JPH07213280A - Thermostable esterase - Google Patents

Abstract

PURPOSE:To obtain a new thermostable variant esterase advantageous to the industrialization of organic synthetic reactions such as ester hydrolyzing and ester synthetic reactions and transesterification. CONSTITUTION:This variant esterase has an amino acid sequence having a site-specific variation in amino acids at the 160th and/or 189th positions in an amino acid sequence expressed by the formula and further a partial amino acid sequence in which at least the thermostable esterase activity in the amino acid sequence functions. The amino acid at the 160th position is preferably Ala, Val, Leu, Ile or Ser and the amino acid at the 189th position is preferably Ala, Val, Leu, Ile, Ser, Thr, Phe, His, Tyr or Arg. The esterase can be produced and obtained in a large amount from a gene prepared by transducing the site- specific variation into a gene capable of coding a wild type esterase having the amino acid sequence, expressed by the formula and derived from Chromobacterium SC-YM-1 (FERM P-14009) according to a usual genetic engineering method.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a thermostable mutant esterase used in ester hydrolysis reaction, ester synthesis reaction, transesterification reaction, etc., a gene encoding the enzyme, a plasmid containing the gene, and the plasmid. And a method for producing a mutant esterase, which comprises culturing the microorganism and producing esterase by the microorganism.

[0002]

2. Description of the Related Art Esterase is an enzyme that hydrolyzes an ester bond, and at the same time has a catalytic ability for ester synthesis and transesterification. In this case, an esterase exhibiting excellent catalytic activity in the target organic synthesis reaction is searched for as the first target, and the optimum one is selected and used.

[0003]

However, in order to utilize the thus selected esterase in vitro,
The stability of the protein with respect to temperature, pH, solvent, pressure, etc. must also be made high, but those having excellent catalytic activity are not necessarily excellent in protein stability. Among them, increasing the temperature, that is, thermal stability is particularly important because it helps to increase the reaction rate (reduce reaction time) and suppress deactivation (improve reaction efficiency), and is essential for industrialization. That is.

[0004]

Under these circumstances, the present inventors have conducted diligent studies using the technique of site-directed mutagenesis of genes, and as a result, have a certain type of wild-type esterase. In the amino acid sequence, it was found that a mutant esterase having an amino acid sequence having a mutation introduced into a specific amino acid exhibits extremely high thermostability, and the present invention was completed. That is, the present invention relates to the 160th position and / or the 18th position in the amino acid sequence represented by SEQ ID NO: 1.
A mutant esterase (hereinafter, referred to as the enzyme of the present invention, which has an amino acid sequence having a site-specific mutation at the 9th amino acid and has a partial amino acid sequence in which at least a thermostable esterase activity functions in the amino acid sequence). , A gene encoding the enzyme (hereinafter referred to as the present gene), a plasmid containing the gene (hereinafter referred to as the present plasmid), a microorganism containing the plasmid (hereinafter referred to as the present microorganism). In addition, a method for producing a mutant esterase (hereinafter, referred to as the production method of the present invention), which comprises culturing the microorganism and producing esterase by the microorganism, is submitted.

The present invention will be described in more detail below. The enzyme of the present invention is an amino acid sequence having a site-specific mutation at the 160th amino acid and / or the 189th amino acid in the amino acid sequence represented by SEQ ID NO: 1, and at least the thermostable esterase activity of the amino acid sequence functions. All mutant esterases having a partial amino acid sequence are included. The partial amino acid sequence having at least a thermostable esterase activity in the amino acid sequence having the site-specific mutation is, for example, at least 1 in the amino acid sequence shown in SEQ ID NO: 1.
The esterase consisting of 362 amino acids from the 1st position to the 362nd position and its equivalents can be mentioned.
The esterase having the amino acid sequence represented by SEQ ID NO: 1 (hereinafter referred to as wild-type esterase) is a microorganism belonging to the genus Chromobacterium, Chromobacterium SC-YM-1 (Institute of Biotechnology, National Institute of Industrial Science and Technology). It is derived from deposit number FERM P-14009) and has a molecular weight of 39348. A gene encoding this wild-type esterase (hereinafter referred to as a wild-type gene) is described in, for example, J. Sambrook, EFFritsch.
, T. Maniatis; Molecular Cloning Second Edition
(Molecular Cloning 2nd edition), Cold Spring Harbor Labora
Tory), published in 1989, etc., and obtained according to the usual genetic engineering techniques. That is, genomic DNA is extracted from the microbial cells obtained by culturing in accordance with a usual method. After destroying the microbial cells by an ordinary method such as ultrasonic disruption and treating with protease, the genomic DN
Extract A. The obtained genomic DNA is cleaved with an appropriate restriction enzyme and inserted into, for example, a phage vector λgt11 or a plasmid vector pUC19 using a ligase to prepare a genomic DNA library. The wild-type gene is analyzed by a screening method such as an immunological method using an antibody against esterase, a hybridization method using a synthetic DNA probe corresponding to a partial amino acid sequence of esterase, and a method for measuring the activity of esterase. Can be obtained.

The gene of the present invention can be prepared by introducing the following site-specific mutation into the obtained wild-type gene. The site-directed mutagenesis method uses a single-stranded DNA of a plasmid into which a prototype gene (here, a wild-type gene) is incorporated as a template, and a synthetic oligonucleotide containing a nucleotide sequence for introducing a mutation as a primer. A mutant gene (here, the gene of the present invention) is synthesized. In the present invention, at the 160th position and / or the 18th position in the amino acid sequence shown by SEQ ID NO: 1.
Mutant primers may be prepared so that the 9th amino acid is replaced with an amino acid other than glycine, and amplification by PCR is performed. Preferably, the 160th amino acid is selected from Group A consisting of the following amino acids, and 189
A specific mutation is preferred in which the th amino acid is replaced with an amino acid selected from Group B consisting of the following amino acids. (Group A) alanine, valine, leucine, isoleucine,
Serine (group B) alanine, valine, leucine, isoleucine,
Serine, threonine, phenylalanine, histidine,
Tyrosine and arginine More preferably, specific mutations can be introduced simultaneously at the 160th and 189th amino acids.
In addition, as a method of site-specific mutation other than the above, for example, Smith et al. (Genetic Engineering 31 Setlow, J. and H.
ollaender, A Plenum: New York), Vlasuk et al. (Experime
ntal Manipulation of Gene Expression, Inouye, M.: Aca
demic Press, New York), Hos.N.Hunt et al. (Gene, 77,51,1)
989) and the like.

[0007] By using the gene of the present invention thus prepared, a large amount of esterase can be produced and obtained according to a usual genetic engineering method. More specifically, a plasmid that allows the gene of the present invention to be expressed in a host microbial cell is prepared, introduced into a host microbial cell for transformation, and the transformant microorganism is cultured.
The above-mentioned plasmid contains a genetic information that can be replicated in a host microbial cell, is capable of autonomous growth, is easy to isolate and purify from the host, and is an expression vector having a detectable marker. Preferred are those into which the gene of the present invention has been introduced. Various kinds of expression vectors are already on the market, and the restriction enzyme for cleaving the expression vector used for introducing the gene of the present invention is also on the market. For example, for expression in E. coli, an expression vector containing a promoter such as lac, trp or tac (these are commercially available as an expression vector or a promoter cartridge from Pharmacia PL) can be used. Furthermore, by connecting a ribosome binding region upstream of the gene of the present invention, higher expression can be achieved. Regarding the ribosome binding region, Guarente.L et al. (Cell 20 p543 (1980)) and Taniguchi et al. (Genetics of Industrial Microorganismsp202)
(1982) Kodansha), but a ribosome binding region suitable for expression of the gene of the present invention may be designed and synthesized.

As the host microbial cells, both eukaryotes and prokaryotes can be used, and examples thereof include Escherichia coli. In addition, the above-mentioned plasmid can be introduced into the host microbial cell by an ordinary genetic engineering method. Culture of E. coli can be performed by a usual method. For example, the culture is performed in a medium containing an appropriate carbon source, nitrogen source, and trace nutrients such as vitamins.
The culture method may be either solid culture or liquid culture, but the aeration and stirring culture method is preferable. Collection of esterase from the cultured bacterial cells of the microorganism of the present invention thus obtained may be carried out by appropriately combining ordinary isolation / purification methods. For example, after completion of the culture, the bacterial cells are centrifuged or the like. It may be purified by combining the steps of using various chromatographies such as ion exchange, hydrophobicity, gel filtration, etc. The recombinant microorganism producing the thermostable esterase thus produced can be used as a bioreactor for ester hydrolysis to produce useful compounds such as intermediates for pharmaceuticals and agricultural chemicals. Further, by culturing the recombinant microorganism, a large amount of thermostable esterase can be produced and used as an enzyme reactor.

[0009]

The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

Example 1 (Preparation of wild-type gene as template DNA: preparation of genomic DNA) Chromobacterium SC-YM-1 (FERM P-1)
4009) in 5 ml of preculture medium (glucose 1%
(W / V), yeast extract 1% (W / V), K2 HPO4.0 0.1%
(W / V), MgSO4 0.02% (W / V), pH 7.3)
After shaking culture at 30 ° C for 24 hours, the resulting culture solution is added to 1000 ml of medium for main culture (glucose 1% (W / V)
, Yeast extract 1% (W / V), K2 HPO4 0.1% (W / V)
, MgSO4 0.02% (W / V), pH 7.3) and inoculated at 30 ° C. At that time, when the OD660 reached 3.4, penicillin G was added so that the final concentration was 2 units / ml of the culture solution, and the culture was continued until the OD660 reached 10. Centrifuge (8000g, 10
Min., 4 ° C) to collect the cells, and 80 ml of 10 mM Tris-HCl buffer (pH 8.0), 25% (W / V) sucrose solution was added to egg white lysozyme (manufactured by Seikagaku Corporation) to give a final concentration of 5
It was added so that the amount would be mg / ml and incubated at 37 ° C for 30 minutes. Then 10 ml of 10% (W / V) SDS
, And protease K (Boehringer)
To a final concentration of 200 μg / ml,
Incubated at ℃ for 3 hours. Then an equal amount of 0.1
After extraction with M tris-saturated phenol 3 times and ether 2 times, 2 volumes of ethanol was added to the aqueous layer to precipitate the nucleic acid, which was then centrifuged (12000 g, 30 minutes, 4 ° C.). After drying the obtained nucleic acid, 20 ml of Tris-EDTA
Buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH
8.0), CsCl-EtBr equilibrium density gradient ultracentrifugation (275000 g, 18 hours, 25 ° C.), and D
The band of NA was collected, and it was used as a Tris-EDTA buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).
After dialysis, about 5.4 mg of genomic DNA was obtained.

Example 2 (Preparation of wild-type gene as template DNA: preparation of genomic DNA library) 100 μg of the genomic DNA obtained in Example 1 was digested with XhoI (restriction enzyme manufactured by Takara Shuzo) to obtain a genomic DNA fragment. It was On the other hand, 1 μg of λ phage λZAPII (manufactured by Stratagene) was also digested with XhoI, and
Mix with A fragment, add ligase (Takara Shuzo),
C reacted overnight. Next, this reaction solution was packaged in Escherichia coli XL-1blue strain (attached to the kit) using an in vitro packaging kit (manufactured by Stratagene) to prepare a genomic DNA library.

Example 3 (Preparation of wild-type gene as template DNA: screening of genomic DNA library) Preparation of Synthetic DNA Probe and Isotope Labeling A 44-mer oligonucleotide (mixed probe: SEQ ID NOS: 2 and 3) shown below was synthesized based on the N-terminal amino acid sequence of the wild-type esterase as the template DNA. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Thr Leu Phe Asp Gly Ile Thr Ser Arg Ile Val Asp Thr Asp Arg 5'ACI CTI TTC GAC GGI ATC ACI TGI CGI ATC GTI GAC ACI GAC CG 3 'C Oligonucleotides were synthesized using an automatic DNA synthesizer (Applied Biosystems model 380A). To 50 pmol of this probe DNA, 3 μl of 0.5 M Tris-HCl buffer (pH 7.6), 0.1 MM
gCl2, 0.05MDTT, 0.001MEDTA,
10 units T4 polynucleotide kinase (manufactured by Takara Shuzo) and 10 μl [γ 32 P] ATP (manufactured by Amersham) are mixed and reacted at 37 ° C. for 60 minutes, followed by gel filtration with Sephadex G-50 (manufactured by Pharmacia). Thus, an isotope-labeled DNA probe was prepared. 2. Screening of genomic DNA library As shown in Example 2, Escherichia coli infected with phage was plated using an in vitro packaging kit (Stratagene), and the plate was cooled to 4 ° C. A nitrocellulose filter was brought into close contact with and phages were transferred onto the filter. Soak the filter in 1.5M NaCl-0.5M NaOH solution,
Denature the attached DNA, then add 1.5M NaCl
-Neutralized with 0.5 M Tris-HCl buffer (pH 8.0) solution. Then 0.36M NaCl-20 mM NaH2
PO4 (pH 7.5) -2 mM EDTA (pH 7.5)
The filter was washed in 5) and then dried. Next, using the isotope-labeled DNA probe corresponding to the N-terminal amino acid sequence of the wild-type esterase prepared as described above, the genomic DNA library prepared in Example 2 was subjected to plaque hybridization according to the following method. went. That is, filter 1) 4xSS
C, 1% (W / V) SDS, 10x Denhardt (0.2% (W / V)
/ V) Ficoll, 0.2% (W / V) polyvinylpyrrolidone, 0.2% (W / V) bovine serum albumin) was incubated at 60 ° C for 30 minutes, and then 2) 5xSS
C, 5x Denhardt, 100 μg / ml salmon testis DNA
The reaction was carried out by incubating at 60 ° C. for 5 hours with a solution containing Hybridization was carried out at 60 ° C. overnight by adding a filter and the solution of the above 2) to a plastic bag and adding an isotope-labeled DNA probe at about 5 × 10 5 cpm per filter. The hybridized filter is 1) 2x
SSC, 0.5% (W / V) SDS solution at 60 ℃, 1
5 minutes, 2) 2xSSC, 0.5% (W / V) SDS solution at 25 ° C, 30 minutes, 3) 2xSSC, 0.5% SDS
After washing with a solution containing (W / V) at 60 ℃ for 15 minutes,
After air-drying, an X-ray film (FUJI RX) and an intensifying screen were applied, and an autoradiogram was taken overnight at -80 ° C. As a result, a pCC3 strain giving a positive signal was obtained.
As a result of determining the nucleotide sequence by the dideoxy method, the obtained clone strain did not encode the entire length of the esterase gene. Therefore, a part of the sequence was again used as a DNA probe for screening by plaque hybridization. At that time, the genomic DNA is Sa
Partially digested with u3AI and similarly λ phage λZAPII
A library prepared by ligating to (Stratagene) was used. As a result, 9 wild-type gene clones giving a positive signal were obtained.

Example 4 (Preparation of wild-type gene as template DNA: preparation of subclone) Wild-type gene clone obtained in Example 3, namely λZAP
The insert DNA cloned in II was cloned into J. Sambro
ok, EFFritsch, T. Maniatis; Molecular Cloning 2nd edition,
Cold Spring Harbor Laboratory (Cold Sp
ring harbor laboratory), 1989, etc. were used to infect a helper phage R408 to excise the plasmid vector containing the plasmid vector in vivo and subclon it. In this way, the plasmid pCC6 was obtained (see FIG. 4).

Example 5 (Expression plasmid containing wild-type gene as template DNA) Expression vector pKK223-3 (Boyer et al., Prot. Natl.
Acad.Sci.USA, 80,21-25 (1983), made by Pharmacia)
By partial digestion with BamHI, blunting with T4 DNA polymerase, and ligation
PKK223-4 having one BamHI site deleted was prepared. On the other hand, around the start codon of the wild-type gene and its 5 '
In order to convert the upstream nucleotide sequence into a sequence suitable for gene expression in Escherichia coli, a DNA fragment having the following nucleotide sequence was synthesized using Applied DNA Synthesizer Model 380A. LP-1 (shown in SEQ ID NO: 4) LP-2 (shown in SEQ ID NO: 5) ES-3 (shown in SEQ ID NO: 6) ES-4 (shown in SEQ ID NO: 7) ES-5 (shown in SEQ ID NO: 8) ES-6 (shown in SEQ ID NO: 9) ES-7 (shown in SEQ ID NO: 10) Phosphorylates the 5'end of the synthesized LP-2, ES-3, ES-5, ES-6 and ES-7 fragments. , Ligation and annealing with each untreated fragment,
The following double-stranded DNA fragment (SD) was prepared. Both ends of the prepared double-stranded DNA fragment (SD) were phosphorylated. SD <LP-1><ES-7><AATTCTTTTT TAATAAAATC AGGAGGAAAA AACATATGAC TCTGTTCGAT GGTATCACTT GAAAAA ATTATTTTAG TCCTCCTTTT TTGTATACTG AGACAAGCTA CCATAGTGAA <LP-2><ES-6 EcoRI ES-3><ES-5> CGCGAATCGAATCTACTCATCGAATCTACTCATCGAATG GCAGACTGAC AATTGTAGGA CCTTGCACGC CGG><ES-4> Eco52I On the other hand, the SacI fragment (about 3.5 kbp) in pCC6 was subcloned into pUC118 (Takara Shuzo).
CC30 was produced. This pCC30 is Eco52I,
The translation region of esterase (about 1.2 Kbp) was excised by digestion with SacI. On the other hand, pUC118 having a lac promoter was transformed with EcoRI and Sac.
It was digested with I and treated with alkaline phosphatase.
Then, the above DNA fragment (SD) and the Eco52I-SacI fragment containing the gene translation region of the present invention are ligated between the EcoRI and SacI sites of pUC118 using a DNA ligation kit (Takara Shuzo) to obtain pCC101 ( (See FIGS. 5 and 6).

Example 6 (Preparation of Gene of the Present Invention: Preparation of Mutant Primer) As mutant primers for converting 160 Gly and 189 Gly into amino acids, FIG.
25, various synthetic oligonucleotides corresponding to each amino acid (mutation primers 160A, 160I,
160L, 160S, 160V, 189A, 189F,
189H, 189I, 189L, 189R, 189S,
189T, 189V and 189Y) were used. These mutant primers were synthesized using an Applied Biosystems DNA Synthesizer Model 394 and then purified with the "Oligonucleotide Purification Cartridge" manufactured by the same company. When wild-type esterase was produced in recombinant Escherichia coli, eight C-terminal amino acids were deleted in addition to the full-length esterase (C-terminal amino acid was 362 Glu). Since an esterase degradation product was produced, the 363rd amino acid was changed to the stop codon. As a mutagenic primer for conversion, synthetic oligonucleotides (mutagenic primers RV-1, MY-1, A363ter as shown in FIG. 7 and SEQ ID NOs: 26 to 30 are used.
m, RV-D and MY-2), and similarly using an Applied Biosystems DNA Synthesizer Model 394, and then purifying with an "oligonucleotide purification cartridge" manufactured by the same company.

Example 7 (Preparation of Gene of the Present Invention: Introduction of Site-Specific Mutation) For the preparation of mutant esterase, Hos. N. Hunt et al. (Gene, 77,
51, 1989). The outline of site-directed mutagenesis is shown in FIG. 1. Site-directed mutagenesis operation 500 ng of pCC101 obtained in Example 5 was used as template DNA.
And the mutant primer-MY-1 represented by SEQ ID NO: 27.
(100 pmol) and the mutagenic primer 160A (100 pmol) represented by SEQ ID NO: 11,
DNA by AmpTM PCR Reagent kit (Takara Shuzo)
The fragment was amplified (1st PCR). The resulting PCR product (270 bp fragment) was purified using a SUPREC-02 (Takara Shuzo) column. Then, similarly pCC
101 500 ng as a template DNA, the mutation primer RV-C (50 pmol) represented by SEQ ID NO: 26 and the previously purified 270 bp DNA fragment (50 pmol)
Was used as a primer to amplify a DNA fragment by the GeneAmp ™ PCR Reagent kit. The amplified DNA fragment was digested with the restriction enzymes CelIII and ClaI, and the sample was
% Agarose gel (NuSieve3: 1Agaros
e) (manufactured by Takara Shuzo Co., Ltd.), a DNA fragment of about 240 bp was separated and purified using Gene Clean DNA Purification Kit of Bio 101. On the other hand, pCC101 3 μg
Was digested with CelIII and ClaI and treated with alkaline phosphatase. Then, the CelIII-ClaI fragment (4.2 Kbp) of pCC101 and the mutated CelIII-Cla obtained by the above-described preparation were introduced.
The I fragment (240 bp) was ligated using a DNA ligation kit (manufactured by Takara Shuzo) and transformed into Escherichia coli JM109 strain according to a usual method. 2. Screening of mutant After preparing a plasmid from the transformant obtained in the above 1, the nucleotide sequence of the mutation site was determined by the dideoxy method, and it was confirmed that the mutation as designed was introduced. The above operations 1 and 2 are carried out in the same manner for 5 kinds of 160th glycine mutants or 10 kinds of 189th glycine mutants, and the respective mutant plasmids (the present plasmids pCC160A, pCC160I, pCC
160L, pCC160S, pCC160V, pCC1
89A, pCC189F, pCC189H, pCC18
9I, pCC189L, pCC189R, pCC189
S, pCC189T, pCC189V and pCC18
The transformant of 9Y) was obtained.

Example 8 (Production of enzyme of the present invention by transformant microorganism) Recombinant Escherichia coli of 15 types of enzyme expression plasmids of the present invention obtained in Example 7 and recombinant Escherichia coli of wild-type esterase expression vector ( pCC101 / JM10
9), a total of 16 strains, were inoculated into LB medium (tryptone 1%, yeast extract 0.5%, NaCl 0.5%), and then cultured at 37 ° C., and IPTG (isopropyl-β-D-thiogalactoate) was grown in the logarithmic growth phase. (Pyranoside) was added to a final concentration of 1 mM to induce the expression of esterase. After culturing,
The cells were collected by centrifugation (8000 g, 10 minutes, 4 ° C.), and a part thereof was subjected to SDS-PAGE.
In all 6 types of samples, esterase was recognized as a main band at a position of a molecular weight of about 40,000, and the enzyme of the present invention was highly expressed in E. coli.

Example 9 (Purification of Enzyme of the Present Invention) Recombinant microorganism (p
CC101 / JM109) of 16 species (15 variants of the present invention and wild type) were ultrasonically disrupted (20 KH
z, 15 minutes, 4 ° C.) and then centrifugation (12000 g, 30)
Minutes, 4 ° C.) to obtain the supernatant. The obtained supernatant 15
0 ml of anion exchange resin (DEAE-Sepharo
se fastflow, made by Pharmacia) 200m
The target enzyme was adsorbed on the carrier by passing it through a column filled with l. The column was thoroughly washed with 0.15 M NaCl + 10 mM Tris-HCl buffer (pH 7.5) to remove the non-adsorbed portion, and then the target enzyme was eluted by the 0.15 to 0.35 M NaCl linear concentration gradient method. The active fractions of esterase, the target enzyme, were collected and collected by a hydrophobic resin (Butyl-Toy
pearl 650S, manufactured by Toyo Soda Kogyo Co., Ltd.) 200 ml
Was passed through a column packed with. 10% (W / V) of (NH4)
The column was thoroughly washed with 2 SO4 +10 mM Tris-HCl buffer (pH 7.5) to remove non-adsorbed components, and then 10-
The target enzyme was eluted by a 0% (W / V) saturated ammonium sulfate linear concentration gradient method. The active fractions of the target enzyme esterase were collected to obtain a purified enzyme (hereinafter, referred to as the enzyme 160 of the present invention).
A, 160I, 160L, 160S, 160V, 189
A, 189F, 189H, 189I, 189L, 189
R, 189S, 189T, 189V and 189Y, designated as wild-type esterase WT. ).

Example 10 (Thermal stability of the enzyme of the present invention) The 16 types of purified enzymes obtained in Example 9 were examined for their thermal stability by the following procedure. 2.5 ml of 10
5 μm of the above purified enzyme in mM phosphate buffer (pH 7.0)
After incubating the test solution to which g was added at 50 ° C. for 60 minutes,
The residual activity of the enzyme of the present invention was measured. The activity was measured using p-nitrophenylacetate (pNPA), which is a general substrate for esterase. Specifically, the above test solution after incubation was added to 0.1 M phosphate buffer (pH 7.2) containing 40 μM of substrate dissolved in 2% acetone, and incubated at 37 ° C. to release the amount of p-nitrophenol. To 405 nm
It was measured from the increase in the absorbance. 1 activity per minute
The amount of enzyme that liberates μmol of p-nitrophenol was 1 unit. The results are shown in Table 1. 6 at 50 ° C
The residual activity ratio after incubation for 0 minutes was 26% for the wild-type esterase, while the enzyme activity of the present invention was 30% for all.
As described above, the thermal stability was improved in all cases.

[0020]

[Table 1] ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ The enzyme of the present invention residual activity rate (%) ━━━━━━━ ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 69 189Y 96 Wild-type esterase (WT) 26 (control area) ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━

Example 11 (Preparation of multiple mutant type gene of the present invention) For the preparation of mutant esterase, Hos.N.
The method of Hunt et al. (Gene, 77, 51, 1989) was used. The outline of site-directed mutagenesis is shown in FIG. 7. 1. Site-directed mutagenesis operation Using 500 ng of pCC101 obtained in Example 6 as the template DNA, the mutation primer MY-2 (100 pmol) represented by SEQ ID NO: 30 and the mutation primer A363term (100 pmo represented by SEQ ID NO: 28)
l) was used to amplify a DNA fragment with the GeneAmp ™ PCR Reagent kit (Takara Shuzo). (1st PCR)
The resulting PCR product (150 bp fragment) is SUPREC
It was purified using a -02 (Takara Shuzo) column. Then, similarly, using 500 ng of pCC101 as the template DNA, the mutagenic primer RV-D shown in SEQ ID NO: 29.
(50 pmol) and previously purified 150 bp DNA
GeneAmpTM PC using the fragment (50 pmol) as a primer
The DNA fragment was amplified with the R Reagent kit. The amplified DNA fragment was digested with the restriction enzymes BstPI and XbaI, and the sample was subjected to 4% agarose gel (NuSieve).
Electrophoresis with 3: 1 Agarose Takara Shuzo)
The 80 bp DNA fragment was separated and purified using Gene Clean DNA Purification Kit of Bio 101. On the other hand, p
3 μg of CC101 was digested with BstPI and XbaI and treated with alkaline phosphatase. Then, the BstPI-XbaI fragment of pCC101 (4.2K
bp) and the Bst in which the mutation obtained by previously prepared is introduced
The PI-XbaI fragment (280 bp) was ligated using a DNA ligation kit (manufactured by Takara Shuzo) and transformed into Escherichia coli JM109 strain according to a usual method. 2. Screening of Mutant After preparing a plasmid from the transformant obtained in the above 1, the nucleotide sequence of the mutation site was determined by the dideoxy method, and it was confirmed that the designed mutation was introduced. The thus prepared plasmid was designated as pCC36.
It was named 3 term. 3. Preparation of Multiple Mutant Type Gene of the Present Invention Ec was added with 10 μg of pCC160S, which is a mutant plasmid prepared from the transformant obtained in Example 7.
A 0.6 Kbp fragment obtained by digestion with oRI and FspI, and 10 μg of the same mutant plasmid pCC189Y were subjected to F
A 0.4 Kbp fragment obtained by digestion with spI and BstPI and pCC363ter obtained by 2 above.
m 3 μg was digested with BstPI and EcoRI to obtain three 3.4 Kbp fragments, which were ligated with each other using a DNA ligation kit (manufactured by Takara Shuzo Co., Ltd.), and transformed into Escherichia coli JM109 strain according to a conventional method, and a multiple mutant type was prepared. Recombinant plasmid pCC160S18 containing the gene of the present invention
9Y363term was obtained. Similarly, pCC160
A189F363term, pCC160A189H3
63 term, pCC160A189Y363ter
m, pCC160S189F363term, pCC1
Six types of transformants containing 60S189H363term in total of the multiple mutant type plasmid of the present invention were obtained (see FIG. 8).

Example 12 (Production of multiple mutant type enzyme of the present invention by transformant microorganism) The recombinant Escherichia coli of the six types of multiple mutant type enzyme expression plasmids obtained in Example 11 was transformed into LB medium (tryptone 1). %, Yeast extract 0.5%, NaCl 0.5%)
After inoculation, the cells were cultured at 37 ° C., and IPTG (isopropyl-β-D-thiogalactopyranoside) was added at a final concentration of 1 mM during the logarithmic growth phase to induce the expression of esterase. After culturing, centrifuge (8000 g, 10 minutes,
The bacterial cells are collected at 4 ° C) and a part of them is collected by SDS-PAG.
When subjected to E, esterase was recognized as a main band at a position of a molecular weight of about 39000 in all 6 types of samples, and the enzyme of the present invention was highly expressed in E. coli. Then, from the cultured 6 types of recombinant microorganisms, the same purification was carried out according to the method shown in Example 9,
Each purified enzyme was obtained (multiple mutant type enzyme 160A of the present invention).
189F363term, 160A189H363te
rm, 160A189Y363term, 160S18
9F363term, 160S189H363ter
m, 160S189Y363term).

Example 13 (Thermal stability of the multiple mutant type enzyme of the present invention) The purified enzyme obtained in Example 12 and Example 9 was described in Example 10 except that 55 ° C was used instead of 50 ° C. The thermal stability was examined by a method similar to that described above. The results are shown in Table 2. The residual activity ratio after incubation for 60 minutes at 55 ° C was 1 for the wild-type esterase.
3%, whereas the multiple mutant type enzyme of the present invention is 1
60S189Y363term was 89% and almost inactivated. Further, this multiple mutant type enzyme of the present invention was further improved in thermostability as compared with the single mutant type enzyme of the present invention, 160S and 189Y.

[0024]

[Table 2] ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ The enzyme of the present invention residual activity rate (%) ━━━━━━ ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ ━━━━━━━━━━━━━━━━━━━━━━━

[0025]

According to the present invention, in an organic synthetic reaction,
It has become possible to use esterase with excellent thermostability. In addition, a DNA fragment containing the gene of the present invention is used as a vector DN.
By constructing a plasmid incorporated in A and culturing a transformant microorganism in which the plasmid was introduced into a microorganism, a thermostable esterase can be efficiently produced.

[Sequence list]

SEQ ID NO: 1 Sequence length: 370 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence 5 10 15 Met Thr Leu Phe Asp Gly Ile Thr Ser Arg Ile Val Asp Thr Asp Arg 20 25 30 Leu Thr Val Asn Ile Leu Glu Arg Ala Ala Asp Asp Pro Gln Thr Pro 35 40 45 Pro Asp Arg Thr Val Val Phe Val His Gly Asn Val Ser Ser Ala Leu 50 55 60 Phe Trp Gln Glu Ile Met Gln Asp Leu Pro Ser Asp Leu Arg Ala Ile 65 70 75 80 Ala Val Asp Leu Arg Gly Phe Gly Gly ser Glu His Ala Pro Val Asp 85 90 95 Ala Thr Arg Gly Val Arg Asp Phe Ser Asp Asp Leu His Ala Thr Leu 100 105 110 Glu Ala Leu Asp Ile Pro Val Ala His Leu Val Gly Trp Ser Met Gly 115 120 125 Gly Gly Val Val Met Gln Tyr Ala Leu Asp His Pro Val Leu Ser Leu 130 135 140 Thr Leu Gln Ser Pro Val Ser Pro Tyr Gly Phe Gly Gly Thr Arg Arg 145 150 155 160 Asp Gly Ser Arg Leu Thr Asp Asp Asp Ala Gly Cys Gly Gly Gly Gly 165 170 175 Ala Asn Pro Asp Phe Ile Gln Arg Leu Ile Asp His Asp Thr Ser Asp 180 185 190 Asp Ala Gln Thr Ser Pro Arg Ser Val Phe Arg Ala Gly Tyr Val Ala 195 200 205 Ser Asp Tyr Thr Thr Asp His Glu Asp Val Trp Val Glu Ser Met Leu 210 215 220 Thr Thr Ser Thr Ala Asp Gly Asn Tyr Pro Gly Asp Ala Val Pro Ser 225 230 235 240 Asp Asn Trp Pro Gly Phe Ala Ala Gly Arg His Gly Val Leu Asn Thr 245 250 255 Met Ala Pro Gln Tyr Phe Asp Val Ser Gly Ile Val Asp Leu Ala Glu 260 265 270 Lys Pro Pro Ile Leu Trp Ile His Gly Thr Ala Asp Ala Ile Val Ser 275 280 285 Asp Ala Ser Phe Tyr Asp Leu Asn Tyr Leu Gly Gln Leu Gly Ile Val 290 295 300 Pro Gly Trp Pro Gly Glu Asp Val Ala Pro Ala Gln Glu Met Val Ser 305 310 315 320 Gln Thr Arg Asp Val Leu Gly Arg Tyr Ala Ala Gly Gly Gly Thr Val 325 330 335 Thr Glu Val Ala Val Glu Gly Ala Gly His Ser Ala His Leu Glu Arg 340 345 350 Pro Ala Val Phe Arg His Ala Leu Leu Glu Ile Ile Gly Tyr Val Gly 355 360 365 Ala Ala Ala Asp Pro Ala Pro Pro Thr Glu Ala Ile Ile Ile Arg Ser 370 Ala Asp

SEQ ID NO: 2 Sequence length: 44 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ACICTITTCG ACGGIATCAC ITGICGIATC GTIGACACIG ACCG 44

SEQ ID NO: 3 Sequence length: 44 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ACICTITTCG ACGGIATCAC ITCICGIATC GTIGACACIG ACCG 44

SEQ ID NO: 4 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AATTCTTTTT TAATAAAATC 20

SEQ ID NO: 5 Sequence length: 26 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TTTTCCTCCT GATTTTATTA AAAAAG 26

SEQ ID NO: 6 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGTATCACTT CGCGAATCGT AGATACTGAT 30

SEQ ID NO: 7 Sequence length: 45 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGCCGCACGT TCCAGGATGT TAACAGTCAG ACGATCAGTA TCTAC 45

SEQ ID NO: 8 Sequence length: 29 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTGACTG TTAACATCCT GGAACGTGC 29

SEQ ID NO: 9 Sequence length: 37 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GATTCGCGAA GTGATACCAT CGAACAGAGT CATATGT 37

SEQ ID NO: 10 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AGGAGAAAA AACATATGAC TCTGTTCGAT 30

SEQ ID NO: 11 Sequence length: 32 Sequence type: Nucleic acid Number of strands: Single-stranded topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGCCGGTTGC GGTGGCGGCG CCGCGAACCC CG 32

SEQ ID NO: 12 Sequence length: 32 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGCCGGTTGC GGTGGCGGCA TTGCGAACCC CG 32

SEQ ID NO: 13 Sequence length: 32 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGCCGGTTGC GGTGGCGGCC TTGCGAACCC CG 32

SEQ ID NO: 14 Sequence length: 32 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGCCGGTTGC GGTGGCGGCA GTGCGAACCC CG 32

SEQ ID NO: 15 Sequence length: 32 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGCCGGTTGC GGTGGCGGCG TTGCGAACCC CG 32

SEQ ID NO: 16 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCGCCTACG TCGCCTCGGA 30

SEQ ID NO: 17 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCTTCTACG TCGCCTCGGA 30

SEQ ID NO: 18 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCCACTACG TCGCCTCGGA 30

SEQ ID NO: 19 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCATCTACG TCGCCTCGGA 30

SEQ ID NO: 20 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCCTCTACG TCGCCTCGGA 30

SEQ ID NO: 21 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCCGCTACG TCGCCTCGGA 30

SEQ ID NO: 22 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCAGCTACG TCGCCTCGGA 30

SEQ ID NO: 23 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCACCTACG TCGCCTCGGA 30

SEQ ID NO: 24 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCGTCTACG TCGCCTCGGA 30

SEQ ID NO: 25 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTCTTCCGC GCCTACTACG TCGCCTCGGA 30

SEQ ID NO: 26 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GACCACCCGG TGCTGAGCCT GACCCTGCAG 30

SEQ ID NO: 27 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TACTGCGGGG CCATGGTGTT CAGCACGCCG 30

SEQ ID NO: 28 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CCGCCGACCG AGTAGATCTT CATCCGCTCC 30

SEQ ID NO: 29 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGCGGAACGG TCACCGAGGT CGCCGTCGAG 30

SEQ ID NO: 30 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGACGGCCAG TGCCAAGCTT GCATGCCTGC 30

[Brief description of drawings]

FIG. 1 is a diagram (No. 1) showing the amino acid sequence of wild-type esterase and the nucleotide sequence of a gene encoding the enzyme (1st to 144th amino acid sequences).

FIG. 2 is a diagram (part 2) showing the amino acid sequence of wild-type esterase and the nucleotide sequence of the gene encoding the enzyme (from the 145th position to the 304th position in the amino acid sequence).

FIG. 3 shows the amino acid sequence of wild-type esterase and the nucleotide sequence of the gene encoding the enzyme (No. 3) (from the 305th position to the 370th position in the amino acid sequence).

FIG. 4 is a diagram showing a restriction enzyme map of a plasmid pCC6 in which a gene encoding a wild-type esterase is subcloned.

FIG. 5 is a diagram showing a construction process of an expression plasmid pCC101 containing a gene encoding a wild-type esterase.

FIG. 6 is a diagram showing a restriction enzyme map of an expression plasmid pCC101 containing a gene encoding a wild-type esterase. The white outline in the figure indicates Chromobacterium SC-YM-1 (F
ERM P-14009) -derived DNA, and the hatched portion shows the translation region of wild-type esterase.

FIG. 7: The 160th amino acid of wild-type esterase,
It is a figure which shows the base sequence of the synthetic oligonucleotide used in order to introduce | transduce a specific mutation to the 189th amino acid and the 363rd amino acid.

FIG. 8 is a diagram showing the steps for constructing a recombinant plasmid containing the gene of the present invention.

FIG. 9 is a diagram showing a construction process of a recombinant plasmid pCC363term containing a C-terminal deletion mutant type gene of the present invention.

FIG. 10 is a diagram showing the steps of constructing a recombinant plasmid pCC160S189Y363term containing a multiple mutant enzyme gene of the present invention.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI technical display location C12R 1:19) (C12N 1/21 C12R 1:19)

Claims (6)

[Claims] 1. An amino acid sequence having a site-specific mutation at the 160th and / or 189th amino acid in the amino acid sequence represented by SEQ ID NO: 1, and at least the thermostable esterase activity of the amino acid sequence functions. A mutant esterase having a partial amino acid sequence. 2. In the amino acid sequence represented by SEQ ID NO: 1, the 160th amino acid is selected from group A consisting of the following amino acids, and the 189th amino acid is replaced with an amino acid selected from group B consisting of the following amino acids: The mutant esterase according to claim 1, which is an amino acid sequence having a specific mutation as described above. (Group A) alanine, valine, leucine, isoleucine,
Serine (group B) alanine, valine, leucine, isoleucine,
Serine, threonine, phenylalanine, histidine,
Tyrosine, arginine 3. A gene encoding the esterase according to claim 1. 4. A plasmid containing the gene according to claim 3. 5. A microorganism containing the plasmid according to claim 4. 6. A method for producing a mutant esterase, which comprises culturing the microorganism according to claim 5 and producing esterase by the microorganism.