AAT CCG GCT TCC CGT CCG ATC GGT GGC GAT GGC 2064 Trp Ala Gly Leu Leu Asn Pro Ala Ser Arg Pro Ile Gly Gly Asp Gly 675 680 685 GAT ACC GTG CTG GCG AAC GGG CTC GTC CCG TCA GCC GGG CCG CAG GCG 2112 Asp Thr Val Leu Ala Asn Gly Leu Val Pro Ser Ala Gly Pro Gln Ala 690 695 700 ACC TAT GGT GCC CTG TCG CGC TAC GTC TTC GAT GTC GGC AAT TGG GAC 2160 Thr Tyr Gly Ala Leu Ser Arg Tyr Val Phe Asp Val Gly Asn Trp Asp 705 710 715 AAT AGC CGC TGG GTC GTC TTC CAC GGC GCC TCC GGG CAT CCG GCC AGC 2208 Asn Ser Arg Trp Val Val Phe His Gly Ala Ser Gly His Pro Ala Ser 720 725 730 735 GCC CAT TAT GCC GAT CAG AAT GCG CCC TGG AGC GAC TGT GCG ATG GTG 2256 Ala His Tyr Ala Asp Gln Asn Ala Pro Trp Ser Asp Cys Ala Met Val 740 745 750 CCG ATG CTC TAT AGC TGG GA C AGG ATC GCG GCA GAG GCC GTG ACG TCG 2304 Pro Met Leu Tyr Ser Trp Asp Arg Ile Ala Ala Glu Ala Val Thr Ser 755 760 765 CAG GAA CTC GTC CCG GCC TGA 2325 Gln Glu Leu Val Pro Ala 770

[Brief description of drawings]

FIG. 1 is a diagram showing a restriction enzyme map of pCKK170Q which is an expression vector of mutant CC acylase K170Q.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI technical display location // (C12N 9/80 C12R 1:19) (C12N 1/21 C12R 1:19) (C12P 35 / 06 C12R 1:19)

Claims (7)

[Claims] 1. A precursor amino acid sequence before being processed into α-subunit and β-subunit in a host cell has the formula: A1-169-X1 -A171-773 (wherein A1-169). Shows the same amino acid sequence as the amino acid sequence of Thr1 to Phe169 of natural cephalosporin C acylase A171-773 shows the same amino acid sequence as the amino acid sequence of Leu171 to Ala773 of natural cephalosporin C acylase. X1 represents an amino acid other than Lys)), which is a mutant cephalosporin C acylase. 2. The mutant cephalosporin C acylase according to claim 1, wherein X1 is Gln. 3. A DNA encoding the mutant cephalosporin C acylase according to claim 1 or 2. 4. An expression vector containing the DNA according to claim 3. 5. A host cell transformed with the expression vector according to claim 4. 6. The mutant cephalo according to claim 1 or 2, wherein the host cell according to claim 5 is cultured in a medium, and the mutant cephalosporin C acylase is collected from the resulting culture. Method for producing sporin C acylase. 7. The formula: (Wherein R1 represents acetoxy, hydroxy or hydrogen. R2 represents an acyl carboxylate) or a salt thereof is contacted with the culture of the transformant of claim 5 or a treated product thereof. Let the formula: (In the formula, R1 is as defined above.) A compound (I) or a salt thereof is obtained, and a process for producing the compound (I).