CN113201516A

CN113201516A - P-nitrobenzyl esterase mutant and application thereof

Info

Publication number: CN113201516A
Application number: CN202110465504.0A
Authority: CN
Inventors: 陈小龙; 王广强; 金晓; 胡军; 陆跃乐; 张翼轸; 朱林江; 陈志钢; 陈翰驰; 田雯; 朱俊峰
Original assignee: ANHUI FENGLE PERFUME CO LTD; Zhejiang University of Technology ZJUT
Current assignee: ANHUI FENGLE PERFUME CO LTD; Zhejiang University of Technology ZJUT
Priority date: 2021-04-28
Filing date: 2021-04-28
Publication date: 2021-08-03
Anticipated expiration: 2041-04-28
Also published as: CN113201516B

Abstract

The invention discloses a p-nitrobenzyl esterase mutant and application thereof in preparing l-menthol by chiral resolution of enzymatic dl-menthyl. The mutant is obtained by carrying out site-directed saturation mutation on 315 site of wild p-nitrobenzyl esterase with an amino acid sequence shown as SEQ ID NO. 2. The invention has the following beneficial effects: firstly, the esterase mutant of the invention does not need to add a cosolvent, and the enzyme catalytic activity maintains a higher level; ② in the solvent-free system, the stereoselectivity of mutant enzyme catalysis is obviously improved compared with wild type. The mutant enzyme is used for catalytic reaction after being over-expressed by escherichia coli, 10-200 g/L of dl-menthyl acetate is taken as a substrate, hydrolysis and resolution are carried out to prepare L-menthol, and the result shows that the conversion rate of the L-menthyl acetate substrate>70% ee of the product l-menthol_pValue of>95% of the design reside in theShowing good industrial application performance.

Description

P-nitrobenzyl esterase mutant and application thereof

(I) technical field

The invention relates to a p-nitrobenzyl esterase mutant and a coding gene thereof, and application of the p-nitrobenzyl esterase mutant in preparing l-menthol by chiral resolution of enzymatic dl-menthyl.

(II) background of the invention

Menthol is a cyclic monoterpene alcohol perfume with the largest demand at present, and has 8 isomers in total, wherein l-menthol has unique mint fragrance and cooling effect, and has the functions of exciting, sterilizing, relieving pain, relieving itching, cooling with fragrance and the like, so that the menthol has very wide application in various industries, such as food, tobacco, cosmetics, oral health products and the like. They are also widely used in pharmaceuticals such as analgesics and local anesthetics, as precursors and auxiliary reagents for the synthesis of chiral compounds, and the like.

The production method of l-menthol comprises a plant extraction method, a chemical synthesis method, a biological enzyme chiral resolution method and the like. Plant extraction is an important production method of l-menthol at present, and is favored by consumers due to the nature of the product. However, the quality and price of the product are influenced by various factors such as the production area of the raw material mint leaves and illumination. In addition, the extract is rich in crude oil impurities, difficult to separate, high in energy consumption and large in price fluctuation. The chemical synthesis and optical resolution have high production cost and complex process, are easy to bring toxic substances, and are not suitable for industrial application. Although the chemical asymmetric synthesis method is available, the technical difficulty is high. In contrast, the biological enzyme method has mild reaction, cheap and easily available raw materials, and is environment-friendly, and the like, which promotes researchers to research the chiral resolution of the biological method.

The existing esterase from bacillus subtilis has good advantages in preparing l-menthol by hydrolyzing dl-menthyl acetate through chiral resolution, including high reaction rate, large substrate feeding amount and the like, but has the defects of low stereoselectivity of enzyme and need of adding a cosolvent such as ethanol or butanol and the like to improve the catalytic rate and catalytic stereoselectivity of the enzyme. Therefore, the esterase needs to be directionally modified to improve the application performance.

With the continuous analysis of the crystal structure of the enzyme, the continuous improvement of the calculation simulation technology based on bioinformatics, the success of semi-rational design, directed evolution and screening of the enzyme is obviously improved. A large number of industrial enzymes which are used are artificially modified, and particularly have great success in the field of modification of the properties of esterase and lipase, and the improvement of the thermal stability of the enzymes, the improvement of the catalytic reaction activity of the enzymes, the improvement of the substrate specificity, the improvement of the enantioselectivity and the like is mainly focused.

Disclosure of the invention

The invention aims to provide a p-nitrobenzyl esterase mutant with good stereoselectivity, a coding gene thereof and application thereof in preparing l-menthol by chiral resolution of enzymatic dl-menthyl acetate.

The technical scheme adopted by the invention is as follows:

a p-nitrobenzyl esterase mutant is obtained by carrying out site-directed saturation mutagenesis on a 315 site of wild type p-nitrobenzyl esterase with an amino acid sequence shown as SEQ ID NO. 2.

Esterases generally have a structure with two active pockets, including a hydrophobic (larger) and a hydrophilic (smaller) pocket. For the substrate dl-menthyl ester, the isopropyl group on the six-membered ring of the substrate faces the hydrophobic pocket in the enzyme's catalytic pocket and the methyl group on the six-membered ring of the substrate is bound to the hydrophilic pocket of the enzyme in the catalytic mechanism. This is one of the most favorable positions for menthyl ester catalysis (Holmquist M et al 2010.protein Science,5:83-88), as shown in FIG. 2 (M represents a medium substituent and L is a large substituent). The side chain effect of the residue is influenced by changing the residues around the active pocket, and the size of the enzyme pocket is changed, so that the isomers of different substrates are different from the enzyme combination, and the enzyme selectivity is improved.

The wild p-nitrobenzyl esterase (PNB) shown in SEQ ID NO.2 is derived from Bacillus subtilis CGMCC No.17904(CN 110373366A), can realize efficient chiral resolution on dl-menthyl ester, is used for preparing l-menthol, and particularly has high hydrolysis rate and high dosage of dl-menthyl ester substrate. However, the enzyme catalysis process needs to add a cosolvent such as butanol or ethanol to improve the stereoselectivity of the substrate. In the absence of a cosolvent system, the substrate stereoselectivity of the enzyme catalysis is low. And the organic solvent is added into the catalytic system, so that the production cost is increased, and the difficulty in separating and purifying the product l-menthol is increased. The invention improves the catalytic rate of the enzyme in a cosolvent-free system and obviously improves the stereoselectivity of the enzyme to a substrate in the cosolvent-free system by mutating and modifying the wild enzyme.

The p-nitrobenzyl esterase PNB gene was obtained by PCR amplification, cloned into the expression vector pET28a of Escherichia coli BL21(DE3), and subjected to enzyme overexpression. Combining enzyme three-dimensional structure calculation simulation, carrying out saturation mutation on amino acid sites playing a key role in substrate stereoselectivity in an esterase PNB substrate structure pocket, carrying out enzymology comparative analysis, and screening to obtain the esterase mutant.

Preferably, the amino acid sequence of the p-nitrobenzyl esterase mutant is shown as SEQ ID NO. 3.

The invention also relates to a gene for coding the p-nitrobenzyl esterase mutant.

The coding gene of the esterase mutant PNB-F315E can be a gene sequence synthesized after codon optimization according to the amino acid sequence of the coding gene, and can also be a gene sequence subjected to mutation modification after PCR amplification from the B.subtilis CGMCC No.17904 strain genome. Preferably, the nucleotide sequence of the coding gene is shown as SEQ ID NO. 4.

The invention also relates to application of the p-nitrobenzyl esterase mutant in preparing l-menthol by catalyzing chiral resolution of dl-menthyl through enzyme.

Specifically, the application is as follows: constructing a recombinant bacterium containing the mutant coding gene, and hydrolyzing dl-menthyl ester by taking wet thalli obtained by fermenting and culturing the recombinant bacterium or enzyme-containing cells obtained by crushing thalli as a catalyst to obtain l-menthol.

The gene of the esterase mutant PNB-F315E can be cloned to an expression plasmid and transformed into a host cell, and the esterase preparation is prepared by induction fermentation and used for catalyzing the selective hydrolysis of dl-menthyl ester to prepare l-menthol. The expression plasmid and the host cell are preferably pET28a plasmid and Escherichia coli BL21(DE3) host cell, namely recombinant bacterium E.coli BL21(DE3) (pET28a-PNB-F315E) is constructed.

The hydrolysis may be carried out in the absence of a solvent.

Preferably, in the hydrolysis reaction system, the cell density is 5-30 OD (preferably 10OD), the dosage of the dl-menthyl acetate is 1% -20% (w/w) (preferably 15%), and the hydrolysis process is controlled to be pH 6.5-8.5 (preferably pH8.0) and the temperature is 25 ℃ -40 ℃ (preferably 30 ℃).

The dl-menthyl ester is preferably dl-menthyl acetate. The esterase mutant is used for preparing l-menthol by catalyzing and hydrolyzing 1-20% of dl-menthyl acetate in a cosolvent-free system, and the conversion rate of l-menthyl acetate substrate>70% ee of the product l-menthol_pValue of>95％。

The invention has the following beneficial effects: firstly, the esterase mutant of the invention does not need to add a cosolvent, and the enzyme catalytic activity maintains a higher level; ② in the solvent-free system, the stereoselectivity of mutant enzyme catalysis is obviously improved compared with wild type. The mutant enzyme is used for catalytic reaction after being over-expressed by escherichia coli, 10-200 g/L of dl-menthyl acetate is taken as a substrate, hydrolysis and resolution are carried out to prepare L-menthol, and the result shows that the conversion rate of the L-menthyl acetate substrate>70% ee of the product l-menthol_pValue of>95 percent, and shows good industrial application performance.

(IV) description of the drawings

FIG. 1 is a schematic diagram of the structures of l-menthol, d-menthol, dl-menthol, and dl-menthyl acetate.

FIG. 2 is a schematic representation of the substrate binding pocket of esterase PNB.

FIG. 3 is a GC chromatogram of a standard sample of dl-menthyl acetate, dl-menthol.

FIG. 4 is a GC chromatogram of a catalytic reaction solution for preparing l-menthol by hydrolysis and resolution of dl-menthyl acetate catalyzed by esterase mutant F315E.

(V) detailed description of the preferred embodiments

For the purpose of enhancing understanding of the present invention, the present invention will be described in further detail with reference to specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention.

LB culture medium: 5.0g/L of yeast powder, 10.0g/L, NaCl 10.0.0 g/L of peptone and distilled water as a solvent.

Fermentation medium: yeast powder 12.0g/L, peptone 15.0g/L, Na₂HPO₄·12H₂O 8.9g/L、KH₂PO₄3.4g/L、NH₄Cl 2.67g/L、Na₂SO₄ 0.71g/L、MgSO₄·7H₂O0.49 g/L, kanamycin 50 mug/L, pH7.0, and the solvent is distilled water.

pH8.0 phosphate buffer solution (200 mM): na (Na)₂HPO₄·12H₂O 67.8g/L，NaH₂PO₄·2H₂O0.82g/L, and the solvent is distilled water.

Example 1: cloning and expression of wild-type esterase PNB gene

The esterase PNB gene of B.subtilis CGMCC No.17904 genome is amplified by PCR technology. The amplification primers are PNB-F and PNB-R.

PNB-F：GAAGGAGATATACCATGGGCACTCATCAAATAGTAACGAC

PNB-R：CGGAGCTCGAATTCGGATCCTTATTCTCCTTTTGAAGGGAATAG

And separating and purifying the PNB gene fragment obtained by PCR amplification through agarose gel electrophoresis, and then using the PNB gene fragment for ligation reaction. The plasmid pET-28a was extracted, and the plasmid was double-digested with restriction endonucleases Ncol/BamHI, separated and purified by agarose gel electrophoresis, and used for ligation reaction. The purified PNB gene fragment and the purified linearized pET-28a plasmid were ligated using the One-Step Cloning Kit (Clonexpress II One Step Cloning Kit) of Novozan. mu.L of the ligation product was taken, mixed with 100. mu.L of E.coli BL21(DE3) competent cells, placed in an ice bath for 30min and then heat-shocked in a water bath at 42 ℃ for 90 s. Competent cells after heat shock were plated on LB (containing 50. mu.g/mL Kana) plates. After 12h of growth in an incubator at 37 ℃. And (3) carrying out colony PCR verification on the transformant, carrying out streak purification, inoculating the transformant to an LB liquid culture medium for culture, extracting plasmids, and carrying out sequencing verification to finally obtain a recombinant strain E.coli BL21(DE3) (pET-28a-PNB) for expressing the wild esterase PNB, namely E.coli IEF-PNB for short.

Inducible expression of the wild-type esterase PNB. Coli IEF-PNB was streaked from a preserved glycerin tube overnight, and then a single colony was inoculated into LB liquid medium containing 50. mu.g/mL kanamycin and cultured at 37 ℃ overnight at 200 rpm. Inoculating into fermentation medium according to 0.5% (v/v) inoculum size, and culturing at 37 deg.C for 2.5 h; adding IPTG with the final concentration of 1.0mM, adjusting the culture temperature to 25 ℃, and continuing to ferment for 5h to obtain the microbial inoculum for over-expressing the wild esterase PNB.

Example 2: activity analysis of wild esterase PNB for preparing l-menthol by catalyzing and hydrolyzing dl-menthyl acetate

Centrifuging 2mL of the wild esterase PNB microbial inoculum prepared by the method for 10min at 10000 Xg to collect cells, and resuspending the cells in 1mL of 200mM phosphate buffer solution with pH 8.0; taking two parts of heavy suspension microbial inoculum, adding 10% (v/v) n-butanol as cosolvent (the kind of cosolvent is optimized) into one part, and adding pure water with the same amount into the other part as a control; 20 μ L of dl-menthyl acetate was added and the solution was catalyzed by metal bath shaking at 1200rpm at 30 ℃ for 2h and the solution was used for GC analysis.

The results of GC analysis of the catalytic solution are shown in table 1, and the stereoselectivity of the catalytic solution to the dl-menthyl acetate substrate is improved from 70.13% to 92.01% under the catalytic system with the addition of organic solvent n-butanol, so that the stereoselectivity of the wild-type PNB enzyme to the substrate is significantly improved in the cosolvent n-butanol system.

Table 1: PNB enzyme catalysis result under solvent-free and butanol system

GC analysis of the catalyst liquid samples:

1) sample pretreatment: adding 500 mu L of catalytic reaction liquid into ethyl acetate with the same proportion for mixed extraction; centrifuge at 12000 Xg for 1min, and collect the supernatant organic phase for chromatography.

2) Gas chromatography detection conditions: a chromatographic column: agilent CYCLODEX-B60 m × 0.250 mm. Temperature rising procedure: keeping at 80 deg.C for 10 min; heating to 140 deg.C at 5 deg.C/min, and maintaining for 5 min; heating to 145 deg.C at 1 deg.C/min, and maintaining for 1 min. A detector: a FID detector; the peak time of the product l-menthol is about 36min, the peak time of the substrate menthyl ester is about 40min, and GC chromatograms of the dl-menthyl acetate and the dl-menthol standard are shown in figure 3, namely d-menthol, l-menthyl acetate and d-menthyl acetate respectively from left to right.

Example 3: design of esterase PNB mutation site and construction and screening of mutant

In order to improve the substrate stereoselectivity of the wild esterase PNB in a solvent-free system, a computer-aided design is adopted to select the site-directed mutation of the PNB. According to the reported crystal structure of esterase derived from Bacillus subtilis (PDB ID: 1QE3), homologous modeling is carried out on esterase PNB derived from strain B.subtilis CGMCC No. 17904. And performing simulation analysis by using protein three-dimensional structure analysis software and molecular docking software. Comprehensively considering the docking result of the esterase and the substrate, the characteristics of a substrate binding pocket of the enzyme, the structural characteristics of enzyme identification substrate stereo selection and the catalytic mechanism of the enzyme, and finally predicting the function of the phenylalanine residue at the 315 th site of the amino acid sequence SEQ ID NO. 2: the site is at the entrance of the enzyme catalytic hydrophobic pocket, which is closely related to the binding of the larger group (isopropyl) on the six-membered ring of the substrate, and this is also the key site for determining the stereoselectivity of the enzyme. The enzyme binding relationship to the substrate l-menthyl acetate is shown in FIG. 2 (yellow stick structure is phenylalanine at position 315 near the brown hydrophobic pocket). Thus, the 315 th amino acid of SEQ ID NO.2 is preferentially used as a mutation analysis site.

A saturation mutation primer of 315 th amino acid is designed according to an amino acid sequence shown in SEQ ID NO.2 and is shown in Table 2. The vector pET28a-pnbA is used as a template to carry out PCR amplification on the whole plasmid, and an amplification band with correct size is obtained by 0.8% agarose gel electrophoresis detection. The PCR product was digested with the restriction enzyme DpnI for 1h, and the methylated plasmid template was digested. And performing a one-step cloning method on the digested PCR product to perform a ligation reaction, then transforming the PCR product into an escherichia coli BL21(DE3) cell, and performing colony PCR verification and sequencing verification to obtain the esterase mutant with the mutation of the target site.

Table 2: mutant primer design table based on multiple sequence alignment result

Example 4: screening of the library of saturated mutants of amino acid 315

19 mutants were obtained by site-directed mutagenesis at amino acid position 315 as shown in SEQ ID NO 2, and the differences in catalytic activity and stereoselectivity to the substrate of the mutant enzymes were evaluated under the same catalytic conditions. The transformants on the plate were transferred to LB liquid medium containing 50. mu.g/ml kanamycin and cultured to the middle of logarithmic growth. Then transferring the strain to a fermentation medium according to the inoculation amount of 1% (v/v), and culturing for 3h at 37 ℃; adding IPTG with final concentration of 0.5mM, controlling the fermentation temperature at 25 ℃, and continuing to ferment for 12h to obtain the microbial inoculum after induced expression.

Collecting cultured bacterial agent containing esterase mutant 2mL at 10000 Xg for 10min, centrifuging, collecting cells, and resuspending the cells in 1mL of 200mM phosphate buffer solution with pH 8.0; 20 μ L of dl-menthyl acetate was added and the solution was catalyzed by metal bath shaking at 1200rpm at 30 ℃ for 2h and the solution was used for GC analysis.

The results of the analyses of the enzyme activity and substrate stereoselectivity of the wild type PNB and 19 PNB mutants are shown in table 3. The F315E mutant strain is the optimal mutant by comprehensively considering the substrate selectivity and the catalytic rate of the enzyme.

Table 3: comparison of enzyme activity and substrate stereoselectivity of wild-type PNB and 19 PNB mutants

Example 5: application of mutant strain F315E in preparation of l-menthol by catalytic hydrolysis of dl-menthyl acetate

Inducible expression of esterase mutant F315E. After streaking the strain E.coli IEF-PNB-F315E overnight from the preserved glycerol tube, a single colony was inoculated into LB liquid medium containing 50. mu.g/mL kanamycin and cultured overnight at 37 ℃ at 200 rpm. Inoculating into fermentation medium according to 0.5% (v/v) inoculum size, and culturing at 37 deg.C for 2.5 h; adding IPTG with the final concentration of 1.0mM, adjusting the culture temperature to 25 ℃, and continuing to ferment for 5h to obtain the microbial inoculum of the esterase mutant strain F315E.

Taking esterase mutant strain F315E fermentation liquid microbial inoculum, centrifuging to obtain 4g of wet thalli, resuspending with 50mL of 100mM sodium phosphate buffer solution with pH8.0, adding different amounts of dl-menthyl acetate (20 g/L, 150g/L and 200 g/L) respectively, and carrying out catalytic reaction at 30 ℃ under the mechanical magnetic stirring of 500 rpm. During the catalytic reaction, the pH of the reaction was adjusted to 8.0 with 2M NaOH solution. The reaction solution was analyzed by gas chromatography, and as shown in FIG. 4, d-menthol, l-menthyl acetate, and d-menthyl acetate were obtained from left to right, respectively. The results of the catalytic reactions at different feed rates are shown in Table 4, where the conversion is at 150g/L feed>70％，ee_p>95％。

Table 4: catalytic result of mutant strain F315E under different feeding amounts

Sequence listing

<110> Anhui Fengle spice, Limited liability company

Zhejiang University of Technology

<120> p-nitrobenzyl esterase mutant and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1473

<212> DNA

<213> Bacillus subtilis

<400> 1

atgggcactc atcaaatagt aacgactcaa tacggcaaag taaaaggcac aacggaaaac 60

ggcgtacata agtggaaagg catcccctat gccaagccgc ctgtcggaca atggcgtttt 120

aaagcacctg agccgcctga agtgtgggaa gatgtccttg atgccacagc gtacggccct 180

atttgcccgc agccgtctga tttgctctca ctgtcgtatg ctgagttgcc ccgccagtcc 240

gaggattgct tgtatgtcaa tgtatttgcg cctgacactc caagccaaaa cctgcctgtc 300

atggtttgga ttcacggagg cgctttttat ctcggcgcag gcagtgagcc attgtatgac 360

ggatcaaaac ttgcggcgca gggagaggtc attgtcgtta cactgaacta tcggctgggg 420

ccgtttggct ttttgcactt gtcttccttt gatgaggcgt attccgataa ccttgggctt 480

ttagaccaag tcgccgcact gaaatgggtg cgggagaata tttcagcgtt tggcggtgat 540

cccgataacg taacagtatt tggagaatcc gccggcggga tgagcattgc cgcgcttctc 600

gctatgcctg cggcaaaagg cctgttccag aaagcaatca tggaaagcgg cgcttctcga 660

acgatgacga aagaacaagc ggcgagcacc tcggcagcct ttttacaggt ccttgggatt 720

aacgagggcc aactggataa attgcatacg gtttctgcgg aagatttgct aaaagcggct 780

gatcagcttc ggattgcaga aaaagaaaat atctttcagc tgttcttcca gcccgccctt 840

gatccgaaaa cgctgcctga agaaccagaa aaagcgatcg cagaaggggc tgcttctggc 900

attccgctat tgattggaac aacccgtgat gaaggatatt tatttttcac cccggattca 960

gacgttcatt ctcaggaaac gcttgatgca gcactcgagt atttactagg gcagccgctg 1020

gccaagaatg ccgccgattt gtatccgcgt tctctggaaa gccaaattca aatgatgact 1080

gatttattat tttggcgccc tgccgtcgcc tatgcatccg cacagtctca ttacgcccct 1140

gtctggatgt acaggttcga ttggcacccg gagaagccgc cgtacaataa agcgtttcac 1200

gcattagagc ttccttttgt ctttggaaat ctggacggat tggaacgaat ggcacaagcg 1260

gagattacgg atgaggtgaa acagctttct cacacgatac aatcagcgtg gatcacgttc 1320

gctaaaacag gaaacccaag caccgaagct gtgaattggc cggcgtatca tgaagaaacg 1380

agagagacgc tgattttaga ctcagagatt acgatcgaaa acgatcccga atctgaaaaa 1440

aggcagaagc tattcccttc aaaaggagaa taa 1473

<210> 2

<211> 490

<212> PRT

<213> Bacillus subtilis

<400> 2

Met Gly Thr His Gln Ile Val Thr Thr Gln Tyr Gly Lys Val Lys Gly

1 5 10 15

Thr Thr Glu Asn Gly Val His Lys Trp Lys Gly Ile Pro Tyr Ala Lys

20 25 30

Pro Pro Val Gly Gln Trp Arg Phe Lys Ala Pro Glu Pro Pro Glu Val

35 40 45

Trp Glu Asp Val Leu Asp Ala Thr Ala Tyr Gly Pro Ile Cys Pro Gln

50 55 60

Pro Ser Asp Leu Leu Ser Leu Ser Tyr Ala Glu Leu Pro Arg Gln Ser

65 70 75 80

Glu Asp Cys Leu Tyr Val Asn Val Phe Ala Pro Asp Thr Pro Ser Gln

85 90 95

Asn Leu Pro Val Met Val Trp Ile His Gly Gly Ala Phe Tyr Leu Gly

100 105 110

Ala Gly Ser Glu Pro Leu Tyr Asp Gly Ser Lys Leu Ala Ala Gln Gly

115 120 125

Glu Val Ile Val Val Thr Leu Asn Tyr Arg Leu Gly Pro Phe Gly Phe

130 135 140

Leu His Leu Ser Ser Phe Asp Glu Ala Tyr Ser Asp Asn Leu Gly Leu

145 150 155 160

Leu Asp Gln Val Ala Ala Leu Lys Trp Val Arg Glu Asn Ile Ser Ala

165 170 175

Phe Gly Gly Asp Pro Asp Asn Val Thr Val Phe Gly Glu Ser Ala Gly

180 185 190

Gly Met Ser Ile Ala Ala Leu Leu Ala Met Pro Ala Ala Lys Gly Leu

195 200 205

Phe Gln Lys Ala Ile Met Glu Ser Gly Ala Ser Arg Thr Met Thr Lys

210 215 220

Glu Gln Ala Ala Ser Thr Ser Ala Ala Phe Leu Gln Val Leu Gly Ile

225 230 235 240

Asn Glu Gly Gln Leu Asp Lys Leu His Thr Val Ser Ala Glu Asp Leu

245 250 255

Leu Lys Ala Ala Asp Gln Leu Arg Ile Ala Glu Lys Glu Asn Ile Phe

260 265 270

Gln Leu Phe Phe Gln Pro Ala Leu Asp Pro Lys Thr Leu Pro Glu Glu

275 280 285

Pro Glu Lys Ala Ile Ala Glu Gly Ala Ala Ser Gly Ile Pro Leu Leu

290 295 300

Ile Gly Thr Thr Arg Asp Glu Gly Tyr Leu Phe Phe Thr Pro Asp Ser

305 310 315 320

Asp Val His Ser Gln Glu Thr Leu Asp Ala Ala Leu Glu Tyr Leu Leu

325 330 335

Gly Gln Pro Leu Ala Lys Asn Ala Ala Asp Leu Tyr Pro Arg Ser Leu

340 345 350

Glu Ser Gln Ile Gln Met Met Thr Asp Leu Leu Phe Trp Arg Pro Ala

355 360 365

Val Ala Tyr Ala Ser Ala Gln Ser His Tyr Ala Pro Val Trp Met Tyr

370 375 380

Arg Phe Asp Trp His Pro Glu Lys Pro Pro Tyr Asn Lys Ala Phe His

385 390 395 400

Ala Leu Glu Leu Pro Phe Val Phe Gly Asn Leu Asp Gly Leu Glu Arg

405 410 415

Met Ala Gln Ala Glu Ile Thr Asp Glu Val Lys Gln Leu Ser His Thr

420 425 430

Ile Gln Ser Ala Trp Ile Thr Phe Ala Lys Thr Gly Asn Pro Ser Thr

435 440 445

Glu Ala Val Asn Trp Pro Ala Tyr His Glu Glu Thr Arg Glu Thr Leu

450 455 460

Ile Leu Asp Ser Glu Ile Thr Ile Glu Asn Asp Pro Glu Ser Glu Lys

465 470 475 480

Arg Gln Lys Leu Phe Pro Ser Lys Gly Glu

485 490

<210> 3

<211> 490

<212> PRT

<213> Unknown (Unknown)

<400> 3

Met Gly Thr His Gln Ile Val Thr Thr Gln Tyr Gly Lys Val Lys Gly

1 5 10 15

Thr Thr Glu Asn Gly Val His Lys Trp Lys Gly Ile Pro Tyr Ala Lys

20 25 30

Pro Pro Val Gly Gln Trp Arg Phe Lys Ala Pro Glu Pro Pro Glu Val

35 40 45

Trp Glu Asp Val Leu Asp Ala Thr Ala Tyr Gly Pro Ile Cys Pro Gln

50 55 60

Pro Ser Asp Leu Leu Ser Leu Ser Tyr Ala Glu Leu Pro Arg Gln Ser

65 70 75 80

Glu Asp Cys Leu Tyr Val Asn Val Phe Ala Pro Asp Thr Pro Ser Gln

85 90 95

Asn Leu Pro Val Met Val Trp Ile His Gly Gly Ala Phe Tyr Leu Gly

100 105 110

Ala Gly Ser Glu Pro Leu Tyr Asp Gly Ser Lys Leu Ala Ala Gln Gly

115 120 125

Glu Val Ile Val Val Thr Leu Asn Tyr Arg Leu Gly Pro Phe Gly Phe

130 135 140

Leu His Leu Ser Ser Phe Asp Glu Ala Tyr Ser Asp Asn Leu Gly Leu

145 150 155 160

Leu Asp Gln Val Ala Ala Leu Lys Trp Val Arg Glu Asn Ile Ser Ala

165 170 175

Phe Gly Gly Asp Pro Asp Asn Val Thr Val Phe Gly Glu Ser Ala Gly

180 185 190

Gly Met Ser Ile Ala Ala Leu Leu Ala Met Pro Ala Ala Lys Gly Leu

195 200 205

Phe Gln Lys Ala Ile Met Glu Ser Gly Ala Ser Arg Thr Met Thr Lys

210 215 220

Glu Gln Ala Ala Ser Thr Ser Ala Ala Phe Leu Gln Val Leu Gly Ile

225 230 235 240

Asn Glu Gly Gln Leu Asp Lys Leu His Thr Val Ser Ala Glu Asp Leu

245 250 255

Leu Lys Ala Ala Asp Gln Leu Arg Ile Ala Glu Lys Glu Asn Ile Phe

260 265 270

Gln Leu Phe Phe Gln Pro Ala Leu Asp Pro Lys Thr Leu Pro Glu Glu

275 280 285

Pro Glu Lys Ala Ile Ala Glu Gly Ala Ala Ser Gly Ile Pro Leu Leu

290 295 300

Ile Gly Thr Thr Arg Asp Glu Gly Tyr Leu Glu Phe Thr Pro Asp Ser

305 310 315 320

Asp Val His Ser Gln Glu Thr Leu Asp Ala Ala Leu Glu Tyr Leu Leu

325 330 335

Gly Gln Pro Leu Ala Lys Asn Ala Ala Asp Leu Tyr Pro Arg Ser Leu

340 345 350

Glu Ser Gln Ile Gln Met Met Thr Asp Leu Leu Phe Trp Arg Pro Ala

355 360 365

Val Ala Tyr Ala Ser Ala Gln Ser His Tyr Ala Pro Val Trp Met Tyr

370 375 380

Arg Phe Asp Trp His Pro Glu Lys Pro Pro Tyr Asn Lys Ala Phe His

385 390 395 400

Ala Leu Glu Leu Pro Phe Val Phe Gly Asn Leu Asp Gly Leu Glu Arg

405 410 415

Met Ala Gln Ala Glu Ile Thr Asp Glu Val Lys Gln Leu Ser His Thr

420 425 430

Ile Gln Ser Ala Trp Ile Thr Phe Ala Lys Thr Gly Asn Pro Ser Thr

435 440 445

Glu Ala Val Asn Trp Pro Ala Tyr His Glu Glu Thr Arg Glu Thr Leu

450 455 460

Ile Leu Asp Ser Glu Ile Thr Ile Glu Asn Asp Pro Glu Ser Glu Lys

465 470 475 480

Arg Gln Lys Leu Phe Pro Ser Lys Gly Glu

485 490

<210> 4

<211> 1473

<212> DNA

<213> Unknown (Unknown)

<400> 4

atgggcactc atcaaatagt aacgactcaa tacggcaaag taaaaggcac aacggaaaac 60

ggcgtacata agtggaaagg catcccctat gccaagccgc ctgtcggaca atggcgtttt 120

aaagcacctg agccgcctga agtgtgggaa gatgtccttg atgccacagc gtacggccct 180

atttgcccgc agccgtctga tttgctctca ctgtcgtatg ctgagttgcc ccgccagtcc 240

gaggattgct tgtatgtcaa tgtatttgcg cctgacactc caagccaaaa cctgcctgtc 300

atggtttgga ttcacggagg cgctttttat ctcggcgcag gcagtgagcc attgtatgac 360

ggatcaaaac ttgcggcgca gggagaggtc attgtcgtta cactgaacta tcggctgggg 420

ccgtttggct ttttgcactt gtcttccttt gatgaggcgt attccgataa ccttgggctt 480

ttagaccaag tcgccgcact gaaatgggtg cgggagaata tttcagcgtt tggcggtgat 540

cccgataacg taacagtatt tggagaatcc gccggcggga tgagcattgc cgcgcttctc 600

gctatgcctg cggcaaaagg cctgttccag aaagcaatca tggaaagcgg cgcttctcga 660

acgatgacga aagaacaagc ggcgagcacc tcggcagcct ttttacaggt ccttgggatt 720

aacgagggcc aactggataa attgcatacg gtttctgcgg aagatttgct aaaagcggct 780

gatcagcttc ggattgcaga aaaagaaaat atctttcagc tgttcttcca gcccgccctt 840

gatccgaaaa cgctgcctga agaaccagaa aaagcgatcg cagaaggggc tgcttctggc 900

attccgctat tgattggaac aacccgtgat gaaggatatt tagagttcac cccggattca 960

gacgttcatt ctcaggaaac gcttgatgca gcactcgagt atttactagg gcagccgctg 1020

gccaagaatg ccgccgattt gtatccgcgt tctctggaaa gccaaattca aatgatgact 1080

gatttattat tttggcgccc tgccgtcgcc tatgcatccg cacagtctca ttacgcccct 1140

gtctggatgt acaggttcga ttggcacccg gagaagccgc cgtacaataa agcgtttcac 1200

gcattagagc ttccttttgt ctttggaaat ctggacggat tggaacgaat ggcacaagcg 1260

gagattacgg atgaggtgaa acagctttct cacacgatac aatcagcgtg gatcacgttc 1320

gctaaaacag gaaacccaag caccgaagct gtgaattggc cggcgtatca tgaagaaacg 1380

agagagacgc tgattttaga ctcagagatt acgatcgaaa acgatcccga atctgaaaaa 1440

aggcagaagc tattcccttc aaaaggagaa taa 1473

Claims

1. A p-nitrobenzyl esterase mutant is obtained by carrying out site-directed saturation mutagenesis on a 315 site of wild type p-nitrobenzyl esterase with an amino acid sequence shown as SEQ ID NO. 2.

2. The p-nitrobenzyl esterase mutant according to claim 1, characterized in that the amino acid sequence of the p-nitrobenzyl esterase mutant is shown in SEQ ID NO. 3.

3. A gene encoding a p-nitrobenzyl esterase mutant according to claim 1.

4. The encoding gene of claim 3, wherein the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 4.

5. Use of a mutant p-nitrobenzyl esterase according to claim 1 for the enzymatic preparation of l-menthol by chiral resolution of dl-menthyl ester.

6. The use according to claim 5, characterized in that the use is: constructing a recombinant bacterium containing the mutant coding gene, and hydrolyzing dl-menthyl ester by taking wet thalli obtained by fermenting and culturing the recombinant bacterium or enzyme-containing cells obtained by crushing thalli as a catalyst to obtain l-menthol.

7. The use according to claim 6, wherein the hydrolysis is carried out in the absence of a solvent.

8. The use according to claim 6, wherein the cell density in the hydrolysis reaction system is 5-30 OD, the amount of dl-menthyl acetate is 1-20%, and the pH value in the hydrolysis process is controlled to be 6.5-8.5 and the temperature is controlled to be 25-40 ℃.

9. Use according to claim 6, characterised in that the dl-menthyl ester is dl-menthyl acetate.