AU2006252111A1 - Corynebacterium glutamicum genes encoding metabolic pathway proteins - Google Patents

Description

P001 Section 29 Regulation 3.2(2)

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT Application Number: Lodged: Invention Title: Corynebacterium glutamicum genes encoding metabolic pathway proteins The following statement is a full description of this invention, including the best method of performing it known to us: CORYNEBACTERIUM GLUTAMICUM GENES ENCODING METABOLIC PATHWAY 0PROTEINS U Related Applications The present application is a continuation in part of U. S. Patent Application 09/606, 740, filed June 23, 2000. This application is also a continuation in part ofU. S. Patent Application 09/603, 124, filed June 23, 2000. The present application claims priority to prior filed U. S.

Provisional Patent Application Serial No. 60/141031, filed June 25, 1999, U. S. Provisional N, Patent Application Serial No. 60/142101, filed July 2, 1999, U. S. Provisional Patent NI Application Serial No. 60/148613, filed August 12, 1999, U. S. Provisional Patent 0 0 Application Serial No. 60/187970, filed March 9, 2000, and also to German Patent ,IC Application No. 19931420. 9, filed July 8, 1999. The entire contents of all of the aforementioned applications are hereby expressly incorporated herein by this reference.

Background of the Invention Certain products and by-products of naturally-occurring metabolic processes in cells have utility in a wide array of industries, including the food, feed, cosmetics, and pharmaceutical industries. These molecules, collectively termed 'fine chemicals', include organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, and enzymes.

Their production is most conveniently performed through large-scale culture of bacteria !0 developed to produce and secrete large quantities of a particular desired molecule. One particularly useful organism for this purpose is Corynebacterium glutamicum, a gram positive, nonpathogenic bacterium. Through strain selection, a number of mutant strains have been developed which produce an array of desirable compounds. However, selection of strains improved for the production of a particular molecule is a time-consuming and difficult process.

Summary of the Invention The invention provides novel bacterial nucleic acid molecules which have a variety of uses.

These uses include the identification of microorganisms which can be used to produce fine chemicals amino acids, such as, for example, lysine and methionine), the modulation of fine chemical production in C. glutamicum or related bacteria, the typing or identification of C. glutamicum or related bacteria, as reference points for mapping the C. glutamicum S genome, and as markers for transformation.

These novel nucleic acid molecules encode proteins, referred to herein as metabolic pathway (MP) proteins.

C. glutamicum is a gram positive, aerobic bacterium which is commonly used in industry for the large-scale production of a variety of fine chemicals, and also for the degradation of hydrocarbons (such as in petroleum spills) and for the oxidation of terpenoids. The MP S nucleic acid molecules of the invention, therefore, can be used to identify microorganisms S which can be used to produce fine chemicals, e. by fermentation processes. Modulation of

(NO

0 the expression of the MP nucleic acids of the invention, or modification of the sequence of S the MP nucleic acid molecules of the invention, can be used to modulate the production of one or more fine chemicals from a microorganism to improve the yield or production of one or more fine chemicals from a Corynebacterium or Brevibacterium species). In a preferred embodiment, the MP genes of the invention are combined with one or more genes involved in the same or different metabolic pathway to modulate the production of one or more fine chemicals from a microorganism.

The MP nucleic acids of the invention may also be used to identify an organism as being Corynebacterium glutamicum or a close relative thereof, or to identify the presence of C glutamicum or a relative thereof in a mixed population of microorganisms. The invention !0 provides the nucleic acid sequences of a number of C. glutamicum genes by probing the extracted genomic DNA of a culture of a unique or mixed population of microorganisms under stringent conditions with a probe spanning a region of a C. glutamicum gene which is unique to this organism, one can ascertain whether this organism is present. Although Corynebacterium glutamicum itself is nonpathogenic, it is related to species pathogenic in humans, such as Corynebacterium diphtheriae (the causative agent of diphtheria) the detection of such organisms is of significant clinical relevance.

The MP nucleic acid molecules of the invention may also serve as reference points for mapping of the C. glutamicum genome, or of genomes of related organisms.

Similarly, these molecules, or variants or portions thereof, may serve as markers for genetically engineered Corynebacterium or Brevibacterium species.

The MP proteins encoded by the novel nucleic acid molecules of the invention are capable of,

ID

S for example, performing an enzymatic step involved in the metabolism of certain fine N, chemicals, including amino acids, e. lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose. Given the availability of cloning vectors for use in Corynebacterium glutamicum, such as those disclosed in Sinskey et al., U.

S. Patent No. 4, 649, 119, and techniques for genetic manipulation of C. glutamicum and the related Brevibacterium species g, lactofermentum) (Yoshihama et al, J. Bacteriol. 162 591-597 (1985) Katsumata et al., J. Bacteriol. 159 306-311 (1984); and Santamaria et al., S J. Gen. Microbiol. 130 2237-2246 (1984)), the nucleic acid molecules of the invention may 0 be utilized in the genetic engineering of this organism to make it a better or more efficient producer of one or more fine chemicals.

This improved production or efficiency of production of a fine chemical may be due to a direct effect of manipulation of a gene of the invention, or it may be due to an indirect effect of such manipulation. Specifically, alterations in C. glutamicum metabolic pathways for amino acids, e. lysine and methionine, vitamins, cofactors, nucleotides, and trehalose may have a direct impact on the overall production of one or more of these desired compounds from this organism. For example, optimizing the activity of a lysine or a methionine biosynthetic pathway protein or decreasing the activity of a lysine or methionine degradative pathway protein may result in an increase in the yield or efficiency of production of lysine or !0 methionine from such an engineered organism. Alterations in the proteins involved in these metabolic pathways may also have an indirect impact on the production or efficiency of production of a desired fine chemical. For example, a reaction which is in competition for an intermediate necessary for the production of a desired molecule may be eliminated, or a pathway necessary for the production of a particular intermediate for a desired compound may be optimized.

Further, modulations in the biosynthesis or degradation of, for example, an amino acid, e. g., lysine or methionine, a vitamin, or a nucleotide may increase the overall ability of the microorganism to rapidly grow and divide, thus increasing the number and/or production capacities of the microorganism in culture and thereby increasing the possible yield of the desired fine chemical.

The nucleic acid and protein molecules of the invention, alone or in combination with one or more nucleic acid and protein molecules of the same or different metabolic pathway, may be utilized to directly improve the production or efficiency of production of one or more desired fine chemicals from Corynebacterium glutamicum methionine or lysine). Using S recombinant genetic techniques well known in the art, one or more of the biosynthetic or S degradative enzymes of the invention for amino acids, e. lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose may be manipulated such that its function is modulated. For example, a biosynthetic enzyme may be improved in efficiency, or its allosteric control region destroyed such that feedback inhibition of production of the compound is prevented.

Similarly, a degradative enzyme may be deleted or modified by substitution, deletion, or addition such that its degradative activity is lessened for the desired compound without 0 impairing the viability of the cell. In each case, the overall yield or rate of production of the desired fine chemical may be increased.

It is also possible that such alterations in the protein and nucleotide molecules of the invention may improve the production of other fine chemicals besides the amino acids, e. g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose through indirect mechanisms. Metabolism of any one compound is necessarily intertwined with other biosynthetic and degradative pathways within the cell, and necessary cofactors, intermediates, or substrates in one pathway are likely supplied or limited by another such pathway. Therefore, by modulating the activity of one or more of the proteins of the invention, the production or efficiency of activity of another fine chemical biosynthetic or !0 degradative pathway may be impacted.

For example, amino acids serve as the structural units of all proteins, yet may be present intracellularly in levels which are limiting for protein synthesis therefore, by increasing the efficiency of production or the yields of one or more amino acids within the cell, proteins, such as biosynthetic or degradative proteins, may be more readily synthesized.

Likewise, an alteration in a metabolic pathway enzyme such that a particular side reaction becomes more or less favored may result in the over-or under-production of one or more compounds which are utilized as intermediates or substrates for the production of a desired fine chemical.

This invention provides novel nucleic acid molecules which encode proteins, referred to herein as metabolic pathway proteins, which are capable of, for example, performing an enzymatic step involved in the metabolism of molecules important for the normal functioning of cells, such as amino acids, e. lysine and methionine, vitamins, cofactors, nucleotides and nucleosides, or trehalose. Nucleic acid molecules encoding an MP protein are referred to herein as MP nucleic acid molecules.

In a preferred embodiment, an MP protein, alone or in combination with one or more proteins of the same or different metabolic pathway, performs an enzymatic step related to the 5 metabolism of one or more of the following: amino acids, e. lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose.

Examples of such proteins include those encoded by the genes set forth in Table 1.

Accordingly, one aspect of the invention pertains to isolated nucleic acid molecules g., S cDNAs, DNAs, or RNAs) comprising a nucleotide sequence encoding an MP protein or 0 biologically active portions thereof, as well as nucleic acid fragments suitable as primers or hybridization probes for the detection or amplification of MP- encoding nucleic acid g., DNA or mRNA). In particularly preferred embodiments, the isolated nucleic acid molecule comprises one of the nucleotide sequences set forth as the odd-numbered SEQ ID NO in the Sequence Listing g. SEQ ID NO 3, or SEQ ID NO or the coding region or a complement thereof of one of these nucleotide sequences. In other particularly preferred embodiments, the isolated nucleic acid molecule of the invention comprises a nucleotide sequence which hybridizes to or is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, !0 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94% and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99. 7% or more homologous to a nucleotide sequence set forth as an odd-numbered SEQ ID NO in the Sequence Listing g. SEQ ID NO 3, or SEQ ID NO or a portion thereof. In other preferred embodiments, the isolated nucleic acid molecule encodes one of the amino acid sequences set forth as an even-numbered SEQ ID NO in the Sequence Listing g. SEQ ID NO 4, or SEQ ID NO The preferred MP proteins of the present invention also preferably possess at least one of the MP activities described herein.

In another embodiment, the isolated nucleic acid molecule encodes a protein or portion thereof wherein the protein or portion thereof includes an amino acid sequence which is sufficiently homologous to an amino acid sequence of the invention a sequence having an even-numbered SEQ ID NO in the Sequence Listing, such as SEQ ID NO 4, or SEQ ID NO e. sufficiently homologous to an amino acid sequence of the invention such that the protein or portion thereof maintains an MP activity. Preferably, the protein or portion thereof encoded by the nucleic acid molecule maintains the ability to perform an enzymatic S reaction in a amino acid, e. lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway. In one embodiment, the protein encoded by the nucleic acid molecule is at least about 50%, 51%, 52%, 53%, 54%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70% more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or S 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 1 0 99. 7% or more homologous to an amino acid sequence of the invention an entire amino acid sequence selected from those having an even-numbered SEQ ID NO in the C Sequence Listing, such as SEQ ID NO 4, or SEQ ID NO In another preferred embodiment, the protein is a full length C. glutamicum protein which is substantially homologous to an entire amino acid sequence of the invention (encoded by an open reading frame shown in the corresponding odd-numbered SEQ ID NO in the Sequence Listing g., SEQ ID NO 3, or SEQ ID NO In another preferred embodiment, the isolated nucleic acid molecule is derived from C.

glutamicum and encodes a protein an MP fusion protein) which includes a biologically active domain which is at least about 50% or more homologous to one of the amino acid !0 sequences of the invention a sequence of one of the even-numbered SEQ ID NOs in the Sequence Listing, such as SEQ ID NO 4, or SEQ ID NO 6) and is able to catalyze a reaction in a metabolic pathway for an amino acid, e. lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose, or one or more of the activities set forth in Table 1, and which also includes heterologous nucleic acid sequences encoding a heterologous polypeptide or regulatory regions.

In another embodiment, the isolated nucleic acid molecule is at least 15 nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising a nucleotide sequence of the invention a sequence of an odd- numbered SEQ ID NO in the Sequence Listing, such as SEQ ID NO 3, or SEQ ID NO Preferably, the isolated nucleic acid molecule corresponds to a naturally-occurring nucleic acid molecule. More preferably, the isolated nucleic acid encodes a naturally-occurring C. glutamicum MP protein, or a biologically active portion thereof.

Another aspect of the invention pertains to vectors, e. recombinant expression vectors, S containing the nucleic acid molecules of the invention, alone or in combination with one or S more nucleic acid molecules involved in the same or different pathway, and host cells into which such vectors have been introduced. In one embodiment, such a host cell is used to produce an MP protein by culturing the host cell in a suitable medium. The MP protein can be then isolated from the medium or the host cell.

Yet another aspect of the invention pertains to a genetically altered microorganism in which one or more MP genes, alone or in combination with one or more genes involved in the same or different metabolic pathway, have been introduced or altered. In one embodiment, the O 0 genome of the microorganism has been altered by introduction of a nucleic acid molecule of the invention encoding one or more wild-type or mutated MP sequences as transgenes alone or in combination with one or more nucleic acid molecules involved in the same or different metabolic pathway. In another embodiment, one or more endogenous MP genes within the genome of the microorganism have been altered, e. functionally disrupted, by homologous recombination with one or more altered MP genes. In another embodiment, one or more endogenous or introduced MP genes, alone or in combination with one or more genes of the same or different metabolic pathway in a microorganism have been altered by one or more point mutations, deletions, or inversions, but still encode functional MP proteins.

In still another embodiment, one or more of the regulatory regions a promoter, !0 repressor, or inducer) of one or more MP genes in a microorganism, alone or in combination with one or more MP genes or in combination with one or more genes of the same or different metabolic pathway, has been altered by deletion, truncation, inversion, or point mutation) such that the expression of one or more MP genes is modulated. In a preferred embodiment, the microorganism belongs to the genus Corynebacterium or Brevibacterium, with Corynebacterium glutamicum being particularly preferred. In a preferred embodiment, the microorganism is also utilized for the production of a desired compound, such as an amino acid, with lysine and methionine being particularly preferred. In a particularly preferred embodiment, the MP gene is the metC gene (SEQ ID NO or the RXA00657 gene (SEQ ID NO alone or in combination with one or more MP genes of the invention or in combination with one or more genes involved in methionine and/or lysine metabolism.

In another aspect, the invention provides a method of identifying the presence or activity of Cornyebacterium diphtheriae in a subject. This method includes detection of one or more of the nucleic acid or amino acid sequences of the invention the sequences set forth in Table 1 and in the Sequence Listing as SEQ ID NOs 1 through 122) in a subject, thereby N, detecting the presence or activity of Corynebacterium diphtheriae in the subject.

Still another aspect of the invention pertains to an isolated MP protein or portion, e. g, s 5 biologically active portion, thereof. In a preferred embodiment, the isolated MP protein or portion thereof, alone or in combination with one or more MP proteins of the invention or in S combination with one or more proteins of the same or different metabolic pathway, can catalyze an enzymatic reaction involved in one or more pathways for the metabolism of an amino acid, e. lysine or methionine, a vitamin, a cofactor, a nutraceutical, a nucleotide, a \O 10 nucleoside, or trehalose. In another preferred embodiment, the isolated MP protein or portion thereof, is sufficiently homologous to an amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO: in the Sequence Listing, such as SEQ ID NO: 4, or SEQ ID NO 6) such that the protein or portion thereof maintains the ability to catalyze an enzymatic reaction involved in one or more pathways for the metabolism of an amino acid, a vitamin, a cofactor, a nutraceutical, a nucleotide, a nucleoside, or trehalose.

The invention also provides an isolated preparation of an MP protein. In preferred embodiments, the MP protein comprises an amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO: of the Sequence Listing such as SEQ ID NO: 4, or SEQ ID NO In another preferred embodiment, the invention pertains to an isolated !0 full length protein which is substantially homologous to an entire amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO of the Sequence Listing such as SEQ ID NO 4, or SEQ ID NO 6) (encoded by an open reading frame set forth in a corresponding odd-numbered SEQ ID NO of the Sequence Listing such as SEQ ID NO 3, or SEQ ID NO In yet another embodiment, the protein is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70% more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99. 7% or more homologous to an entire amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO of the Sequence Listing such as SEQ ID NO 4, or SEQ ID NO In other embodiments, the isolated MP protein comprises an amino acid sequence which is at least about 50% or more homologous to one of the amino acid sequences of the invention a sequence of an even-numbered SEQ ID NO of the Sequence Listing such as SEQ ID NO 4, or SEQ ID NO 6) and is able to S catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, S nucleoside, or trehalose metabolic pathway either alone or in combination one or more MP proteins of the invention or any protein of the same or different metabolic pathway, or has one or more of the activities set forth in Table 1.

Alternatively, the isolated MP protein can comprise an amino acid sequence which is S encoded by a nucleotide sequence which hybridizes, e. hybridizes under stringent conditions, or is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or S 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70% S0 more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99. 7% or more homologous to a nucleotide sequence of one of the even-numbered SEQ ID NOs set forth in the Sequence Listing. It is also preferred that the preferred forms of MP proteins also have one or more of the MP bioactivities described herein.

The MP polypeptide, or a biologically active portion thereof, can be operatively linked to a non-MP polypeptide to form a fusion protein. In preferred embodiments, this fusion protein has an activity which differs from that of the MP protein alone. In other preferred embodiments, this fusion protein, when introduced into a C. glutamicum pathway for the !0 metabolism of an amino acid, vitamin, cofactor, nutraceutical, results in increased yields and/or efficiency of production of a desired fine chemical from C. glutamicum. In particularly preferred embodiments, integration of this fusion protein into an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway of a host cell modulates production of a desired compound from the cell.

In another aspect, the invention provides methods for screening molecules which modulate the activity of an MP protein, either by interacting with the protein itself or a substrate or binding partner of the MP protein, or by modulating the transcription or translation of an MP nucleic acid molecule of the invention.

Another aspect of the invention pertains to a method for producing a fine chemical. This method involves the culturing of a cell containing one or more vectors directing the expression of one or more MP nucleic acid molecules of the either alone or in combination one or more MP nucleic acid molecules of the invention or any nucleic acid molecule of the same or different metabolic pathway, such that a fine chemical is produced. In a preferred S embodiment, this method further includes the step of obtaining a cell containing such a vector, in which a cell is transfected with a vector directing the expression of an MP nucleic acid. In another preferred embodiment, this method further includes the step of recovering the fine chemical from the culture. In a particularly preferred embodiment, the cell is from the genus Corynebacterium or Brevibacterium, or is selected from those strains set forth in Table 3. In another preferred embodiment, the MP genes is the metC gene (SEQ ID NO or the gene designated as RXA00657 (SEQ ID NO 5) (see Table alone or in combination with one or more MP nucleic acid molecules of the invention or with one or more genes involved S0 in methionine and/or lysine metabolism. In yet another preferred embodiment, the fine chemical is an amino acid, e. L-lysine and L-methionine.

Another aspect of the invention pertains to methods for modulating production of a molecule from a microorganism. Such methods include contacting the cell with an agent which modulates MP protein activity or MP nucleic acid expression such that a cell associated activity is altered relative to this same activity in the absence of the agent. In a preferred embodiment, the cell is modulated for one or more C. glutamicum amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways, such that the yields or rate of production of a desired fine chemical by this microorganism is improved.

The agent which modulates MP protein activity can be an agent which stimulates MP protein !0 activity or MP nucleic acid expression.

Examples of agents which stimulate MP protein activity or MP nucleic acid expression include small molecules, active MP proteins, and nucleic acids encoding MP proteins that have been introduced into the cell. Examples of agents which inhibit MP activity or expression include small molecules and antisense MP nucleic acid molecules.

Another aspect of the invention pertains to methods for modulating yields of a desired compound from a cell, involving the introduction of a wild-type or mutant MP gene into a cell, either alone or in combination one or more MP nucleic acid molecules of the invention or any nucleic acid molecule of the same or different metabolic pathway, either maintained on a separate plasmid or integrated into the genome of the host cell. If integrated into the genome, such integration can be random, or it can take place by homologous recombination such that the native gene is replaced by the introduced copy, causing the production of the desired compound from the cell to be modulated. In a preferred embodiment, said yields are increased. In another preferred embodiment, said chemical is a fine chemical. In a particularly preferred embodiment, said fine chemical is an amino acid. In especially I preferred embodiments, said amino acid are L-lysine and L-methionine. In another preferred C embodiment, said gene is the metC gene (SEQ ID NO or the RXA00657 gene (SEQ ID S NO alone or in combination with one or more MP nucleic acid molecules of the invention or with one or more genes involved in methionine and/or lysine metabolism.

Detailed Description of the Invention The present invention provides MP nucleic acid and protein molecules which are involved in S the metabolism of certain fine chemicals in Corynebacterium glutamicum, including amino 0 0 acids, e. lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose. The molecules of the invention may be utilized in the modulation of production of fine chemicals from microorganisms, such as C. glutamicum, either directly where modulation of the activity of a lysine or methionine biosynthesis protein has a direct impact on the production or efficiency of production of lysine or methionine from that organism), or may have an indirect impact which nonetheless results in an increase of yield or efficiency of production of the desired compound where modulation of the activity of a nucleotide biosynthesis protein has an impact on the production of an organic acid or a fatty acid from the bacterium, perhaps due to improved growth or an increased supply of necessary co- factors, energy compounds, or precursor molecules). The MP molecules may be utilized !0 alone or in combination with other MP molecules of the invention, or in combination with other molecules involved in the same or a different metabolic pathway lysine or methione metabolism). In a preferred embodiment, the MP molecules are the metC (SEQ ID NO or RXA00657 (SEQ ID NO 5) nucleic acid molecules and the proteins encoded by these nucleic acid molecules (SEQ ID NO. 4 and SEQ ID NO. 6, respectively). Aspects of the invention are further explicated below.

I. Fine Chemicals The term 'fine chemical' is art-recognized and includes molecules produced by an organism which have applications in various industries, such as, but not limited to, the pharmaceutical, agriculture, and cosmetics industries. Such compounds include organic acids, such as tartaric acid, itaconic acid, and diaminopimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides, and nucleotides (as described e. g. in S Kuninaka, A. (1996) Nucleotides and related compounds, p. 561-612, in Biotechnology vol.

6, Rehm et al., eds. VCH Weinheim, and references contained therein), lipids, both saturated and unsaturated fatty acids arachidonic acid), diols propane diol, and butane diol), carbohydrates hyaluronic acid and trehalose), aromatic compounds g., aromatic amines, vanillin, and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, vol. A27,"Vitamins", p. 443-613 (1996) VCH S Weinheim and references therein and Ong, A. Niki, E. Packer, L. (1995)"Nutrition, S Lipids, Health, and Disease"Proceedings of the UNESCO/Confederation of Scientific and t 0 Technological Associations in Malaysia, and the Society for Free Radical Research- Asia, held Sept. 1-3, 1994 at Penang, Malaysia, AOCS Press, (1995)), enzymes, polyketides (Cane Ce et al. (1998) Science 282 63-68), and all other chemicals described in Gutcho (1983) Chemicals by Fermentation, Noyes Data Corporation, ISBN 0818805086 and references therein. The metabolism and uses of certain of these fine chemicals are further explicated below.

A. Amino Acid Metabolism and Uses Amino acids comprise the basic structural units of all proteins, and as such are essential for normal cellular functioning in all organisms. The term "amino" acid" is art- WO 01/66573 PCT/B00/02035 N recognized. The proteinogenic amino acids, of which there are 20 species, serve as Sstructural units for proteins, in which they are linked by peptide bonds, while the nonproteinogenic amino acids (hundreds of which are known) are not normally found in Sproteins (see Ulmann's Encyclopedia of Industrial Chemistry, vol. A2, p. 57-97 VCH: S 5 Weinheim (1985)). Amino acids may be in the D- or L- optical configuration, though Lamino acids are generally the only type found in naturally-occurring proteins.

Biosynthetic and degradative pathways of each of the 20 proteinogenic amino acids have been well characterized in both prokaryotic and eukaryotic cells (see, for example, SStryer, L. Biochemistry, 3 rd edition, pages 578-590 (1988)). The 'essential' amino acids I 10 (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, Sand valine), so named because they are generally a nutritional requirement due to the complexity of their biosyntheses, are readily converted by simple biosynthetic pathways to the remaining 11 'nonessential' amino acids (alanine, arginine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, and tyrosine). Higher animals do retain the ability to synthesize some of these amino acids, but the essential amino acids must be supplied from the diet in order for normal protein synthesis to occur.

Aside from their function in protein biosynthesis, these amino acids are interesting chemicals in their own right, and many have been found to have various applications in the food, feed, chemical, cosmetics, agriculture, and pharmaceutical industries. Lysine is an important amino acid in the nutrition not only of humans, but also ofmonogastric animals such as poultry and swine. Glutamate is most commonly used as a flavor additive (mono-sodium glutamate, MSG) and is widely used throughout the food industry, as are aspartate, phenylalanine, glycine, and cysteine. Glycine, Lmethionine and tryptophan are all utilized in the pharmaceutical industry. Glutamine, valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine are of use in both the pharmaceutical and cosmetics industries. Threonine, tryptophan, and D/ Lmethionine are common feed additives. (Leuchtenberger, W. (1996) Amino aids technical production and use, p. 466-502 in Rehm et al. (eds.) Biotechnology vol. 6, chapter 14a, VCH: Weinheim). Additionally, these amino acids have been found to be useful as precursors for the synthesis of synthetic amino acids and proteins, such as Nacetylcysteine, S-carboxymethyl-L-cysteine, (S)-5-hydroxytryptophan, and others described in Ulmann's Encyclopedia of Industrial Chemistry, vol. A2, p. 57-97, VCH: Weinheim, 1985.

WO 01/66573 PCT/IB00/02035 I The biosynthesis of these natural amino acids in organisms capable of producing Sthem, such as bacteria, has been well characterized (for review of bacterial amino acid U biosynthesis and regulation thereof, see Umbarger, H.E.(1978) Ann. Rev. Biochem. 47: S533-606). Glutamate is synthesized by the reductive amination of a-ketoglutarate, an S 5 intermediate in the citric acid cycle. Glutamine, proline, and arginine are each subsequently produced from glutamate. The biosynthesis of serine is a three-step process beginning with 3-phosphoglycerate (an intermediate in glycolysis), and resulting in this amino acid after oxidation, transamination, and hydrolysis steps. Both cysteine l t and glycine are produced from serine; the former by the condensation of homocysteine N 10 with serine, and the latter by the transferal of the side-chain p-carbon atom to 0 tetrahydrofolate, in a reaction catalyzed by serine transhydroxymethylase.

Phenylalanine and tyrosine are synthesized from the glycolytic and pentose phosphate pathway precursors erythrose 4-phosphate and phosphoenolpyruvate in a 9-step biosynthetic pathway that differ only at the final two steps after synthesis of prephenate.

Tryptophan is also produced from these two initial molecules, but its synthesis'is an 11step pathway. Tyrosine may also be synthesized from phenylalanine, in a reaction catalyzed by phenylalanine hydroxylase. Alanine, valine, and leucine are all biosynthetic products of pyruvate, the final product of glycolysis. Aspartate is formed from oxaloacetate, an intermediate of the citric acid cycle. Asparagine, methionine, threonine, and lysine are each produced by the conversion of aspartate. Isoleucine is formed from threonine.

The biosynthetic pathways leading to methionine have been studied in diverse organisms. The first step, acylation ofhomoserine, is common to all of the organisms, even though the source of the transferred acyl groups is different. Escherichia coli and the related species use succinyl-CoA (Michaeli, S. and Ron, E. Z. (1981) Mol. Gen.

Genet. 182, 349-354), while Saccharomyces cerevisiae (Langin, et al. (1986) Gene 49, 283-293), Brevibacteriumflavum (Miyajima, R. and Shiio, I. (1973) J. Biochem. 73, 1061-1068; Ozaki, H. and Shiio, I. (1982) J. Biochem. 91, 1163-1171), C. glutamicum (Park, et al. (1998) Mol. Cells 8, 286-294), and Leptospira meyeri (Belfaiza, J. et al. (1998) 180, 250-255; Bourhy, et al. (1997) J. Bacteriol. 179, 4396-4398) use acetyl-CoA as the acyl donor. Formation ofhomocysteine from acylhomoserine can occur in two different ways. E. coli uses the transsulfuration pathway which is catalyzed by cystathionine y-synthase (the product of metB) and cystathionine P-lyase WO 01/66573 PCT/IB00/02035 S(the product of metC). S. cerevisiae (Cherest, H. and Surdin-Kerjan, Y. (1992) Genetics S130, 51-58), B.flavum (Ozaki, H. and Shiio, I. (1982)J. Biochem. 91, 1163-1171), SPseudomonas aeruginosa (Foglino, et al. (1995) Microbiology 141, 431-439), and Q L. meyeri (Belfaiza, et al. (1998) J Bacteriol. 180, 250-255) utilize the direct S 5 sulfhydrylation pathway which is catalyzed by acylhomoserine sulfhydrylase. Unlike closely related B. flavum which uses only the direct sulfhydrylation pathway, enzyme activities of the transsulfuration pathway have been detected in the extracts of the C.

glutamicum cells and the pathway has been proposed to be the route for methionine Sbiosynthesis in the organism (Hwang, et al. (1999) Mol. Cells 9, 300-308; Kase, H.

IO 10 and Nakayama, K. (1974) Agr. Biol. Chem. 38, 2021-2030; Park, et al. 1998) SMol. Cells 8, 286-294).

Although some genes involved in methionine biosynthesis in C. glutamicum have been isolated, information on the biosynthesis of methionine in C. glutamicum is still very limited. No genes other than metA and metB have been isolated from the organism. To understand the biosynthetic pathways leading to methioriine in C.

glutamicum, we have isolated and characterized the metC gene (SEQ ID NO:3) and the metZ (also called metY) gene (SEQ ID NO:1) of C. glutamicum (see Table 1).

Amino acids in excess of the protein synthesis needs of the cell cannot be stored, and are instead degraded to provide intermediates for the major metabolic pathways of the cell (for review see Stryer, L. Biochemistry 3 r d ed. Ch. 21 "Amino Acid Degradation and the Urea Cycle" p. 495-516 (1988)). Although the cell is able to convert unwanted amino acids into useful metabolic intermediates, amino acid production is costly in terms of energy, precursor molecules, and the enzymes necessary to synthesize them.

Thus it is not surprising that amino acid biosynthesis is regulated by feedback inhibition, in which the presence of a particular amino acid serves to slow or entirely stop its own production (for overview of feedback mechanisms in amino acid biosynthetic pathways, see Stryer, L. Biochemistry, 3 rd ed. Ch. 24: "Biosynthesis of Amino Acids and Heme" p.

575-600 (1988)). Thus, the output of any particular amino acid is limited by the amount of that amino acid present in the cell.

B. Vitamin, Cofactor, and Nutraceutical Metabolism and Uses Vitamins, cofactors, and nutraceuticals comprise another group of molecules which the higher animals have lost the ability to synthesize and so must ingest, although WO 01/66573 PCT/IB00/02035

ID

they are readily synthesized by other organisms, such as bacteria. These molecules are C either bioactive substances themselves, or are precursors of biologically active substances which may serve as electron carriers or intermediates in a variety of Smetabolic pathways. Aside from their nutritive value, these compounds also have significant industrial value as coloring agents, antioxidants, and catalysts or other processing aids. (For an overview of the structure, activity, and industrial applications of these compounds, see, for example, Ullman's Encyclopedia of Industrial Chemistry, S"Vitamins" vol. A27, p. 443-613, VCH: Weinheim, 1996.) The term "vitamin" is artcrecognized, and includes nutrients which are required by an organism for normal functioning, but which that organism cannot synthesize by itself. The group of vitamins c-i may encompass cofactors and nutraceutical compounds. The language "cofactor" includes nonproteinaceous compounds required for a normal enzymatic activity to occur. Such compounds may be organic or inorganic; the cofactor molecules of the invention are preferably organic. The term "nutraceutical" includes dietary supplements having health benefits in plants and animals, particularly humans. Examples of such molecules are vitamins, antioxidants, and also certain lipids polyunsaturated fatty acids).

The biosynthesis of these molecules in organisms capable of producing them, such as bacteria, has been largely characterized (Ullman's Encyclopedia of Industrial Chemistry, "Vitamins" vol. A27, p. 443-613, VCH: Weinheim, 1996; Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley Sons; Ong, Niki, E. Packer, L. (1995) "Nutrition, Lipids, Health, and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia, and the Society for Free Radical Research Asia, held Sept.

1-3, 1994 at Penang, Malaysia, AOCS Press: Champaign, IL X, 374 S).

Thiamin (vitamin BI) is produced by the chemical coupling ofpyrimidine and thiazole moieties. Riboflavin (vitamin B 2 is synthesized from (GTP) and ribose-5'-phosphate. Riboflavin, in turn, is utilized for the synthesis of flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). The family of compounds collectively termed 'vitamin B 6 pyridoxine, pyridoxamine, pyridoxaand the commercially used pyridoxin hydrochloride) are all derivatives of the common structural unit, 5-hydroxy-6-methylpyridine. Pantothenate (pantothenic acid, (R)-(+)-N-(2,4-dihydroxy-3,3-dimethyl- 1 -oxobutyl)-P-alanine) can be produced WO 01/66573 PCT/IB00/02035 ID either by chemical synthesis or by fermentation. The final steps in pantothenate O biosynthesis consist of the ATP-driven condensation of p-alanine and pantoic acid. The 0 enzymes responsible for the biosynthesis steps for the conversion to pantoic acid, to P- Salanine and for the condensation to panthotenic acid are known. The metabolically active form of pantothenate is Coenzyme A, for which the biosynthesis proceeds in enzymatic steps. Pantothenate, pyridoxal-5'-phosphate, cysteine and ATP are the precursors of Coenzyme A. These enzymes not only catalyze the formation of panthothante, but also the production of (R)-pantoic acid, (R)-pantolacton, t) panthenol (provitamin Bs), pantetheine (and its derivatives) and coenzyme A.

0 10 Biotin biosynthesis from the precursor molecule pimeloyl-CoA in 0 microorganisms has been studied in detail and several of the genes involved have been identified. Many of the corresponding proteins have been found to also be involved in Fe-cluster synthesis and are members of the nifS class of proteins. Lipoic acid is derived from octanoic acid, and serves as a coenzyme in energy metabolism, where it becomes part of the pyruvate dehydrogenase complex and the a-ketoglutarate dehydrogenase complex. The folates are a group of substances which are all derivatives of folic acid, which is turn is derived from L-glutamic acid, p-amino-benzoic acid and 6methylpterin. The biosynthesis of folic acid and its derivatives, starting from the metabolism intermediates guanosine-5'-triphosphate (GTP), L-glutamic acid and pamino-benzoic acid has been studied in detail in certain microorganisms.

Corrinoids (such as the cobalamines and particularly vitamin B 12 and porphyrines belong to a group of chemicals characterized by a tetrapyrole ring system.

The biosynthesis of vitamin B 12 is sufficiently complex that it has not yet been completely characterized, but many of the enzymes and substrates involved are now known. Nicotinic acid (nicotinate), and nicotinamide are pyridine derivatives which are also termed 'niacin'. Niacin is the precursor of the important coenzymes NAD (nicotinamide adenine dinucleotide) and NADP (nicotinamide adenine dinucleotide phosphate) and their reduced forms.

The large-scale production of these compounds has largely relied on cell-free chemical syntheses, though some of these chemicals have also been produced by largescale culture of microorganisms, such as riboflavin, Vitamin B 6 pantothenate, and biotin. Only Vitamin Bl2 is produced solely by fermentation, due to the complexity of WO 01/66573 PCT/IB00/02035 its synthesis. In vitro methodologies require significant inputs of materials and time, N, often at great cost.

C. Purine, Pyrimidine, Nucleoside and Nucleotide Metabolism and Uses Purine and pyrimidine metabolism genes and their corresponding proteins are important targets for the therapy of tumor diseases and viral infections. The language S"purine" or "pyrimidine" includes the nitrogenous bases which are constituents of nucleic acids, co-enzymes, and nucleotides. The term "nucleotide" includes the basic structural units of nucleic acid molecules, which are comprised of a nitrogenous base, a 010 pentose sugar (in the case of RNA, the sugar is ribose; in the case of DNA, the sugar is C D-deoxyribose), and phosphoric acid. The language "nucleoside" includes molecules which serve as precursors to nucleotides, but which are lacking the phosphoric acid moiety that nucleotides possess. By inhibiting the biosynthesis of these molecules, or their mobilization to form nucleic acid molecules, it is possible to inhibit RNA and DNA synthesis; by inhibiting this activity in a fashion targeted to cancerous cells, the ability of tumor cells to divide and replicate may be inhibited. Additionally, there are nucleotides which do not form nucleic acid molecules, but rather serve as energy stores AMP) or as coenzymes FAD and NAD).

Several publications have described the use of these chemicals for these medical indications, by influencing purine and/or pyrimidine metabolism Christopherson, R.I. and Lyons, S.D. (1990) "Potent. inhibitors of de novo pyrimidine and purine biosynthesis as chemotherapeutic agents." Med. Res. Reviews 10: 505-548). Studies of enzymes involved in purine and pyrimidine metabolism have been focused on the development of new drugs which can be used, for example, as immunosuppressants or anti-proliferants (Smith, (1995) "Enzymes in nucleotide synthesis." Curr. Opin.

Struct. Biol. 5: 752-757; (1995) Biochem Soc. Transact. 23: 877-902). However, purine and pyrimidine bases, nucleosides and nucleotides have other utilities: as intermediates in the biosynthesis of several fine chemicals thiamine, S-adenosyl-methionine, folates, or riboflavin), as energy carriers for the cell ATP or GTP), and for chemicals themselves, commonly used as flavor enhancers IMP or GMP) or for several medicinal applications (see, for example, Kuninaka, A. (1996) Nucleotides and Related Compounds in Biotechnology vol. 6, Rehm et al., eds. VCH: Weinheim, p. 561- 612). Also, enzymes involved in purine, pyrimidine, nucleoside, or nucleotide WO 01/66573 PCT/IB00/02035 0 metabolism are increasingly serving as targets against which chemicals for crop C¢N protection, including fungicides, herbicides and insecticides, are developed.

The metabolism of these compounds in bacteria has been characterized (for Sreviews see, for example, Zalkin, H. and Dixon, J.E. (1992) "de novo purine nucleotide biosynthesis", in: Progress in Nucleic Acid Research and Molecular Biology, vol. 42, Academic Press:, p. 259-287; and Michal, G. (1999) "Nucleotides and Nucleosides", Chapter 8 in: Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, C- Wiley: New York). Purine metabolism has been the subject of intensive research, and is CN essential to the normal functioning of the cell. Impaired purine metabolism in higher animals can cause severe disease, such as gout. Purine nucleotides are synthesized from CI ribose-5-phosphate, in a series of steps through the intermediate compound phosphate (IMP), resulting in the production of guanosine-5'-monophosphate (GMP) or (AMP), from which the triphosphate forms utilized as nucleotides are readily formed. These compounds are also utilized as energy stores, so their degradation provides energy for many different biochemical processes in the cell.

Pyrimidine biosynthesis proceeds by the formation of uridine-5'-monophosphate (UMP) from ribose-5-phosphate. UMP, in turn, is converted to cytidine-5'-triphosphate (CTP).

The deoxy- forms of all of these nucleotides are produced in a one step reduction reaction from the diphosphate ribose form of the nucleotide to the diphosphate deoxyribose form of the nucleotide. Upon phosphorylation, these molecules are able to participate in DNA synthesis.

D. Trehalose Metabolism and Uses Trehalose consists of two glucose molecules, bound in a, a-1,1 linkage. It is commonly used in the food industry as a sweetener, an additive for dried or frozen foods, and in beverages. However, it also has applications in the pharmaceutical, cosmetics and biotechnology industries (see, for example, Nishimoto et al., (1998) U.S.

Patent No. 5,759,610; Singer, M.A. and Lindquist, S. (1998) Trends Biotech. 16: 460- 467; Paiva, C.L.A. and Panek, A.D. (1996) Biotech. Ann. Rev. 2: 293-314; and Shiosaka, M. (1997) J. Japan 172: 97-102). Trehalose is produced by enzymes from many microorganisms and is naturally released into the surrounding medium, from which it can be collected using methods known in the art.

WO 01/66573 PCT/IB00/02035 ND II. Elements and Methods of the Invention SThe present invention is based, at least in part, on the discovery of novel 0 molecules, referred to herein as MP nucleic acid and protein molecules (see Table 1), Swhich play a role in or function in one or more cellular metabolic pathways. In one S 5 embodiment, the MP molecules catalyze an enzymatic reaction involving one or more amino acid, lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways. In a preferred embodiment, the activity of one or more MP molecules of the present invention, alone or in combination with t molecules involved in the same or different metabolic pathway methionine or I 10 lysine metabolism), in one or more C. glutamicum metabolic pathways for amino acids, Svitamins, cofactors, nutraceuticals, nucleotides, nucleosides or trehalose has an impact on the production of a desired fine chemical by this organism. In a particularly preferred embodiment, the MP molecules of the invention are modulated in activity, such that the C. glutamicum metabolic pathways in which the MP proteins of the invention are involved are modulated in efficiency or output, which either directly or indirectly modulates the production or efficiency of production of a desired fine chemical by C. glutamicum. In a preferred embodiment, the fine chemical is an amino acid, lysine or methionine. In another preferred embodiment, the MP molecules are metZ, metY, and/or RXA00657 (see Table 1).

The language, "MP protein" or "MP polypeptide" includes proteins which play a role in, catalyze an enzymatic reaction, in one or more amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside or trehalose metabolic pathways.

Examples of MP proteins include those encoded by the MP genes set forth in Table 1 and by the odd-numbered SEQ ID NOs. The terms "MP gene" or "MP nucleic acid sequence" include nucleic acid sequences encoding an MP protein, which consist of a coding region and also corresponding untranslated 5' and 3' sequence regions.

Examples ofMP genes include those set forth in Table 1. The terms "production" or "productivity" are art-recognized and include the concentration of the fermentation product (for example, the desired fine chemical) formed within a given time and a given fermentation volume kg product per hour per liter). The term "efficiency of production" includes the time required for a particular level of production to be achieved (for example, how long it takes for the cell to attain a particular rate of output of a fine chemical). The term "yield" or "product/carbon yield" is art-recognized and includes WO 01/66573 PCT/IB00/02035 I the efficiency of the conversion of the carbon source' into the product fine chemical). This is generally written as, for example, kg product per kg carbon source.

By increasing the yield or production of the compound, the quantity of recovered molecules, or of useful recovered molecules of that compound in a given amount of culture over a given amount of time is increased. The terms "biosynthesis" or a "biosynthetic pathway" are art-recognized and include the synthesis of a compound, Spreferably an organic compound, by a cell from intermediate compounds in what may be a multistep and highly regulated process. The terms "degradation" or a "degradation pathway" are art-recognized and include the breakdown of a compound, preferably an organic compound, by a cell to degradation products (generally speaking, smaller or less N- complex molecules) in what may be a multistep and highly regulated process. The language "metabolism" is art-recognized and includes the totality of the biochemical reactions that take place in an organism. The metabolism of a particular compound, then, the metabolism of an amino acid such as glycine) comprises the overall biosynthetic, modification, and degradation pathways in the cell related to this compound.

The MP molecules of the present invention may be combined with one or more MP molecules of the invention or one or more molecules of the same or different metabolic pathway to increase the yield of a desired fine chemical. In a preferred embodiment, the fine chemical is an amino acid, lysine or methionine.

Alternatively, or in addition, a byproduct which is not desired may be reduced by combination or disruption of MP molecules or other metabolic molecules molecules involved in lysine or methionine metabolism). MP molecules combined with other molecules of the same or a different metabolic pathway may be altered in their nucleotide sequence and in the corresponding amino acid sequence to alter their activity under physiological conditions, which leads to an increase in productivity and/or yield of a desired fine chemical. In a further embodiment, an MP molecule in its original or in its above-described altered form may be combined with other molecules of the same or a different metabolic pathway which are altered in their nucleotide sequence in such a way that their activity is altered under physiological conditions which leads to an increase in productivity and/or yield of a desired fine chemical, an amino acid such as methionine or lysine.

WO 01/66573 PCT/IB00/02035 D0 In another embodiment, the MP molecules of the invention, alone or in 0 combination with one or more molecules of the same or different metabolic pathway, 0 are capable of modulating the production of a desired molecule, such as a fine chemical, Sin a microorganism such as C. glutamicum. Using recombinant genetic techniques, one S 5 or more of the biosynthetic or degradative enzymes of the invention for amino acids, lysine or methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose may be manipulated such that its function is modulated. For example, a biosynthetic enzyme may be improved in efficiency, or its allosteric control region t¢ destroyed such that feedback inhibition of production of the compound is prevented.

NO 10 Similarly, a degradative enzyme may be deleted or modified by substitution, deletion, or Saddition such that its degradative activity is lessened for the desired compound without impairing the viability of the cell. In each case, the overall yield or rate of production of one of these desired fine chemicals may be increased.

It is also possible that such alterations in the protein and nucleotide molecules of the invention may improve the production of other fine chemicals besides the amino acids, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose.

Metabolism of any one compound is necessarily intertwined with other biosynthetic and degradative pathways within the cell, and necessary cofactors, intermediates, or substrates in one pathway are likely supplied or limited by another such pathway.

Therefore, by modulating the activity of one or more of the proteins of the invention, the production or efficiency of activity of another fine chemical biosynthetic or degradative pathway may be impacted. For example, amino acids serve as the structural units of all proteins, yet may be present intracellularly in levels which are limiting for protein synthesis; therefore, by increasing the efficiency of production or the yields of one or more amino acids within the cell, proteins, such as biosynthetic or degradative proteins, may be more readily synthesized. Likewise, an alteration in a metabolic pathway enzyme such that a particular side reaction becomes more or less favored may result in the over- or under-production of one or more compounds which are utilized as intermediates or substrates for the production of a desired fine chemical.

The isolated nucleic acid sequences of the invention are contained within the genome of a Corynebacterium glutamicum strain available through the American Type Culture Collection, given designation ATCC 13032. The nucleotide sequence of the isolated C. glutamicum MP DNAs and the predicted amino acid sequences of the C.

WO 01/66573 PCT/IB00/02035 Sglutamicum MP proteins are shown in the Sequence Listing as odd-numbered SEQ ID SNOs and even-numbered SEQ ID NOs, respectively. Computational analyses were 0 performed which classified and/or identified these nucleotide sequences as sequences which encode metabolic pathway proteins, proteins involved in the methionine or lysine metabolic pathways.

The present invention also pertains to proteins which have an amino acid sequence which is substantially homologous to an amino acid sequence of the invention the sequence of an even-numbered SEQ ID NO of the Sequence Listing). As used Sherein, a protein which has an amino acid sequence which is substantially homologous I 10 to a selected amino acid sequence is least about 50% homologous to the selected amino acid sequence, the entire selected amino acid sequence. A protein which has an amino acid sequence which is substantially homologous to a selected amino acid sequence can also be least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to the selected amino acid sequence.

An MP protein of the invention, or a biologically active portion or fragment thereof, alone or in combination with one or more proteins of the same or different metabolic pathway, can catalyze an enzymatic reaction in one or more amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways, or have one or more of the activities set forth in Table 1 metabolism of methionine or lysine biosynthesis).

Various aspects of the invention are described in further detail in the following subsections: A. Isolated Nucleic Acid Molecules One aspect of the invention pertains to isolated nucleic acid molecules that encode MP polypeptides or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes or primers for the identification or amplification of MP-encoding nucleic acid MP DNA). As used herein, the term WO 01/66573 PCT/IB00/02035 NO "nucleic acid molecule" is intended to include DNA molecules cDNA or genomic SDNA) and RNA molecules mRNA) and analogs of the DNA or RNA generated 0 using nucleotide analogs. This term also encompasses untranslated sequence located at both the 3' and 5' ends of the coding region of the gene: at least about 100 nucleotides of sequence upstream from the 5' end of the coding region and at least about nucleotides of sequence downstream from the 3'end of the coding region of the gene.

The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA. An "isolated" nucleic acid molecule is one which is separated t from other nucleic acid molecules which are present in the natural source of the nucleic O 10 acid. Preferably, an "isolated" nucleic acid is free of sequences which naturally flank Sthe nucleic acid sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated MP nucleic acid molecule can contain less than about kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived a C. glutamicum cell). Moreover, an "isolated" nucleic acid molecule, such as a DNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized.

A nucleic acid molecule of the present invention, a nucleic acid molecule having a nucleotide sequence of an odd-numbered SEQ ID NO of the Sequence Listing, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, a C. glutamicum MP DNA can be isolated from a C. glutamicum library using all or portion of one of the odd-numbered SEQ ID NO sequences of the Sequence Listing as a hybridization probe and standard hybridization techniques as described in Sambrook, Fritsh, E. and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

Moreover, a nucleic acid molecule encompassing all or a portion of one of the nucleic acid sequences of the invention an odd-numbered SEQ ID NO:) can be isolated by the polymerase chain reaction using oligonucleotide primers designed based upon this sequence a nucleic acid molecule encompassing all or a portion of one of the nucleic acid sequences of the invention an odd-numbered SEQ ID NO of the WO 01/66573 PCT/IB00/02035

ID

Sequence Listing) can be isolated by the polymerase chain reaction using CN- oligonucleotide primers designed based upon this same sequence). For example, mRNA can be isolated from normal endothelial cells by the guanidinium-thiocyanate Q extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and DNA can be prepared using reverse transcriptase Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for polymerase chain reaction amplification can be designed based upon one of the C nucleotide sequences shown in the Sequence Listing. A nucleic acid of the invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to an MP nucleotide sequence can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.

In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises one of the nucleotide sequences shown in the Sequence Listing. The nucleic acid sequences of the invention, as set forth in the Sequence Listing, correspond to the Corynebacterium glutamicum MP DNAs of the invention. This DNA comprises sequences encoding MP proteins the "coding region", indicated in each oddnumbered SEQ ID NO: sequence in the Sequence Listing), as well as 5' untranslated sequences and 3' untranslated sequences, also indicated in each odd-numbered SEQ ID NO: in the Sequence Listing. Alternatively, the nucleic acid molecule can comprise only the coding region of any of the nucleic acid sequences of the Sequence Listing.

For the purposes of this application, it will be understood that some of the MP nucleic acid and amino acid sequences set forth in the Sequence Listing have an identifying RXA, RXN, RXS, or RXC number having the designation "RXA", "RXN", "RXS", or "RXC" followed by 5 digits RXA, RXN, RXS, or RXC). Each of the nucleic acid sequences comprises up to three parts: a 5' upstream region, a coding region, and a downstream region. Each of these three regions is identified by the same RXA, RXN, RXS, or RXC designation to eliminate confusion. The recitation "one of the odd-numbered sequences of the Sequence Listing", then, refers to any of the nucleic acid sequences in the Sequence Listing, which may also be distinguished by their WO 01/66573 PCT/IB00/02035 differing RXA, RXN, RXS, or RXC designations. The coding region of each of these sequences is translated into a corresponding amino acid sequence, which is also set forth in the Sequence Listing, as an even-numbered SEQ ID NO: immediately following the corresponding nucleic acid sequence. For example, the coding region for RXA00115 is set forth in SEQ ID NO:69, while the amino acid sequence which it encodes is set forth as SEQ ID NO:70. The sequences of the nucleic acid molecules of the invention are identified by the same RXA, RXN, RXS, or RXC designations as the amino acid Smolecules which they encode, such that they can be readily correlated. For example, the t amino acid sequences designated RXA00115, RXN00403, and RXS03158 are translations of the coding regions of the nucleotide sequences of nucleic acid molecules RXA00115, RXN00403, and RXS03158, respectively. The correspondence between the RXA, RXN, RXS, and RXC nucleotide and amino acid sequences of the invention and their assigned SEQ ID NOs is set forth in Table 1.

Several of the genes of the invention are "F-designated genes". An F-designated gene includes those genes set forth in Table 1 which have an in front of the RXA, RXN, RXS, or RXC designation. For example, SEQ ID NO:77, designated, as indicated on Table 1, as "F RXA00254", is an F-designated gene.

Also listed on Table 1 are the metZ (or metY) and metC genes (designated as SEQ ID NO:1 and SEQ ID NO:3, respectively. The corresponding amino acid sequence encoded by the metZ and metC genes are designated as SEQ ID NO:2 and SEQ ID respectively.

In one embodiment, the nucleic acid molecules of the present invention are not intended to include those compiled in Table 2.

In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of one of the nucleotide sequences of the invention a sequence of an odd-numbered SEQ ID NO: of the Sequence Listing), or a portion thereof. A nucleic acid molecule which is complementary to one of the nucleotide sequences of the invention is one which is sufficiently complementary to one of the nucleotide sequences shown in the Sequence Listing the sequence of an odd-numbered SEQ ID NO:) such that it can hybridize to one of the nucleotide sequences of the invention, thereby forming a stable duplex.

In still another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which is at least about 50%, 51%, 52%, 53%, WO 01/66573 PCT/IB00/02035 S 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to a nucleotide sequence of the invention a sequence of an odd-numbered SEQ ID NO: of the Sequence SListing), or a portion thereof. Ranges and identity values intermediate to the above- C, recited ranges, 70-90% identical or 80-95% identical) are also intended to be ,1 encompassed by the present invention. For example, ranges of identity values using a combination of any of the above values recited as upper and/or lower limits are intended C to be included. In an additional preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, to one of the nucleotide sequences of the invention, or a portion thereof.

Moreover, the nucleic acid molecule bf the invention can comprise only a portion of the coding region of the sequence of one of the odd-numbered SEQ ID NOs of the Sequence Listing, for example a fragment which can be used as a probe or primer or a fragment encoding a biologically active portion of an MP protein. The nucleotide sequences determined from the cloning of the MP genes from C. glutamicum allows for the generation of probes and primers designed for use in identifying and/or cloning MP homologues in other cell types and organisms, as well as MP homologues from other Corynebacteria or related species. The probe/primer typically comprises substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 40, 50 or 75 consecutive nucleotides of a sense strand of one of the nucleotide sequences of the invention a sequence of one of the oddnumbered SEQ ID NOs of the Sequence Listing), an anti-sense sequence of one of these sequences, or naturally occurring mutants thereof. Primers based on a nucleotide sequence of the invention can be used in PCR reactions to clone MP homologues.

Probes based on the MP nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In preferred embodiments, the probe further comprises a label group attached thereto, e.g. the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co- WO 01/66573 PCT/IB00/02035 factor. Such probes can be used as a part of a diagnostic test kit for identifying cells C which misexpress an MP protein, such as by measuring a level of an MP-encoding nucleic acid in a sample of cells from a subject detecting MP mRNA levels or Sdetermining whether a genomic MP gene has been mutated or deleted.

In one embodiment, the nucleic acid molecule of the invention encodes a protein or portion thereof which includes an amino acid sequence which is sufficiently Shomologous to an amino acid sequence of the invention a sequence of an evennumbered SEQ ID NO of the Sequence Listing) such that the protein or portion thereof 1 maintains the ability to catalyze an enzymatic reaction in an amino acid, vitamin, C 10 cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway. As used C herein, the language "sufficiently homologous" refers to proteins or portions thereof which have amino acid sequences which include a minimum number of identical or equivalent an amino acid residue which has a similar side chain as an amino acid residue in a sequence of one of the even-numbered SEQ ID NOs of the Sequence Listing) amino acid residues to an amino acid sequence of the invention such that the protein or portion thereof is able to catalyze an enzymatic reaction in a C. glutamicum amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside or trehalose metabolic pathway. Protein members of such metabolic pathways, as described herein, function to catalyze the biosynthesis or degradation of one or more of: amino acids, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose. Examples of such activities are also described herein. Thus, "the function of an MP protein" contributes to the overall functioning of one or more such metabolic pathway and Scontributes, either directly or indirectly, to the yield, production, and/or efficiency of production of one or more fine chemicals. Examples of MP protein activities are set forth in Table 1.

In another embodiment, the protein is at least about 50%, 51%, 52%, 53%, 54%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 66%, 67%, 68%, 69%, or more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%,77%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 96%, 97%, 98%, 99%, 99.7% or more homologous to an entire amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO: of the Sequence Listing).

WO 01/66573 PCT/IB00/02035 Portions of proteins encoded by the MP nucleic acid molecules of the invention 0C are preferably biologically active portions of one of the MP proteins. As used herein, the term "biologically active portion of an MP protein" is intended to include a portion, Se.g., a domain/motif, of an MP protein that catalyzes an enzymatic reaction in one or more C. glutamicum amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways, or has an activity as set forth in Table 1. To determine whether an MP protein or a biologically active porfion thereof can catalyze an enzymatic t" reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or 0C trehalose metabolic pathway, an assay of enzymatic activity may be performed. Such assay methods are well known to those of ordinary skill in the art, as detailed in C0 Example 8 of the Exemplification.

Additional nucleic acid fragments encoding biologically active portions of an MP protein can be prepared by isolating a portion of one of the amino acid sequences of the invention a sequence of an even-numbered SEQ ID NO: of the Sequence Listing), expressing the encoded portion of the MP protein or peptide by recombinant expression in vitro) and assessing the activity of the encoded portion of the MP protein or peptide.

The invention further encompasses nucleic acid molecules that differ from one of the nucleotide sequences of the invention a sequence of an odd-numbered SEQ ID NO: of the Sequence Listing) (and portions thereof) due to degeneracy of the genetic code and thus encode the same MP protein as that encoded:by the nucleotide sequences of the invention. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in the Sequence Listing an even-numbered SEQ ID In a still further embodiment, the nucleic acid molecule of the invention encodes a full length C.

glutamicum protein which is substantially homologous to an amino acid sequence of the invention (encoded by an open reading frame shown in an odd-numbered SEQ ID NO: of the Sequence Listing).

It will be understood by one of ordinary skill in the art that in one embodiment the sequences of the invention are not meant to include the sequences of the prior art, such as those Genbank sequences set forth in Table 2, which was available prior to the present invention. In one embodiment, the invention includes nucleotide and amino acid sequences having a percent identity to a nucleotide or amino acid sequence of the WO 01/66573 PCT/IB00/02035

ID

0 invention which is greater than that of a sequence of the prior art a Genbank C sequence (or the protein encoded by such a sequence) set forth in Table For example, the invention includes a nucleotide sequence which is greater than and/or at Sleast 45% identical to the nucleotide sequence designated RXA00657 SEQ ID One of ordinary skill in the art would be able to calculate the lower threshold of percent identity for any given sequence of the invention by examining the GAP-calculated percent identity scores set forth in Table 4 for each of the three top hits for the given sequence, and by subtracting the highest GAP-calculated percent identity from 100 C percent. One of ordinary skill in the art will also appreciate that nucleic acid and amino acid sequences having percent identities greater than the lower threshold so calculated iN at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more identical) are also encompassed by the invention.

In addition to the C. glutamicum MP nucleotide sequences set forth in the Sequence Listing as odd-numbered SEQ ID NOs, it will be appreciated by one of ordinary skill in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of MP proteins may exist within a population the C.

glutamicum population). Such genetic polymorphism in the MP gene may exist among individuals within a population due to natural variation. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding an MP protein, preferably a C. glutamicum MP protein. Such natural variations can typically result in 1-5% variance in the nucleotide sequence of the MP gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in MP that are the result of natural variation and that do not alter the functional activity of MP proteins are intended to be within the scope of the invention.

Nucleic acid molecules corresponding to natural variants and non-C. glutamicum homologues of the C. glutamicum MP DNA of the invention can be isolated based on their homology to the C. glutamicum MP nucleic acid disclosed herein using the C.

glutamicum DNA, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. Accordingly, in WO 01/66573 PCT/IB00/02035 N another embodiment, an isolated nucleic acid molecule of the invention is at least C nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising a nucleotide sequence of an odd-numbered SEQ ID NO: of the Sequence Listing. In other embodiments, the nucleic acid is at least 30, 50, 100, 250 or more nucleotides in length. As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under Swhich nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferably, the conditions are such that sequences at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologous to each other typically remain hybridized to each other. Such c stringent conditions are known to one of ordinary skill in the art and can be found in Current Protocols in Molecular Biology, John Wiley Sons, N.Y. (1989), 6.3.1-6.3.6.

A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washies in 0.2 X SSC, 0.1% SDS at 50-65 0 C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to a nucleotide sequence of the invention corresponds to a naturally-occurring nucleic acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature encodes a natural protein). In one embodiment, the nucleic acid encodes a natural C.

glutamicum MP protein.

In addition to naturally-occurring variants of the MP sequence that may exist in the population, one of ordinary skill in the art will further appreciate that changes can be introduced by mutation into a nucleotide sequence of the invention, thereby leading to changes in the amino acid sequence of the encoded MP protein, without altering the functional ability of the MP protein. For example, nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in a nucleotide sequence of the invention. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of one of the MP proteins an evennumbered SEQ ID NO: of the Sequence Listing) without altering the activity of said MP protein, whereas an "essential" amino acid residue is required for MP protein activity.

Other amino acid residues, however, those that are not conserved or only semi- WO 01/66573 PCT/IBOO/02035 IN conserved in the domain having MP activity) may not be essential for activity and thus O are likely to be amenable to alteration without altering MP activity.

0 Accordingly, another aspect of the invention pertains to nucleic acid molecules Sencoding MP proteins that contain changes in amino acid residues that are not essential for MP activity. Such MP proteins differ in amino acid sequence from a sequence of an even-numbered SEQ ID NO: of the Sequence Listing yet retain at least one of the MP activities described herein. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an Samino acid sequence at least about 50% homologous to an amino acid sequence of the NO 10 invention and is capable of catalyzing an enzymatic reaction in an amino acid, vitamin, O cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway, or has one or more activities set forth in Table 1. Preferably, the protein encoded by the nucleic acid molecule is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% homologous to one of the amino acid sequences of the invention.

To determine the percent homology of two amino acid sequences one of the amino acid sequences of the invention and a mutant form thereof) or of two nucleic acids, the sequences are aligned for optimal comparison purposes gaps can be introduced in the sequence of one protein or nucleic acid for optimal alignment with the other protein or nucleic acid). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in one sequence one of the amino acid sequences of the invention) is occupied by the same amino acid residue or nucleotide as the corresponding position in the other sequence a mutant form of the amino acid sequence), then the molecules are homologous at that position as used herein amino acid or nucleic acid "homology" is equivalent to amino acid or nucleic acid "identity"). The percent homology between the two sequences is a function of the number of identical positions shared by the sequences homology of identical positions/total of positions x 100).

An isolated nucleic acid molecule encoding an MP protein homologous to a protein sequence of the invention a sequence of an even-numbered SEQ ID NO: of WO 01/66573 PCT/IB00/02035 I the Sequence Listing) can be created by introducing one or more nucleotide C substitutions, additions or deletions into a nucleotide sequence of the invention such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into one of the nucleotide sequences of the invention by standard techniques, such as site-directed mutagenesis and PCRmediated mutagenesis. Preferably, conservative amino acid substitutions are made at Sone or more predicted non-essential amino acid residues. A "conservative amino acid c- substitution" is one in which the amino acid residue is replaced with an amino acid 0C residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side CN- chains lysine, arginine, histidine), acidic side chains aspartic acid, glutamic acid), uncharged polar side chains glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains threonine, valine, isoleucine) and aromatic side chains tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in an MP protein is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of an MP coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for an MP activity described herein to identify mutants that retain MP activity. Following mutagenesis of the nucleotide sequence of one of the odd-numbered SEQ ID NOs of the Sequence Listing, the encoded protein can be expressed recombinantly and the activity of the protein can be determined using, for example, assays described herein (see Example 8 of the Exemplification).

In addition to the nucleic acid molecules encoding MP proteins described above, another aspect of the invention pertains to isolated nucleic acid molecules which are antisense thereto. An "antisense" nucleic acid comprises a nucleotide sequence which is complementary to a "sense" nucleic acid encoding a protein, complementary to the coding strand of a double-stranded DNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. The antisense nucleic acid can be complementary to an entire MP coding strand, or to only a portion thereof. In one embodiment, an antisense nucleic acid molecule is WO 01/66573 PCT/IB00/02035 N antisense to a "coding region" of the coding strand of a nucleotide sequence encoding an SMP protein. The term "coding region" refers to the region of the nucleotide sequence Scomprising codons which are translated into amino acid residues the entire coding Q region of SEQ ID NO.:1 (metZ) comprises nucleotides 363 to 1673). In another S 5 embodiment, the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding MP. The term "noncoding region" refers to 5' and 3' sequences which flank the coding region that are not translated into amino acids also referred to as 5' and 3' untranslated regions).

n Given the coding strand sequences encoding MP disclosed herein the I 10 sequences set forth as odd-numbered SEQ ID NOs in the Sequence Listing), antisense Snucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of MP mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of MP mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of MP mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-Dgalactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, WO 01/66573 PCT/IBOO/02035 I:O uracil-5-oxyacetic acid wybutoxosine, pseudouracil, queosine, 2-thiocytosine, Smethyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid Smethylester, uracil-5-oxyacetic acid 5-methyl-2-thiouracil, 3-(3-amino-3-N-2- Scarboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense S 5 nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

t The antisense nucleic acid molecules of the invention are typically administered N 10 to a cell or generated in situ such that they hybridize with or bind to cellular mRNA Sand/or genomic DNA encoding an MP protein to thereby inhibit expression of the protein, by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. The antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong prokaryotic, viral, or eukaryotic promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual P-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids.

Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-omethylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).

In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes hammerhead ribozymes WO 01/66573 PCT/IB00/02035 S(described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave MP mRNA transcripts to thereby inhibit translation of MP mRNA.

A ribozyme having specificity for an MP-encoding nucleic acid can be designed based upon the nucleotide sequence of an MP DNA disclosed herein SEQ ID NO:1 (metZ). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide Ssequence to be cleaved in an MP-encoding mRNA. See, Cech et al. U.S. Patent No. 4,987,071 and Cech et al. U.S. Patent No. 5,116,742. Alternatively, MP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, Bartel, D. and Szostak, J.W. (1993) Science 261:1411-1418.

C Alternatively, MP gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of an MP nucleotide sequence an MP promoter and/or enhancers) to form triple helical structures that prevent transcription of an MP gene in target cells. See generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. t al. (1992) Ann. N. Y. Acad. Sci. 660:27-36; and Maher, L.J. (1992) Bioassays 14(12):807-15.

Another aspect of the invention pertains to combinations of genes involved in methionine and/or lysine metabolism and the use of to combinations of genes involved in methionine and/or lysine metabolism in the methods of the invention. Preferred combinations are the combination of metZ with metC, metB (encoding Cystathionine- Synthase), metA (encoding homoserine-O-acetyltransferase), metE (encoding Methionine Synthase), metH (encoding Methionine Synthase), hor (encoding homoserine dehydrogenase), asd (encoding aspartatesemialdehyd dehydrogenase), lysC /ask (encoding aspartokinase) and rxa00657 (herein designated as SEQ ID dapA, (gene encoding DIHYDRODIPICOLINATE SYNTHASE), dapB (gene encoding DIHYDRODIPICOLINATE REDUCTASE), dapC (gene encoding 2,3,4,5tetrahydropyridine-2-carboxylate N-succinyltransferase), dapD/argD (gene encoding acetylornithine transaminase), dapE (gene encoding succinyldiaminopimelate desuccinylase), dapF (gene encoding diaminopimelate epimerase), lysA (gene encoding diaminopimelate decarboxylase), ddh (gene encoding diaminopimelate dehydrogenase), lysE (gene encoding for the lysine exporter lysG (gene encoding for the exporter regulator), hsk (gene encoding homoserine kinase) as well as genes involved in anaplerotic reaction such as ppc (gene encoding phosphoenolpyruvate carboxylase), WO 01/66573 PCT/IB00/02035 I ppcK (gene encoding phosphoenolpyruvate carboxykinase), pycA (gene encoding Ci pyruvate carboxylase), accD, accA, accB, accC (genes encoding for subunits of acetyl- CoA-carboxylase), as well as genes of the pentose-phosphate pathway, gpdh genes Sencoding glucose-6-phophate-dehydrogenase, opcA, pgdh (gene encoding 6phosphogluconate-dehydrogenase), ta (gene encoding transaldolase), tk (gene encoding gene encoding transketolase), pgl (gene encoding 6-PHOSPHOGLUCONO- LACTONASE), ripe (gene encoding RIBULOSE-PHOSPHATE 3-EPIMERASE) 0 rpe (gene encoding RIBOSE 5-PHOSPHATE EPIMERASE) 0C or combinations of the above-mentioned genes of the pentose-phosphate-pathways, or other MP genes of the invention.

NC The genes may be altered in their nucleotide sequence and in the corresponding amino acid sequence resulting in derivatives in such a way that their activity is altered under physiological conditions which leads to an increase in productivity and/or yield of a desired fine chemical, an amino acid such as methionine or lysine. One class of such alterations or derivatives is well known for the nucleotide sequence of the ask gene encoding aspartokinase. These alterations lead to removal of feed back inhibition by the amino acids lysine and threonine and subsequently to lysine overproduction. In a preferred embodiment the metZ gene or altered forms of the metZ gene are used in a Corynebacterium strain in combination with ask, horn, metA and metHor derivatives of these genes. In another preferred embodiment metZ or altered forms of the metZ gene are used in a Corynebacterium strain in combination with ask, hom, metA and metE or derivatives of these genes. In a more preferred embodiment, the gene combinations metZ or altered forms of the metZ gene are combined with ask horn, metA and metH or derivatives of these genes, or metZ is combined with ask, hom, metA and metE or derivatives of these genes in a Corynebacterium strain and sulfur sources such as sulfates, thiosulfates, sulfites and also more reduced sulfur sources such as H 2 S and sulfides and derivatives are used in the growth medium. Also, sulfur sources such as methyl mercaptan, methanesulfonic acid, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids such as cysteine and other sulfur containing compounds can be used. Another aspect of the invention pertains to the use of the above mentioned gene combinations in a Corynebacterium strain which is, before or after introduction of the genes, mutagenized by radiation or by mutagenic chemicals well-known to one of ordinary skill in the art and selected for resistance against high concentrations of the fine WO 01/66573 PCT/IB00/02035 N chemical of interest, e.g. lysine or methionine or analogues of the desired fine chemical C such as the methionine analogues ethionine, methyl methionine, or others. In another embodiment, the gene combinations mentioned above can be expressed in a SCorynebacterium strain having particular gene disruptions. Preferred are gene disruptions that encode proteins that favor carbon flux to undesired metabolites. Where methionine is the desired fine chemical the formation of lysine may be unfavorable. In such a case the combination of the above mentioned genes should proceed in a C Corynebacterium strain bearing a gene disruption of the lysA gene (encoding C diaminopimelate decarboxylase) or the ddh gene (encoding the meso-diaminopimelate dehydrogenase catalysing the conversion of tetrahydropicolinate to meso- C1 diaominopimelate). In a preferred embodiment, a favorable combination of the abovementioned genes are all altered in such a way that their gene products are not feed back inhibited by end products or metabolites of the biosynthetic pathway leading to the desired fine chemical. In the case that the desired fine chemical is methionine, the gene combinations may be expressed in a strain previously treated with mutagenic agents or radiation and selected for the above-mentioned resistance. Additionally, the strain should be grown in a growth medium containing one or more of the above mentioned sulfur sources.

In another embodiment of the invention, a gene was identified from the genome of Corynebacterium glutamicum as a gene coding for a hypothetical transcriptional regulatory protein. This gene is described as RXA00657. The nucleotide sequence of RXA00657 corresponds to SEQ ID NO:5. The amino acid sequence of RXA00657 corresponds to SEQ ID NO:6. It was found that when the RXA00657 gene, as well as upstream and downstream regulatory regions described in the examples, was cloned into a vector capable of replicating in Corynebacterium glutamicum and transformed and expressed in a lysine producing strain such as ATCC13286, that this strain produced more lysine compared to the strain transformed with the same plasmid lacking the aforementioned nucleotide fragment RXA00657. In addition to the observation that the lysine titer was increased in the mentioned strain, the selectivity determined by the molar amount of lysine produced compared to the molar amount of sucrose consumed was increased (see Example 14). Overexpression of RXA00657 in combination with the overexpression of other genes either directly involved in the lysine specific pathway WO 01/66573 PCT/IB00/02035 such as lysC, dapA, dapB, dapC, dapD, dapF, ddh, lysE, lysG, and lysR results in an Sincrease in the production of lysine compared to RXA00657 alone.

B. Recombinant Expression Vectors and Host Cells S 5 Another. aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding an MP protein (or a portion thereof) or combinations of genes wherein at least one gene encodes for an MP protein. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", IO 10 which refers to a circular double stranded DNA loop into which additional DNA 0 segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form ofplasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector.

However, the invention is intended to include such other forms of expression vectors, such as viral vectors replication defective retroviruses, adenoviruses and adenoassociated viruses), which serve equivalent functions.

The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory WO 01/66573 PCT/IB00/02035 O sequence" is intended to include promoters, repressor binding sites, activator binding C. sites, enhancers and other expression control elements terminators, polyadenylation signals, or other elements of mRNA secondary structure). Such Sregulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

Regulatory sequences include those which direct constitutive expression of a nucleotide Ssequence in many types of host cell and those which direct expression of the nucleotide Ssequence only in certain host cells. Preferred regulatory sequences are, for example, promoters such as cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, lacI-, T7-, T5-, T3-, 0 10 gal-, trc-, ara-, SP6-, amy, SP02, X-PR- or X PL, which are used preferably in bacteria.

O

C Additional regulatory sequences are, for example, promoters from yeasts and fungi, such as ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, promoters from plants such as CaMV/35S, SSU, OCS, lib4, usp, STLS1, B33, nos or ubiquitin- or phaseolinpromoters. It is also possible to use artificial promoters. It will be appreciated by one of ordinary skill in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein MP proteins, mutant forms of MP proteins, fusion proteins, etc.).

The recombinant expression vectors of the invention can be designed for expression of MP proteins in prokaryotic or eukaryotic cells. For example, MP genes can be expressed in bacterial cells such as C. glutamicum, insect cells (using baculovirus expression vectors), yeast and other fungal cells (see Romanos, M.A. et al. (1992) "Foreign gene expression in yeast: a review", Yeast 8: 423-488; van den Hondel, C.A.M.J.J. et al. (1991) "Heterologous gene expression in filamentous fungi" in: More Gene Manipulations in Fungi, J.W. Bennet L.L. Lasure, eds., p. 396-428: Academic Press: San Diego; and van den Hondel, C.A.M.J.J. Punt, P.J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J.F. et al., eds., p. 1-28, Cambridge University Press: Cambridge), algae and multicellular plant cells (see Schmidt, R. and Willmitzer, L. (1988) High efficiency Agrobacterium tumefaciens -mediated transformation ofArabidopsis thaliana leaf and cotyledon explants" Plant Cell Rep.: 583-586), or mammalian cells.

WO 01/66573 PCT/IB00/02035 O Suitable host cells are discussed further in Goeddel, Gene Expression Technology: C Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion Sor non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein but also to the Cterminus or fused within suitable regions in the proteins. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the C solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase.

Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. In one embodiment, the coding sequence of the MP protein is cloned into a pGEX expression vector to create a vector encoding a fusion protein comprising, from the N-terminus to the C-terminus, GST-thrombin cleavage site-X protein. The fusion protein can be purified by affinity chromatography using glutathione-agarose resin.

Recombinant MP protein unfused to GST can be recovered by cleavage of the fusion protein with thrombin.

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., (1988) Gene 69:301-315) pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN- I113-B1, Agt 11, pBdCl, and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89; and Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York IBSN 0 444 904018).

Target gene expression from the pTrc vector relies on host RNA polymerase WO 01/66573 PCT/IB00/02035 transcription from a hybrid trp-lac fusion promoter. Target gene expression from the ,1 pET ld vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by Shost strains BL21(DE3) or HMS174(DE3) from a resident X prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter. For transformation of other varieties of bacteria, appropriate vectors may be selected. For example, the plasmids pIJ101, pIJ364, pIJ702 and pIJ361 are known to be useful in transforming C, Streptomyces, while plasmids pUB 110, pC194, or pBD214 are suited for transformation of Bacillus species. Several plasmids of use in the transfer of genetic information into Corynebacterium include pHM1519, pBL1, pSA77, or pAJ667 (Pouwels et al., eds.

N (1985) Cloning Vectors. Elsevier: New York IBSN 0 444 904018).

One strategy to maximize recombinant protein expression is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in the bacterium chosen for expression, such as C. glutamicum (Wada et al. (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the MP protein expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari, et al., (1987) Embo J. 6:229-234),, 2 t, pAG-1, Yep6, Yepl3, pEMBLYe23, pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods for the construction of vectors appropriate for use in other fungi, such as the filamentous fungi, include those detailed in: van den Hondel, C.A.M.J.J. Punt, P.J.

(1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy, et al., eds., p. 1-28, Cambridge University Press: Cambridge, and Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York (IBSN 0 444 904018).

Alternatively, the MP proteins of the invention can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of WO 01/66573 PCT/IB00/02035

ID

proteins in cultured insect cells Sf 9 cells) include the pAc series (Smith et al.

(1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39).

SIn another embodiment, the MP proteins of the invention may be expressed in unicellular plant cells (such as algae) or in plant cells from higher plants the spermatophytes, such as crop plants). Examples of plant expression vectors include those detailed in: Becker, Kemper, Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20: 1195-1197; and Bevan, M.W. (1984) "Binary Agrobacterium vectors for 0 10 plant transformation", Nucl. Acid. Res. 12: 8711-8721, and include pLGV23, pGHlac+,

O

C- pBIN19, pAK2004, and pDH51 (Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York IBSN 0 444 904018).

In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements.

For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type tissue-specific regulatory elements are used to express the nucleic acid). Tissuespecific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al.

(1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters the neurofilament promoter; Byrne and Ruddle (1989) PNAS 86:5473-5477), WO 01/66573 PCT/IB00/02035 I pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916), and mammary C gland-specific promoters milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the ca-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).

The invention further provides a recombinant expression vector comprising a C,1 DNA molecule of the invention cloned into the expression vector in an antisense C0 orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an

O

CN RNA molecule which is antisense to MP mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA.

The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews Trends in Genetics, Vol. 1(1) 1986.

Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

A host cell can be any prokaryotic or eukaryotic cell. For example, an MP protein can be expressed in bacterial cells such as C. glutamicum, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those of ordinary skill in the art. Microorganisms WO 01/66573 PCT/IB00/02035

\D

0 related to Corynebacterium glutamicum which may be conveniently used as host cells

O

Cfor the nucleic acid and protein molecules of the invention are set forth in Table 3.

SVector DNA can be introduced into prokaryotic or eukaryotic cells via Sconventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection", "conjugation" and "transduction" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid linear DNA or RNA a linearized vector or a gene construct alone without a vector) C or nucleic acid in the form of a vector a plasmid, phage, phasmid, phagemid, C transposon or other DNA) into a host cell, including calcium phosphate or calcium \0 chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, natural

O

rC competence, chemical-mediated transfer, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding an MP protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection cells that have incorporated the selectable marker gene will survive, while the other cells die).

To create a homologous recombinant microorganism, a vector is prepared which contains at least a portion of an MP gene into which a deletion, addition or substitution has been introduced to thereby alter, functionally disrupt, the MP gene. Preferably, this MP gene is a Corynebacterium glutamicum MP gene, but it can be a homologue from a related bacterium or even from a mammalian, yeast, or insect source. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous MP gene is functionally disrupted no longer encodes a functional protein; also referred to as a "knock out" vector). Alternatively, WO 01/66573 PCT/IB00/02035 the vector can be designed such that, upon homologous recombination, the endogenous (N MP gene is mutated or otherwise altered but still encodes functional protein the Uupstream regulatory region can be altered to thereby alter the expression of the Sendogenous MP protein). In the homologous recombination vector, the altered portion of the MP gene is flanked at its 5' and 3' ends by additional nucleic acid of the MP gene to allow for homologous recombination to occur between the exogenous MP gene carried by the vector and an endogenous MP gene in a microorganism. The additional 04 flanking MP nucleic acid is of sufficient length for successful homologous 04 recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are included in the vector (see Thomas, and c Capecchi, M.R. (1987) Cell 51: 503 for a description of homologous recombination vectors). The vector is introduced into a microorganism by electroporation) and cells in which the introduced NMP gene has homologously recombined with the endogenous MP gene are selected, using art-known techniques.

In another embodiment, recombinant microorganisms can be produced which contain selected systems which allow for regulated expression of the introduced gene.

For example, inclusion of an MP gene on a vector placing it under control of the lac operon permits expression of the MP gene only in the presence of IPTG. Such regulatory systems are well known in the art.

In another embodiment, an endogenous MP gene in a host cell is disrupted by homologous recombination or other genetic means known in the art) such that expression of its protein product does not occur. In another embodiment, an endogenous or introduced MP gene in a host cell has been altered by one or more point mutations, deletions, or inversions, but still encodes a functional MP protein. In still another embodiment, one or more of the regulatory regions a promoter, repressor, or inducer) of an MP gene in a microorganism has been altered by deletion, truncation, inversion, or point mutation) such that the expression of the MP gene is modulated. One of ordinary skill in the art will appreciate that host cells containing more than one of the described MP gene and protein modifications may be readily produced using the methods of the invention, and are meant to be included in the present invention.

A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce express) an MP protein. Accordingly, the invention WO 01/66573 PCT/IB00/02035 I further provides methods for producing MP proteins using the host cells of the 0"4 invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding an MP protein has been introduced, or into which genome has been introduced a gene encoding a wild-type or altered MP protein) in a suitable medium until MP protein is produced. In another embodiment, the method further comprises isolating MP proteins from the medium or the host cell.

C. Isolated MP Proteins Another aspect of the invention pertains to isolated MP proteins, and biologically 0C active portions thereof. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.

The language "substantially free of cellular material" includes preparations of MP protein in which the protein is separated from cellular components of the cells in which it is naturally or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of MP protein having less than about 30% (by dry weight) ofnon-MP protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% ofnon-MP protein, still more preferably less than about 10% of non-MP protein, and most preferably less than about 5% non-MP protein. When the MP protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about and most preferably less than about 5% of the volume of the protein preparation. The language "substantially free of chemical precursors or other chemicals" includes preparations of MP protein in which the protein is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. In one embodiment, the language "substantially free of chemical precursors or other chemicals" includes preparations of MP protein having less than about 30% (by dry weight) of chemical precursors or non-MP chemicals, more preferably less than about 20% chemical precursors or non-MP chemicals, still more preferably less than about 10% chemical precursors or non-MP chemicals, and most preferably less than about 5% chemical precursors or non-MP chemicals. In preferred embodiments, isolated proteins or WO 01/66573 PCT/IB00/02035 biologically active portions thereof lack contaminating proteins from the same organism C from which the MP protein is derived. Typically, such proteins are produced by recombinant expression of, for example, a C. glutamicum MP protein in a microorganism such as C. glutamicum.

An isolated MP protein or a portion thereof of the invention can catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, Snucleoside, or trehalose metabolic pathway, or has one or more of the activities set forth in Table 1. In preferred embodiments, the protein or portion thereof comprises an amino N, acid sequence which is sufficiently homologous to an amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO: of the Sequence Listing) C1 such that the protein or portion thereof maintains the ability to catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway. The portion of the protein is preferably a biologically active portion as described herein. In another preferred embodiment, an MP protein of the invention has an amino acid sequence set forth as an even-numbered SEQ ID NO: of the Sequence Listing. In yet another preferred embodiment, the MP protein has an amino acid sequence which is encoded by a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, to a nucleotide sequence of the invention a sequence of an odd-numbered SEQ ID NO: of the Sequence Listing). In still another preferred embodiment, the MP protein has an amino acid sequence which is encoded by a nucleotide sequence that is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to one of the nucleic acid sequences of the invention, or a portion thereof. Ranges and identity values intermediate to the aboverecited values, 70-90% identical or 80-95% identical) are also intended to be encompassed by the present invention. For example, ranges of identity values using a combination of any of the above values recited as upper and/or lower limits are intended to be included. The preferred MP proteins of the present invention also preferably possess at least one of the MP activities described herein. For example, a preferred MP protein of the present invention includes an amino acid sequence encoded by a WO 01/66573 PCT/IB00/02035 N nucleotide sequence which hybridizes, hybridizes under stringent conditions, to a C, nucleotide sequence of the invention, and which can catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose Smetabolic pathway, or which has one or more of the activities set forth in Table 1.

In other embodiments, the MP protein is substantially homologous to an amino acid sequence of the invention a sequence of an even-numbered SEQ ID NO: of the Sequence Listing) and retains the functional activity of the protein of one of the amino acid sequences of the invention yet differs in amino acid sequence due to natural Svariation or mutagenesis, as described in detail in subsection I above. Accordingly, in another embodiment, the MP protein is a protein which comprises an amino acid r, sequence which is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even'more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to an entire amino acid sequence of the invention and which has at least one of the MP activities described herein. Ranges and identity values intermediate to the above-recited values, 70-90% identical or 80-95% identical) are also intended to be encompassed by the present invention. For example, ranges of identity values using a combination of any of the above values recited as upper and/or lower limits are intended to be included. In another embodiment, the invention pertains to a full length C. glutamicum protein which is substantially homologous to an entire amino acid sequence of the invention.

Biologically active portions of an MP protein include peptides comprising amino acid sequences derived from the amino acid sequence of an MP protein, an amino acid sequence of an even-numbered SEQ ID NO: of the Sequence Listing or the amino acid sequence of a protein homologous to an MP protein, which include fewer amino acids than a full length MP protein or the full length protein which is homologous to an MP protein, and exhibit at least one activity of an MP protein. Typically, biologically active portions (peptides, peptides which are, for example, 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino acids in length) comprise a domain or motif with at least one activity of an MP protein. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant WO 01/66573 PCT/IB00/02035

ID

0 techniques and evaluated for one or more of the activities described herein. Preferably, NC the biologically active portions of an MP protein include one or more selected domains/motifs or portions thereof having biological activity.

SMP proteins are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as _described above) and the MP protein is expressed in the host cell. The MP protein can C- then be isolated from the cells by an appropriate purification scheme using standard C protein purification techniques. Alternative to recombinant expression, an MP protein, polypeptide, or peptide can be synthesized chemically using standard peptide synthesis

O

rC techniques. Moreover, native MP protein can be isolated from cells endothelial cells), for example using an anti-MP antibody, which can be produced by standard techniques utilizing an MP protein or fragment thereof of this invention.

The invention also provides MP chimeric or fusion proteins. As used herein, an MP "chimeric protein" or "fusion protein" comprises an MP polypeptide operatively linked to a non-MP polypeptide. An "MP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to MP, whereas a "non-MP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the MP protein, a protein which is different from the MP protein and which is derived from the same or a different organism. Within the fusion protein, the term "operatively linked" is intended to indicate that the MP polypeptide and the non-MP polypeptide are fused in-frame to each other. The non-MP polypeptide can be fused to the N-terminus or C-terminus of the MP polypeptide. For example, in one embodiment the fusion protein is a GST-MP fusion protein in which the MP sequences are fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant MP proteins. In another embodiment, the fusion protein is an MP protein containing a heterologous signal sequence at its Nterminus. In certain host cells mammalian host cells), expression and/or secretion of an MP protein can be increased through use of a heterologous signal sequence.

Preferably, an MP chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended WO 01/66573 PCT/IB00/02035 N termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.

Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel Q et al. John Wiley Sons: 1992). Moreover, many expression vectors are commercially I 10 available that already encode a fusion moiety a GST polypeptide). An MP- C encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the MP protein.

Homologues of the MP protein can be generated by mutagenesis, discrete point mutation or truncation of the MP protein. As used herein, the term "homologue" refers to a variant form of the MP protein which acts as an agonist or antagonist of the activity of the MP protein. An agonist of the MP protein can retain substantially the same, or a subset, of the biological activities of the MP protein. An antagonist of the MP protein can inhibit one or more of the activities of the naturally occurring form of the MP protein, by, for example, competitively binding to a downstream or upstream member of the MP cascade which includes the MP protein. Thus, the C. glutamicum MP protein and homologues thereof of the present invention may modulate the activity of one or more metabolic pathways in which MP proteins play a role in this microorganism.

In an alternative embodiment, homologues of the MP protein can be identified by screening combinatorial libraries of mutants, truncation mutants, of the MP protein for MP protein agonist or antagonist activity. In one embodiment, a variegated library of MP variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of MP variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential MP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins for phage display) containing the set of MP sequences therein.

There are a variety of methods which can be used to produce libraries of potential MP WO 01/66573 PCT/IB00/02035 N homologues from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential MP sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, Narang, S.A. (1983) Tetrahedron 39:3; SItakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477.

In addition, libraries of fragments of the MP protein coding can be used to generate a variegated population of MP fragments for screening and subsequent C selection of homologues of an MP protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of an MP coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the MP protein.

Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of MP homologues. The most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a new technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify MP homologues (Arkin and Yourvan (1992) PNAS 89:7811-7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).

WO 01/66573 PCT/IB00/02035 0 In another embodiment, cell based assays can be exploited to analyze a 0. variegated MP library, using methods well known in the art.

D. Uses and Methods of the Invention The nucleic acid molecules, proteins, protein homologues, fusion proteins, primers, vectors, and host cells described herein can be used in one or more of the Sfollowing methods: identification of C. glutamicum and related organisms; mapping of genomes of organisms related to C. glutamicum; identification and localization of C.

t r glutamicum sequences of interest; evolutionary studies; determination of MP protein O 10 regions required for function; modulation of an MP protein activity; modulation of the activity of an MP pathway; and modulation of cellular production of a desired compound, such as a fine chemical.

The MP nucleic acid molecules of the invention have a variety of uses. First, they may be used to identify an organism as being Corynebacterium glutamicum or a close relative thereof. Also, they may be used to identify the presence of C. glutamicum or a relative thereof in a mixed population of microorganisms. The invention provides the nucleic acid sequences of a number of C. glutamicum genes; by probing the extracted genomic DNA of a culture of a unique or mixed population of microorganisms under stringent conditions with a probe spanning a region of a C. glutamicum gene which is unique to this organism, one can ascertain whether this organism is present.

Although Corynebacterium glutamicum itself is not pathogenic to humans, it is related to species which are human pathogens, such as Corynebacterium diphtheriae.

Corynebacterium diphtheriae is the causative agent of diphtheria, a rapidly developing, acute, febrile infection which involves both local and systemic pathology. In this disease, a local lesion develops in the upper respiratory tract and involves necrotic injury to epithelial cells; the bacilli secrete toxin which is disseminated through this lesion to distal susceptible tissues of the body. Degenerative changes brought about by the inhibition of protein synthesis in these tissues, which include heart, muscle, peripheral nerves, adrenals, kidneys, liver and spleen, result in the systemic pathology of the disease. Diphtheria continues to have high incidence in many parts of the world, including Africa, Asia, Eastern Europe and the independent states of the former Soviet Union. An ongoing epidemic of diphtheria in the latter two regions has resulted in at least 5,000 deaths since 1990.

WO 01/66573 PCTIIB00/02035 O In one embodiment, the invention provides a method of identifying the presence CI or activity of Cornyebacterium diphtheriae in a subject. This method includes detection Sof one or more of the nucleic acid or amino acid sequences of the invention the sequences set forth as odd-numbered or even-numbered SEQ ID NOs, respectively, in the Sequence Listing) in a subject, thereby detecting the presence or activity of Corynebacterium diphtheriae in the subject. C. glutamicum and C. diphtheriae are Srelated bacteria, and many of the nucleic acid and protein molecules in C. glutamicum are homologous to C. diphtheriae nucleic acid and protein molecules, and can therefore ¢CI be used to detect C. diphtheriae in a subject.

The nucleic acid and protein molecules of the invention may also serve as CI markers for specific regions of the genome. This has utility not only in the mapping of the genome, but also for functional studies of C. glutamicum proteins. For example, to identify the region of the genome to which a particular C. glutamicum DNA-binding protein binds, the C. glutamicum genome could be digested, and the fragments incubated with the DNA-binding protein. Those which bind the protein may be additionally probed with the nucleic acid molecules of the invention, preferably with readily detectable labels; binding of such a nucleic acid molecule to the genome fragment enables the localization of the fragment to the genome map of C. glutamicum, and, when performed multiple times with different enzymes, facilitates a rapid determination of the nucleic acid sequence to which the protein binds. Further, the nucleic acid molecules of the invention may be sufficiently homologous to the sequences of related species such that these nucleic acid molecules may serve as markers for the construction of a genomic map in related bacteria, such as Brevibacterium lactofermentum.

The MP nucleic acid molecules of the invention are also useful for evolutionary and protein structural studies. The metabolic processes in which the molecules of the invention participate are utilized by a wide variety ofprokaryotic and eukaryotic cells; by comparing the sequences of the nucleic acid molecules of the present invention to those encoding similar enzymes from other organisms, the evolutionary relatedness of the organisms can be assessed. Similarly, such a comparison permits an assessment of which regions of the sequence are conserved and which are not, which may aid in determining those regions of the protein which are essential for the functioning of the enzyme. This type of determination is of value for protein engineering studies and may WO 01/66573 PCT/IB00/02035 N give an indication of what the protein can tolerate in terms of mutagenesis without losing function.

Manipulation of the MP nucleic acid molecules of the invention may result in the production of MP proteins having functional differences from the wild-type MP proteins. These proteins may be improved in efficiency or activity, may be present in greater numbers in the cell than is usual, or may be decreased in efficiency or activity.

SThe invention also provides methods for screening molecules which modulate the activity of an MP protein, either by interacting with the protein itself or a substrate or 04 binding partner of the MP protein, or by modulating the transcription or translation of an MP nucleic acid molecule of the invention. In such methods, a microorganism Sexpressing one or more MP proteins of the invention is contacted with one or more test compounds, and the effect of each test compound on the activity or level of expression of the MP protein is assessed.

When the desired fine chemical to be isolated from large-scale fermentative culture of C. glutamicum is an amino acid, a vitamin, a cofactor, a nutraceutical, a nucleotide, a nucleoside, or trehalose, modulation of the activity or efficiency of activity of one or more of the proteins of the invention by recombinant genetic mechanisms may directly impact the production of one of these fine chemicals. For example, in the case of an enzyme in a biosynthetic pathway for a desired amino acid, improvement in efficiency or activity of the enzyme (including the presence of multiple copies of the gene) should lead to an increased production or efficiency of production of that desired amino acid. In the case of an enzyme in a biosynthetic pathway for an amino acid whose synthesis is in competition with the synthesis of a desired amino acid, any decrease in the efficiency or activity of this enzyme (including deletion of the gene) should result in an increase in production or efficiency of production of the desired amino acid, due to decreased competition for intermediate compounds and/or energy. In the case of an enzyme in a degradation pathway for a desired amino acid, any decrease in efficiency or activity of the enzyme should result in a greater yield or efficiency of production of the desired product due to a decrease in its degradation. Lastly, mutagenesis of an enzyme involved in the biosynthesis of a desired amino acid such that this enzyme is no longer is capable of feedback inhibition should result in increased yields or efficiency of production of the desired amino acid. The same should apply to the biosynthetic and WO 01/66573 PCT/IB00/02035 IO degradative enzymes of the invention involved in the metabolism of vitamins, cofactors, Snutraceuticals, nucleotides, nucleosides and trehalose.

Similarly, when the desired fine chemical is not one of the aforementioned compounds, the modulation of activity of one of the proteins of the invention may still 5 impact the yield and/or efficiency of production of the compound from large-scale culture of C. glutamicum. The metabolic pathways of any organism are closely interconnected; the intermediate used by one pathway is often supplied by a different Spathway. Enzyme expression and function may be regulated based on the cellular levels Sof a compound from a different metabolic process, and the cellular levels of molecules

\O

necessary for basic growth, such as amino acids and nucleotides, may critically affect C the viability of the microorganism in large-scale culture. Thus, modulation of an amino acid biosynthesis enzyme, for example, such that it is no longer responsive to feedback inhibition or such that it is improved in efficiency or turnover may result in increased cellular levels of one or more amino acids. In turn, this increased pool of amino acids provides not only an increased supply of molecules necessary for protein synthesis, but also of molecules which are utilized as intermediates and precursors in a number of other biosynthetic pathways. If a particular amino acid had been limiting in the cell, its increased production might increase the ability of the cell to perform numerous other metabolic reactions, as well as enabling the cell to more efficiently produce proteins of all kinds, possibly increasing the overall growth rate or survival ability of the cell in large scale culture. Increased viability improves the number of cells capable of producing the desired fine chemical in fermentative culture, thereby increasing the yield of this compound. Similar processes are possible by the modulation of activity of adegradative enzyme of the invention such that the enzyme no longer catalyzes, or catalyzes less efficiently, the degradation of a cellular compound which is important for the biosynthesis of a desired compound, or which will enable the cell to grow and reproduce more efficiently in large-scale culture. It should be emphasized that optimizing the degradative activity or decreasing the biosynthetic activity of certain molecules of the invention may also have a beneficial effect on the production of certain fine chemicals from C. glutamicum. For example, by decreasing the efficiency of activity of a biosynthetic enzyme in a pathway which competes with the biosynthetic pathway of a desired compound for one or more intermediates, more of those intermediates should be available for conversion to the desired product. A similar WO 01/66573 PCT/IB00/02035 situation may call for the improvement of degradative ability or efficiency of one or C- more proteins of the invention.

This aforementioned list of mutagenesis strategies for MP proteins to result in Sincreased yields of a desired compound is not meant to be limiting; variations on these mutagenesis strategies will be readily apparent to one of ordinary skill in the art. By these mechanisms, the nucleic acid and protein molecules of the invention may be Sutilized to generate C. glutamicum or related strains of bacteria expressing mutated MP 0 nucleic acid and protein molecules such that the yield, production, and/or efficiency of 0C production of a desired compound is improved. This desired compound may be any 0 10 natural product of C. glutamicum, which includes the final products of biosynthesis C- pathways and intermediates of naturally-occurring metabolic pathways, as well as molecules which do not naturally occur in the metabolism of C. glutamicum, but which are produced by a C glutamicum strain of the invention. Preferred compounds to be produced by Corynebacterium glutamicum strains are the amino acids L-lysine and Lmethionine.

In one embodiment, the metC gene encoding cystathionine p-lyase, the third enzyme in the methionine biosynthetic pathway, was isolated from Corynebacterium glutamicum. The translational product of the gene showed no significant homology with that of metC gene from other organisms. Introduction of the plasmid containing the metC gene into C. glutamicum resulted in a 5-fold increase in the activity of cystathionine p-lyase. The protein product, now designated MetC (corresponding to SEQ ID NO:4), which encodes a protein product of 35,574 Daltons and consists of 325 amino acids, is identical to the previously reported aecD gene (Rossol, I. and Puhler, A.

(1992) J. Bacteriology 174, 2968-2977) except the existence of two different amino acids. Like aecD gene, when present in multiple copies, metC gene conferred resistance to S-(p-aminoethyl)-cysteine which is a toxic lysine analog. However, genetic and biochemical evidences suggest that the natural activity of metC gene product is to mediate methionine biosynthesis in C. glutamicum. Mutant strains ofmetC were constructed and the strains showed methionine prototrophy. The mutant strains completely lost their ability to show resistance to S-(y-aminoethyl)-cysteine. These results show that, in addition to the transsulfuration, which is another biosynthetic pathway, the direct sulfhydrylation pathway is functional in C. glutamicum as a parallel biosynthetic route for methionine.

WO 01/66573 PCT/IB00/02035 In yet another embodiment, it is also shown that the additional sulfhydrylation i pathway is catalyzed by O-acetylhomoserine sulfhydrylase. The presence of the pathway is demonstrated by the isolation of the corresponding metZ (or metY) gene and enzyme (corresponding to SEQ ID NO:1 and SEQ ID NO:2, respectively). Among the eukaryotes, fungi and yeast species have been reported to have both the transsulfuration and direct sulfhydrylation pathway. Thus far, no prokaryotic organism which possesses both pathways has been found. Unlike E. coli which only possesses single biosynthetic route for lysine, C. glutamicum possesses two parallel biosynthetic pathways for the ,i amino acid. The biosynthetic pathway for methionine in C. glutamicum is analogous to that of lysine in that aspect.

C The gene metZ is located in the upstream region of metA, which is the gene encoding the enzyme catalysing the first step of methionine biosynthesis (Park, et al. (1998) Mol. Cells 8, 286-294). Regions upstream and downstream ofmetA were sequenced to identify other met genes. It appears that metZ and metA form an operon.

Expression of the genes encoding MetA and MetZ leads to overproduction of the corresponding polypeptides.

Surprisingly, metZ clones can complement methionine auxotrophic Escherichia coli metB mutant strains. This shows that the protein product of metZ catalyzes a step that can bypass the step catalyzed by the protein product of metB.

MetZ was also disrupted and the mutant strain showed methionine prototrophy.

Corynebacterium glutamicum metB and metZ double mutants were also constructed. The double mutant is auxotrophic for methionine. Thus, metZ encodes a protein catalysing the reaction from O-Acetyl-Homoserine to Homocysteine, which is one step in the sulfhydrylation pathway of methionine biosynthesis. Corynebacterium glutamicum contains both the transsulfuration and the sulfhydrylation pathway of methionine biosynthesis.

Introduction of metZ into C. glutamicum resulted in the expression of a 47,000 Dalton protein. Combined introduction of metZ and metA in C. glutamicum resulted in the appearance of metA and metZ proteins as shown by gel electrophoresis. If the Corynebacterium strain is a lysine overproducer, introduction of a plasmid containing metZ and metA resulted in a lower lysine titer but accumulation of homocysteine and methionine is detected.

WO 01/66573 PCT/IB00/02035 O In another embodiment metZ and metA were introduced into Corynebacterium C glutamicum strains together with the hom gene, encoding the homoserine dehydrogenase, catalysing the conversion from aspartate semialdehyde to homoserine. Different hom genes from different organisms were chosen for this experiment. The Corynebacterium glutamicum hom gene can be used as well as hom genes from other procaryotes like Escherichia coli or Bacillus subtilis or the hor gene of eukaryotes such as Saccharomyces Scerevisiae, Shizosaccharomyces pombe, Ashbya gossypii or algae, higher plants or animals. It may be that the hom gene is insensitive against feed back inhibition mediated CI by any metabolites that occur in the biosynthetic routes of the amino acids of the aspartate family, like aspatrate, lysine, threonine or methionine. Such metabolites are for example CI aspartate, lysine, methionine, threonine, aspartyl-phosphate, aspartate semialdehyd, homoserine, cystathionine, homocysteine or any other metabolite that occurs in this biosynthetic routes. In addition to the metabolites, the homoserine dehydrogenase may be insensitive against inhibition by analogues of all those metabolites or even against other compounds involved in this metabolism as there are other amino acids like cysteine or cofactors like vitamin B12 and all of its derivatives and S-adenosylmethionine and its metabolites and derivatives and analogues. The insensitivity of the homoserine dehydrogenase against all these, a part of these or only one of these compounds may either be its natural attitude or it may be the result from one or more mutations that resulted from classical mutation and selection using chemicals or irradiation or other mutagens. The mutations could also be introduced into the hor gene using gene technology, for example the introduction of site specific point mutations or by any method aforementioned for the MP or MP encoding DNA-sequences.

When a hom gene was combined with the metZ and metA genes and introduced into a Corynebacterium glutamicum strain that is a lysine overproducer, lysine accumulation was reduced and homocysteine and methionine accumulation was enhanced.

A further enhancement of homocysteine and methionine concentrations can be achieved, if a lysine overproducing Corynebacterium glutamicum strain is used and a disruption of the ddh gene or the lysA gene was introduced prior to the transformation with DNA containing a hor gene and metZ and metA in combination. The overproduction of homocysteine and methionine was possible using different sulfur sources. Sulfates, thiosulfates, sulfites and also more reduced sulfur sources like H2S and sulfides and derivatives could be used. Also, organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like cysteine and other IN sulfur containing compounds can be used to achieve homocysteine and methionine

O

S overproduction.

In another embodiment, the metC gene was introduced into a Corynebacterium glutamicum strain using aforementioned methods. The metC gene can be transformed into the strain in combination with other genes like metB, metA and metA. The hom gene can also be added.

When the hom gene, the met C, metA and metB genes were combined on a vector and ("1 S introduced into a Corynebacterium glutamicum strain, homocysteine and methionine overproduction was achieved. The overproduction of homocysteine and methionine was 0 possible using different sulfur sources. Sulfates, thiosulfates, sulfites and also more reduced sulfur sources like H 2 S and sulfides and derivatives could be used.

Also, organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like cysteine and other sulfur containing compounds can be used to achieve homocysteine and methionine overproduction.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patent applications, patents, published patent applications, Tables, and the sequence listing cited throughout this application are hereby incorporated by reference.

Comprises/comprising and grammatical variations thereof when used in this specification are to be taken to specify the presence of stated features, integers, steps or components or groups thereof, but do not preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.

WO 01/66573 PCT/IB00/02035 SExemplification Example 1: Preparation of total genomic DNA of Corynebacterium glutamicum ATCC13032 A culture of Corynebacterium glutamicum (ATCC 13032) was grown overnight 04 at 30 0 C with vigorous shaking in BHI medium (Difco). The cells were harvested by S 10 centrifugation, the supernatant was discarded and the cells were resuspended in 5 ml

O

0C buffer-I of the original volume of the culture all indicated volumes have been calculated for 100 ml of culture volume). Composition of buffer-I: 140.34 g/1 sucrose, 2.46 g/l MgSO 4 x 7H20, 10 ml/1 KH 2 PO, solution (100 g/l, adjusted to pH 6.7 with KOH), 50 ml/1 M12 concentrate (10 g/l (NH 4 2

SO

4 1 g/1NaC1, 2 g/1 MgSO, x 7H2O, 0.2 g/1 CaCI 2 0.5 g/1 yeast extract (Difco), 10 ml/l trace-elements-mix (200 mg/l FeSO4 x H20, 10 mg/1 ZnSO 4 x 7 H 2 0, 3 mg/l MnC1, x 4 H20, 30 mg/l H 3 BO, 20 mg/1 CoC12 x 6 H20, 1 mg/1 NiC1, x 6 H 2 0, 3 mg/1 Na 2 MoO 4 x 2 H 2 0, 500 mg/l complexing agent (EDTA or critic acid), 100 ml/l vitamins-mix (0.2 mg/l biotin, 0.2 mg/1 folic acid, mg/1 p-amino benzoic acid, 20 mg/1 riboflavin, 40 mg/l ca-panthothenate, 140 mg/l nicotinic acid, 40 mg/1 pyridoxole hydrochloride, 200 mg/l myo-inositol). Lysozyme was added to the suspension to a final concentration of 2.5 mg/ml. After an approximately 4 h incubation at 37°C, the cell wall was degraded and the resulting protoplasts are harvested by centrifugation. The pellet was washed once with 5 ml buffer-I and once with 5 ml TE-buffer (10 mM Tris-HC1, 1 mM EDTA, pH The pellet was resuspended in 4 ml TE-buffer and 0.5 ml SDS solution and 0.5 ml NaCl solution (5 M) are added. After adding ofproteinase K to a final concentration of 200 pg/ml, the suspension is incubated for ca. 18 h at 37 0 C. The DNA was purified by extraction with phenol, phenol-chloroform-isoamylalcohol and chloroformisoamylalcohol using standard procedures. Then, the DNA was precipitated by adding 1/50 volume of 3 M sodium acetate and 2 volumes of ethanol, followed by a 30 min incubation at -20 0 C and a 30 min centrifugation at 12,000 rpm in a high speed centrifuge using a SS34 rotor (Sorvall). The DNA was dissolved in 1 ml TE-buffer containing g/ml RNaseA and dialysed at 4 0 C against 1000 ml TE-buffer for at least 3 hours.

WO 01/66573 PCT/IB00/02035 I During this time, the buffer was exchanged 3 times. To aliquots of 0.4 ml of the Sdialysed DNA solution, 0.4 ml of 2 M LiC1 and 0.8 ml of ethanol are added. After a min incubation at -20 0 C, the DNA was collected by centrifugation (13,000 rpm, Biofuge Fresco, Heraeus, Hanau, Germany). The DNA pellet was dissolved in TE-buffer. DNA prepared by this procedure could be used for all purposes, including southern blotting or construction of genomic libraries.

Example 2: Construction of genomic libraries in Escherichia coli of Corynebacterium ^C glutamicum ATCC13032.

Using DNA prepared as described in Example 1, cosmid and plasmid libraries were C constructed according to known and well established methods (see Sambrook, J. et al.

(1989) "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John Wiley Sons.) Any plasmid or cosmid could be used. Of particular use were the plasmids pBR322 (Sutcliffe, J.G. (1979) Proc. Natl. Acad. Sci. USA, 75:3737-3741); pACYC177 (Change Cohen (1978) J. Bacteriol 134:1141-1156), plasmids of the pBS series (pBSSK+, pBSSK- a others; Stratagene, LaJolla, USA), or cosmids as SuperCosl (Stratagene, LaJolla, USA) or Lorist6 (Gibson, Rosenthal A. and Waterson, R.H. (1987) Gene 53:283-286. Gene libn specifically for use in C. glutamicum may be constructed using plasmid pSL109 (Lee, H.-S.

A. J. Sinskey (1994) J. Microbiol. Biotechnol. 4: 256-263).

For the isolation of metC clones, E. coli JE6839 cells were transformed with the library DNA and plated onto the M9 minimal medium containing ampicillin and appropriate supplements. The plates were incubated at 37 0 C for 5 days. Colonies were isolated and screened for the plasmid content. The complete nucleotide sequence of the isolated metC gene was determined by methods well-known to one of ordinary skill in the art.

Example 3: DNA Sequencing and Computational Functional Analysis Genomic libraries as described in Example 2 were used for DNA sequencing according to standard methods, in particular by the chain termination method using ABI377 sequencing machines (see Fleischman, R.D. et al. (1995) "Whole-genome Random Sequencing and Assembly of Haemophilus Influenzae Rd., Science, 269:496- WO 01/66573 PCT/IB00/02035 0 512). Sequencing primers with the following nucleotide sequences were used: (N GGAAACAGTATGACCATG-3' (SEQ ID NO:123) or 3'(SEQ ID NO.:124).

Example 4: In vivo Mutagenesis In vivo mutagenesis of Corynebacterium glutamicum can be performed by passage o Splasmid (or other vector) DNA through E. coli or other microorganisms Bacillus spp. o yeasts such as Saccharomyces cerevisiae) which are impaired in their capabilities to maintai 4 the integrity of their genetic information. Typical mutator strains have mutations in the gent 0 10 for the DNA repair system mutHLS, mutD, mutT, etc.; for reference, see Rupp, W.D.

C- (1996) DNA repair mechanisms, in: Escherichia coli and Salmonella, p. 2277-2294, ASM: Washington.) Such strains are well known to those of ordinary skill in the art. The use of si strains is illustrated, for example, in Greener, A. and Callahan, M. (1994) Strategies 7: 32-3, Example 5: DNA Transfer Between Escherichia coli and Corynebacterium glutamicum Several Corynebacterium and Brevibacterium species contain endogenous plasmids (as pHM1519 or pBL1) which replicate autonomously (for review see, e.g., Martin, J.F. et al. (1987) Biotechnology, 5:137-146). Shuttle vectors for Escherichia coli and Corynebacterium glutamicum can be readily constructed by using standard vectors for E. coli (Sambrook, J. et al. (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John Wiley Sons) to which a origin or replication for and a suitable marker from Corynebacterium glutamicum is added. Such origins of replication are preferably taken from endogenous plasmids isolated from Corynebacterium and Brevibacterium species. Of particular use as transformation markers for these species are genes for kanamycin resistance (such as those derived from the Tn5 or Tn903 transposons) or chloramphenicol (Winnacker, E.L. (1987) "From Genes to Clones Introduction to Gene Technology, VCH, Weinheim). There are numerous examples in the literature of the construction of a wide variety of shuttle vectors which replicate in both E.

coli and C. glutamicum, and which can be used for several purposes, including gene overexpression (for reference, see Yoshihama, M. et al. (1985) J Bacteriol. 162:591-597, WO 01/66573 PCT/IB00/02035 O Martin J.F. et al. (1987) Biotechnology, 5:137-146 and Eikmanns, B.J. et al. (1991) Gene, 102:93-98).

Using standard methods, it is possible to clone a gene of interest into one of the shuttle vectors described above and to introduce such a hybrid vectors into strains of Corynebacterium glutamicum. Transformation of C. glutamicum can be achieved by protoplast transformation (Kastsumata, R. et al. (1984) J Bacteriol. 159306-311), Selectroporation (Liebl, E. et al. (1989) FEMS Microbiol. Letters, 53:399-303) and in cases where special vectors are used, also by conjugation (as described e.g. in Schafer, A et al.

(1990) J Bacteriol. 172:1663-1666). It is also possible to transfer the shuttle vectors for C. glutamicum to E. coli by preparing plasmid DNA from C. glutamicum (using standard C methods well-known in the art) and transforming it into E. coli. This transformation step can be performed using standard methods, but it is advantageous to use an Mcr-deficient E. coli strain, such as NM522 (Gough Murray (1983) J. Mol. Biol. 166:1-19).

Genes may be overexpressed in C. glutamicum strains using plasmids which comprise pCG1 Patent No. 4,617,267) or fragments thereof, and optionally the gene for kanamycin resistance from TN903 (Grindley, N.D. and Joyce, C.M. (1980) Proc. Natl. Acad. Sci. USA 77(12): 7176-7180). In addition, genes may be overexpressed in C. glutamicum strains using plasmid pSL109 (Lee, and A. J.

Sinskey (1994) J Microbiol. Biotechnol. 4: 256-263).

Aside from the use of replicative plasmids, gene overexpression can also be achieved by integration into the genome. Genomic integration in C. glutamicum or other Corynebacterium or Brevibacterium species may be accomplished by well-known methods, such as homologous recombination with genomic region(s), restriction endonuclease mediated integration (REMI) (see, DE Patent 19823834), or through the use of transposons. It is also possible to modulate the activity of a gene of interest by modifying the regulatory regions a promoter, a repressor, and/or an enhancer) by sequence modification, insertion, or deletion using site-directed methods (such as homologous recombination) or methods based on random events (such as transposon mutagenesis or REMI). Nucleic acid sequences which function as transcriptional terminators may also be inserted 3' to the coding region of one or more genes of the invention; such terminators are well-known in the art and are described, for example, in Winnacker, E.L. (1987) From Genes to Clones Introduction to Gene Technology. VCH: Weinheim.

WO 01/66573 PCT/IB00/02035

IO

0 Example 6: Assessment of the Expression of the Mutant Protein 0 Observations of the activity of a mutated protein in a transformed host cell rely on Sthe fact that the mutant protein is expressed in a similar fashion and in a similar quantity to that of the wild-type protein. A useful method to ascertain the level of transcription of the mutant gene (an indicator of the amount ofmRNA available for translation to the gene product) is to perform a Northern blot (for reference see, for example, Ausubel et al.

(1988) Current Protocols in Molecular Biology, Wiley: New York), in which a primer t designed to bind to the gene of interest is labeled with a detectable tag (usually radioactive or chemiluminescent), such that when the total RNA of a culture of the organism is extracted, run on gel, transferred to a stable matrix and incubated with this probe, the binding and quantity of binding of the probe indicates the presence and also the quantity of mRNA for this gene. This information is evidence of the degree of transcription of the mutant gene. Total cellular RNA can be prepared from Corynebacterium glutamicum by several methods, all well-known in the art, such as that described in Bormann, E.R. et al.

(1992) Mol. Microbiol. 6: 317-326.

To assess the presence or relative quantity of protein translated from this mRNA, standard techniques, such as SDS-acrylamide gel electrophoresis, were employed. The overproduction of metC and metZin combination with metA in Corynebacterium glutamicum was demonstrated by this method. Western blot may also be employed (see, for example, Ausubel et al. (1988) Current Protocols in Molecular Biology, Wiley: New York). In this process, total cellular proteins are extracted, separated by gel electrophoresis, transferred to a matrix such as nitrocellulose, and incubated with a probe, such as an antibody, which specifically binds to the desired protein. This probe is generally tagged with a chemiluminescent or colorimetric label which may be readily detected. The presence and quantity of label observed indicates the presence and quantity of the desired mutant protein present in the cell.

Example 7: Growth of Escherichia coli and Genetically Modified Corynebacterium glutamicum Media and Culture Conditions E. coli strains are routinely grown in MB and LB broth, respectively (Follettie, M.

et al. (1993) J. Bacteriol. 175, 4096-4103). Minimal media for E. coli is M9 and modified MCGC (Yoshihama, et al. (1985) J. Bacteriol. 162, 591-507). Glucose was WO 01/66573 PCT/IB00/02035 I added to a final concentration of Antibiotics were added in the following amounts C (micrograms per milliliter): ampicillin, 50; kanamycin, 25; nalidixic acid, 25. Amino acids, vitamins, and other supplements were added in the following amounts: methionine, 9.3 mM; arginine, 9.3 mM; histidine, 9.3 mM; thiamine, 0.05 mM. E. coli cells were routinely grown at 37 0 C, respectively.

Genetically modified Corynebacteria are cultured in synthetic or natural growth media. A number of different growth media for Corynebacteria are both well-known and C. readily available (Lieb et al. (1989) Appl. Microbiol. Biotechnol., 32:205-210; von der C. Osten et al. (1998) Biotechnology Letters, 11:11-16; Patent DE 4,120,867; Liebl (1992) 010 "The Genus Corynebacterium, in: The Procaryotes, Volume II, Balows, A. et al., eds.

C1 Springer-Verlag). These media consist of one or more carbon sources, nitrogen sources, inorganic salts, vitamins and trace elements. Preferred carbon sources are sugars, such as mono-, di-, or polysaccharides. For example, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose serve as very good carbon sources. It is also possible to supply sugar to the media via complex compounds such as molasses or other by-products from sugar refinement. It can also be advantageous to supply mixtures of different carbon sources. Other possible carbon sources are alcohols and organic acids, such as methanol, ethanol, acetic acid or lactic acid. Nitrogen sources are usually organic or inorganic nitrogen compounds, or materials which contain these compounds. Exemplary nitrogen sources include ammonia gas or ammonia salts, such as NH 4 CI or (NH,) 2

SO

4 NHLOH, nitrates, urea, amino acids or complex nitrogen sources like corn steep liquor, soy bean flour, soy bean protein, yeast extract, meat extract and others.

The overproduction of sulfur containing amino acids like homocysteine and methionine was made possible using different sulfur sources. Sulfates, thiosulfates, sulfites and also more reduced sulfur sources like H 2 S and sulfides and derivatives can be used. Also, organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like cysteine and other sulfur containing compounds can be used to achieve homocysteine and methionine overproduction Inorganic salt compounds which may be included in the media include the chloride-, phosphorous- or sulfate- salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. Chelating compounds can be added to the medium to keep the metal ions in solution. Particularly useful chelating WO 01/66573 PCT/IB00/02035 I compounds include dihydroxyphenols, like catechol or protocatechuate, or organic acids, CI such as citric acid. It is typical for the media to also contain other growth factors, such as Svitamins or growth promoters, examples of which include biotin, riboflavin, thiamin, folic Sacid, nicotinic acid, pantothenate and pyridoxin. Growth factors and salts frequently originate from complex media components such as yeast extract, molasses, corn steep liquor and others. The exact composition of the media compounds depends strongly on the immediate experiment and is individually decided for each specific case. Information CI about media optimization is available in the textbook "Applied Microbiol. Physiology, A CI Practical Approach (eds. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 0 10 19 963577 It is also possible to select growth media from commercial suppliers, like CI standard 1 (Merck) or BHI (grain heart infusion, DIFCO) or others.

All medium components are sterilized, either by heat (20 minutes at 1.5 bar and 121 C) or by sterile filtration. The components can either be sterilized together or, if necessary, separately. All media components can be present at the beginning of growth, or they can optionally be added continuously or batchwise.

Culture conditions are defined separately for each experiment. The temperature should be in a range between 15'C and 45*C. The temperature can be kept constant or can be altered during the experiment. The pH of the medium should be in the range of 5 to preferably around 7.0, and can be maintained by the addition of buffers to the media.

An exemplary buffer for this purpose is a potassium phosphate buffer. Synthetic buffers such as MOPS, HEPES, ACES and others can alternatively or simultaneously be used. It is also possible to maintain a constant culture pH through the addition of NaOH or

NH

4 OH during growth. If complex medium components such as yeast extract are utilized, the necessity for additional buffers may be reduced, due to the fact that many complex compounds have high buffer capacities. If a fermentor is utilized for culturing the microorganisms, the pH can also be controlled using gaseous ammonia.

The incubation time is usually in a range from several hours to several days. This time is selected in order to permit the maximal amount of product to accumulate in the broth. The disclosed growth experiments can be carried out in a variety of vessels, such as microtiter plates, glass tubes, glass flasks or glass or metal fermentors of different sizes.

For screening a large number of clones, the microorganisms should be cultured in microtiter plates, glass tubes or shake flasks, either with or without baffles. Preferably 100 ml shake flasks are used, filled with 10% (by volume) of the required growth WO 01/66573 PCT/IB00/02035 medium. The flasks should be shaken on a rotary shaker (amplitude 25 mm) using a Cspeed-range of 100 300 rpm. Evaporation losses can be diminished by the maintenance Sof a humid atmosphere; alternatively, a mathematical correction for evaporation losses Sshould be performed.

If genetically modified clones are tested, an unmodified control clone or a control clone containing the basic plasmid without any insert should also be tested. The medium is inoculated to an OD 600 of 0.5 1.5 using cells grown on agar plates, such as CM plates g/1 glucose, 2,5 g/l NaC1, 2 g/1 urea, 10 g/l polypeptone, 5 g/1 yeast extract, 5 g/l meat extract, 22 g/l NaC1, 2 g/l urea, 10 g/l polypeptone, 5 g/l yeast extract, 5 g/l meat extract, 0 10 22 g/1 agar, pH 6.8 with 2M NaOH) that had been incubated at 30'C. Inoculation of the C1 media is accomplished by either introduction of a saline suspension of C. glutamicum cells from CM plates or addition of a liquid preculture of this bacterium.

Example 8 -In vitro Analysis of the Function of Mutant Proteins The determination of activities and kinetic parameters of enzymes is well established in the art. Experiments to determine the activity of any given altered enzyme must be tailored to the specific activity of the wild-type enzyme, which is well within the ability of one of ordinary skill in the art. Overviews about enzymes in general, as well as specific details concerning structure, kinetics, principles, methods, applications and examples for the determination of many enzyme activities may be found, for example, in the following references: Dixon, and Webb, (1979) Enzymes. Longmans: London; Fersht, (1985) Enzyme Structure and Mechanism.

Freeman: New York; Walsh, (1979) Enzymatic Reaction Mechanisms. Freeman: San Francisco; Price, Stevens, L. (1982) Fundamentals of Enzymology. Oxford Univ.

Press: Oxford; Boyer, ed. (1983) The Enzymes, 3 rd ed. Academic Press: New York; Bisswanger, (1994) Enzymkinetik, 2 nd ed. VCH: Weinheim (ISBN 3527300325); Bergmeyer, Bergmeyer, Gral, eds. (1983-1986) Methods of Enzymatic Analysis, 3 rd ed., vol. I-XII, Verlag Chemie: Weinheim; and Ullmann's Encyclopedia of Industrial Chemistry (1987) vol. A9, "Enzymes". VCH: Weinheim, p.

352-363.

Cell extracts from Corynebacterium glutamicum were prepared as described previously (Park, et al. (1998) Mol. Cells 8, 286-294). Cystathionine P-lyase was assayed as follows. The assay mixture contained 100 mM Tris-HC1 (pH8.5), 0.1 mM WO 01/66573 PCT/IB00/02035 NADH, 1 mM L-cystathionine, 5 units of L-lactate dehydrogenase, and appropriate amounts of crude extract. Optical changes were monitored at 340 nm. Assay for S-(Oaminoethyl)-cysteine (AEC) resistance was carried out as described in Rossol, I. and SPiihler, A. (1992) J. Bacteriol. 174, 2968-77. The results of cystathionin P-lyase assays from extracts of different Corynebacterium glutamicum strains as well as results of AEC resistance assays of the same strain are summarized in Table 5, below.

WO 01/66573 PCT/IB00/02035 Table 5. Expression of cystathionine P-lyase a Pori .Activity Growth on Resistance StrainsProperties (nmol min mg') MM b to AEC

E

C. glutamicum AS019E12 146 C. glutamicum AS019E12/pMTI Empty vector 145 C. glutamicum AS019E12/pSL173 metC clone 797 -t C. glutamicum HIA57 metC mutant d 19 C. glutamicum HL459 metC mutant d 23 E. coli JE6839 metC mutant 21 ND The enzyme was induced by growth to the stationary phase on the minimal medium containing 1% glucose. Cells were harvested, disrupted, and assayed for the activity as described in the Materials and Methods.

b MCGC minimal media was used. Growth was monitored on plates.

C Cells were grown on plates containing 40 mM S-(P-aminoethyl)-cysteine (AEC) for 5 days.

The mutants were generated in this study.

e Not determined.

The ability of the metC clones to express cystathionine 3-lyase was tested by enzymatic assay. Crude extracts prepared from the C. glutamicum AS019E12 cells harboring plasmid pSL173 were assayed. Cells harboring the plasmid showed approximately a 5-fold increase in the activity of cystathionine P-lyase compared to those harboring the empty vector pMT1 (Table apparently due to the gene-dose effect. SDS-PAGE analysis of crude extracts revealed a putative cystathionine P-lyase band with approximate Mr of 41,000. Intensity of each putative cystathionine p-lyase band agreed with the complementation and enzymatic assay data (Table As described above, a region of metC appeared to be nearly identical to the previously reported aecD.

Since the aecD gene was isolated on the basis of its ability to confer resistance to S-(paminoethyl)-cysteine (AEC), a toxic lysine analogue, we tested the protein product of metC for the presence of the activity. As shown in Table 5, cells overexpressing cystathionine p-lyase showed increased resistance to AEC. The strain carrying a mutation in metC gene (see below) completely lost its ability to show a resistant phenotype to AEC.

Assay for O-acetylhmoserine sulphydrylase was performed as follows (Belfaiza, J., et al. (1998) J Bacteriol. 180, 250-255; Ravanel, M. Droux, and R. Douce (1995) Arch. Biochem. Biophys. 316, 572-584; Foglino, M. (1995) Microbiology 141, 431-439).

Assay mixture of 0.1 ml contained 20 mM MOPS-NaOH (pH7.5), 10 mM O- WO 01/66573 PCT/IB00/02035 acetylhomoserine, 2 mM Na 2 S in 50 mM NaOH, and an appropriate amount of enzyme.

SImmediately after the addition ofNa 2 S which was added last, the reaction mixture was overlayed with 50 ul of mineral oil. After 30 minute incubation at 30 0 C, the reaction Swas stopped by boiling the mixture for 3 minutes. Homocysteine produced in the reaction was quantified as previously described (Yamagata, S. (1987) Method Enzymol.

143, 478-483.). Reaction mixture of 0.1 ml was taken and mixed with 0.1 ml of H 2 0, 0.6 ml of saturated NaC1, 0.1 ml of 1.5 M Na 2

CO

3 containing 67 mM KCN, and 0.1 ml Sof 2% nitroprusside. After 1 minute incubation at room temperature, optical density was measured at 520 nm. Corynebacterium cells harboring additional copies of the metZ gene, a plasmid containing the metZ gene, exhibited significantly higher metZ C enzyme activities than the same type of Corynebacterium cells without additional copies of the metZ gene.

The activity of proteins which bind to DNA can be measured by several wellestablished methods, such as DNA band-shift assays (also called gel retardation assays).

The effect of such proteins on the expression of other molecules can be measured using reporter gene assays (such as that described in Kolmar, H. et al. (1995) EMBO J. 14: 3895-3904 and references cited therein). Reporter gene test systems are well known and established for applications in both pro- and eukaryotic cells, using enzymes such as beta-galactosidase, green fluorescent protein, and several others.

The determination of activity of membrane-transport proteins can be performed according to techniques such as those described in Gennis, R.B. (1989) "Pores, Channels and Transporters", in Biomembranes, Molecular Structure and Function, Springer: Heidelberg, p. 85-137; 199-234; and 270-322.

Example 9: Analysis of Impact of Mutant Protein on the Production of the Desired Product The effect of the genetic modification in C. glutamicum on production of a desired compound (such as an amino acid) can be assessed by growing the modified microorganism under suitable conditions (such as those described above) and analyzing the medium and/or the cellular component for increased production of the desired product an amino acid). Such analysis techniques are well known to one of ordinary skill in the art, and include spectroscopy, thin layer chromatography, staining methods of various kinds, enzymatic and microbiological methods, and analytical WO 01/66573 PCT/IB00/02035 O chromatography such as high performance liquid chromatography (see, for example, C( Ullman, Encyclopedia of Industrial Chemistry, vol. A2, p. 89-90 and p. 443-613, VCH: SWeinheim (1985); Fallon, A. et al., (1987) "Applications of HPLC in Biochemistry" in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17; Rehm et al.

(1993) Biotechnology, .vol. 3, Chapter III: "Product recovery and purification", page 469-714, VCH: Weinheim; Belter, P.A. et al. (1988) Bioseparations: downstream Sprocessing for biotechnology, John Wiley and Sons; Kennedy, J.F. and Cabral, J.M.S.

(1992) Recovery processes for biological materials, John Wiley and Sons; Shaeiwitz, 0 J.A. and Henry, J.D. (1988) Biochemical separations, in: Ulmann's Encyclopedia of Industrial Chemistry, vol. B3, Chapter 11, page 1-27, VCH: Weinheim; and Dechow,

O

eC F.J. (1989) Separation and purification techniques in biotechnology, Noyes Publications.) In addition to the measurement of the final product of fermentation, it is also possible to analyze other components of the metabolic pathways utilized for the production of the desired compound, such as intermediates and side-products, to determine the overall efficiency of production of the compound. Analysis methods include measurements of nutrient levels in the medium sugars, hydrocarbons, nitrogen sources, phosphate, and other ions), measurements of biomass composition and growth, analysis of the production of common metabolites of biosynthetic pathways, and measurement of gasses produced during fermentation. Standard methods for these measurements are outlined in Applied Microbial Physiology, A Practical Approach, P.M. Rhodes and P.F. Stanbury, eds., IRL Press, p. 103-129; 131-163; and 165-192 (ISBN: 0199635773) and references cited therein.

Example 10: Purification of the Desired Product from C. glutamicum Culture Recovery of the desired product from the C. glutamicum cells or supernatant of the above-described culture can be performed by various methods well known in the art.

If the desired product is not secreted from the cells, the cells can be harvested from the culture by low-speed centrifugation, the cells can be lysed by standard techniques, such as mechanical force or sonication. The cellular debris is removed by centrifugation, and the supernatant fraction containing the soluble proteins is retained for further purification of the desired compound. If the product is secreted from the C. glutamicum WO 01/66573 PCT/IBOO/02035 I cells, then the cells are removed from the culture by low-speed centrifugation, and the C supemate fraction is retained for further purification.

The supernatant fraction from either purification method is subjected to chromatography with a suitable resin, in which the desired molecule is either retained on a chromatography resin while many of the impurities in the sample are not, or where the impurities are retained by the resin while the sample is not. Such chromatography steps Smay be repeated as necessary, using the same or different chromatography resins. One of ordinary skill in the art would be well-versed in the selection of appropriate chromatography resins and in their most efficacious application for a particular molecule to be purified. The purified product may be concentrated by filtration or ultrafiltration, C and stored at a temperature at which the stability of the product is maximized.

There are a wide array of purification methods known to the art and the preceding method of purification is not meant to be limiting. Such purification techniques are described, for example, in Bailey, J.E. Ollis, D.F. Biochemical Engineering Fundamentals, McGraw-Hill: New York (1986).

The identity and purity of the isolated compounds may be assessed by techniques standard in the art. These include high-performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin layer chromatography, NIRS, enzymatic assay, or microbiologically. Such analysis methods are reviewed in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et a. (1996) Biotekhnologiya 11: 27- 32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry, (1996) vol. A27, VCH: Weinheim, p. 89-90, p. 521-540, p. 540- 547, p. 559-566, 575-581 and p. 581-587; Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al.

(1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17.

Example 11: Analysis of the Gene Sequences of the Invention The comparison of sequences and determination of percent homology between two sequences are art-known techniques, and can be accomplished using a mathematical algorithm, such as the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci.

USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST WO 01/66573 PCT/IB00/02035 NO programs (version 2.0) ofAltschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST C4 nucleotide searches can be performed with the NBLAST program, score 100, c wordlength 12 to obtain nucleotide sequences homologous to MP nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score 50, wordlength 3 to obtain amino acid sequences homologous to MP protein molecules of the invention. To obtain gapped alignments for Scomparison purposes, Gapped BLAST can be utilized as described in Altschul et al., S(1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped C BLAST programs, one of ordinary skill in the art will know how to optimize the parameters of the program XBLAST and NBLAST) for the specific sequence eC being analyzed.

Another example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Meyers and Miller ((1988) Comput. Appl. Biosci. 4: 11- 17). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Additional algorithms for sequence analysis are known in the art, and include ADVANCE and ADAM. described in Torelli and Robotti (1994) Comput. Appl. Biosci. 10:3-5; and FASTA, described in Pearson and Lipman (1988) P.N.A.S. 85:2444-8.

The percent homology between two amino acid sequences can also be accomplished using the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 12, 10, 8, 6, or 4 and a length weight of 2, 3, or 4. The percent homology between two nucleic acid sequences can be accomplished using the GAP program in the GCG software package, using standard parameters, such as a gap weight of 50 and a length weight of 3.

A comparative analysis of the gene sequences of the invention with those present in Genbank has been performed using techniques known in the art (see, Bexevanis and Ouellette, eds. (1998) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins. John Wiley and Sons: New York). The gene sequences of the invention were compared to genes present in Genbank in a three-step process. In a first step, a BLASTN analysis a local alignment analysis) was performed for each of the WO 01/66573 PCT/IB00/02035 sequences of the invention against the nucleotide sequences present in Genbank, and the c, top 500 hits were retained for further analysis. A subsequent FASTA search a Scombined local and global alignment analysis, in which limited regions of the sequences Sare aligned) was performed on these 500 hits. Each gene sequence of the invention was subsequently globally aligned to each of the top three FASTA hits, using the GAP program in the GCG software package (using standard parameters). In order to obtain correct results, the length of the sequences extracted from Genbank were adjusted to the length of the query sequences by methods well-known in the art. The results of this C, analysis are set forth in Table 4. The resulting data is identical to that which would have.

been obtained had a GAP (global) analysis alone been performed on each of the genes of C1 the invention in comparison with each of the references in Genbank, but required significantly reduced computational time as compared to such a database-wide GAP (global) analysis. Sequences of the invention for which no alignments above the cutoff values were obtained are indicated on Table 4 by the absence of alignment information.

It will further be understood by one of ordinary skill in the art that the GAP alignment homology percentages set forth in Table 4 under the heading homology (GAP)" are listed in the European numerical format, wherein a represents a decimal point. For example, a value of "40,345" in this column represents "40.345%".

Example 12: Construction and Operation of DNA Microarrays The sequences of the invention may additionally be used in the construction and application of DNA microarrays (the design, methodology, and uses of DNA arrays are well known in the art, and are described, for example, in Schena, M. et al. (1995) Science 270: 467-470; Wodicka, L. et al. (1997) Nature Biotechnology 15: 1359-1367; DeSaizieu, A. et al. (1998) Nature Biotechnology 16: 45-48; and DeRisi, J.L. et al.

(1997) Science 278: 680-686).

DNA microarrays are solid or flexible supports consisting of nitrocellulose, nylon, glass, silicone, or other materials. Nucleic acid molecules may be attached to the surface in an ordered manner. After appropriate labeling, other nucleic acids or nucleic acid mixtures can be hybridized to the immobilized nucleic acid molecules, and the label may be used to monitor and measure the individual signal intensities of the hybridized molecules at defined regions. This methodology allows the simultaneous quantification of the relative or absolute amount of all or selected nucleic acids in the applied nucleic WO 01/66573 PCT/IB00/02035 I acid sample or mixture. DNA microarrays, therefore, permit an analysis of the 1 expression of multiple (as many as 6800 or more) nucleic acids in parallel (see, e.g., SSchena, M. (1996) BioEssays 18(5): 427-431).

The sequences of the invention may be used to design oligonucleotide primers which are able to amplify defined regions of one or more C. glutamicum genes by a nucleic acid amplification reaction such as the polymerase chain reaction. The choice Sand design of the 5' or 3' oligonucleotide primers or of appropriate linkers allows the covalent attachment of the resulting PCR products to the surface of a support medium described above (and also described, for example, Schena, M. et al. (1995) Science 270: 467-470).

C Nucleic acid microarrays may also be constructed by in situ oligonucleotide synthesis as described by Wodicka, L. et al. (1997) Nature Biotechnology 15: 1359- 1367. By photolithographic methods, precisely defined regions of the matrix are exposed to light. Protective groups which are photolabile are thereby activated and undergo nucleotide addition, whereas regions that are masked from light do not undergo any modification. Subsequent cycles of protection and light activation permit the synthesis of different oligonucleotides at defined positions. Small, defined regions of the genes of the invention may be synthesized on microarrays by solid phase oligonucleotide synthesis.

The nucleic acid molecules of the invention present in a sample or mixture of nucleotides may be hybridized to the microarrays. These nucleic acid molecules can be labeled according to standard methods. In brief, nucleic acid molecules mRNA molecules or DNA molecules) are labeled by the incorporation of isotopically or fluorescently labeled nucleotides, during reverse transcription or DNA synthesis.

Hybridization of labeled nucleic acids to microarrays is described in Schena, M. et al. (1995) supra; Wodicka, L. et al. (1997), supra; and DeSaizieu A. et al. (1998), supra). The detection and quantification of the hybridized molecule are tailored to the specific incorporated label. Radioactive labels can be detected, for example, as described in Schena, M. et al. (1995) supra) and fluorescent labels may be detected, for example, by the method of Shalon et al. (1996) Genome Research 6: 639-645).

The application of the sequences of the invention to DNA microarray technology, as described above, permits comparative analyses of different strains of C.

glutamicum or other Corynebacteria. For example, studies of inter-strain variations WO 01/66573 PCT/IB00/02035 I based on individual transcript profiles and the identification of genes that are important for specific and/or desired strain properties such as pathogenicity, productivity and stress tolerance are facilitated by nucleic acid array methodologies. Also, comparisons of the profile of expression of genes of the invention during the course of a fermentation reaction are possible using nucleic acid array technology.

SExample 13: Analysis of the Dynamics of Cellular Protein Populations S(Proteomics) SThe genes, compositions, and methods of the invention may be applied to study the interactions and dynamics of populations of proteins, termed 'proteomics'. Protein C populations of interest include, but are not limited to, the total protein population of C.

glutamicum in comparison with the protein populations of other organisms), those proteins which are active under specific environmental or metabolic conditions during fermentation, at high or low temperature, or at high or low pH), or those proteins which are active during specific phases of growth and development.

Protein populations can be analyzed by various well-known techniques, such as gel electrophoresis. Cellular proteins may be obtained, for example, by lysis or extraction, and may be separated from one another using a variety of electrophoretic techniques. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separates proteins largely on the basis of their molecular weight. Isoelectric focusing polyacrylamide gel electrophoresis (IEF-PAGE) separates proteins by their isoelectric point (which reflects not only the amino acid sequence but also posttranslational modifications of the protein). Another, more preferred method of protein analysis is the consecutive combination of both IEF-PAGE and SDS-PAGE, known as 2-D-gel electrophoresis (described, for example, in Hermann et al. (1998) Electrophoresis 19: 3217-3221; Fountoulakis et al. (1998) Electrophoresis 19: 1193-1202; Langen et al.

(1997) Electrophoresis 18: 1184-1192; Antelmann et al. (1997) Electrophoresis 18: 1451-1463). Other separation techniques may also be utilized for protein separation, such as capillary gel electrophoresis; such techniques are well known in the art.

Proteins separated by these methodologies can be visualized by standard techniques, such as by staining or labeling. Suitable stains are known in the art, and include Coomassie Brilliant Blue, silver stain, or fluorescent dyes such as Sypro Ruby (Molecular Probes). The inclusion of radioactively labeled amino acids or other protein WO 01/66573 PCT/IB00/02035 O precursors 35S-methionine, 35 S-cysteine, 14C-labelled amino acids, 1N-amino -q acids, 1 5 N0 3 or 5NH4I or 3C-labelled amino acids) in the medium of C glutamicum permits the labeling of proteins from these cells prior to their separation. Similarly, fluorescent labels may be employed. These labeled proteins can be extracted, isolated and separated according to the previously described techniques.

Proteins visualized by these techniques can be further analyzed by measuring the Samount of dye or label used. The amount of a given protein can be determined quantitatively using, for example, optical methods and can be compared to the amount C of other proteins in the same gel or in other gels. Comparisons of proteins on gels can be made, for example, by optical comparison, by spectroscopy, by image scanning and C analysis of gels, or through the use of photographic films and screens. Such techniques are well-known in the art.

To determine the identity of any given protein, direct sequencing or other standard techniques may be employed. For example, N- and/or C-terminal amino acid sequencing (such as Edman degradation) may be used, as may mass spectrometry (in particular MALDI or ESI techniques (see, Langen et al. (1997) Electrophoresis 18: 1184-1192)). The protein sequences provided herein can be used for the identification of C. glutamicum proteins by these techniques.

The information obtained by these methods can be used to compare patterns of protein presence, activity, or modification between different samples from various biological conditions different organisms, time points of fermentation, media conditions, or different biotopes, among others). Data obtained from such experiments alone, or in combination with other techniques, can be used for various applications, such as to compare the behavior of various organisms in a given metabolic) situation, to increase the productivity of strains which produce fine chemicals or to increase the efficiency of the production of fine chemicals.

Example 14: Cloning of Genes by Application of the Polymerase Chain Reaction

(PCR)

Genes can be amplified using specific oligonucleotides comprising either nucleotide sequences homologous to sequences of Corynebacterium glutamicum or other strains as well as recognition sites of restriction enzymes well known in the art as described in Sambrook, Fritsh, E. and Maniatis, T. Molecular Cloning: A WO 01/66573 PCT/IB00/02035 I Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor C Laboratory Press, Cold Spring Harbor, NY, 1989). Theses oligonucleotides can be used to amplify specific DNA-fragments containing parts of the chromosome of mentioned strains using DNA-polymerases such as T. aquaticus DNA-polymerase, P. furiosus DNA-polymerase, or P. woesei DNA-polymerase and dNTPs nucleotides in an appropriate buffer solution as described by the manufacturer.

Gene fragments such as coding sequences from RXA00657 including C appropriate upstream and downstream regions not contained in the coding region of the c mentioned gene can be amplified using the aforementioned technologies. Furthermore, these fragments can be purified from unincorporated oligonucleotides and nucleotides.

C DNA restriction enzymes can be used to produce protruding ends that can be used to ligate DNA fragments to vectors digested with complementary enzymes or compatible enzymes producing ends that can be used to ligate the DNA into the vectors mentioned in Sinskey et al., U.S. Patent No. 4,649,119, and techniques for genetic manipulation of C. glutamicum and the related Brevibacterium species lactofermentum) (Yoshihama et al, J. Bacteriol. 162: 591-597 (1985); Katsumata et al., J. Bacteriol. 159: 306-311 (1984); and Santamaria et al., J. Gen. Microbiol. 130: 2237-2246 (1984).

Oligonucleotides used as primers for the amplification of upstream DNA sequence, the coding region sequence and the downstream region of RXA00657 were as follows: TCGGGTATCCGCGCTACACTTAGA (SEQ ID NO:121); GGAAACCGGGGCATCGAAACTTA (SEQ ID NO:122).

Corynebacterium glutamicum chromosomal DNA with an amount of 200ng was used as a template in a 100pl reaction volume containing 2,5U Pfu Turbo-Polymerase T M (StratageneTM), and 200[1M dNTP-nucleotides The PCR was performed on a PCR- CyclerTM (Perkin Elmer 2400TM) using the following temperature/time protocol: 1 cycle: 94 2 min.; cycle: 94°C 1 min.; 52 0 C: 1 min, 72°C: 1.5 min., 1 cycle: 72 5 min.

Primers were removed from the resulting amplified DNA fragment and the resulting fragment was cloned into the blunt EcoRV site ofpBS KS (StratageneTM). The fragment was excised by digestion with the restriction enzymes BamHI/XhoI and ligated WO 01/66573 PCT/IB00/02035 \NO into a BamHI Sail digested vector pB (SEQ ID NO.: 125). The resulting vector is called SpB RXA00657.

Resulting recombinant vectors can be analyzed using standard techniques Sdescribed in Sambrook, Fritsh, E. and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and can be transferred into C.

glutamicum using aforementioned techniques.

A Corynebacterium strain (ATCC 13286) was treated for a transformation as t described. Transformation of C. glutamicum can be achieved by protoplast transformation \O 10 (Kastsumata, R. et al. (1984) J. Bacteriol. 159306-311), electroporation (Liebl, E. et al.

0(1989) FEMS Microbiol. Letters, 53:399-303) and in cases where special vectors are used, also by conjugation (as described, in Schafer, A. et al. (1990) J. Bacteriol. 172:1663- 1666). It is also possible to transfer the shuttle vectors for C. glutamicum to E. coli by preparing plasmid DNA from C. glutamicum (using standard methods well-known in the art) and transforming it into E. coli. This transformation step can be performed using standard methods, but it is advantageous to use an Mcr-deficient E. coli strain, such as NM522 (Gough Murray (1983) J Mol. Biol. 166:1-19).

Transformation of a bacterial strain such as Corynebacterium glutamicum strain (ATCC 13286) was performed with a plasmid pB containing the aforementioned DNA regions of RXA00657 (SEQ ID NO.:6) and in another case with the vector pB (SEQ ID NO.: carrying no additional insertion of nucleic acids.

The resulting strains were plated on and isolated from CM-Medium (10 g/1 Glucose 2,5 g/1 NaCI, 2,0 g/1 Urea, 10 g/1 Bacto Peptone (Difco/Becton Dicinson/Sparks USATM), 5 g/1 yeast extract (Difco/Becton Dicinson/Sparks USATM), 5g/1 meat extract (Difco/Becton Dicinson/Sparks USATM), 22g/1 Agar (Difco/Becton Dickinson/Sparks USA T M and 15.tg/ml kanamycin sulfate (Serva, Germany) with a adjusted with NaOH to pH of 6.8.

Strains isolated from the aforementioned agar medium were inoculated in 10 ml in a 100ml shake flask containing no baffles in liquid medium containing 100 g/1 sucrose 50g/l (NH4) 2 S0 4 2,5 g/1 NaC1, 2,0 g/l Urea, 10 g/l Bacto Peptone (Difco/Becton Dickinson/Sparks USA), 5 g/l yeast extract (Difco/Becton Dickinson/Sparks USA), 5g/1 meat extract (Difco/Becton Dickinson/Sparks USA), and WO 01/66573 PCT/IB00/02035 S25g/1 CaCO3 (Riedel de Haen, Germany) Medium was a adjusted with NaOH to pH of 6.8.

Strains were incubated at 30 0 C for 48h. Supematants of incubations were Sprepared by centrifugation 20'at 12,000 rpm in an Eppendorfr M microcentrifuge. Liquid supematants were diluted and subjected to amino acid analysis (Standard methods for these measurements are outlined in Applied Microbial Physiology, A Practical SApproach, P.M. Rhodes and P.F. Stanbury, eds., IRL Press, p. 103-129; 131-163; and 165-192 (ISBN: 0199635773) and references cited therein).

1 The results are shown in Table 6, below.

C Results: Table 6: Strain ATCC Plasmid pB pB RXA00657 13286 contained lysin produced 13.5 14.93 (g/l) Selectivity 0.235 0.25 (mol lysine/ mol consumed Saccharose) Equivalents Those of ordinary skill in the art will recognize, or will be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

2006252111 19 Dec 2006 TABLE 1: Included Genes Lysine biosynthesis Nucleic Acid SEQ -ID NO 7 9 11 13 17 19 21 Amino Acid Identification Code SEQ ID NO 6 RXA00657 8 RXA02229 10 RXS02970 12 F RXA01 009 14 RXC02390 16 RXCO1796 18 RXCO1207 Contig.

GR00653 GR00287 NT Start NT Stop Function 2793 4714 AMINOACID BIOSYNTHESIS REGULATOR 3617 DIAMINOPIMELATE EPIMERASE (EC 5.1.1.7) ACETYLORNITHINE AMINOTRANSFERASE (EC 2.6.1.11) 5943 ACETYLORNITHINE AMINOTRANSFERASE (EC 2.6.1.11) MEMBRANE SPANNING PROTEIN INVOLVED IN LYSINE METABOLISM MEMBRANE ASSOCIATED PROTEIN INVOLVED IN LYSINE METABOLISM CYTOSOLIC PROTEIN INVOLVED IN METABOLISM OF LYSINE AND

THREONINE

TRANSCRIPTIONAL REGULATOR INVOLVED IN LYSINE METABOLISM CYTOSOLIC PROTEIN INVOLVED IN LYSINE METABOLISM 20 RXCO0657 22 RXCO0552 Lysine biosynthesis 00 Nucleic Acid SEQ ID NO 23 Amino Acid Identification Code SEQ ID NO 24 RXA00534 26 RXA00533 28 RXA02843 RXA02022 RXA00044 RXA00863 RXA00864 Contig.

GRO01 37 GRO0137 GR00842 GROD613 GROO007 GR00236 GR00236 GROO842 W0135 GROO068 GR00274 GR00752 GR00408 GROO036 GROD408 GR00236 38 RXA02843 RXN00355 42 F RXA00352 4758 3469 543 2063 3458 896 1694 543 31980 861 3 5237 4249 5443 4320 2647 NT Start NT Stop Function 3496 ASPARTOKINASE ALPI-IA AND BETA SUBUNITS (EC 2.7.2.4) 2438 ASPARTATE-SEMIALDEHYDE DEHYDROGENASE (EC 1.2.1.11) 4 2,3,4,5-TETRAH-YDROPYRIDINE-2-CARBOXYLATE N-SUCCINYLTRANSFERASE (EC 2.3.1.117) 3169 SUCCINYL-DIAMINOPIMELATE DESUCCINYLASE (EC 3.5.1.18) 4393 DII-YDRODIPICOLINATE SYNTI-ASE (EC 4.2.1.52) 1639 DIHYDRODIPICOLINATE REDUCTASE (EC 1.3.1.26) 2443 probable 2,3-dihydrodipicolinate N-C6-lyase (cyclizing) (EC Corynebacterium glutamicum 4 2,3,4,5-TETRAHYDROPYRIDINE-2-CARBOXYLATE N-SUCCINYLTRANSFERASE (EC: 2.3.1.117) 30961 MESO-DIAMINOPIMELATE D-DEHYDROGENASE 4 MESO-DIAMINOPIMELATE D-DEHYDROGENASE (EC 1.4.1.16) RXA00972 RXA02653 RXA01 393 RXA00241 RXA01 394 RXA00865 1379 7234 3380 6945 5018 3549 DIAMINOPIMELATE DECARBOXYLASE (EC 4.1.1.20) DIAMINOPIMELATE DECARBOXYLASE (EC 4.1.1.20) LYSINE EXPORT REGULATOR PROTEIN L-LYSINE TRANSPORT PROTEIN LYSINE EXPORTER PROTEIN DI[HYDRODIPICOLINATE SYNTHASE (EC 4.2.1.52) 2006252111 19 Dec 2006 Nucleic Acid SEQ ID NO 57 59 61 63 67 Amino Acid Identification Code Contig.

SEQ ID NO 56 RXS02021 58 RXS02157 60 RXC00733 62 RXCO0861 64 RXCO0866 66 RXC02095 68 RXC03185 NT Start NT Stop Function0 2.3,4,5-TERAHYDROPYRIDINE-2-CARBOXYLATE N-SUCCINYLTRANSFERASE (EC 2.3.1.117) ACETYLORNITHINE AMINOTRANSFERASE (EC 2.6.1.11) ABC TRANSPORTER ATP-BINDINO PROTEIN INVOLVED IN LYSINE

METABOLISM

PROTEIN INVOLVED IN LYSINE METABOLISM ZN-DEPENDENT HYDROLASE INVOLVED IN LYSINE METABOLISM ABC TRANSPORTER ATP-BINDING PROTEIN INVOLVED IN LYSINE

METABOLISM

PROTEIN INVOLVED IN LYSINE METABOLISM Metabolism of methionine and S-adenosyl methionine Nucleic Acid SEQ ID NO 00 w 3 69 71 73 7 79 81 83 87 89 91 93 Amino Acid SEQ ID NO 2 4 70 72 74 76 78 80 82 84 86 94 90 91 94 Identification Code metZ or met metc RXA001 '15 RXN00403 F RXA00403 RXS03158 F RXA00254 RXA02532 RXS031 59 F RXA02768 RXA0021 6 RXA021 97 RXN02198 F RXA02198 RXN03074 Contig GROO017 W0086 GROG088 GR00038 GR00726 GR00770 GROO032 GROO645 W0302 GR00646 W0042 NT Start NT Stop Function O-ACETYLHOMOSERINE SULFHYDRYLASE (EC 4.2.99.10) Cystathionine-y-Iyase 5359 4313 HOMOSERINE 0-ACETYLTRANSFERASE (EC 2.3.1.31) 70041 68911 HOMOSERINE O-ACETYLTRANSFERASE 723 1832 HOMOSERINE 0-ACETYLTRANSFERASE (EC 2.3. 1.11) CYSTATHIONINE GAMMA-SYNTHASE (EC 4.2.99.9) 2404 1811 CYSTATHIONINE GAMMA-SYNTHASE (EC 4.2.99.9) 3085 2039 CYSTATHIONINE GAMMA-SYNTHASE (EC 4.2.99.9) CYSTATHIONINE GAMMA-SYNTHASE (EC 4.2.99.9) 1919 2521 CYSTATHIONINE. GAMMA-SYNTI-ASE (EC 4.2.99.9) 16286 15297 5-methyltetrahydrofolate-homocysteine methyltransferase (methionine synthetase) 4552 4025 5-METHYLTETRAHYDROFOLATE-HOMOCYSTEINE METHYLTRANSFERASE (EC 2.1.1.13) 9228 11726 5-METHYLTETRAHYDROFOLATE-HOMOCYSTEINE METHYLTRANSFERASE (EC 2.1 .1 .13) 2483 6 5-METHYLTETRAHYDROFOLATE-HOMOCYSTEINE METHYLTRANSFERASE (EC 2.1.1.13) 2238 1741 S-ADENOSYLMETHIONINE:2-DEMETHYLMENAQUINONE METHYLTRANSFERASE (EC 2006252111 19 Dec 2006 Nucleic Acid S EQ -IDNO 97 99 101 103 105 107 109 ill 113 00 115 117 Amino Acid SEQ ID NO 96 98 100 102 104 106 108 110 112 114 116 118 Identification Code F RXA02906 RXN00132 F RXAOOI 32 F RXA01371 RXN02085 F RXA02085 F RXA02086 RXN02648 F RXA02648 F RXA02658 RXC02238 RXCO01 28 Contig.

GR10044 W01 24 GROO020 GR00398 GROO629 GR00629 GR00751 GR00752 NT Start NT Stop Function 1142 3612 7728 2339 3496 5252 5254 14764 645 S-ADENOSYLMETHIONINE:2-DEMETHYLMENAQUINONE METHYLTRANSFERASE (EC 5045 ADENOSYU-IOMOCYSTEINASE (EC 3.3.1.1) 7624 ADENOSYLHOMOCYSTEINASE (EC 3.3.1.1) 3634 ADENOSYLHOMOCYSTEINASE (EC 3.3.1.1) METHYLTRANSFERASE (EC 2.1.1.14) 5295 METHYLTRANSFERASE (EC 2.1.1.14) 5731 METI-YLTRANSFERASE (EC 2.1.1.14) METHYLTRANSFERASE (EC 2.1.1.14) 4730 METHYLTRANSFERASE (EC 2.1.1.14) 15447 METHYLTRANSFERASE (EC 2.1.1.14) PROTEIN INVOLVED IN METABOLISM OF S-ADENOSYLMETHIONINE, PURINES AND PANTOTHENATE EXPORTED PROTEIN INVOLVED IN METABOLISM OF PYRIDIMES AND

ADENOSYLHOMOCYSTEINE

S-2adenosyl methionine (SAM) Biosynthesis Nucleic Acid Amino Acid SEQ ID NO SEQ ID NO 119 120 Identification Code Contig.

RXA02240 GR00654 NT Start 7160 NT Stop 8380 Function S-ADENOSYLMETHIONINE SYNTHETASE (EC 2.5.1.6) 2006252111 19 Dec 2006 TABLE 2: GENES IDENTIFIED FROM GEN-BANK GenBankm Gene Name Gene Function Reference Accession No.

A09073 ppg Phosphoenol pyruvate carboxylase Bachmann, B. et al. "DNA fragment coding for phosphoenolpyruvat corboxylase, recombinant DNA carrying said fragment, strains carrying the recombinant DNA and method for producing L-aminino acids using said Patent: EP 0358940-A 3 03/21/90 A45579, Threonine dehydratase Moeckel, B. et al. "Production of L-isoleucine by means of recombinant A45581, micro-organisms with deregulated threonine dehydratase," Patent: WO A45583, 9519442-A 5 07/20/95 A45585 A45587 AB003 132 murC; ftsQ; ftsZ Kobayashi, M. etal. "Cloning, sequencing, and characterization of the ftsZ gene from coryneibrm bacteria," Biochem. Biophys. Res. Commun., 236(2):383-388 (1997) ABO 15023 murC; ftsQ Wachi, M. et al. "A murC gene from Coryneformn bacteria," AppL. Microbial.

5 1(2):223-228 (1999) ABO 18530 dtsR Kimura, E. et al. "Molecular cloning of a novel gene, dtsR, which rescues the detergent sensitivity of a mutant derived from Brevibacteriurn Biosci. BiotechnoL. Biochem., 60(10): 1565-1570 (1996) AB018531 dtsRl; dtsR2 AB020624 murl D-glutaniate racemase AB023377 tkt transketolase AB024708 gltB; gltD Glutamine 2-oxoglutarate aminotransferase large and small subunits AB025424 acn aconitase AB0277 14 rep Replication protein AB0277 15 rep; aad Replication protein; aminoglycoside _________________adenyltransferase AF005242 argC AF005635 glnA Glutamine synthetase AF030405 hisF cyclase AF030520 argG Argininosuccinate syntlietase AF03 1518 argF Omithine carbainolytransferase 2006252111 19 Dec 2006 GenBank~m Gene Name Gene Function Reference Accession No.

AF036932 aroD) 3-dehydroquinate dehydratase AF03 8548 pyc Pyruvate carboxylase AF03 8651 dciAE; apt; rel Dipeptide-binding protein; adenine Wehmeier, L. et al. "The role of the Corynebacterium glutamicum rel gene in phosphoribosyltransferase; GTP (p)ppGpp metabolism," Microbiology, 144:1853-1862 (1998) ~~pyrophosphokinase AF04 1436 argR Arginine repressor AF045998 impA Inositol monophosphate phosphatase AF048764 argH Argininosuccinate AF049897 argC; argJ; argfl; N-acetylglutamylphosphate reductase; argD); argF; argR; ornithine acetyltransferase; NargG; argH acetyiglutamate kinase; acetylomithine transminase; ornithine carbamoyltransferase; arginine repressor; argininosuccinate synthase; argininosuccinate lyase AF050 109 inbA Enoyl-acyl carrier protein reductase AF050 166 hisG AT? phosphoribosyltransferase 1846 hisA phosphoribosyl-4-imidazolecarboxamide isomerase AF052652 metA Homoserine 0-acetyltranisfierase Park, S. et al. "Isolation and analysis of metA, a methionmne biosynthetic gene encoding homoserine acetyltransferase in Corynebacterium glutamicum," Mol Cells., 8(3):286-294 (1998) AF05307 1 aroB Dehydroquinate synthetase AF060558 hisH Glutamine axnidotransferase AF086704 hisE Phosphoribosyl-ATPpyrophosphohydrolase AFt 14233 aroA 5-enolpyruvylshikimate 3-phosphate synthase AF 116184 panD L-aspartate-alpha-decarboxylase precursor Dusch, N. et al. "E xpression of the Corynebacterium glutamicum panD gene overproduction in Escherichia coli," AppI. Environ. Microbiol., 65(4)1530- 1539 (1999) 2006252111 19 Dec 2006 GenBank' Gene Name Gene Function Reference0 Accession No.

AF124518 aroD; aroE 3-dehydroquinase; shikimate U ___________dehydrogenase AF124600 aroC; aroK; aroB; Chorismate synthase; shikimate kinase; 3pepQ dehydroquinate synthase; putative cytoplasmic peptidase AF145897 inhA AF145898 inhA AJO0 1436 ectP Transport of ectoine, glycine betaine, Peter, H. et al. "Corynebacterium glutamnicum is equipped with four secondary proline carriers for compatible solutes: Identification, sequencing, and characterization of the proline/ectoine uptake system, ProP, and the ectoine/proline/glycine betaine carrier, EctP," J Bacteriol, 180(22):6005-6012 (1998) AJ004934 dapD) Tetrahydrodipicolinate succinylase Wehrmann, A. et al. "Different modes of diaminopimelate synthesis and their (incomplete') role in cell wall integrity: A study with Corynebacterium. glutamicum," J BacterioL, 180(12):3159-3165 (1998) AJO07732 ppc; secG; amt; ocd; Phosphoenolpyruvate-carboxylase; high soxA affinity ammonium uptake protein; putative ornithine-cyclodecarboxylase; sarcosine oxidase AJO 103 19 ftsY, glnB, glnD; srp; Involved in cell division; PH1 protein; Jakoby, M. et al. "Nitrogen regulation in Corynebacteriumn glutamicum; amtP uridylyltransferase (uridylyl-removing Isolation of genes involved in biochemical characterization of corresponding enzmnye); signal recognition particle; low proteins," FEMS Microbiol., 173(2):303-3 10 (1999) affinity ammonium uptake protein AJ132968 cat Chloramphenicol aceteyl transferase AJ224946 mqo L-malate: quinone oxidoreductase Molenaar, D. et al. "Biochemical and genetic characterization of the membrane-associated malate dehydrogenase (acceptor) from Corynebacterium Eur. J. Biochem., 254(2):395-403 (1998) AJ238250 ndh _NADH dehydrogenase AJ23 8703 porA Porin Lichtinger, T. et al. "Biochemical and biophysical characterization of the cell wall porin of Corynebacterium glutamicum: The channel is formed by a low molecular mass polypeptide," Biochemistry, 37(43): 15024-15032 (1998) D17429 Transposable element IS3 1831 Vertes et al."Isolation and characterization of IS3 183 1, a transposable element Corynebacterium glutamicum," Mol. Microbiol., 11 (4):739-746 (1994) 2006252111 19 Dec 2006 Gen~ankTI Gene Name Gene Function Reference Accession No.

D184 102 odhA 2-oxoglutarate dehydrogenase Usuda, Y. et al.' "Molecular cloning of the Corynebacterium glutarnicum (Brevibacterium lactofermentum AJ12036) odhA gene encoding a novel type 2-oxoglutarate dehydrogenase," Microbiology, 142:3347-3354 (1996) E01 358 hdh; hk Homoserine dehydrogenase; homoserine Katsumata, R. et al. "Production of L-thereonine and L-isoleucine," Patent: JLP 1987232392-A 1 10/12/87 EQ01359 Upstream of the start codon of homosermne Katsumata, R. et al. "Production of L-thereonine and L-isoleucine," Patent: JP gene 1987232392-A 2 10/12/87 EQ01375 Tryptophan operon EQ 13 76 trpL; trpE Leader peptide; anthranilate synthase Matsui, K. et al. "Tryptophan operon, peptide and protein coded thereby, utilization of tryptophan operon gene expression and production of Patent: JP 1987244382-A 1 10/24/87 EQ01377 Promoter and operator regions of Matsui, K. et al. "Tryptophan operon, peptide and protein coded thereby, tryptophan operon utilization of tryptophan operon gene expression and production of Patent: JP 1987244382-A 1 10/24/87 E03937 Biotin-synthase Hatakeyama, K. et al. "DNA fragment containing gene capable of coding synthetase and its utilization," Patent: JP 1992278088-A 1 10/02/92 E04040 Diamino pelargonic acid aminotransferase Kohama, K. et al. "Gene coding diaxninopelargonic acid aminotransferase and desthiobiotin synthetase and its utilization," Patent: JP 1992330284-A 1 11/18/92 E04041 Desthiobiotinsynthetase Kohama, K. et al. "Gene coding diaminopelargonic acid aminotransferase and desthiobiotin synthetase and its utilization," Patent: JP 1992330284-A 1 11/18/92 E04307 Flavumn aspartase Kurusu, Y. et al. "Gene DNA coding aspartase and utilization thereof," Patent: 1993030977-A 1 02/09/93 E04376 Isocitric acid lyase Katsumata, R. et al. "Gene manifestation controlling DNA," Patent: 1? 1993056782-A 3 03/09/93 E04377 Isocitric acid lyase N-terminal fragment Katsumata, R. et al. "Gene manifestation controlling DNA," Patent: JP 3 03/09/93 E04484 Prephenate dehydratase Sotouchi, N. et al. "Production of L-phenylalanine by fermentation," Patent: JP 1993076352-A 2 03/30/93 108 Aspartokinase Fugono, N. et al-. "'Gene DNA coding Aspartokinase and its use," Patent: JP 84366-A 1,07/27/93 2006252111 19 Dec 2006 GenBankm Gene Name Gene Function Reference Accession 112 Dihydro-dipichorinate synthetase Hatakeyama, K. et al. "Gene DNA coding dihydrodipicolinic acid synthetase its use," Patent: JP 1993184371-A 1 07/27/93 E05776 Diaminopimelic acid dehydrogenase Kobayashi, M. et al. "Gene DNA coding Diaminopimelic acid dehydrogenase its use," Patent: JP 1993284970-A 1 11/02/93 E05779 Threonine synthase Kohama, K. et al. "Gene DNA coding threonine synthase and its use," Patent: 1993284972-A 1 11/02/93 E06 110 Prephenate dehydratase Kikuchi, T. et al. "Production of L-phenylalanine by fermentation method," JP 199334488 1-A 1 12/27/93 E061 11 Mutated Prephenate dehydratase Kikcuchi, T. et al. "Production of L-phenylalanine by fermentation method," JP 1993344881-A 1 12/27/93 E06 146 Acetohydroxy acid synthetase Inui, M. et Al. "Gene capable of coding Acetohydroxy acid synthetase and its Patent: JP 1993344893-A 1 12/27/93 E06825 Aspartokinase Sugimoto, M. et at. "Mutant aspartokinase gene," patent: JP 1994062866-A 1 E06826 Mutated aspartokinase alpha subunit Sugimoto, M. et at. "Mutant aspartokmnase gene," patent: IP 1994062866-A 1 E06827 Mutated aspartokinase alpha subunit Sugimoto, M. et al. "Mutant aspartokinase gene," patent: JP 1994062866-A 1 E07701 secY Honno, N. et al. "Gene DNA participating in integration of membraneous to membrane," Patent: JP 1994169780-A 1 06/21/94 E08 177 Aspartokinase Sato, Y. et al. "Genetic DNA capable of coding Aspartokinase released from inhibition and its utilization," Patent: JP 1994261766-A 1 09/20/94 E08 178, Feedback inhibition-released Aspartokinase Sato, Y. et al. "Genetic DNA capable of coding Aspartokinase released from E08179, feedback inhibition and its utilization," Patent: JP 1994261766-A 1 09/20/94 E08 180, E08181, E08 182 E08232 Acetohydroxy-acid isomeroreductase Inui, M. et at. "Gene DNA coding acetohydroxy acid isomeroreductase," JP 1994277067-A 1 10/04/94 E08234 secE Asai, Y. et al. "Gene DNA coding for translocation machinery of protein," JP 1994277073-A 1 10/04/94 E08643 FT aminotransferase and desthiobiotin H-atakeyama, K. et al. "DNA fragment having promoter function in promoter region -coryneform bacterium," Patent: JP 199503 1476-A 1 02/03/95 2006252111 19 Dec 2006 GenBankT" Gene Name Gene Function Reference Accession No.

E08646 Biotin synthetase Hatakeyama, K. et al. "DNA fragment having promoter function in bacterium," Patent: JP 1995031476-A 1 02/03/95 E0869 Aspartase Kohama, K. et al "DNA fragment having promoter function in coryneform Patent: JP 1995031478-A 1 02/03/95 E08900 Dihydrodipicolinate reductase Madori, M. et al. "DNA fragment containing gene coding Dihydrodipicolinate reductase and utilization thereof," Patent: JP 1995075578-A 1 03/20/95 E08901 Diaminopimelic acid decarboxylase Madori, M. et al. "DNA fragment containing gene coding Diaminopimelic acid decarboxylase and utilization thereof," Patent: JP 1995075579-A 1 03/20/95 El12594 Serine hydroxymethyltransferase Hatakeyama, K. et al. "Production of L-trypophan," Patent: JP 199702839 1-A 1 02/04/97 E12760, transposase Moriya, M. et al. "Amplification of gene using artificial transposon," Patent: E12759, JP 1997070291 -A 03/18/97 E12758 E12764 Arginyl-tRNA synthetase; diaminopimelic Moriya, M. et al. "Amplification of gene using artificial transposon," Patent: decarboxylase JP 1997070291-A 03/18/97 E12767 Dihydradipicolinic acid synthetase Moriya, M. et al. "Amplification of gene using artificial transposon," Patent: 1997070291 -A 03/18/97 El12770 aspartokinase Moriya, M. et al. "Amplification of gene using artificial transposon," Patent: JP 1997070291-A 03/18/97 E12773 Dihydrodipicolinic acid reductase Moriya, M. et al. "Amplification of gene using artificial transposon," Patent: JP 1997070291 -A 03/18/97 E13655 Glucose-6-phosphate dehydrogenase Hatakeyama, K. et al. "Glucose-6-phosphate dehydrogenase and DNA capable coding the same," Patent: JP 1997224661 -A 1 09/02/97 LO01508 INA Threonine dehydratase Moeckel, B. et al. "Functional and structural analysis of the threonine dehydratase of Corynebacteriumn glutamicum," J Bacteriol., 174:8065-8072 (1992) L07603 EC 4.2.1.15 3-deoxy-D-arabinoheptulosonate-7- Chen, C. et al. "The cloning and nucleotide sequence of Corynebacterium phosphate synthase glutamicum 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase gene," FEMS Microbiol.- Let., 107:223-230 (1993) L09232 IlvB; ilvN; ilvC Acetohydroxy acid synthase large subunit; Keilhauer, C. et al. "Isoleucine synthesis in Corynebacterium glutamicurn: Acetohydroxy acid synthase small subunit; molecular analysis of the ilvB-ilvN-ilvC operon," J Bacteriol., 175(17):5595acid isomeroreductase 5603 (1993) 2006252111 19 Dec 2006 GenBankm Gene Name Gene Function Reference Accession No.

LI18874 PtsM Phosphoenolpyruvate sugar Fouet, A et al. "Bacillus subtilis sucrose-specific enzyme 11 of the phosphotransferase phosphotransferase system: expression in Escherichia coli and homology to enzymes II from enteric bacteria," PNAS USA, 84(24):8773-8777 (1987); Lee, J.K. et al. '"Nucleotide sequence of the gene encoding the Corynebacterium glutamicum mannose enzyme HI and analyses of the deduced protein sequence," FEMS Microbial. Let., 1 19(1-2):137-145 (1994) L27 123 aceB Malate synthase Lee, H-S. et al. "Molecular characterization of aceB, a gene encoding malate synthase in Corynebacterium glutamicum," J. Microbial. BiotechnoL, (1994) L27 126 Pyruvate kinase .Jeten, M. S. et al. "Structural and functional analysis of pyruvate kinase from Corynebacterium. glutainicum," Appi. Environ. MicrobioL, 60(7):2501-2507 L28760 aceA Isocitrate lyase L35906 dtxr Diphtheria toxin repressor Oguiza, J.A. et al. "Molecular cloning, DNA sequence analysis, and characterization of the Corynebacteriumn diphitheriae dtxR from Brevibacterium J. Bacterial., 1 77(2):465-467 (1995) M1 3774 Prephenate dehydratase Follettie, M.T. et al. "Molecular cloning and nucleotide sequence of the Corynebacterium glutamicurn pheA gene," J. Bacterial, 167:695-702 (1986) M16 175 5S rRNA Park, Y-H. et al. "Phylogenetic analysis of the coryneform bacteria by 56 sequences," J Bacterial., 169:1801-1806 (1987) M16663 trpE Anthranilate synthase, 5' end Sano, K. et al. "Structure and function of the trp operon control regions of Brevibacteritun lactofermentum, a glutamic-acid-producing bacterium," Gene, 52:191-200 (1987) M16664 trpA Tryptophan synthase, 3'end Sano, K. et al. "Structure and function of the trp operon control regions of Brevibacteriumn lactofermentum, a glutamic-acid-producing bacterium," Gene, 52:191-200 (1987) M25819 Phosphoenolpyruvate carboxylase Q'Regan, M. et al. "Cloning and nucleotide sequence of the Phosphoenolpyruvate carboxylase-coding gene of Corynebacterium ATCC 13032," Gene, 77(2):237-251 (1989) 106 23S rRNA gene insertion sequence Roller, C. et al. "Gram-positive bacteria with a high DNA G+C content are characterized by a common insertion within their 23S rRNA genes," J Gen.

138:1167-1 175 (1992) 2006252111 19 Dec 2006 GenBankTm Gene Name Gene Function Reference Accession No.

107, 23S rRNA gene insertion sequence Railer, C. et al. "Gram-positive bacteria with a high DNA G+C content are 108 characterized by a common insertion within their 23S rRNA genes," J. Gen 138:1167-1 175 (1992) M89931I aecD; brnQ; yhbw Beta C-S lyase;- branched-chain amino acid Rossol, 1. et al. "The Corynebacteriumn glutamicum aecD gene encodes a C-S uptake carrier; hypothetical protein yhbw lyase with alpha, beta-elimination activity that degrades aminoethylcysteine," J Bacterial, 174(9):2968-2977 (1992); Tauch, A. et al. "Isoleucine uptake in Corynebacterium glutamicumn ATCC 13032 is directed by the bmQ gene product," Arch. Microbial, 1 69(4):303-3 12 (1998) S59299 trp Leader gene (promoter) Herry, D.M. et al. "Cloning of the trp gene cluster from a tryptophanhyperproducing strain of Corynebacterium glutamicum: identification of a mutation in the trp leader sequence," AppI. Environ. Microbial. 59(3):79 1-799 (1993) UI 11545 trpD Anthranilate phosphoribosyltransferase O'Gara, J.P. and Dunican, L.K. (1994) Complete *nucleotide sequence of the Corynebacterium glutamicum ATCC 21850 tpD gene." Thesis, Microbiology University College Galway, Ireland.

U 13922 cgllM; cglIR; clgIIR Putative type II 5-cytosoine Schafer, A. et al. "Cloning and characterization of a DNA region encoding a methyltransferase; putative type H stress-sensitive restriction system from Corynebacterium glutamicum ATCC restriction endonuclease; putative type I or 13032 and analy~sis of its role in intergeneric conjugation with Escherichia type III restriction endonuclease coli," J. Bacteria), 176(23):7309-7319 (1994); Schafer, A. et al. "The Corynebacteriumfglutamicumr cglIM gene encoding a 5-cytosine in an McrBC- Escherichia coli strain," Gene, 203 (2):95-101 (1997) U14965 U31224 ppx Ankri, S. et al. "Mutations in the Corynebacterium glutamnicumproline biosynthetic pathway: A natural bypass of the proA step," J Bacterial, 178(15):4412-4419 (1996) U3 1225 proC L-proline: NADP+ 5-oxidoreductase Ankri, S. et al. "Mutations in the Corynebacterium glutamnicumproline biosynthetic pathway: A natural bypass of the proA step," J Bacterial, (1996) U3 1230 obg; proB; unkdh ?;gamma glutamyl kinase;similar to D- Ankri, S. et al. "Mutations in the Corynebacterium glutamicumproline isomer specific 2-hydroxyacid biosynthetic pathway: A natural bypass of the proA step," Bacterial., ___________dehydrogenases 178(15):4412-4419 (1996) 2006252111 19 Dec 2006 GenBankTm Gene Name Gene Function Reference Accession No.

U3 1281 bioB Biotin synthase Serebriiskii, "Two new members of the bio B superfamily: Cloning, sequencing and expression of bio B genes of Methylobacillus flagellatumn and ________________Corynebacteriumn glutamicum," Gene, 175:15-22 (1996) U35023 thtR; accBC Thiosulfate sulfurtransferase; acyl CoA Jager, W. et al. "A Corynebacterium glutamicumn gene encoding a two-domain carboxylase protein similar to biotin carboxylases and biotin-carboxyl-carrier proteins," Microbiol., 166(2);76-82 (1996) U43535 cmr Multidrug resistance protein Jager, W. et al. "A Corynebacterium glutamicumn gene conferring multidrug resistance in the heterologous host Escherichia coli," J Bacteriol., 1 (1997) U43536 clpB Heat shock ATP-binding protein U53 587 aphA-3 3'5' -am inoglycoside phosphotransferase U89648 Corynebacterium glutamicumn unidentifiedsequence involved in histidine biosynthesis, partial sequence X04960 trpA; trpB; trpC; trpD; Tryptophan operon Matsui, K. et al. "Complete nucleotide and deduced amino acid sequences of trpE; trpG; trpL the Brevibacterium lactofermentum tryptophan operon," Nucleic Acids Res., 14(24):101 13-10114 (1986) X07563 lys A DAP decarboxylase (meso-diaminopimelate Yeh, P. et al. "Nucleic sequence of the lysA gene of Corynebacterium decarboxylase, EC 4.1.1.20) glutarnicumn and possible mechanisms for modulation of its expression," Mo.

Gen. Genet., 212(l):112-1 19 (1988) X14234 EC 4.1.1.31 Phosphoenolpyruvate carboxylase Eikmranns, B.J. et al. "The Phosphoenolpyruvate carboxylase gene of Corynebacteriumn glutamicum: Molecular cloning, nucleotide sequence, and expression," Mol. Gen Genet., 218(2):330-339 (1989); Lepiniec, L. et al.

"Sorghum Phosphoenolpyruvate carboxylase gene family: structure, function molecular evolution," Plant. Mol. Biol., 21 (3):487-502 (1993) Xl17313 fda Fructose-bisphosphate aldolase Von der Osten, C.H. et al. "Molecular cloning, nucleotide sequence and finestructural analysis of the Corynebacteriumn glutamicum fda gene: structural comparison of C. glutamicum fructose-I, 6-biphosphate aldolase to class I and cass 11 aldolases," Mol. Microbiol., X53993 dapA L-2, 3-dihydrodipicolinate synthetase (EC Bonnassie, S. et al. "Nucleic sequence of the dapA gene from 1Corynebacterium glutamicum," Nucleic Acids Res., 18(21):6421 (1990) 2006252111 19 Dec 2006 GenBankTu Gene Name Gene Function Reference Accession No.

X54223 AttB-related site Cianciotto, N. et al. "DNA sequence homology between att B-related sites of Corynebacteriumn diphtheriae, Corynebacteriumn ulcerans, Corynebacterium glutamnicum. and the attP site of lambdacorynephage," FEMS. Microbial, 66:299-302 (1990).

X54740 argS; lysA Arginyl-tRNA synthetase; Diaminopimelate Marcel, T. et al. "Nucleotide sequence and organization of the upstream region decarboxylase of the Corynebacterium glutamicum lysA gene," Mal. MicrobiaL, 4(1 1):1819- (1990) X55994 trpL; tipE Putative leader peptide; anthr-anilate Heery, D.M. et al. "Nucleotide sequence of the Corynebacterium glutamicumn synthase component 1 trpE gene," Nucleic Acids Res., 18(23):7 138 (1990) X56037 thrC Threonine synthase Han, K.S. et al. "The molecular structure of the Corynebacterium glutamicumn synthase gene," Ma!. MicrobiaL, 4(10):1693-1702 (1990) X56075 attB-related site Attachment site Cianciotto, N. et al. "DNA sequence homology between aft B3-related sites of Corynebacterium:diphtheriae, Corynebacterium ulcerans, Corynebacterium glutamicum and the attP site of lambdacorynephage," FEMS. Microbial, Lett., 66:299-302.(1990) X57226 lysC-alpha; lysC-beta; Aspartokinase-aipha subunit; Kalinowski, J. et'al. "Genetic and biochemical analysis of the Aspartokinase asd Aspartokinase-beta subunit; aspartate beta from Corynebacterium glutamicum," Mo!. Microbial., 5(5):1 197-1204 (1991); semialdehyde dehydrogenase Kalinowski, J. et al. "Aspartokinase genes lysC alpha and lysC beta overlap and are adjacent to the aspertate beta-semialdehyde dehydrogenase gene asd in ________________Corynebacteriumn glutamicum," MU! Gen. Genet., 224(3):3 17-324 (1990) X59403 gap;pgk; tpi Glyceraldehyde-3-phosphate; Eikmanns, B.J. "Identification, sequence analysis, and expression of a phosphoglycerate kinase; triosephosphate Corynebacterium glutamicum gene cluster encoding the three glycolytic isomerase enzymes glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, and triosephosphate isomeras," Bacterial, 174(19):6076-6086 (1992) X59404 gdh Glutamate dehydrogenase Bormann, E.R. et al. "Molecular analysis of the Corynebacterium glutamicum gdh gene encoding glutamate dehydrogenase," Mo!. Microbial, 6(3):3 17-326 (1992) X603 12' lysl -L-lysine permease Seep-Feldhaus, A.H. et al. "Molecular analysis of the Corynebacterium glutamicurn lysl gene involved in lysine uptake," Mo!. Microbiol., 5(12):2995- (1991) 2006252111 19 Dec 2006 GenBank~m Gene Name Gene Function Reference Accession No.

X66078 copi Psi protein Joliff, G. et al. "Cloning and nucleotide sequence of the csplI gene encoding PSI, one of the two major secreted proteins of Corynebacterium glutamicum: The deduced N-terminal region of PSI1 is similar to the Mycobacterium antigen complex," MoL MicrobioL, 6(16):2349-2362 (1992) X66 112 glt Citrate synthase Eikmanns, B.J. et al. "Cloning sequence, expression and transcriptional analysis of the Corynebacterium glutamicum gItA gene encoding citrate MicrobioL, 140:1817-1828 (1994) X67737 dapB Dihydrodipicolinate X69 103 csp2 Surface layer protein PS2 Peyret, J.L. et al. "Characterization of the cspB gene encoding PS2, an ordered surface-layer protein in Corynebacteriumn glutamicum," Mol. MicrobioL, (1993) X69 104 IS3 related insertion element Bonaniy, C. et al.."Identification of IS 1206, a Corynebacteriumn glutamicum 153-related inser tion sequence and phylogenetic analysis," Mol Microbiol., (1994) X70959 leuA Isopropylmalate synthase Patek, M. et al. "Leucine synthesis in Corynebacteriumn glutamicum: enzyme activities, structure of leuA, and effect of leuA inactivation on lysine Appi. Environ. MicrobioL, 60(1): 133-140 (1994) X7 1489 icd Isocitrate dehydrogenase (NADP+) Eikmanns, B.i. et al. "Cloning sequence analysis, expression, and inactivation of the Corynebacterium glutaniicumn icd gene encoding isocitrate dehydrogenase and biochemical characterization of the enzyme," J BacterioL, (1995) X72855 GDHA Glutamate dehydrogenase (NADP+) X75083, mtrA 5-methyltryptophan resistance Heery, D.M. et al. "A sequence from a tryptophan-hyperproducing strain of X70584 Corynebacteriurn glutamnicumn encoding resistance to Biophys. Res. Commun., 201(3):1255-1262 (1994) X75085 recA Fitzpatrick, R. et al. "Construction and characterization of recA mutant strains of Corynebacteriumn glutamicuxn and Brevibacterium lactofermentum," AppL Biotechnol., 42(4):575-580 (1994) X75504 aceA; thiX Partial Isocitrate lyase; Reinscheid, D.J. et al. "Characterization of the isocitrate lyase gene from Corynebacteriumn glutamicum and biochemical analysis of the enzyme," J 176(12):3474-3483 (1994) X76875 ATPase beta-subunit Ludwig, W. et al. "Phylogenetic relationships of bacteria based on comparative analysis of elongation factor Tu and ATP-synthase beta-subunit 2006252111 19 Dec 2006 genes," Antonie Van Leeuwenhoek 64:285-305 (1993) GenBank~m Gene Name Gene Function Reference Accession No.

X77034 tuf Elongation factor Tu Ludwig, W. et al. "Phylogenetic relationships of bacteria based on comparative sequence analysis of elongation factor Tu and ATP-synthase beta-subunit Antonie Van Leeuwenhoek, 64:285-305 (1993) X77384 recA Bilhnan-Jacobe, H. "Nucleotide sequence of a recA gene from ____________Corynebacteriumn glutamicum," DNA Seq., 4(6):403-404 (1994) X7849 1 aceB Malate synthase Reinscheid, D. et al. "Malate synthase from Corynebacterium glutamicum pta-ack operon encoding phosphotransacetylase: sequence analysis," Microbiology, 140:3099-3108 (1994) X80629 16S rDNA 16S ribosomal RN"A Rainey, F.A. et al.. "Phylogenetic analysis of the genera Rhodococcus and Norcardia and evidence for the evolutionary origin of the genus Norcardia from within the radiation of Rhodococcus species," Microbial, 141:523-528 X81 191 gluA; gluB; gluC; Glutamate uptake system Kronemeyer, W. et al. "Structure of the gluABCD cluster encoding the gluD glutamate uptake system of Corynebacterium glutamicum," .1 Bacterial., 152-1158 (1995) X81379 dapE Succinyldiaminopimelate desuccinylase Wehrmann, A. et al. "Analysis of different DNA fragments of Corynebacteriumn glutamicumn complementing dapE of Escherichia coli," 40:3349-56 (1994) X8206 1 16S rDNA 1 6S ribosomal RNA Ruimy, R. et al. "Phylogeny of the genus Corynebacterium deduced from analyses of small-subunit ribosomal DNA sequences," Int. J Syst. Bacterial., 45(4):740-746 (1995) X82928 asd; lysG Aspartate-semialdehyde dehydrogenase; Serebrijski, 1. et al. "Multicopy suppression by asd gene and osmotic stressdependent complementation by heterologous proA in proA mutants," J 1 77(24):7255-7260 (1995).

X82929 proA Gamma-giutamyl phosphate reductase Serebrijski, 1. et al. "Multicopy suppression by asd gene and osmotic stressdependent complementation by heterologous proA in proA mutants," j.

1 77(24):7255-7260 (1995) X84257 16S rDNA 16S ribosomial RNA Pascual, C. et al. "Phylogenetic analysis of the genus Corynebacteriun based 16S rRNA gene sequences," Int. J Syst. Bacterial, 45(4):724-728 (1995) X85965 aroP; dapE Aromatic amino acid permease; Wehrmann et al. "Functional analysis of sequences adjacent to dapE of C.

-glutamicun proline reveals the presence of aroP, which encodes the aromatic acid transporter," J Bacterial, 177(20):5991-5993 (1995) 0 0

CA

-4 0 0 h.J 0

U'

2006252111 19 Dec 2006 GenBankm Gene Name Gene Function Reference Accession No.

X86 157 argB; argC; argD); Acetylglutamate kinase; N-acetyl-gamma- Sakanyan, V. et al. "Genes and enzymes of the acetyl cycle of arginine argF; argJ glutamyl-phosphate reductase; biosynthesis in Corynebacterium glutamicum: enzyme evolution in the early acetylomithine aininotransferase; ornithine steps of the arginine pathway," Microbiology 142:99-108 (1996) carbamnoyltransferase; glutamate N- X89084 pta; ackA Phosphate acetyltransferase; acetate kinase Reinscheid, D.J. 6t al. "Cloning, sequence analysis, expression and inactivation of the Corynebacteriumn glutamicumn pta-ack operon encoding phosphotransacetylase and acetate kinase," Microbiology, 145:503-513 (1999) X89850 attB Attachment site Le Marrec, C. et al. "Genetic characterization of site-specific integration functions of phi AAU2 infecting "Arthrobacter aureus C70," J Bacteriol., 1996-2004 (1996) X90356 Promoter fragment FlI Patek, M. et al. "Promoters from Corynebacteriumn glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90357 Promoter fragment F2 Patek, M. et al. "Promoters from Corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, 142:1297-1309 (1996) X90358 Promoter fragment F 10 Patek, M. et al. "Promoters from Corynebacterium. glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90359 Promoter fragment F 13 Patek, M. et al. "Promoters from Corynebacterium glutamnicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90360 Promoter fragment F22 Patek, M. et al. "Promoters from Corynebacteriumn glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90361 Promoter fragment F34 Patek, M. et al. "Promoters from Corynebacteriumn glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90362 Promoter fragment F37 Patek, M. et al. "Promoters from C. glutamnicum: cloning, molecular analysis search for a consensus motif," Microbiology, 142:1297-1309 (1996) 2006252111 19 Dec 2006 GenBankT" Gene Name Gene Function Reference Accession No.

X90363 Promoter fragment F45 Patek, M. et al. "Promoters from Corynebacteriumn glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90364 Promoter fragment F64 Patek, M. et al. "Promoters from Corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90365 Promoter fragment F75 Patek, M. et al. "Promoters from Corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90366 Promoter fragment PFI 01 Patek, M. et al. "Promoters from Corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X90367 Promoter fragment PF 104 Patek, M. et al. "Promoters from Corynebacteriumn glutamicum: cloning, molecular analysis and search for a consensus motif" Microbiology, (1996) X90368 Promoter fragment PF109 Patek, M. et al. "Promoters from Corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif," Microbiology, (1996) X93513 amt Ammoniumn transport system Siewe, R.M. et al. "Functional and genetic characterization of the (methyl) ammonium uptake carrier of Corynebacterium glutamicum," J. Biol. Chem., 1(1 0):5398-5403 (1996) X935 14 betP Glycine betaine transport system Peter, H. et al. "Isolation, characterization, and expression of the Corynebacterium glutamicumn betP gene, encoding the transport system for the solute glycine betaine," J Bacteriol., 178(17):5229-5234 (1996) X95649 orf4 Patek, M. et al. "Identification and transcriptional analysis of the dapB-ORF2dapA-ORF4 operon of Corynebacterium glutamicum, encoding two enzymes in L-lysine synthesis," Biotechnol. Lett., 19:1113-1117 (1997) X(96471 lysE; lysG Lysine exporter protein; Lysine export Vrljic, M. et al. "A new type of transporter with a new type of cellular regulator protein func tion: L-lysine export from Corynebacterium glutamicum," Mol.

22(5j:815-826 (1996) X(96580 panB; panG; xylB 3-methyl-2-oxobutanoate Sahm, H. et al. "D-pantothenate synthesis in Corynebacterium glutamnicumn and _______________hydroxymethyltransferase; pantoate-beta- use of panBC and genes encoding L-valine synthesis for D-pantothenate0 2006252111 19 Dec 2006 ligase; xylulokinase overproduction,?AppI. Environ. Microbial., 65(5): 1973-1979 (1999) GenBank~m Gene Name Gene Function Reference Accession X96962 Insertion sequence IS 1207 and transposase X99289 Elongation factor P Ranmos, A. et al. "Cloning, sequencing and expression of the gene encoding elongation factor P in the amino-acid producer Brevibacteriuni lactofermentum ____________(Corynebacteriumn glutamicumn ATCC 13869)," Gene, 198:217-222 (1997) Y00140 thrB Homoserine kinase Mateos, L.M. et al. "Nucleotide sequence of the homoserine kinase (thrB) gene the Brevibacteriwn. lactofermentum," Nucleic Acids Res., 15(9):3922 (1987) YOO 151 ddh Meso-diaminopimelate D-dehydrogenase Ishino, S. et al. "Nucleotide sequence of the meso-dianiinopimelate D- (EC 1.4.1.16) dehydrogenase gene from Corynebacteriumn glutamicum," Nucleic Acids Res., (1987) Y00476 thrA Homoserine dehydrogenase Mateos, L.M. et al. "Nucleotide sequence of the homoserine dehydrogenase (thrA) gene of the Brevibacterium lactofermentuxn," Nucleic Acids Res., (1987) Y00546 horn; thrB Homoserine dehydrogenase; homoserine kinase Peoples, O.P. et al. "Nucleotide sequence and fine structural analysis of the Corynebacterium glutamicun hom-thrB operon," MaL Microbial., 2(l):63-72 (1988) Y08964 murC; ftsQ/divD; ftsZ UPD-N-acetylmuramate-alanine ligase; Honrubia, M.P. et al. "Identification, characterization, and chromosomal division initiation protein or cell division organization of the ftsZ gene from Brevibacterium tactofermnentum," Mol. Gen cell division protein Genet., 259(l):97-104 (1998) Y09 163 putP High affinity proline transport system Peter, H. et al. "Isolation of the putP gene of Corynebacterium glutamicumproline and characterization of a low-affinity uptake system for solutes," Archi Microbiol., 168(2): 143-151 (1997) Y09548 pyc Pyruvate carboxylase Peters-Wendisch, P.G. et al. "Pyruvate carboxylase from Corynebacteriumn glutamicum: characterization, expression and inactivation of the pyc gene," 144:915-927 (1998) Y09578 leuB 3-isopropylmalate dehydrogenase Patek, M. et al. "Analysis of the leuB gene from Corynebacteriumn Appl Microbial. Biatechnal., 50(l):42-47 (1998) Y12472 Attachment site bacteriophage Phi- 16 Moreau, S. et al.'"Site-specific integration of corynephage Phi-16: The of an integration vector," Microbial., 145:539-548 (1999) Y12537 proP Proline/ectoine uptake system protein Peter, H. et al. "Corynebacterium glutamicum is equipped with four secondary carriers for compatible solutes: Identification, sequencing, and characterization of the proline/ectoine uptake system, ProP, and the ectoine/proline/glycine carrier, EctP," J Bacterial., 180(22):6005-6012 (1998) 2006252111 19 Dec 2006 GenBankT1 Gene Name Gene Function Reference Accession No.

Y13221 g~nA Glutaniine synthetase I Jakoby, M. et al. "Isolation of Corynebacterium glutamicum glnA gene glutamine synthetase FEMS Microbial Let., 154(l):81-88 (1997) Y 16642 lpd Dihydrolipoamide dehydrogenase Y18059 Attachment site Corynephage 304L Moreau, S. et al. "Analysis of the integration functions of φ304L: An module among corynephages," Virology, 255(l):15O-159 (1999) Z21501 argS; lysA Arginyl-tRNA synthetase; diaminopimelate Oguiza, J.A. et al. "A gene encoding arginyl-tRNA synthetase is located in the decarboxylase (partial) upstream region of the lysA gene in Brevibacterium lactofermentum: Regulation of argS-lysA cluster expression by arginine," J Bacterial., 1 75(22):73 56-7362 (1993) Z21502 dapA; dapB Dihydrodipicolinate synthase; Pisabarro, A. et al. "A cluster of three genes (dapA, orf2, and dapB) of dihydrodipicolinate reductase Brevibacterium lactofermentumn encodes dihydrodipicolinate reductase, and a third polypeptide of unknown function," J Bacterial., 175(9):2743-2749 Z29563 thrC Threonine synthase Malumbres, M. et al. "Analysis and expression of the thrC gene of the encoded synthase," App. Environ~ Microbil.., 60(7)2209-2219 (1994) Z46753 16S rDNA Gene for 16S ribosomnal RNA Z49822 sigA SigA sigma factor Oguiza, J.A. et al "Multiple sigma factor genes in Brevibacterium lactofermentum: Characterization of sigA and sigB," J. Bacteria!., 1 78(2):550.

553 (1996) Z49823 galE; dtxR Catalytic activity UTDP-galactose 4- Oguiza, J.A. et al "The galE gene encoding the UDP-galactose 4-epimerase of epimerase; diphtheria toxin regulatory Brevibacterium lactofermenturn is coupled transcriptionally to the dmdR gene," Gene, 177:103-107 (1996) Z49824 orfi; sigB SigB sigma factor Oguiza, J.A. et al "Multiple sigma factor genes in Brevibacterium lactofermentumn: Characterization of sigA and sigB," J Bacteria!., 1 78(2):550- (1996) Z66534 Transposase Correia, A. et al. "Cloning and characterization of an IS-like element present in the genome of Brevibacterium lactofermentumn ATCC 13869," Gene, (1996) 'A sequence for this gene was published in the indicated reference. However, the sequence obtained by the inventors of the present application is significantly longer than the published version. It is believed that the published version relied on an incorrect start codon, and thus represents only a fragment of the actual coding region.

WO 01/66573 WO 0166573PCTIBOOIO2O35 TABLE 3: Corynebacterium and Brevibacterium Strains Which May be Used in the Practice of the Invention Genus pecie ATCC FERM RN CC CIMB CS NCTC DSMZ, Brevibacterium ammoniagenes 21054 Brevibacterium ammoniagenes 19350 Brevibacterium animoniagenes 19351 Brevibacterium ammoniagenes 19352 Brevibacterium amnioniagenes 19353 Brevibacterium ammoniagenes. 19354 Brevibacterium ammoniagenes 19355 Brevibacterium ammoniagenes 19356 Brevibacterium ammoniagenes 21055 Brevibacterium ammoniagenes 21077 Brevibacterium ammoniagenes 21553 Brevibacterium ammoniagenes 21580 Brevibacterium ammoniagenes 39101 Brevibacterium butanicum 21196 Brevibacterium divaricatum 21792 P928 Brevibacteriuni flavum 21474 Brevibacterium flavum 21129 Brevibacterium flavum 21518 Brevibacterium flavum B 1474 Brevibacteriuni flavum B 1472 Brevibacterium flavum 21127 Brevibacterium flavum 21128 Brevibacterium flavum 21427 Brevibacterium flavum 21475 Brevibacterium flavum 21517 Brevibacterium flavum 21528 Brevibacterium flavum 21529 Brevibacterium flavum B 1477 Brevibacterium flavum ____B11478 Brevibacterium flavum 21127 Brevibacterium flavum B 1474 Brevibacterium healii 15527 Brevibacterium ketoglutamicum 21004 Brevibacterium ketoglutamicum 21089 Brevibacterium ketosoreductum 21914 Brevibacterium lactofermentum Brevibacterium lactofermentum 74 Brevibacterium lactofermentum 77 Brevibacterium lactofermentum 21798 Brevibacterium lactofermentum 21799 Brevibacterium lactofermentum 21800 Brevibacterium lactofermentum 21801 Brevibacterium lactofermentum B 1470 Brevibacterium lactofermentum IB 11471 WO 01/66573 WO 0166573PCTIBOOIO2035 Genus species ATCC FERM NRRL. CECT NCXMB CBS. NCTC DSMZ Brevibacterium lactofermentumn 21086 Brevibacterium lactofermentumn 21420 Brevibacterium lactofermentum 21086 Brevibacterium lactofermentumn 31269 Brevibacterium linens 9174 Brevibacterium linens 19391 Brevibacterium linens 8377 Brevibacterium paraffmnolyticum Brevibacterium spec. Brevibacterium spec. ___717.73 Brevibacterium spec. 14604 Brevibacterium spec. 21860 Brevibacterium spec. 21864 Brevibacterium Spec. 21865 Brevibacterium spec. '21866 E~revibacterium spec. 19240 Corynebacterium acetoacidophilum 21476 Corynebacterium acetoacidophilum 13870 Corynebacterium acetoglutamicum Bi 11473 Corynebacterium acetoglutamicum B1 1475 Corynebacterium acetoglutamicum 15806 Corynebacterium acetoglutamicum 2.1491 Corynebacterium acetoglutamicum 31270 Corynebacterium acetophilum B3671 Corynebacterium amnioniagenes 6872 ____2399 Corynebacterium ammoniagenes 15511 Corynebacteriun fujiokense 21496 Corynebacterium glutamicumn 14067 Corynebacterium glutamnicumn 39137 Corynebacterium glutaniicumn 21254 Corynebacterium glutamicum 21255 Corynebacterium glutamicumn 31830 Corynebacterium glutamicumn 13032 Corynebacterium glutamicumn 14305 Corynebacterium glutamicumn 15455 Corynebacterium glutamicum 13058 Corynebacterium glutamnicumn 13059 Corynebacterium glutamnicum 13060 Corynebacterium glutamicumn 21492 Corynebacterium glutamicum 21513 Corynebacterium glutamicum 21526 Corynebacterium glutamicumn 21543 Corynebacterium glutamicum 13287 Corynebacterium glutamicum 21851 Corynebacterium glutamnicumn 21253 Corynebacterium glutamicum 21514 Corynebacterium glutamicum 21516 lCorynebacterium ghitamic1m21299 WO 01/66573 WO 0166573PCT/IBOO/02035 Genus, spjc es: ATCC FERM NRRL CECT NCIB CB~S Ncrc DSMZ Corynebacterium glutamicum 21300 Corynebacterium glutamicum 39684 Corynebacterium glutamicum 21488 Corynebacterium glutainicum 21649 Corynebacterium glutamicum 21650 Corynebacterium glutamicum 19223 Corynebacterium glutaniicum 13869 Corynebacterium glutamicum 21157 Corynebacterium glutaniicum 21158 Corynebacterium glutamicum 21159 Corynebacterium glutamicum 21355 Corynebacterium glutamicum 31808 Corynebacterium glutamicum 21674 Corynebacterium glutamicum 21562 Corynebacterium glutamnicum 21563 Corynebacterium glutamicum 21564 Corynebacterium glutaniicum 21565 Corynebacterium glutarnicum. 21566 Corynebacterium glutamicum 21567 Corynebacterium glutamicum 21568 Corynebacterium glutainicum 21569 Corynebacterium glutainicum 21570 Corynebacterium glutamicum 21571 Corynebacterium glutamnicum 21572 Corynebacterium glutamicum 21573 Corynebacterium glutamicum 21579 Corynebacterium glutamicum 19049 Corynebacterium glutamicum 19050 Corynebacterium glutamicum 19051 Corynebacterium glutamicum 19052 Corynebacterium glutamicum 19053 Corynebacterium glutamicum 19054 Corynebacterium glutamicum 19055 Corynebacterium glutamicum 19056 Corynebacterium glutainicum 19057 Corynebacterium glutamicum 19058 Corynebacterium glutamicum 19059 Corynebacterium glutamicum 19060 Corynebacterium glutamicum 19185 Corynebacterium glutamicum 13286 Corynebacterium glutamicum 21515 Corynebacterium glutamicum 21527 Corynebacterium glutamicum 21544 Corynebacterium glutamicum 21492 Corynebacterium glutamicum 183 Caiynebacterium glutamicum _B8 182 Corynebacterium glutamicum 12416 Corynebacterium glutamicum B12417 WO 01/66573 WO 1/6573PCT/11BOO/02035 Genus.-. species ATCC FERM NR1RL CEC NCJMB CBS NCTC DSMZ Other ____origin' Corynebacterium glutamicum B 12418 Corynebacterium glutamicum BI 11476 Corynebacterium glutamicum 21608 Corynebacterium lilium P973 Corynebacteriurn nitrilophilus 21419 11594 Corynebacterium spec. P4445 Corynebacterium spec. P4446 Corynebacterium spec. 31088 Corynebacteriumn spec. 31089 Corynebacterium, spec. 31090 Corynebacterium spec. 31090 Corynebacterium. spec. 31090 Corynebacterium spec. 15954 _____20145 Corynebacterium. spec. 21857 Corynebacterium spec. 21862 Corynebacterium spec. 21863 Coryncbacterium Glutamicumn* AS0 19 Corynebacteriurn Glutamicum** AS019 ____E12 Corynebacterium Glutamicumn*** HL457 Coryebacterium IGlutamicum** HL4591 ATCC: American Type Culture Collection, Rockville, MD, USA FERM: Fermentation Research Institute, Chiba, Japan NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL, USA CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK CBS: Centraalbureau voor Schimmelcultures, Baam, NL NCTC: National Collection of Type Cultures, London, UK DSMZ: Deutsche Sammlung von Mikroorganismen und Zelikulturen, Braunschweig, Germany For reference see Sugawara, H. et al. (1993) World directory of collections of cultures of microorganisms: Bacteria, fungi and yeasts 4 th edn), World federation for culture collections world data center on microorganisms, Saimata, Japen.

Spontaneous rifampin-resistant mutant of C glutamcum ATCCi3O59dYoshihamaet al., 1985 **Restriction-deficient variant of AS019 Fallettie etal, 1993 '~~metC-disrupted mutant of AS0i9EI2 This study neIC-disrupted mutant of ASO19EI2 Ti ld This study 2006252111 19 Dec 2006 TABLE 4: ALIGNMENT RESULTS Lenaqth Accession Name of Genbank Hit ID lenii1t Genbank Hit Mr ,xa0O657 906 GBBA1:AF064700 metE 1314 GBBA2ZM1VO16 metc 978 Gl3BA2:C0RCSLYS =r00023 3579 GBEST33Al776129 Source of (3enbank Hit 3481 53662 2821 483 483 AF0647D0 RllodococOJs sp. N01-A CprS and CprR genes. complete ods. Rhodococajs sp AL021 841 Mycobactedum tuberculosis H37Rv complete genomne; segment 143/162. Mycobactedum tuberculosis M89931 Corynebactedum glutamicum beta C-S lyase (aecD) and branched-chain amio acid uptaorynebacterium glutamicum Ai776129 EST257217 tomato resistant, Cornel Lycopersicon esculentum cDNA dlone Lycopersicon esculentum cLER 7133, mnRNA sequence.

A1776129 EST257217 tomato resistant, Comeg Lycopersicon esculentumn cODNA clone Lycopersicon esculentumn cLER17D3, mRNA sequence.

homolo-av

(GAP)

40.265 61.278 99.591 40,956 Date of Deposit 15-Jul-98 23-Jun-9 04-JUN-1 998 29-Jun-99 ncaOOO44 1059 rxaOO0S4 1401 GB-EST33:AI7761 29 EMPA:E11760 GBJ'AT1261 24 GBBA2:ECOIJW89 GBPAT:E16763 GB-HTG2AC007892 6911 E 11760 Base sequence of sucrase gene.

40.956 29-Jun-99 Corynebacteriumn glutamicumn 42,979 6911 176195 2517 134257 126124 U00006 E16763 AC007892 Sequence 4 from patent US 5556776. Unknown.

E. cobi chromosomal region from 89.2 to 92.8 minutes. Escheidia cob gDNA encodling aspartate transferase (MAT). Corynebacterium glutamicumn Drosophila melanogasler chromosome 3 dlone BACR02003 (D797) RPCI-98 Drosophila melanogaster 02.0.3 map 9913-99B3 strain y; on bw sp, -SEQUENCING IN PROGRESS 113 unordered pieces.

Drosophila melanogaster chromosome 3 dlone BACR02003 (D797) RPCI-98 Drosophila melanogaster 02.0.3 map 9913-991B strain y; on bw sp, -SEQUENCING IN PROGRESS~, 113 unordered pieces.

42,979 39,097 95,429 31.111 08-OCT-1 997 (Rel. 52, Created) 07-OCT-1996 17-DEC-1 993 28-ul-99 2-Aug-99 GBHTG2AC007892 134257 AC007892 31,111 2-Aug-99 U~rxaOO072 rxaGOlOS 798 GB BA1:MTVOO2 GB BA1:ECU29581 GBBA2:AE000366 rxaOO1O6 579 GBEST15AA494237 58414 71128 10405 367 ALGO8967 Mycobacterium tuberculosis H37Rv complete genome; segment 1221162. Mycobacterium U29581 Escheridiia coli K-1 2 genonie; approximately 63 to 64 minutes. Escherid'iia col AE000366 Escheicha coli K-12 MG1655 section 256 of 40D of the complete genomne. Escinenchia cob AA494237 ng83fO4.sl NCI_CGAPPrS H-omo sapiens cDNA clone IMAGE:941 407 H-omo sapiens simnilar to SWDYR LACCA P00381 DIHYDROFOLATE REDUCTASE;, mRNA sequence.

AF161327 Corynebacterlum diphtheriae histidine kinase ChrS (chrS) and response Corynebacteri regulator ChrA (chrA) genes, complete ods.

ARD41 189 Sequence 4 from patent US 5811286. Unknown.

AC0071 10 Homo sapiens chromosome 17, done hRPK.472-J 18, complete sequence. Homo sapiens tuberculosis 37,753 35,669 35,669 42,896 17-Jun-98 14-Jan-97 12-Nov-98 20-Aug-97 GBBA2:AF161327 2021 m diphtheriae 40,210 9-Sep-99 41,176 29-Sep-99 36,783 30-MAR-i1999 GB PATAR041 189 GBPR4'AC007110 654 148336 rxaOOllS 1170 GBHTG3:AC008537 170030 AC008537 GBHTG3:AC008537 170030 AC008537 Homo sapiens chromosome 19 done CIT-HSPC_490E21, SEQUENCING Homo sapiens IN PROGRESS 93 unordered pieces.

Homo sapiens chromosome 19 dlone CIT-HSPC_490E21 -SEQUENCING Homo sapiens IN PROGRESS 93 unordered pieces.

40,296 2-Sep-99 40,296 2-Sep-99 2006252111 19 Dec 2006 rxaOtOllB 1284 GBBA2:AF062345 16458 AF062345 TABLE 4: ALIGNMNT RESULTS Caulobacter crescentus Sstl (ssti), S-layer protein subunit (rsaA), ABC Caulobacter crescentus transporter (rsaD), membrane formning unit (rsaE), putative GDP-mannose-4,6- GBPAT:118647 GBG5S13AQ446197 rxaOOl3i 732 GBBA1:MTY2OB 1 GBBAI :SAR7932 GB BA1 :MTY2OB1 1 rxaO132 1557 GBBAI:MTY20B11 GB_1N2:TVU40872 GB-HTG6:ACOI 0706 rxa00145 1059 rxaOOi46 1464 rx&00147 1302 rxa00156 1233 rxaOO166 783 GBBA1:MTCY2B12 GBBAl :PSEPYRBX GB BAI :LLPYRBDNA GB BAt :MTCY2B12 GB BA1:MTCY1 54 GBBAl :MSGY1 54 GBBAI:MTCY2BI2 GBBAI:MSGB937CS GBBA1:PAU81259 GBBA1:SC9B1C GBBA2:AF002133 GBBA1:1J85417 GBHTG3AC008167 GBHTG3ACOO8I67 GB-HTG4:AC010118 dehydratase (IpsA), putative acetyftansferase (lps;B), putative perosamine synthetase (lpsC), putative mannosyltransferase (ipso), putative mannosyltransferase (IpsE), outer membrane protein (rsaF), and putative perosamnine transferase (IpsE) genes, complete cris.

3300 118647 Sequence 6 from patent US 5500353. Unknown.

751 AQ446197 nbxcbOO62Dl 6r CU)GI Rice BAC Library Oryza sativa genomic clone Oryza sativa nbxb0062Dl6r genomic survey sequence.

36330 Z95121 Mycobiacterium tuberculosis H37Rv complete genome; segment 139/162. Mycobacterium tuberculosis 15176 AJO07932 Streptomyces argillaceus mithramycin biosynthetic genes. Srpoye rilcu 36330 Z95121 Mycobacterium tuberculosis H37Rv complete genome; segment 139/162. Mycobecterium tuberculosis 36330 Z95121 Mycobacterium tuberculosis H37Rv complete genome; segment 139/162. Mycobacteium tuberculosis 1882 U40872 Trichomonas vaginalis S-adenosyl-L-homocysteine hydriilase gene, complete Tricliomonas vaginalis cds..

169265 AC010706 Drosophila melanogaster chromosome X clone BACR36015 (13887) RPCI-98 Drosophila melanogaster 36.D.15 map 13C-13E strain y; cn bw sp, SEQUENCING IN PROGRESS 74 unordered pieces.

20431 Z81011 Mycobectenlum tuberculosis H37Rv complete genome; segment 61/162. Mycobacterium tuberculosis 2273 Li19649 Pseudomonas aeruginosa aspartate transcarbamnoytase (jpyrB) and Pseudomonas aeruginosa dlhydroorotase-4ike (pyrX) genes, complete cds's.

1468 X84262 L.lelchmannfl pyrS gene. Lactobacillus lelchmannil 20431 Z81011I Mycobacterium tuberculosis H37Rv complete genome; segment 61/162. Mycobacterium tuberculosis 13935 Z98209 Mycobacterium tuberculosis H37Rv complete genome; segment 121/162. Mycobacterium tuberculosis 40221 AD000002 Mycobacterium tuberculosis sequence from clone yl 54. Mycobacterium tuberculosis 20431 Z81011 Mycobacterium tuberculosis H37Rv complete genome; segment 61/1 62. Mycobacterium tuberculosis 38914 L78820 Mycobacterium leprae cosmnid B937 DNA sequence. Mycobacterium Ieprae 7285 U81 259 Pseudomonas aeruginosa dihydrodipicolinate reductase (dapB) gene, partial Pseudomonas aeruginosa cds, carbamoylphosptiate synthetase small subunit (carA) and carbamoylphosphate synthetase large subunit (carB) genes, complete cds, and FtsJ hcmolog (ftsJ) gene, partial eds.

33320 AL009204 Streptomyces coelicolor cosmid 9B1 0. Streptomyces coelicolor 15437 AF002133 Mycobacterium aviurn strain GIRlO transciptional regulator (may81) gene, Mycobacterium avium partial cds, aconitase (acn), invasin 1 (invi), invasin 2 (inv2), transcriptional regulator (moxR), ketoacyl-reductase (fabG), enoyl-feductase (inhA) and ferrochelatase (mav272) genes, complete cds.

7984 D85417 Propionibacterium freudenrechil hemY, hemnH, hemB, hemX, hemR and heml- Propionibacterium genes, complete cds. freudereichif 174223 AC008167 Homo sapiens clone NH0172013, SEQUENCING IN PROGRESS Homo sapiens unordered pieces.

174223 AC008167 Homo sapiens clone NH0172013, -SEQUENCING IN PROGRESS Homo sapiens unordered pieces.

80605 AC01 0118 Drosophda melaniogaster chromosome 3L162B1 clone RPC198-1 001 5, Drosophila melanogaster SEQUENCING IN PROGRESS 51 unordered pieces.

43,571 41,116 39,726 36,78B 61,914 51,325 22-Nov-99 36,235 19-OCT-1999 36,821 07-OCT-1996 38,124 6-Apr-99 1 7-Jun-98 1 5-Jun-99 17-Junt-98 17-Jun-98 31-OCT-1996 63,365 56,080 47,514 60,714 39,229 36,618 61,527 59,538 55,395 18-un-98 26-Jul-93 29-Apr-97 18-Jun-98 17-Jun-98 03-DEC-i 996 18-Jun-98 15-Jun-96 23-DEC-1996 52,666 10-Feb-99 54,191 26-MAR-1998 48,667 37,451 6-Feb-99 21-Aug-99 37,451 21-Aug-99 38,627 1 6-OCT-1999 2006252111 19 Dec 2006 rxaOO1S8 672 GBBA1 A=04708 GB-BAI:ABO24708 GBEST24A1232702 rxa00216 1113 GBHTG2:HSDJ850E9 GBHTG2:HSDJ85OE9 GBPR2:CNSOIDSA 8734 8734 528 117353 117353 159400 AB024708 AB024708 A1232702 AL121758 AL121758 AL121766 rxaOO219 1065 rxa00223 1212 GBHTG2:ACOO5O79_0 GB-HTG2AC005079-1 GB-HTG2:AC005079_I GBBAI:PPEA3NIF GBBA2:AFI 28444 GB-HTG4ACO1O111 rxa00229 803 GBBA2:AF124518 GBPR3:AC004593 GB _l-TG2AC006907 rxaG0241 1626 GBBA1:CGLYSI G~j-ITG1 :PFMAL1 3P1 GBHTG1:PFMAL13P1 rxa00262 1197 GBJN2:EHU89655 GB_1N2:EHU89655 rxa00266 531 GB-ROAF016I9O EMPAT:E0971 9 110000 AC005079 110000 AC005079 110000 AC005079 19771 X99694 2477 AF128444 138938 AC010111 1758 AF124518 150221 AC0D4593 188972 ACOD6907 4232 X60312 192581 AL049180 192581 AL049180 3219 U89655 3219 U89655 2939 AF016190 3505 E09719 TABLE 4: ALIGNMENT RESULTS Corynebacterium giutarnicum gitB and gitl) genes for giutamnine 2-oxoglutarate Coryriebacterium glutamicumn aminotransferase large and small subunits, complete eds.

Corynebacterumn glutamicum gltB and ghlD genes for glutamine 2-axoglutarate Corynebacterumn glut anicumn aminotransferase large and small subunits, complete cds.

EST229390 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone Rattus sp.

3Tend, mRNA sequence.

Homo sapiens chromosome 20 clone RPS-850E9, SEQUENCING IN Homo sapiens PROGRESS in unordered pieces.

Homo sapiens chromosome 20 clone RP5-850E9, -SEQUENCING IN Homo sapiens PROGRESS in unordered pieces.

Human chromosome 14 DNA sequence -IN PROGRtSS BAC R-4112-18 Homo sapiens of RPCI-1 1 library from chromosome 14 of Homo sapiens (Human), complete sequence.

Homo sapiens clone RG252P22, -SEQUENCING IN PROGRESS .3 Homo sapiens unordered pieces.

Homo sapiens clone RG252P22, -SEQUENCING IN PROGRESS Homo sapiens unordered pieces.

Homo sapiens clone RG252P22, -SEQUENCING IN PROGRESS 3 Homo sapiens unordered pieces.

Plasmidd pEA3 nitrogen fixation genes. Enterobacter agglomerans Rhodobacter capsulatus molybdenum cofactor biosynthetic gene cluster, Rhodobacter capsulatus partial sequence.

Drosophila metanogaster chromosome 31J7OC1 dlone RPCI9S-9B18, Drosophila melanogaster SEQUENCING IN PROGRESS 84 unordered pieces.

Corynebacterium giutamicum 3-dehydroquinaso (aroD) and shikimate Corynebacterium glutanicum dehydrogenase (aroE) genes, complete cds.

Homo sapiens. PAC done DJ0964C1 1 from 7p14-plS5, complete sequence. Homno sapiens Caenorhabditls elegans clone Y76B 12. -SEQUENCING IN PROGRESS ,Caenorhabdltis elegans unordered pieces.

C.glutamicum lysi gene for L-lysina permease. Corynebactenumr glutaniicumn Plasmodiumn falciparurn chromosome 13 strain 3D37, SEQUENCING IN Plasmodium falciparum PROGRESS in unordered pieces.

Plasmodlum falciparum chromosome 13 strain 3137, SEQUENCING IN Plasmodium falciparum PROGRESS In unordered pieces.

Entamoeba histolytca unconventional myosin lB mRNA, complete cds. Entamoeba histotytica Entamoeba histolytica unconventional myosin lB mRNA, complete cds. Entamoeba histolytica Mus musculus connexin-36 (Cx36) gene, complete cds. Mus musa~Itus DNA encoding precursor protein of alkaline cellulase. Bacillus sp.

92,113 93.702 34,221 37,965 37.965 38,79B 38.227 22-Nov-98 38,227 22-Nov-98 38,227 22-Nov-98 48,828 2-Aug-96 40,135 22-MAR-1999 39,527 16-OCT.1999 98,237 18-MAY-1999 36,616 18B-Apr-98 37,095 26-Feb-99 1 00,000 30-Jan-92 34,947 1 1-Aug-99 34,947 11 -Aug-99 36,498 23-MAY-1997 37,544 23-MAY-1997 41,858 9-Feb-99 34,741 08-OCT-1997 (Rel. 52.

Created) 34,741 29-Sep-97 36,943 8-Jan-98 '13-MAR-1999 1 3-MAR-i1999 31-Jan-99 03-DEC-1999 03-DEC-1999 11I-Nov-99 GB -PAT:E02133 3494 E02133 gDNA encoding alkaline cellulase.

GB-IN1 :CELKO5F6 36912 AF040653 Caenorhabdilis elegans cosmid K05176.

Bacillus sp.

Caenorhabditis etegans rxa00278 1155 2006252111 19 Dec 2006 rxa00295 1125 rxa00323 1461 rxa00324 3258 rxaOO330 1566 rxa00335 1554 GBSAl :CGU43535 GB RO:RNU30789 GBBA2:CGU31281 GB BA1 :BRLBIOBA GBPAT:E03937 GB BA1 :MTCY427 GBBAI:MSGB32CS GB..BA1:MTCY427 GB B.A1 :MSGB32CS GBBAl :MTCY427

GBOM:BOVELA

GB-BAl :CGTHRC GBPAT:109078 GBBA1:BLTHRESYN

GBBAI:CGGLNA

GBBA2:AF005635 3510 1614 1647 1005 38110 36404 38110 36404 38110 3242 3120 3146 1892 3686 1690 U30789 U31281 D14084 E03937 Z70692 178818 Z70692 L78818 Z70692 J02717 X56037 Rattus norvegicus clone N27 mRNA.

Corynebacterium glutamicum blotin synthase (bioB) gene, complete cds.

Brevibacteriumn flavumn gene for biotin synthetase, complete ods.

DNA sequence encoding Brevibacterium flavumn biotin-synthase.

Mycobacterium tuberculosis H37Rv complete genome; segment 991162.

Mycobacterium leprae cosmid B32 DNA sequence.

Mycobacterium tuberculosis H37Rv complete genome; spgment 99/162.

Mycobacterium leprae cosmid 832 DNA sequence.

Mycobacteriumn tuberculosis H37Rv complete genome; segment 99/162.

Bovine elastin a mRNA, complete cds.

Corynebacterium glutamnicumn thrC gene for threonlne synthase (EC 4.2.99.2).

TABLE 4: ALIGNMENT RESULTS 2531 U43535 -Corynebacteriumn glutamicum multidrug resistance prtein (cmr) gene, complete cds.

Corynebacteium glutamicum 36,658 Rattus norvegicus 38,190 Corynebacteriumn glutamicumn 99.111 Corynebactenumr glutamicumn 98.489 Corynebacterium glutamicumn 98,207 Mycobacterium tuberculosis 35,615 Mycobacterium leprae 60,917 Mycobacterium tuberculosis 44,606 Mycobactenumn leprae 52,516 Mycobacterium tuberculosis 38,079 Bos taurus 39,351 Corynebacteriumn glutarpicum 99,808 9-Apr-97 20-Aug-96 21-Nov-96 3-Feb-99 29-Sep-97 24-Jun--99 15-Jun-96 24-Jun-99 15-Jun-96 24-Jun-99 27-Apr-93 17-Jun-97 109078 Z29563 Y13221 AFOD5635 Sequence 4 from Patent WO 6809819. Unknown.

Brevibacteriumn lactofermnentum; ATCC 13869;; DNA (genomic);. Corynebacteium glutamicum Corynebacterium glutamicum gInA gene. Corynebactenium glutamicumn Corynebacterium glutamicum glutamine synthetase (gInA) gene, complete ods. Corynebacterium glutamicum 99,617 99,170 100,000 98,906 66,345 34,510 02-DEC-1 994 20-Sep-95 28-Aug-97 14-Jun-99 15-Jun-96 09-MAR-i1999 0 GBBA1:MSGB27CS t00347 891 GBEST27:A1455217 GB_8A2:SSU30252 GB-EST21 :AA91 1262 00351 1578 GB-BA1:MLU15187 GB_1N2:AC004373 GB-IN2:AF145653 38793 L78817 Mycobacterlumn leprae cosmid B27 DNA sequence. Mycobacterium leprae 624 A1455217 UJD21828.3prime LD Drosophila nielanogaster embryo pOT2 Drosophila Drosophila melanogaster melanogaster cDNA clone 1021828 3prime, mRNA sequence.

2891 U30252 Synechococcus PCC7942 nucleoside diphosphate kinase and ORF2 protein Synechococcus PCC7942 genes, complete cds, ORFI protein gene, partial cds, and neutral site I for vector use.

581 AA91 1262 oe75a02.sl NClOGAP_1u5 Homo sapiens cONA clone IMAGE:1417418 3' Homo sapiens similar to gb:Al 8757 UROKINASE PLASMINOGEN ACTIVATOR SURFACE RECEPTOR, GPI-ANCHORED (HUMAN);, mRNA sequence.

36138 U15187 Mycobactedriu leprae cosmid 1296. Mycobacterium leprae 72722 AC004373 Drosophila melanogaster DNA sequence (P1 DS05273 (0380)), complete Drosophila melanogaster sequence.

3197 AF145653 Drosophila melanogaster dlone GH08860 BcDNA-GHO886O Drosophila melanogaster (BcDNA.GH08860) mRNA, complete cds.

8734 AB024708 Corynebacterium glutamicum gltB and gitD genes for glutamine 2-oxoglutarate Corynebacteriumn glutamicum aminotransferase large and small subunits, complete ods.

37751 Z113864 Mycobacterium tuberculosis H37Rv complete genome; segment 159/162. Mycobacterium tuberculosis 15901 AL109849 Streptomyces coelicolor cosmid 3A3. Streptomyces coelicolor A3(2) 37,084 29-OCT-i1999 37,500 21-Apr-98 52,972 09-MAR-1995 46,341 17-Jul-98 rxa00365 727 GBSAI AB024708 GB BAl :MTCYIA6 GBBAI:SC3A3 GB-BAI AB024708 GB BA1:MTCYIA6 GB..BA1 :SC3A3 49,471 96.556 39,496 37,946 14-Jun-99 13-MAR-1 999 17-Jun-98 16-Aug-99 13-MAR-1999 17-Jun-98 18-Aug-99 W rxa00366 480 8734 AB024708 Corynebacterium glutamicumn gltB and gItD genes for glutamine 2-axoglutarate Corynebacteriumn glutamicum 99,374 aminotransferase large and small subunits, complete eds.

37751 Z83864 Mycobacterium tuberculosis H37Rv complete genome;.segment 159/162. Mycobacterium tuberculosis 41,333 15901 AL109849 Streptomyces coelicolor cosmid 3A3. Streptomyces coelicolor A3(2) 37,554 2006252111 19 Dec 2006 rxa00367 4853 GBBAl A8024708 GB BA1:MTCY1A6 GB7BAI:SC3A3 TABLE 4: ALIGNMENT RE~SULTS 8734 AB024708 Corynebacterlum glulamicumn gliB and g~tD genes for glutamnine 2oxoglutarate aminotransferase large and small subunits, complete cds.

37751 Z83864 Mycobacterium tuberculosis H37Rv complete genome; segment 1591162.

15901 AL1 09849 Streptomyces coelicolor cosmid 3A3.

Corynebacterlum glulamicumn 99,312 Mycobactedum tuberculosis 36,971 Streptomyces coeflcolorA3(2) 37,905 134vMAR-1999 17-Juni-96 16-Aug-99 12-Jun-93 24-Aug-99 rxa0O37l 1917 GB VI:SBVORFS GB-EST37A9675 GB IN1 :CELKO9H9 rxa00377 1245 GB7BAl=0U13664 GBPLI ANSOGENE GB-GSS4AQ730303 rxaOO382 1425 GB BAI :PAH-EML GB BAI:MTY25DIO OB BAl :MSGY224 rxaOO3B3 1467 GB_-BAI:vILCB1222 GBHTG2ACOOO269 GB-HTG2:AC007638 rxaOO39l 843 GB-EST38AW017053 GBPAT-AR065862 GBVLAF148805 =x00393 1017 GB BA1 :TY251O GBBA1 :MSGY224 GBBA1 MLB1306 =x00402 623 GB,.BA2:AF052652 GB BA2:AF109162 GBBA2:AF09291 8 rxeOD4O3 1254 GB-BA2.AF052652 GB BAI MTV0lO GBEST23:A1 111288 7588 M89923 Sugarcane baclliform virus ORF 1 ,2,and 3 DNA, complete cds. Sugarcane bacilliform virus 35,643 380 A1967505 Lfimpesto3-21 5-c1 Luimp Lambda HybriZap two-libd library Lotus japonicus Lotus japonicus 42,593 cDNA dIone LP215-03-clO 5 similar to 60S ribosomal protein L39, mRNA sequence.

37881 AF043700 Caenorfiabditis elegans cosmid K09H9. Caenorhabditis elegans 34,295 1678 U13664 Caulobacter crescentus uroporphyrinogen decarboxylase homolog (homE) Caulobacter crescentus 36,832 gene, partial cds.

1299 Y08866 A"ndulans sD gene. Emericela nidulans 39,603 483 AQ730303 HS5505_B1C04T7A RPCI-1 1 Human Male BAC Uibrary Homo sapiens Homo sapiens 36,728 genomnic clone Plate=1081 Col=7 Row--F, genonic survey sequence.

44-44 X82072 P.aeruginosa hemL gene. Pseudomonas aeruginosa 54,175 40838 Z95558 Mycobacterium tuberculosis H37Rv complete genome; segment 28/162. Mycobacteriumn tuberculosis 61,143 40051 AD000004 Mycobedterium tuberculosis sequence from cdone y224. Mycobecterium tuberculosis 61,143 34714 AL049491 Mycpbacteriumn leprae cosmid B1222. Mycobacterium leprae 43,9811 167171 AC006269 Homo sapiens chromosome 17 clone hRPK.515_E__23 map 17, -Homo sapiens 35,444 SEQUENCING IN PROGRESS 2 rirdered pisces..

178053 AC007638 Homo sapiens chromosome 17 clone hRPK.515_-0_-17 map 17, -Homo sapiens 34,821 SEQUENCING IN PROGRESS 8 unordered pieces.

613 AW017053 EST272398 Schistosoma mansoni male, Phil LoVerde/Joe Merrick Schistosoma mansoni 40,472 Schistosoma mansoni cONA clone SMMAS14 5' end, mRNA sequence.

32207 AR065852 Sequence 20 from patent US 5849564. Unknown. 38,56 28559 AF148805 Kaposi's sarcoma-associated herpesvlrus ORF 68 gene, partial cds; and ORF Kaposrs sarcoma-associated 38,509 69, kaposiri, v-FLIP, v-cyclln, latent nuclear antigen, ORF K14, v-GPCR, herpesvlrus putative phosphoribosyltormylgtycinamldine synthase, and LAMP (LAMP) genes, complete cids.

40838 Z95558 Mycobacteriumn tuberculosis H37Rv complete genome; segment 281162. Mycobacterium tuberculosis 36,308 40051 AD000004 Mycobacterium tuberculosis sequence from clone y224. Mycobacterlum tuberculosis 39,282 7762 Y13803 Mycobacterlumn leprae cosmid B1306 DNA. Mycobacterium Ieprae 39,228 2096 AF052652 Conjnebactprlum glutamlcum homoserine O-acetyltransferase (melA) gene, Corynebacterlum glutamicum 99,672 complete cds.

4514 AF109162 Corynebacteriumn diphttiasiae heme uptake locus, complete sequence. Corynebacterium diphtheriae 40,830 20758 AF092918 Pseudomonas alcaligenes outer membrane Xcp-secretion system gene Pseudomonas alcaligenes 50,161 cluster.

2096 AF052652 Corynebacterium glutamicum homoserine O-acetyltransferase (metA) gene, Corynebacterium glutamicuim 99,920 complete cds.

53862 AL021841 Mycobacterium tuberculosIs H37Rv complete genome; segment 1431162. Mycobacterium tuberculosis 52,898 750 All 11288 SWOvAMCAQO2AO5SK Onchocerca volvulus adult male cDNA (SAW8MLW- Onchocerca volvulus 37,565 OvAM) Onchocerca volvulus cDNA clone SWVOvAMCAQO2AO5 mRNA sequence.

22-Jan-98 24-MAR-1995 17-OCT-1996 15-Jul-99 1 8-DEC-1995 17-Jun-98- 03-DEC-1996 27-Aug-99 10-Jun-99 22-MAY-1999 10-Sep-99 29-Sep-99 2-Aug-99 17-Jun-98 03-DEG-1996 24-Jun-97 19-MAR-1998 8-Jun-99 06-DEC-1998 19-MAR-1998 23-Jun-99 31 -Aug-98 2006252111 19 Dec 2006 rxaOO405 613 rxaOO42O 1587 rxa00435 1296 rxa00437 579 GBBA1:MTVO16 GBPR4:AC005145 GBBAI:MTVOi6 GB BAI:MTYI3Di2 GBBAI:MSGY126 GBBA1:MSGB971CS

GBBAIVAFACBBTZ

GBHTG4:AC009541 GB-HTG4AC0O9541 GBPR4AC005951 GBBA1:SC2A1 1 GB-PR4AC005951 53662 AL021841 143678 AC005145 53662 37085 37164 37566 2760 AL021841 Z80343 AD000012 L78821 M68904 TABLE 4: ALIGNMENT R~ESULTS Mycobacterium tuberculosis H37Rv complete genome;segment 1431162.

Homo sapiens Xp22-166-169 GSHB-523A23 (Genonie Systems Human BAC library) complete sequence. '0 Mycobacterium tuberculosis H37Rv complete genome; segment 1431162.

Mycobacterium tuberculosis H37Rv complete genome; segment 156/162.

Mycobactedriu tuberculosis sequence from clone y1126.

Mycobactelium leprae cosrmd B971 DNA sequence.

Alcaligenes eutrophus chromsomal transketolase (cbbTc) and phosphoglycolate phosphatase (cbbZc) genes, complete cds.

Homo sapiens chromosome 7, SEQUENCING IN PROGRESS ~,25 unordered pieces.

Homo sapiens chromosome 7, 'SEQUENCING IN PROGRESS -,25 unordered pieces.

Homo sapiens chromosome 17, clone hRPK372-K20, complete sequence.

Mycobacleiumn tuberculosis Homo sapiens Mycobactedrn tuberculosis Mycobacterlumn tuberculosis Mycobacteriumn tuberculosis Mycobacteriumn leprae Raistonia eutropha Homo sapiens Homo sapiens Homo sapiens 57,259 23-Jun-99 34.179 08-DEC-1998 40.169 62,031 61,902 39,651 38,677 23-Jun-99 17-Jun-98 ID-DEC-1996 15-Jun-96 27-Jul-94 169583 AC009541 169583 AC009-541 155450 AC005951 36,335 12-OCT-1999 36,335 12-OCT-1999 31,738 18-Nov-98 43,262 5-Aug-98 37.647 1 5-Nov-98 22789 AL031 164 Streptomycos coelicolor cosmld 2A1 1. Streptomyoes coellcolor 155450 AC005951 H-omo sapiens chromosome 17, clone hIRPIK.372K 20, complete sequence. Homo sapiens rxaOOA39 591 GBBA1:MTVOI6 GBPL2:AF167358 GB-HTG3:AC009120 53662 1022 269445 AL021841 AF1 67358 AC0091 20 rxa00440 582 rxaOO44l 1287 GB3BA2:SKZ861 11 GBBAl :SC2EI GBBA1:SC2E1 GB..fR2:HS173Di 7860 Z86111 38962 38962 117338 AL023797 AL023797 AL031984 GB-HTG2-HSDJ719K3 267114 AL109931 GB-FiTG2-HSDJ7I9K3 267114 AL109931 rxa00446 987 GB_-BAl :SCD78 36224 AL034355 GB-HTG4:AC009367 226055 AC009367 GB-HTG4:AC009367 226055 AC009367 Mycobacteriumn tuberculosis H37Rv complete genome; segment 143/162. Mycobacterium tuberculosis Rumex acetosa expensin (EXP3) gene, partial cds. Rumex acetosa Homo sapiens chromosome 16 cdone RPC I-1 1_484E3, SEQUENCING-1N- -Homo sapiens PROGRESS 34 unordered pieces.

Streptomyces llvians rpsP, trmD, rpIS, slpW, slpX, sipY, sipZ, mutT genes Streptomyces livklans and 4 open readfig frames.

Streptomyces coelicolor cosmid 2121. Streptoniyoes coelicolor Streptomyces coelicolor cosmid 2E1. Streptomyoes coelicolor Human DNA sequence from clone 173D1 on chromosome 1p36.2l- Homo sapiens 36.33.Contains ESTs, STSs and GSSs, complete sequence.

Homo sapiens chromosome X dlone RP4-719K3 map q21.1-21.31., Homo sapiens SEQUENCING IN PROGRESS in unordered pieces.

Homo sapiens chromosome X done RP4-71 9K3 map q21 .1-21.31, Homo sapiens SEQUENCING IN PROGRESS in unordered pieces.

Streptomyces coelicolor cosmid D78. Streptomyces coeficolor Drosophila melanogaster chromosome 3Lr76A2 clone RPCI98-48B15, Drosophila melanogaster SEQUENCING IN PROGRESS 44 unordered pieces.

Drosophila melanogaster chromosome 3L176A2 clone RlkI98-48B15, Drosophila melanogaster SEQUENCING IN PROGRESS 44 unordered pieces.: Homo sapiens 12q 13.1 PAC RPCI 1-1 30F5 (Roswell Pa~c Cancer Institute Homo sapiens Human PAC library) complete sequence.

Homo sapiens chromosome 12 clone RPCI-1 130175 map 12q13.1, Homo sapiens SEQUENCING IN PROGRESS 156 unordered pieces.

Homo sapiens chromosome 12 clone RPCI-1 130F5 map 12q13.1, Homo sapiens SEQUENCING IN PROGRESS -,156 unordered pieces.

37,088 46,538 43,276 23-Jun-99 17-Aug-99 3-Aug-09 42,931 36,702 38,027 34,521 34,521 56,41 34,959 35,6832 31,373 31,373 4-Jun-98 4-Jun-98 23-Nov-99 03-DEG-1999 03-DEC-1999 26-Nov-98 16-OCT-1999 16-OCT-1999 9-Jun-98 18-OCT-1997 18-OCT-1 997 43.080 27-OCT-1999 rxa00448 1143 GBPR3:AC003670 GBHTG2-.AF029367 GBHTG2.AF029367 88945 AC003670 148676 AF029367 146676 AF029367 2006252111 19 Dec 2006 424 GBHTG2:AC007824 GB-HTG2AC007824 GB-EST35:AI8I8057 rxa0O461 975 GIBBA1:MLCB1779 GB IN1 :DMC86E4 GB-GSS15:AQ6>40325 133361 133361 412 43254 29352 467 TABLE 4: ALIGNMENT RESULTS AC007824 Drosophila melanogaster chromosome 3 done BACRO2ILIB (0715) RPCI-98 Drosophila mel 02.1_16 map 89E-90A strain y; 01 bw sp, -SEQUENCING IN PROGRESS 91 unordered pieces.

AC007824 Drosophila melanogaster chromosome 3 clone BACR02LI 6 (0715) RPCI-98 Drosophila mel 02.1_16 map 89E-90A strain y; 01 bw sp, ISEQUENCING IN PROGRESS 91 unordered pieces.

A1818057 wkl4aO8.xl NCL-CGAP...Lyml2 Homo sapiens cONA clone IMAGE:2412278 Homo sapiens 3 similar to gb:Y00764 UIBIQUINOL-CYTOCHROME C REDUCTASE 11 KID PROTEIN (HUMAN);, mRNA sequence.

Z98271 Mycobacteriumn leprae cosnud B1 779. Mycobacterluni AL021086 Drosophila melanogaster cosmid clone 86E4. Drosophila mel AQ540325 927P1I-2H3.TP 927P 1 Trypanosoma brucei genomnic dlone 927P1 -2H3, Trypanosoma genomic survey sequence.

anogaster anogaster l eprae anogaster brucei 40,000 2-Aug-99 40,000 2-Aug-99 35,714 24-Aug-99 39,308 37,487 38,116 8-Aug-97 27-Apr-99' 8-Jul-99 rxa00465 rxa(J0487 1692 rxa0O488 1641 rxa00489 1245

GBBAI:BAGUAA

GB BA2:UG0O1 5 GBSAl :MTCY78 GBBA1:MTCY78 GBBA2:U00015 GBBA1:SCAJ1U6O1 GBBA2:UCOO15 GB-HTG2:HS225EI2 GBHTG2:HS225EI2 rxa00533 1155 GBBA1 :CGLYS 3866 Y(10499 B.ammoniagenes guaA gene. Corynebacterium ammoniagenes 42325 U00015 Mycobacterlum leprac cosmid B1620. Mycobacterium leprae 33818 Z77165 Mycobacterlum tuberculosis H37Rv complete genome; segment 145/162. Mycobacterium tuberculosis 33818 Z77165 Mycobacterium tuberculosis H37Rv complete gename; segment 145t162. Mycobacterium tuberculosis 42325 U00015 Mycobacterlum lepr-ae casmldd B1620. Mycobacterium leprae 4692 AJO10601 Streptomyces coeicolor A3(2) DNA for whiD and whiK loci. Streptomyces coelicolor 42325 U00015 Mycobacterium Ieprae cosmidd B1620. Mycobacterlum leprae 126464 AL031772 Homo sapiens chromosome 6 clone RPI-225E1 2 map q24, SEQUENCING Homo sapiens IN PROGRESS in unordered pieces.

126464 AL031772 Homo sapiens chromosome 6 dlone RPI-225E1 2 map q24, SEQUENCING Homo sapiens IN PROGRESS In unordered places.

2803 X57226 C. glutamicum lysO-alpha, lysC-beta and asd genes for aspartokinase-aipha Corynebacteium glutamicum and -beta subunits, and aspartate beta semialdehyde dehydrogenase, respectively (20 2.7.2.4; EC01.2.1.11).- 1591 X82928 Oglutamicum aspartate-semaldehyde dehydrogenase gene. Corynebacterium glutanicum 2112 A07546 Recombinant DNA fragment (PstI-Xhol). synthetic construct 2803 X57226 C. glutamicum lysO-alpha, lysO-beta and asd genes for aspartokinase-apha Corynebacterium glutamicum and -beta subunits, and aspartate beta semialdehyde dehydrogenase, respecively (EC 2.7.2.4; EC 1.2. 1.11).

2957 L16848 Corynebacterium flavumn aspartoidnase (ask), and aspartate-scniialdchyde Corynebacterum flavescens dehydrogenase (asd) genes, complete cds.

1643 E14514 DNA encoding Brevibacterium aspartokinase. Corynebacterium glutarnicumn 3492 X70959 C.glulamlicum gene leuA for Isopropylmalate synthase. Corynebactedrlu glutamicum 121125 AL022121 Mycobacterium tuberculosis H37Rv complete genome; segment 1551162. Mycobacterium tuberculosis 2412 U88526 Mycobacterium tuberculosis putative aipha-isopropyl malate synthase (leuA) Mycobacterumn tuberculosis gene, complete ods.

36,756 03-DEC-1999 74,259 37,248 39,725 39,451 39,178 60,835 38,041 36,756 8-Jan-98 01-MAR-i 994 17-Jun-98 1 7-Jun-98 01-MAR-i1994 17-Sep-98 01-MAR-1994 03-DEC-1999

GB...BAI:CGCYSCASD

GB-PATA07545 GBBA1:CGLYS rxatJO534 1386 99,913 99,221 99,391 99,856 98,701 98,773 100,000 68,003 68,185 17-Feb-97 17-Feb-97 30-Jul-93 17-Feb-97 11 -Jun-93 28-Jul-99 10-Feb-99 24-Jun-99 26-Feb-97 GBBAl :CORASKD GB PAT:E14514 GBBA1:CGLEUA GB .BA1 :MTVO25 GB SAl :MTU88526 rxaWM56 1494 2006252111 19 Dec 2006 TABLE 4: ALIGNMENT RESULTS 41622 ALl 18514 Streptomyces coeicolor cosmid 025. rxa00537 2409 GB-BA2:SCD25 Streptornyces coeilcolorA3(2) 63,187 21-Sep-99 rxaCO54i 792 1470 rxa00579 1983 rxa00580 1425 rxaOO581 1092 rxa00584 1248 rxaOO618 1230 GBBA1:MTCY7H7A GB-BAI MTU34956 GBPAT:192052 GB BAI :MTCY369 GB-BA1 :BAPURF GBBAI:MLU15i82 GBBAl :MTCY7H7A GBPATARO 16483 EM-PAT:E1 1273 GB PAT:E125g4 GBPAT:E12594 GBPAT:AR0i6483 EMPAT:E1 1273 GBPAT:E12594 EMPAT:E11273 GBPAThAR016483 GBBA1:CORAHPS GB BAI AOPCZA361 GBBA1:D90714 GBEST 9:AA802737 GB-EST28AJ534381 GB IN1:DMANILLIN GBBAl :MTCY369 GBPAT:A6O3OS GBPL2:AF063247 GB-BA1 :STMAPP 10451 2462 2115 38109 36850 1 885 40123 10451 2104 2104 2104 2104 2104 2104 Z9561 8 Mycobactenumn tuberculosis H37Rv complete genome: segment 39f162.

U34956 Mycobacteriumn tuberculosis phospharibosylformylglycinamidine synthase (purL-) gene, complete cds.

192052 Sequence 19 from patent US 5726299.

Z95151 Mycobacteriumn leprae cosmid 85.

Z80226 Mycobactedrlu tuberculosis H37Rv complete genome; segment 361162.

X91252 B.ammoniagenes purF gene.

U15182 Z95618 AR01 6483 El11273 E1 2594 E1 2594 AR01 6483 El 1273 Mycobactenumr Ieprae cosmid B2266.

Mycobactenumr tuberculosis H37Rv complete genome; segment 391162.

Sequence 1 from patent US 5776740.

DNA encoding serine hydroxymethyl transferase.

DNA encoding serine hydroxymethyltransferase from Brevibacterium Ilavumn.

DNA encoding serine hydroxymethyltrantsferase from Brevibacterium flavumn.

Sequence 1 from patent US 5776740.

DNA encoding serine hydroxymethyl transferase.

Mycobacterium tuberculosis Mycobacteriumn tuberculosis Unknown.

Mycobacteriumn Ieprae Mycobactedrlu tuberculosis Corynebactedriu ammorliagenes Mycobactenumn Ieprae Mycobactenumn tuberculosis Unknown.

Corynebactedrn glulamicumn Corynebacteriumn glutamicumn Corynebacteriumn glutarnicumn Unknown.

Corynebacteriumn glutamicumn 62,401 62,205 98,359 62,468 60.814 66,095 64,315 64,863 98,810 98.810 98,810 99,368 99,368 99,368 17-Jun-98 28-Jan-97 01-DEC-1 998 24-Jun-,97 17-Jun-98 5-Jun-97 09-MAR-1995 17-Jun-98 05-DEC-1 998 08-OCT-1997 (Rel. 52, Created) 24-Jun-98 24-Jun-98 05-DEC-1998 08-OCT-i 997.

(Rel. 52, Created) 24-Jun-98 08-OCT-1997 (Rel. 52, Created) 05-DEC-1998 26-Apr-93 29-MIAR-1999 7-Feb-99 25-Nov-98 18-MAR-1999 8-Nov-95 17-Jun-98 24-Jun-97 084VLAR-1998 5-Jan-99 2104 El12594 DNA encoding senine hydroxymethyltransfearase from Brevibactedriu flavum. Corynebactarium glulamicum 37,071 2104 El 1273 DNA encoding senine hydroxymethyl transferase. Corynebactedriu glutamicumn 37,071 2104 AR0 16483 Sequence 1 from patent US 5776740.

2570 L07603 Carynebactenium glutamnicumn 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase gene, complete ods.

37941 AJ223998 Arnycolatopsis orientalis cosmid PCZA361.

14358 D90714 Eacherichia coli genomic DNA. (16.8 -17.1 min).

280 AA802737 GM08236.5prime GM Drosophila melanogaster ovary BlueScript Drosophila melanogaster cDNA clone GM06236 5prlme, mRNA sequence.

581 A1534381 SD07186.5prime SD Drosophila melanogaster Schneider 12 cell culture pOT2 Drosophila melanogasler cDNA clone SD07186 5prime similar to X89858: Ant FBgnOOl 1558 PID:g927407 SPTREMBL-Q2424O, mRNA sequence.

Unknown. 37,071 Corynebacterium glutamicumn 98,236 Amycolatopsis orientatis Esctherichia coti Drosophila melanogaster Drosophila melanogaster Drosophila melanogaster Mycobacteriumn tuberculosis Mycobactenumr leprae unidentified Pneumocystis caringi f. sp. ratt 54,553 53,312 39,928 41,136 34,398 62,776 61,831 61,785 41,060 rxat)0819 1551 rxaOO62O 1014 4029 36850 38109 1845 1450 X89868 Z80226 Z95151 A60305 AF063247 D.melanogaster mRNA for anllin protein.

Mycobacterium tuberculosis H37Rv complete genome; segment 361162.

Mycobacteriumn teprae cosmid B5.

Sequence 5 from Patent W09708323.

Pneumocyslis caringi f. sp. ratt enatase mRNA, complete cds.

2069 M91546 Streptomyces tMans arninopeptidase P (PepP) gene, complete cds. Srpoye iias3,2 2Jn9 Streptomyces lividans 37,126 12-Jun-93 2006252111 19 Dec 2006 GBHTG3:AC008763 214575 AC008763 rxa00824 810 GB IN1:CEY41E3 GBEST13:AA362167 GBJN1 :CEY41 E3 rxa00626 1386 GBDAl :MTCY369 GB..BA1:MLU 15187 rxa00632 795 GBBA1:BRLEIOAD 1506411 372 150541 36850 38109 38138 2272 Z95559 AA362167 Z95559 Z80226 Z95151 U15187 D140813 TABLE 4: ALIGNMENT RESULTS Homo sapiens chromosome 19 clone CITB-E1-3214H19, -SEQUENCING Homo sapiens IN PROGRESS 21 unordered pieces.

Caenorhabditls elegans cosmid Y41 E3, complete sequence. Caenorhabditis elegans; EST71561 Macrophage I Homo sapiens cONA F'end, mRNA sequence. Homo sapiens Caenorhabditis elegans cosmid Y41 E3, complete sequence. Caenorhabditis elegans; Mycobactetium tuberculosis H37Rv complete genome: segment 361162. Mycobacterium tuberculosis Mycobacterium ieprae cosmid B5. Mycobacterium leprae Mycobactertum leprae cosmid L296. Mycobacterium leprae Brevibactenium flavum genes for 7,8-diaminopelargonic acid aminotransferase Corynebacterlum glutamicum and dethiobiotin synthetase, complete cds.

DNA sequence coding for desthiobiotinsynthetase. Corynebacteriumn glutamicum DNA sequence coding for diamnino pelargonic acid aminotransferase. Corynebacteriumn glutamicum Brevibacterium flavumn genes for 7,8-diaminopelargonic acid aminotransferase Corynabacterfumn glutamicum and dethiobictin synthetase, complete ods.

40.020 3-Aug-99 36,986 38,378 37,694 57,971 58,8036 38,007 97,358 98,074 93,814 95,690 GB PATE040411 GBPAT:E04040 GB_BA1:BRLBiOAD 675 E04041 1272 E04040 2272 D14083 2-Sep-99 21 -Apr-97 2-Sep-99 1 7-Jun-98 24-Jun-97 09-MAR-1995 3-Feb-99 29-Sep-97 29-Sep-97 3-Feb-99 29-Sep-97 4-Nov-96 17-Jun-98 3-Feb-99 rxa00633 1392 GBPAT:E04040 GBBA2:EHU38519 nca00688 666 GB BA1:MTVO4I GB-BA1 :BRLSECY GBBA2:MBU77912 =xaO708 930 GB BA2:AFI1 57493 GBPAT:100836 GB .PAT:E0031 I rxaOO7l7 1083 GBPAT:178753 GBPAT:192042 GBBAl :MTCI125 rxaOO7l8 831 GB BA1:MTCI125 GBGS312A0420755 rxaD0727 1035 GB-HTG3ACOO8332 GBHTG3:AC008332 GBHTG3AC008332 1272 E04040 DNA sequence coding for diamnino pelargonic acid aminotransferase.

11290 U38519 Eiwinia herbicola adenosylmethionine-8-amlino-7-oxononanoate transaminase (bioA) gene, complete ods.

28826 AL021958 Mycobactenum tuberculosis H37Rv complete genome; segment 351162.

1516 D14162 Brevibacterium flavumn gene for SecY protein (complete cds) and gene or adenylate kinase (partial cds).

7163 U77912 Mycobadeitum bovis MBE50a gene, partial cds: and MBE50b, MBE5Oc, preprotein translocase SecY subunift (secY), adenylate kinase (adk), methionine arninopeptidase (map), RNA polymerase ECIF sigma factor MBE50d, and MBE5Oe genes, complete cds.

25454 AF157493 Zymomonas mobiris ZM4 fosmid done 42D7, complete sequence.

1853 100836 Sequence 1 from Patent US 4758514.

1853 E0031 1 DNA coding of 2,5-diketogluconic acid reductase.

1187 178753 Sequence 9 from patent US 5893781.

1187 192042 Sequence 9 *from patent US 5726299.

37432 Z98268 Mycobaterium tuberculosis H37Rv complete genome; segment 761162.

37432 Z98268 Mycobacterium tuberculosis H37Rv complete genome; segment 781162.

37432 Z98268 Mycobadendum tuberculosis H37Rv complete genome; segment 761162.

671 AQ420755 RPCI-1 1-168G18.TJ RPCI-11 Homo sapiens genomic clone RPCt-l 1- 11681318. genomic survey sequence. 118545 AC008332 Drosophila melanogaster chromosome 2 done BACR48D1O0 (D867) RPCI-98 48.0.10 map 34A-34A strain y; on bw sp, -SEQUENCING IN PROGRESS ,7 78 unordered pieces.

118545 AC008332 Drosophila melanogaster chromosome 2 done BACR48DIO (D867) RPCI-98 48.D.10 map 34A-34A strain y; on bw sp, -SEQUENCING IN PROGRESS-", 78 unordered pieces.

118545 AC008332 Drosophila rnelanogaster chromosome 2 clone BACR48D1O0 (D867) RPCI-98 48.D. 10 map 34A-34A strain y; on bw sp, -SEQUENCING IN PROGRESS-", 78 unordered pieces.

Corynabacterium glutamlcumn 95,755 Erwinia lierbicola 55,564 Mycobacterium tuberculosis 60,030 Corynebacteriumn glutamicum 99,563 Mycobacterlum bovis Zymomonas mobills Unknown.

unidentified Unknown.

Unknown.

Mycobaderium tuberculosis Mycobadertum tuberculosis Mycobactedum tuberculosis Homo sapiens DrosophIla moelanogaster Drosophila melanogaster Drosophila melanogaster 60,030 27-Jan-99 39,116 47,419 47,419 37,814 37,814 50,647 55,228 40,300 35,750 40.634 5-Jul-99 21-MAY-1993 29-Sep-97 3-Apr-98 01-DEC-1998 17-Jun-98 1 7-Jun-98 17-Jun-98 23-MAR-1999 6-Aug-99 40,634 6-Aug-99 33,888 6-Aug-99 2006252111 19 Dec 2006 rxa00766 966 GBHTrG2:AC005789 83823 GBJ-1TG2:AC006789 83823 TABLE 4: ALIGNMENT RESULTS AC006789 Caenortiabditis elegans clone Y49F6, -SEQUENCING IN PROGRESS Caenoriabditis elegans unordered pieces.

AC006789 Caenorhabditls elegans dlone Y49F6. -SEQUENCING IN PROGRESS Caenorhabditis elegans; unordered pieces.

090810 Ecoli genomic DNA, Kohara clone #319(37.4-37.8 Eschenichia coi AL022004 Mycobacteriumn tuberculosis H37Rv complete genome; segment 40/162. Mycobacteiumn tuberculosis U151 82 Myoobactarlumn leprae cosmid B2266. Mycobacterium lepre AL1 18514 Streptomyces coelicolor cosmid D25. Streptomyces coelicolor A3(2) rxa00770 1293 GBBA1:D90810 GBBAI:MTVO43 GBBA1:MLU15182 GBBA2:5CD25 20476 68848 40123 41622 36,737 25-Feb-99 36,737 25-Feb-99 36,526 29-MAY-1997 66,193 24-Jun-99 61,443 09-MAR-i1995 59,938 21-Sep-99 rxa00779 1056 GBHTG1:CERO8A GBHTG1:CERO8AS GB..yL2AF078693 rxa00780 669 GBBAI MTCY98 GBBA1:AVINIFREG Gi3BA2AFOO 1780 rxa0083 1023 GBESTI :30506 GBPL2:AC006258 GBEST37:AI998439 rxa00863 867 GBBAI:BLDAPAB GBPAT:E16749 GB PAT:E14520 rxa00864 873 GBBAl :BLDAPAB 51920 Z82281 Caenorhabditls elegans chromosome V dlone R08A5S. SEQUENCING IN Caenorlhabditis elegans PROGRESS in unordered pieces.

51920 Z82281 Caenorhabditls elegans chromosome V clone R08A6, -SEQUENCING IN Coenorhabditis elegans PROGRESS in unordered pieces.

1492 AF078693 Chfamydomonas reinhardli putative O-acetylseine(thiol~lyase precursor Chlamnydomonas reinhardii (Crcys-1A) m9NA, nuclear gene encoding organellar protein, complete cds.

31225 Z83860 Mycobacterlumn tuberculosis H37Rv complete genome; segment 103/162- Mycobacterium tuberculosis 7099 M60090 Azotobacter chroococcumn rutU, nifS, nifV, nWl, nifW, nifZ and nttM genes, Azotobacter chroococcum complete cds.

6701 AF001780 Cyanothece PCC 8801 N~fP (nifP), nitrogenase (nffB), FdxN (fdxN), NifS (nifS) Cyanothece PCC8BO1 and NifJ (nrd"j genes, complete cds, and Nifi- (nifH) gene, partial cds.

329 Z30506 ATTS2430 AC16H Arabidopsis Ihaliana cDNA clone TAJ306 rnRNA Arabid opsls Ilialiana sequence.

110469 AC006258 Arabidopsis thaliana BAC F18G18 from chromosome V near 60.5 cM, Arabidopsis thaliana complete sequence.

455 A1998439 701545695 A. thafiana, Columbia Col-0, rosette-2 Arabidopsis thaliana cDNA Arabidopsis thaliana clone 701545695, mRNA sequence.

3572 Z21502 B.lactofermentum dapA and dapB genes for dihydrodiplcolinate synthase and Corynebacterium glutamicumn dihydrodipicorinate reductase.

2001 El16749 gDNA encoding dlhydrodipicolinate synthase (DDPS). Corynebacteriuni glutamicumn 2001 E14520 DNA encoding Brevibactenum dlhydrodipicolinic adid synthase. Corynebacterium glutamnicumn 3572 Z21 502 B.lactofermentum dapA and dapB genes for dihydrodipicolinate synthase and Corynebacteriumn glutamicumn dlhydrodipicoliate reductase.

1902 X67737 C.glutarnicum dapB gene for dihydrodipicolinate reductase. Corynebacterium glutamicumn 2001 E14520 DNA encoding Brevibaceviumn dihydrodipicolinic adid synihase. Corynebacterium glutamicum 3.572 Z21502 B.lactofermentum dapA and dapB genes for dlhydrodipicollnate synthase and Corynebacterlumn glutamicum dlhydrodipicollnate reductase.

1411 El16752 gDNA encoding dihydrodipicolinate reductase (DDPR). Corynebacterium glutamicum 1411 AR038113 Sequence 18 from patent US §804414. Unknown.

56414 AL008967 Mycobacteriumn tuberculosis H37Rv complete genome; segment 1221162. Mycobacterium tuberculosis 40281 Z98741 Mycobacterium leprac cosmid B22. Mycobacterlumn leprae 2838 U19858 Streptomyces antibloticus guanosine pentaphosphate synthetase (gpsl) gene. Streptomyces antibioticus complete cds.

9184 AJ001206 Streptomyces coellcolor A3(2), glycogen metabolism dluster 11. Streptomyces coelicolor 9589 AJO0 1205 Streptomyces; coelicolor A3(2) glycogen metabolism dusterd. Streptomyoes coelicolor 64.896 64,896 57.970 54,410 51,729 14-OCT-i1998 14-OCT-i1998 3-Nov-99 17-Jun-98 26-Apr-93 36,309 08-MAR-i1999 44.308 11-MAR-1994 35,571 28-DEC-i 998 36,044 8-Sep-99 GB BA1 :CGDAPB GBPAT:E14520 GBBAl BIDAPAB 99,539 99.539 99,539 99,885 100,000 100,000 100,000 99,805 99,805 39,179 39,482 69.706 16-Aug-93 28-Jul-99 28-Jul-99 16-Aug-93 1-Apr-93 28-Jul-99 16-Aug-93 28-Jul-99 29-Sep-99 17-Jun-98 22-Aug-97 25-OCT-1996 rxa00865 1026 GB PAT:E16752 GBPAT:AR038113 rxa00867 650 GBBAI:MTVOO2 GBBAI:MLCB22 GBBAl SAUl 9858 rxa00873 779 GB -BA1 :SCOO0l 206 205 63,415 29-M4AR-i 999 61,617 29-MAR-1 999 2006252111 19 Dec 2006 GBBAI:D78198 rxa00884 1263 GB_BA1:MTCY253 GBBA1:MSGY222 GB._GSS115:AQ654600 rxaOO89l 1102 GBBAI:MTCI4I8B GB BA1:SCOD0l 206 GB_ BA1:SC0001205 nca00952 963 EM..PAT:E10963 GB BAI :BLTRP GBPAT:E01688 rxa00954 644 GBPAT:E01375 GBPAT:E01688 GB BA1 :BLTRP nca00955 1545 GBPAT:E01375 GB BA1 :BLTRP GELPAT:EO16a8 rxa00956 1237 EMPAT:E110963 GBBA1:BLIRP GBPAT:E01375 rxa00957 1677 GBBA1:BLTRP GB PAT:E01 375 GBPAT:.E01688 rxa00958 747 GBBA1:BLTRP GBPAT:E01375 GBPAT:E01688 rxaOO97O 1050 GBBAI :CGHOMTHR 2304 41230 41156 468 11700 9184 9589 3118 7725 7725 7726 7725 7725 7726 7725 7725 3118 D78198 Z81368 AD0000100 AQ654600 Z96071 A.JO01206 AJ01205 E10963 X04960 E01688 E01375 E01688 X04960 E01375 X04960 E01688 E10963 TABLE 4: ALIGNMNT RESULTS Pimelobacter sp. DNA for trehalose synthase, complete ods.

Mycobacterium tubercullosis H37Rv complete genome; segment 106/162.

Mycobacterlumn tuberculosis sequence from done y222.

Sheared ONA-1014.TF Sheared DNA Trypanosoma brucei genomic clone Sheared DNA-1014, genomic survey sequence.

Mycobacterium tuberculosis H37Rv complete genome; segment 7/162.

Streptomyces coelicolor A3(2), glycogen metabolism duster 11.

Streptomyoes coelicolor A3(2) glycogen metabolism cluster!.

gDNA encoding tryptophan synttiase.

Brevibacteuium lactofermentumn tryptophan operon.

Genomnic DNA of trp operon of prepilbacterium latophelmentamn.

DNA sequence of tryptophan operon.

Genrnic DNA of tip operori of prepibactertum latopheblientamn.

Brevibacterium lactofermentumn tryptophan operon.

DNA sequence of tiyptophan operon.

Brevibacterium lactofermentun tryptophan operon.

Genomic DNA of trp, operon of prepilbacterium latophelrnentamn.

gONA encoding tryptophan synthase.

Pimelobacter sp.

Mycobacterium tuberculosis Mycobacterlum tuberculosis Trypanosoma brucei Mycobacterium tuberculosis Streptomyces coelicolor Streptomyces; coelicolor Corynebacterium glutamicumn Corynebacterium glutamicum unidentified Corynebacteium glutamicum unidentified Corynebacter ghitamlcum Corynebacterum glutamicum Corynebacedru glutamicum unidentified Corynebacterium glutamicumn 60,594 37,785 38,006 33,974 63.297 61,965 61.727 99.688 98.847 98,428 98,758 98.758 98,758 98,372 98.372 98.242 98.949 99,107 98,945 99,165 98,927 98,867 98,792 98,792 98,658 99,905 99,810 97.524 99.931 99,931 99,931 5-Feb-99 '17-Jun-98 03-DEC-i1996 22-Jun-99 18-Jun-98 29-MAR-1999 29-MAR-1999 08-OCT-i1997 (Rel. 52, Created) 10O-Feb-99 29-Sep-97 29-Sep-97 29-Sep-97 10-Feb-99 29-Sep-97 10-Feb-99 29-Sep-97 08-OCT-1997 52, Created) 10-Feb-99 29-Sep-97 10-Feb-99 29-Sep-97 29-Sep-97 10-Feb-99 29-Sep-97 29-Sep-97 12-Sep-93 02-DEC-1 994 29-Sep-97 28-Jul-99 rxa00972 1458 GB_PAT:E01358 GBPAT:E16755 GBPAT:ARO38I1O GB-PAT:E14508 GBOV:GGA245664 GBPL2:AC007887 7725 X04960 Brevibacterium lactollermentumn tryptophan operon. Corynebacer glutamicum 7726 E01 375 DNA sequence of tryptophan operon. Corynebacterum glutamicum 7725 X04960 Brevibacterium lactofermentumn tryptophan operon. Corynebacteriumn glutamicum 7726 E01 375 DNA sequence of tryptophan operon. Corynebacterium glutamicum 7725 E01688 Genomnic DNA of tip operon of prepibacterium latophelrnintamn. unidentified 7725 X04960 Brevibacterlum lactofermentum tryptophan operon. Corynebacteriumn gtutamlcum 7726 E01375 DNA sequence of tryptophan operon. Corynebacerumn glutamicum 7725 E01 688 Genrnic DNA of trp operon of prepibactenum latophelmentamn. unidentified 3685 Y00546 Corynebacterium glutamicumn hom-thrB genes for homoserine dehydrogenase Corynebacterium glutamicum and homoserine kinase.

3685 109077 Sequence 1 from Patent WO 8809819. Unknown.

2615 E01 358 DNA encoding for homoserine dehydrogenase(HDH)and homoserine Corynebacterium glutamicum kInase(HK).

3579 E16755 gDNA encoding diaminoplmelate decarboxylase (DDC) and arglnyR-RNA Corynebacteilum glutamnicumn synthase.

3579 AR0381 10 Sequence 15 from patent US 5804414. Unknown.

3579 E14508 DNA encoding Brevibadterium diaminopimelic acid decarboxylase, and arginyl- Corynebacterium glutamnicumn tRNA synthase.

512 AJ245664 Gallus gallus partial mRNA for ATP-citrate lyase (ACL gene). Gallus gallus 159434 AC007887 Genomlc sequence for Arabidopsis thaliana BAC F1504 from chromosome 1, Arabidopsls thallana complete sequence.

29-Sep-99 28-Jul-99 rxaOO9Bl 753 37,538 28-Sep-99 37.600 04-OCT-i 999 2006252111 19 Dec 2006 GB-GSS:CNSORNW 542 rxa00989 1644 rxa00997 705 GBBA1:M1VOO8 GBBAl :SCVALSFP GB_ BAI:MTVO08 GBBA2:CGU31 225 63033 3619 63033 1817 TABLE 4: ALIGNMENT RESULTS AL087338 Arabidopsis thaliana genome survey sequence 17 end of BAC F1407 of IGF Nrabidopsis thaliana library from strain Columbia of Arabidopsls thallana, genomic survey sequence.

AL021246 Mycobacterium tuberculosis H37Rv complete genomne; segment 108/162. Mycobacterium tuberculosis Y13070 S.coelicolor valS, fpgs, ndk genes. Streptomyces coelicollor AL021246 Mycobacterium tuberculosis H37Rv complete genome; segment 108/1 62. Mycobacterium tubercLiosis U31225 Corynebacterium glutamicum L-proline:NADP+ 5-oxidoreductase (praC) gene, Corynebacterium glutamicum complete cds.

AL009026 Caenortiabditis eleganis chromosome IV dlone Y39C12. SEQUENCING IN Caenorhabdltls elegans PROGRESS in unordered pieces.

Z69634 Caenorhabditis elegans cosmid 80001, complete sequence. Caenorhabditis elegans AC005052 Homio sapiens clone RG038K21, -SEQUENCING IN PROGRESS Homo sapiens unordered pieces.

AC005052 Hom~o sapiens clone RG038K21, -SEQUENCING IN PROGRESS ,3 Homo sapiens unordered pieces.

AQ171 808 HS_3179_AlG03_17 CIT Approved Human Genomic Sperm Ubi-ary D Homo Homo sapiens sapiens genomic clone Plate=3179 CoI:=5 Row--M, genojnic survey sequence.

41,264 28-Jun)-99 40,773 58,119 38,167 40,841 17-Jun-98 03-MAR-i1998 17-Jun-98 2-Aug-96 GBHTG1:CEY39C12 282838 rxa01019 1110

GB-INI:CEBOOOI

GBHTG2.AC005052 GBHTG2:AC005052 GBI_GSS9:AQ171808 39416 144734 144734 512 36,416 26-OCT-1999 36,416 2-Sep-99 39,172 12-Jun-98 39,172 12-Jun--98 34,661 rxa0lO26 1782 GBBA1:SC1C2 GB_SAl :ATLEUCD GBBAI:MTVOI2 rxa01027 1131 GBBAI:MLCB637 GBBAl :MTCY349 GB_BA1:SPUNGMUTX rxa01073 954 GBBA1:BACOUTB GBPR4:AC007935 GBPL2.ATAC006282 42210 AL031 124 Streptomyces coelicolor cosmid 1C2.

2982 X84647 Ateichorpyceticus leuC and leuD genes.

Streptomyces coelicolor 68,275 Actinoplanes teichomyceticus 65,935 70287 4.4882 43523 1172 1004 167237 92577 AL021287 Z99263 Z83018 Z21702 M15811 AC007938 A1Z006282 Mycobacterium tuberculosis H37Rv complete genome; segment 132/162. Mycobacterium tuberculosis Mycobacterium leprae cosmid B637. Mycobacterium leprae Mycobacterium tuberculosis H37Rv complete genome; segment 131/1 62. Mycobacterium tuberculosis S.pneumoniae ung gene and mutX genes encoding uracil-DNA glycosylese Streptococcus pneumoniae and 8-oxodGiP nucleoside triphosphatase.

Bacillus subtilis outB gene encoding a sporulatlon protein, complete cds. Bacillus subtilis Honmo sapiens clone UWGC:djs201 from 7q31, complete sequence. Homo sapiens Arabldopsls thaliana chromosomie 11 BAC F13K3 genomic sequence, complete Arabidopsis thaliana sequence.

rxa01O79 2226 GB-BA2:AF112535 4363 AF1 12535 GB..BAI :CANRDFGEN 6054 Y09572 GB_-BA1:MTVO12 70287 AL021287 rxa0l08O 567 GBBA2:AF1 12535 4363 AF112535 GBBA1:CANRDFGEN 6054 Y09572 Corynebacterium glutamicum putative glutaredoxin NrdH (nrdH), NrdI (nrdl), and nbonucleotide reductase alpha-chain (nrdE) genes, complete ods.

Corynebacterium amnioniagenes nrdH, nrdl, nrdE, nrdF genes.

Mycobacterium tuberculosis H37Rv complete genome; segment 132/1 62.

Corynebacterium glutamicum putative glutaredoxin NrdH (nrdH), Nrdl (nrdl), and ribonucleotide reductase alpha-chain (nrdE) genes, complete eds.

Corynebacterum ammonlagenes nrdH, nrdl, nrdE, nrdF genes.

S.typhimurium nrdEF operon.

Limnadia [pritlcularls elongation factor 1-alpha roRNA, partial cds.

Human DNA sequence from PAC 24M1 5 on chromosome 1. Contains tenascin-R (restictin), EST.

Anathix ralla. elongation faictor-I alpha (EF-l a) gene, partial cds.

Corynebaclerium glutamicum Corynebacterium ammoniagenes Mycobacterlum tuberculosis Corynebacteriu glutamicum Corynebacterium emmoniagenes; Salmonella typhimuium Lirnnadia lenticularis Homo sapiens Anathix ralla 40,454 38,636 51,989 38,Q88 53.723 34.322 36,181 99.820 75,966 38,295 100,000 65,511 52,477 43,750 37,475 37.319 17-OCT-1998 15-Jan-99 04-OCT-i1995 23-Jun-99 17-Sep-97 17-Jun-98 1 5-Jun-94 26-Apr-93 1-Jjul-99 13-MAR-i1999 5-Aug-99 18-Apr-98 23-Jun-99 5-Aug-99 18-Apr-98 03-MAR-I1997 29-MAR-I1999 23-Nov-99 16-Jul-97

GBBAI:STNRD

rxaOIO87 999 GE _N2AF063412 GBPR3:H524M15 4894 1093 134539 X73226 AF063412 Z94055 GB_1N2:ARU85702 1240 U85702 2006252111 19 Dec 2006 rxa0l0gS 657 GB -BA1:MTCY01B2 GB-HTG5:AC01 1632 GB-HTG5:ACO1 1632 rxa0lO97 477 GBBA2-.AF030405 GOBA2-AF030405 r=01 098 897 GBBA2:AF030405 GBBAI :MSGY223 GBRA1:MLCB161O rxa01 100 861 GBBA2.AF051846 GBBA2:AF060558 GB..HTG1 :HSDJ14OA9 rxa0ll0i 756 GBBA2.AF060558 GBBA1:SC4G6 TABLE 4: ALIGNMENT RESULTS 35938 Z95554 Mycobacteium tuberculosis H37Rv complete genome; segment 721162.

175917 AC011632 Homo sapiens done RP1 1-3N1 3, WORKING DRAFT SEQUENCE, 9 unordered pieces.

175917 AC0l 1632 Homo sapiens clone RP1 1-3N13, WORKING DRAFT SEQUENCE. 9 unordered pieces.

774 AF03D405 Corynebacterium glutamicum cyclase (hisF) gene, complete cds.

774 AF030405 Corynebacterium glutamicum cyclase (hisF) gene, complete ads.

774 AF030405 Corynebacterium gfutamiaim cyclase (hisF) gene, complete ads.

42061 AD000OO1 9 Mycobacteium tuberculosis sequence from clone y223.

40055 AL049913 Mycobacterium leprae cosmid 81610.

738 AF051846 Corynebactefium glutamicum phosphoribosyformimino-5-amino-1phosphoribosy"-- imidazolecarboxamidde isomefase (hisA) gene, complete ads.

636 AF060558 Corynebactenium glutamlacim glutamine amidotransferase (hisi-) gene, complete ads.

221755 AL109917 Homo sapiens chromosome 1 clone RP1 -140A9, SEQUENCING IN PROGRESS in unordered pieces.

636 AF060558 Corynebactedriu glutamiaczm glutamine amidotransferase (hisH) gene, complete ads.

36917 AL096884 Streptomyces coelicolor cosmid 4G6.

Mycobaceslum tuberculosis Homo sapiens Homo sapiens 43,243 36,471 36,836 17-Jun-98 19-Nov-99 19-Nov-99 13-Nov-97 13-Nov-97 Corynebactenium glutamicum 100,000 Corynebacteium glutamnicurn 41,206 Corynebacteriumn glutamlimr Mycobacteium tuberculosis Mycobactedriu leprae Corynebacteriurn glutamicumn 97,933 40,972 61,366 97,154 13-Nov-97 10O-DEC-I 996 27-Aug-99 12-MAR-1998 29-Apr-98 Corynebacteriumn glutamicumn 95,455 Homo sapiens 30,523 23-Nov-99 Corynebacteriumn glutamicurm 94,462 Streptomyces coellcolor A3(2) 38,378 29-Apr-98 23-Jul-99 GB-BAI:STMHISOPA 3981 M31628 S.coelicolor histidine biosynthesis operon encoding hisD, partial eds., and hisC, hisB, hisH, and hisA genes, complete ods.

rxa0lIO4 729 GBBAI:STMHISOPA 3981 M31628 S.coeicolor histidine biosynthesis operon encoding NeDf, partial ads., and hIsO, hisS, hisH, and hisA genes, complete ads.

GBBAI:SC4G6 36917 AL096884 Streptomyces coelicolor cosmid 4G6.

Streptomyces coelicolor Streptomyces coelicotor 60,053 26-Apr-93 58,333 26-Apr-93 39,045 23-Jul-99 rxa0llOS 1221 rxaOllOG 1449 ixa01145 1137 rXa01 162 1449 GB BA:MTCY336 GB7BA1 :MTCY336 GBBA1:M5GY223 GBBA1:MLCBI6IO GBBAI:MSGY223 GBBA1:MSHISCD GBBAl :MTCY336 GBBAI:CORAtA GB-BAI :BRLILVCA GBPAT:E08232 GB PAT:A60299 GBPR3:HS24E5 32437 32437 42061 40055 42061 Z95586 Z95586 AD000019 Al-049913 AD000019 Mycobacterium tuberculosis H37Rv complete genome; segment 70/162.

Mycobacterium tuberculosis H37Rv complete genomne; segment 70/162.

Mycobacterium tuberculosis sequence from clone y223.

Mycobacteium leprae cosmid B1610.

Mycobacterium tuberculosis sequence from clone y223.

Streptomyces coelicolor A3(2) Mycobacterium tuberculosis Mycobactedrlu tuberculosis Mycobacterlumn tuberculosis Mycobacterium lepre Myoobactarfurn tuberculosis 60.364 60,931 36,851 60,902 37,233 60,111 24-Jun-99 24-Jun-99 10-DEC-I1996 27-Aug-99 IG-DEC-1 996 30-Jun-93 2298 X65542 M.smegmatis genes hisD) and hisC for histidintol dehydrogenase and histdinol- Mycobacterlum smegmatis phosphate aminotransferase, respeciel.

32437 Z95586 Mycobacteium tuberculosis H37Rv complete genome; segment 70/1 62. Myobactarium tuberculosis 4705 L09232 Corynebacterium giUtamicum acetohydroxy acid synthase (llvB) and ONlN) Coiynabacterlum giutamicum genes, and acetohydroxy acid isomeroreductase (ilvC) gene, comiplete cds.

1364 D14551 Brevibacterium flavum HvC gene for acetohydroxy adid isomeroreductase, Corynebacerium glutamnicumn complete ads.

1017 E08232 DNA encoding acetohydroxy-add Isomeroreductase. Corynebatenium glutamicumn 2869 A60299 Sequence 18 from Patent W097062611. Aspergillus niger 35506 Z82185 Human DNA sequence from Fosmid 24E5 on chromosome 22q1I 1 .2-qter Homo sapiens contains parvalbumin, ESTs, STS.

58,420 100,000 24-Jun-99 23-Feb-95 99,560 99,803 38,675 36,204 3-Feb-99 29-Sep-97 06-MAR-1998 23-Nov-99 2006252111 19 Dec 2006 GBPR3:AC005265 43900 rxa0l2O8 846 GBHTG2:AC004965 323792 GB-HTG2:AC004965 323792 AC005265 AC004965 AC004965 rxa0l209 1528 GB-PL2:TAU55859 2397 U55859 GB-HTG3:AC01 1469 113436 AC01 1469 GBHTG3:ACO11469 113436 AC011469 GB-PLIABO10077 77380 ABO10077 GB BA1:MTCY1OG2 38970 Z92539 GB-iNl:LEIPRPP 1887 M76553 GB-HTG2:HSJ799D16 130149 AL050344 TABLE 4: ALIGNMNT RESULTS Homno sapiens chromosome 19, cosmid F1 9750, complete sequence. Hoamo sapiens llama sapiens clone DJ1106H14, -SEQUENCING IN PROGRESS ~,42 Hoamo sapiens unordered pieces.

Hoama sapiens clone 13,1116-114, SEQUENCING IN PROGRESS ,42 llama sapiens unordered pieces.

Triticumn aestivum heat shack protein 80 mRNA, complete cds. Triticum aestivumr Hoama sapiens chromosome 19 clone CIT-HSPC 475D23, -SEQUENCING Homo sapiens IN PROGRESS 31 unordered pieces.

llama sapiens chromosoime 19 lonea CIT-HSPC_475D23, -SEQUENCING Homo sapiens IN PROGRESS 31 unordered pieces. 11 Arabidopsis ttialiana genamic DNA, chromosome 5, P1 clane: MYH19, Arabidopsis thaliana complete sequence.

Mycabacterium tuberculosis H37Rv complete gename; segment 47/162. Mycabacterum tuberculosis Leislimania donovani phosphoibosylpyrophosphate synthetase gene, Leishmania donovani complete cds.

llama sapiens chromosome 1 clone RP4-799D1 6 map p34.3-36.1, omo sapiens SEQUENCING IN PROGRESS in unordered pieces.

Mycobacterium tuberculosis H37Rv complete genome; segment 69/1162. Mycobacterium tuberculosis llamoa sap iens mRNA for KIAAI 109 protein, partial ads. Hoamo sapiens H-S3D986_Al_0 03_1 7 CIT Approved Human Genomic Sperm Library D Hoamo Homo sapiens sapiens genornic clone Plate=3098 CoI-5 Row=E, genamic survey sequence.

36,058 37,269 40,000 40,000 38,363 6-Jul-98 36,058 12-Jun-98 12-Jun-98 1-Feb-99 07-OCT-I1999 07-OCT-1 999 nca01215 1098 36,803 20-Nov-99 37,047 17-Jun-98 50,738 7-Jun-93 38,135 29-Nov-99 rxa01239 2556 GB BA1 :MTCY48 GB PR2:AB029032 GB-GSS:A107201 GBPL-2:F508 35377 6377 355 Z74020 ABO29032 AQ107201 38,139 39,394 41,408 17-Jun-98 4-Aug-99 28-Aug-98 rxa01253 873 GB-PL2:F508 rxa0132l 1044 GBINI:CELCO6G1 GBGSS14:AQ518843 GB-HTG2:AC007473 GBHT04:ACOI 1696 99923 AC005990 Arabidopsls thallana chromasome 1 BAC F508 sequence, complete Arabldopsis thallana sequence.

99923 AC005990 Arabidopsis thaliana chromosome 1 BAC F508 sequence, complete Arabidopsis thaliana sequence.

31205 U41014 Caenarhabditis elegans cosmid CC6GI. Ceenortiabditis elegans 441 AQ518843 HS_5106_AlDIOSP6E RPCI-1 1 Human Male BAC Library llama sapiens Hoamo sapiens genanic clone Ptate=682 001=19 Row--G, genomic survey sequence.

194859 AC007473 Drosophila melanagaster chromosome 2 dlone BACR38Q?12 (D590) RPCI-98 DrosophIla malanogaster 38.D.12 map 48A-48B strain y; cn bw sp, -SEQUENCING IN PROGRESS 60 unordered pieces.

115847 A0011696 Drosophila melanogaster chromosome 2 clone BACR35FOI (01 156) RPCI-98 Drosophila melanogaster 351F.1 map 48A-48C strain y; cn bw sp, -SEQUENCING IN PROGRESS 108 unordered pieces.

83260 AC005167 Arabidopsis thaliana chromosome 11 BAC F1 2A24 genamic sequence, Arabidopsis thaliana complete sequence.

97380 AC005825 Arabidopsis thaliana chramosome I I BAC T24121 genamic sequence, complete Arabidopsis thaliana sequence.

127222 AC0l 1150 llama sapiens clone 4_-K_17, LOW-PASS SEQUENCE SAMPLING. Homo sapiens 728 A1725583 BNLGHi1 2371 Six-day Cotton fiber Gossypium hirsuturn cONA 5' similar to Gossypium hirsutum (U86081) root hair defective 3 [Arabldopsis thalianal, mRNA sequence.

82951 Z81007 Hluman DNA sequence from PAC 227P17, between marters DXS6791 Hoama sapiens andDXS8038 on chromosome X contains CpG island, EST.

36,118 23-DEC-1998 35.574 23-DEC-1 998 38,560 30-Nov-95 41,121 05-MAY-i 999 40,634 2-Aug-99 38,290 26-OCT-I1999 rxa01352 706 GBPL2ATACOO5167 GB-PL2ATACOO5825 GBHTG3:AOOI1150 nca0l 360 259 GBE5T32:A1725583 GBP112:1-S2271317 34,311 34,311 37,722 38,492 39.738 15-OCT-1998 12-Apr-99 01-OCT-I 999 11I-Jun-99 23-Nov-99 2006252111 19 Dec 2006 GBEST34:AV171099 rxa01361 629 GB_-R0:AB00891551 GBEST22:A1050532 GB RO:AB008895 rxa01381 944 GBPLIA80O5237 GBGSSS:AQ766840 GBBA1:M1V043 rxa01393 993 GBBAI:CGLYSEG GB 3A1 :SC5A7 GBPR3:AC004054 rxaOI3O4 822 GB BAI:CGLYSEG GBGSS5:AQ769223 TAB3LE 4: ALIGNMENT RESULTS 173 AV171099 AV171099 Mus musculus head C57BI6J 14, 17 day embryo Mus muscukts Mus musculus cONA dlone 3200002MI 1. mRNA sequence.

530 AB00891 5 Mus musculus mGpll gene, exon 1. Mus musculus 293 A1050532 uc83dlO.yl Sugano mouse idney mkia Mus musculus cDNA dlone Mus musculus IMAGE:1432243 5'similar to TIR:035120 035120 MGPIIP. mRNA sequence.

3062 AB008895 Mus musculus mRNA for mGpilp, complete cds. Mus musculus 87835 A13G05237 Arabidopsls thaliana genomic DNA, chromosome 5, Pi clone: MJJ3,complete Ar-abidopsls thaliana sequence.

491 AQ766840 HS_2026_-A2_-C09 -T7C CIT Approved Human Genomic Sperm Library D Homo sapiens Homo sapiens genomic dlone Plate=2026 Col=1 8 Row=-E, genomic survey sequence.

68848 AL022004 Mycobacteiumn tuberculosis H37Rv complete genome; segment 40/162. Mycobacterium tuber 2374 X96471 C.glutamicum lysE and lysG genes. Corynebacterumn gh.

40337 AL031 107 Streptomyces coelicolor cosmid SAT. Streptomyces celic 112184 AC004054 Homo sapiens chromosome 4 dlone 13220G8 map 4q2l,'complete sequence. Homo sapiens 46,237 6-Jul-99 45,574 28-Sep-99 44,097 9-Jul-98 41,316 23-Nov-97 36,606 20-Nov-99 37,916 28-Jul-99 culosis lamicumn ilor 37.419 34,831 35,138 37,277 24-Jun-99 24-Feb-97 27-Jul-98 9-Jul-98 rxaOl4l6 630 rxa01442 1347 rxa01446 1413 rxaO1483 1395 GBBAl :CGLYSEG 2374 GBBA1:SC3C3 31382 GB_BA1:ML-CB22 40281 GB BA:MTVOO2 56414 GBBAI:D90827 18886 GBBAI:D90828 14590 GB-BA2AEOOO279 10855 GBBA1:SCH1O 39524 GB BAI:MTY13ElO 35019 GBBA1:MLCB4 36310 GB BAl :MTCY98 31225 GBBAI:MSGB1229C-S 30670 X96471 C.glutaimicumn lysE and lysG genes.

AQ769223 HS_3155_8 2_-GI 0_T7C CIT Approved Human Genomic Sperm Library D Homo sapiens genomic dlone Plate=3155 Col-20 Row=-N, genomic survey sequence.

X96471 C-giutamlcum lysE and lysG genes.

AL031231 Streptomyces coelicolor cosmid 3C3.

Z98741 Myoobacterium leprae cosmid 822.

AL008967 Mycobactedrlu tuberculosis H37Rv complete genome; segment 122/162.

D90827 Ecoli genomic DNA, Kohara clone #336(41.2-41.6 min.).

D90828 Ecoli genomic DNA, Kohara dlone #336gap(41 .6-41.9 min.).

AE000279 Escherichia coil K-12 MG1655 section 169 of 400 of the complete genome.

AL049754 Streptomyces coelicolor cosmi H 10.

Z95324 Mycobactenumn tuberculosis H37Rv complete genome; segment 18/162.

AL023514 Mycobactenumn leprae cosmid 84.

Z83860 Mycobactedrlu tuberculosis H37Rv complete genome; segment 103/162.

L78812 Myoobacterium leprae cosmid 81229 DNA sequence.

Corynebactetm gkjtamlcum Streptomyces coelicolor Mycobacteriumn leprae Mycobacterum tuberculosis Esctierichia col Escherichia cogl Eschenichia coil Streptomyces coelicolor Mycobacteriump tuberculosis Mycobacteriumn leprae Mycobactedrn tuberculosis Mycobactedriu leprae Mycobacterium smegmatis Mycobacterium tuberculosis Mycobacteriumn leprae Streptomyces coelicolor Corynebacterium ammoniagenes Mycobactertumn lepre Streptomyces coelicolor Mycobactedrn tuberculosis 33,665 62,726 39,159 37,340 58,517 56.151 56,021 39,037 40,130 37,752 39.057 54,382 52,941 40,941 38,451 61,194 58,021 38.414 36.930 37,062 Corynebacterium glutamicumn 100,000 Homo sapiens 38,400 24-Feb-97 28-Jul-99 24-Feb-97 10-Aug-98 22-Aug-97 17-Jun-98 21-MAR-I1997 21-MAR-I1997 12-Nov-98 04-MAY-1999 17-Jun-98 27-Aug-99 17-Jun-98 15-Jun-96 GBBA2:AF027507 rxa01486 757 GB_-BA1:MTVOO2 GBBAI:MLCB22 GBBAI :SC3C3 rxa01489 1146 GB-BA1:CORFADS GBBA1:MLCB22 GB ~BA1;SC10A7 rxa01491 774 GBBA1:MIVOO2 5168 AF027507 Mycobacterlum smegmatis dGTPase (dgt), and primase (dnaG) genes, complete cds; IRNA-Asn gene, complete sequence.

56414 AL008967 Mycobacterlum tuberculosis H37Rv complete genome; segment 122/162.

40281 Z98741 Mycobactedrn leprae cosmid B22.

31382 AL031231 Streptomyces coelicolor cosmid 3C3.

1547 D37967 Corynebactern ammoniagenes gene for FAD synthetase, complete cols.

16-Jan-98 17-Jun-98 22-Aug-97 10-Aug-98 8-Feb-99 22-Aug-97 9-Jun-99 17-Jun-98 40281 39739 56414 Z98741 AL078618 AL008967 Mycobacterlumn Ieprae cosmld 1322.

Streptomyces coelicolor cosmid IOAT.

Mycobacterium tuberculosis H37Rv complete genome; segment 122/162.

2006252111 19 Dec 2006 GBEST1 3AA356956 GB.0:OMDNAPROI GB-IN1:CEF2BC12 GB-IN1:CEF2BC12 255 7327 14653 14653 AA356956 X92380 Z93380 Z93380 TABLE 4: ALIGNMENT RESULTS EST65614 Jurkat T-cells III Homo sapiens cIDNA 5Vend, mRNA sequence.

O.mossambicus prolactin I gene.

Caenorh-abditis elegans cosmid F28C12, complete sequence.

Caenorhabditis elegans cosmid F28C12, complete sequence.

Homno sapiens Tilapia mossambica Caenorhabditis elegans Caenorhabditis elegans 37,647 38,289 37,984 38,469 21-Apr-97 19-OCT-i 995 23-Nov-95 23-Nov-98 rxa015OB 1662 rxa0l5l2 723 GB BAI:SCE9 GBBAI :MAU 88875 GB BA1:MTY15C1O rxa0l5l4 711 GB BAI:MTCY7H7B GB BA1:MLCB2548 GB3PLI :EGGTPCHI rxa0l5l5 975 GBBA1:ECOUW93 GBBAl :ECOUW93 GBRAl :MTCY49 rxa0l5l6 513 GB-IN1:DME238847 GBHTG3:ACOO921O GB_1N2:AF132179 rxa01517 600 GBPL2:F6H8 GB-PL2:AF038831 GBPL2:ATACOO5957 rxaOlS2l 921 GBBA1ANANiFBH GB PR2AC002461 G13PR2ACO02461 rxa0lS28 651 GB_ RO:MM4371P9 GBPR3:AC005740 37730 AL049841 Streptomyces coelicolor cosmid E9. Streptomyces coelicolor 840 U88875 Mycobacterium avium hypoxanthine-guanine phosphoribosyl transfe-rase gene, Mycobacterium avium complete cdls.

33050 Z95436 Mycobacterium tuberculosis H37Rv complete genome; segment 154V162. Mycobacterium tuberculosis 24244 Z95557 Mycobactedriu tuberculosis H37Rv complete genome; segment 153/162. Mycobactenumn tuberculosis 38916 AL023093 Mycobactedriu leprae cosmid 132548. Mycobacterium ieprae 242 Z49757 E.gracilis mRNA for GTP cyclohydrolase I (core region).; Euglena graclis 338534 U14003 Escherichla coi K-12 chromosomal region from 92.8 to 00.1 minutes. Escheichia coi 338534 U14003 Escheiichla coil K-12 chromosomai region from 92.8 to 00.1 minutes. Escherlcha col 39430 Z73966 Mycobacterium tuberculosis H37Rv complete genome; segment 93/162. Mycobacterium tuberculosis 5419 AJ238847 Drosophila melanogaster mRNA for drosophila dodeca-satellite protein I (DDP-Orosophla melanog aster 103814 AC009210 Drosophila melanogaster chromosome 2 clone BACR01IO6 (D1054) RPCI-98 Drosophila melanogaster 01.1.6 map 550-550 strain y; cn bw sp, -SEQUENCING IN PROGRESS, 86 unordered pieces.

4842 AF132179 Drosophila melanogaster done LD21677 unknown mRNA. Drosophla melanogaster 82596 AF178045 Arabidopsis thailana BAG F6H-8. Arabidopsis thaliana 647 AF038831 Sorosporium saponariae internal transcribed spacer 1, 5.8S nibosomnal RNA Sorosporium saponarlae gene; and internal transcibed spacer 2, complete sequence.

108355 AC005957 Arabidopsis thaliana chromosome 11 BAC T1 5J14 genomnic sequence, Arabidops1 thaliana complete sequence.

5936 J05111 Anabaena sp. (clone AnH2O.1) nltrogen fixation operon nifB, fdxN, WiS, nfU, Anabaena sp.

and nIfHl genes, complete cds.

197273 AC002461 Human BAG done RG204116 from 7q31, complete sequence. Homo sapiens 197273 AC002461 Human BAG done RG204116 from 7q31, complete sequence. Homa sapiens 165901 AL049866 Mus musculus chromosome X, clone 437P9. Mus musculus 186780 AC005740 Homo sapiens chromosome 5p, BAG done 50g21 (LBNL H154), complete Homo sapiens sequence.

166780 AC005740 Homo sapiens chromosome 5p, BAG dione 50g21 (LBNL Hi 54), complete Homo sapiens sequence.

35420 Z84724 Mycobacterium tuberculosis H37Rv complete genome; segment 21/162. Mycobacterium tuberculosis 176196 U00006 E. col chromosomal reagion from 89.2 to 92.8 minutes. Escherichia col 15441 AL096823 Streptomyces coelicolor cosmid Q1 1. Streptomyces coelicolor 47396 AL032630 Gaenorhabditis elegans cosmid Y62H-9A. complete sequence. Caenorhabditis elegans 3202 U51003 Homo sapiens DLX-2 (DLX-2) gene, complete cds. Horno sapiens 395 M1 8444 Pig 0-aminD acid oxidase (DAO) gene, exon 1. Sus scrofa 37432 Z98268 Mycobacterium tuberculosis H37Rv complete genome; segment 76/162. Mycobactenumr tuberculosis 39193 U00021 Mycobacterium leprae cosmid L247. Mycobactedrlu leprae 38936 Z95117 Mycobacterium leprae cosmid 13135.1. Mycobacterium leprae 39,021 1 9-MAY-1999 57.521 05-MAR-1 997 40,086 43,343 38,177 64,876 38,943 37.500 38,010 36.346 17-Jun-98 18-Jun-98 27-Aug-99 20-OCT-I1995 17-Apr-98 17-Apr-96 24-Jun--99 13-Aug-99 37,897 20-Aug-99 36,149 35,846 40,566 38,095 3-Jun-99 19-Aug-99, 13-Apr-99 7-Jan-99 38,206 26-Apr-93 36,623 34,719 37,500 37,031 20-Aug-97 20-Aug-97 29-Jun-99 01-OCT-1 998 1998 rxa01561 1053 rxa01599 1785 GB-PR3AC005740 GB_ BA1:MTCY22G1O GB BA2:ECOUV89 GB-BA1:SCQ1 1 GBIN1:CEY62H9A GB_ PR4:HSU51 003 GBOM:PIGDAO1 GB BA1:MTCI125 GBBAl :U00021 GBBA1:MLCBI351 38,035 01 -OCT-I 998 38.371 38.064 60,775 38,514 37,730 39,340 63,300 38,756 36,756 17-Jun-98 17-DEC-I1993 8-Jul-99 2-Sep-99 07-DEC-1 999 27-Apr-93 17-Jun--98 29-Sep-94 24-Jun-97 2006252111 19 Dec 2006 rxa01617 795 GOBPR2.HSMTM0 GBPR2I-IS13D1O GBPR2:HSMT4O rxa01657 723 GBBA1:MTCYiAiO GBEST6:D79278 GB BA2:AF129925 rxa0l66O 675 GBBA1:MTVO13

GBRO:MMFVI

GB PAT:A67508 rxa01678 651 GBVI:TVU95309 GBVI\:TVU95303 GBELV:TVU95302 rxa01679 1359 GBEST5:H91843 TABLE 4: ALIGNMENT RESULTS 217657 AL034384 Human chromosome Xq28, cosmidd clones 7H-3, 14D7, 01230, liE7, F1096, Homo sapiens A12197, 12G8, A09100; complete sequence bases 1. .217 657.

153147 AL021407 Homo sapiens DNA sequence from PAC 13D10 on chromosome 6p22.3-23. Homo sapiens Contains CpG island.

217657 AL034384 Human chromosome Xq28, cosmid clones 71-3, 14D7, C1230, I IE7, F1096, Homo sapiens A12197, 12G8, A09100; complete sequence bases 1. .217657.

25949 Z95387 Mycobacterium tuberculosis H37RY complete genome; .segment 117/162. Mycobacterium tuberculosis 392 D79278 HUM2I 3D06B Human aorta polyAl- (T~ujiwara) Homo sapiens cDNA done Homo sapiens GEN-213DO6 mRNA sequence.

10243 AF129925 Thiobaillus ferroo~dans carboxysome operon, complete cds. Thiobacilus ferrooAxdans 11364 AL021309 Mycobacterium tuberculosis H37Rv complete gename; segment 134/162. Mycobacterium tuberculosis 6480 X9771 9 M.musculus retrovirus restriction gene Fyi. Mus musculus 6480 A67608 Sequence I from Patent W09743410. Mus musqulus 600 U95309 Tula virus 064 nucleocapsid protein gene, partial cds. Tula virus 600 U95303 Tula virus 052 nucleocapsid protein gene, partial cds. Tula virus 600 U,95302 Tuba virus 024 nucleocapsid protein gene, partial cds. Tula virus 362 H91843 ys8le0l.sl Soares retina N2b4HR Homo sapiens cdNA clone IMAGE221208 Home sapiens 40,811 5-Jul-99 38,768 23-Nov-99 39,018 5-Jul-99 GBSTS:G26925 GBPL2:AF139451 GBBAI:SC1C2 GBEST22:A1064232 rxaOI690 1224 GB JN2:AFli17896 rxa01692 873 GBBA2AF067123

GBRO:RATNFHPEP

GBRO:RSNFH-

GB-BA2:AF124600 rxa01698 1353 3 similar to gbX63749_-mal GUANINE NUCLEOTIDE-BINDING PROTEIN ALPHA-i (HUMAN);, mRNA sequence.

362 G26925 human 81S SHGC-30023, sequence tagged site, Home sapien 1202 AF1 39451 Gossypium robinsoni CeIP.2 pseudogene, partial sequence. Gossypium r 42210 AL031 124 Streptomyces coellcolor cosmld 10C2. Streptomyces 493 A1064232 GH04563.5prtme GH Drosophila melanogasler head p012 Drosophila Drosophila m melanogaster cDNA clone GH-04563 5prime, mRNA sequence.

1020 AFI 17896 Drosophila melanogaster neuropeptide F (npf) gene, complete cds. Drosophila m 1034 AF067123 Lactobaclilus reuteri cobalamin biosynthesis protein J (db1J) gene, partial cds; Lactobacillus and uroporphyrin-Ill C-methyltransferase (sumT) gene, complete cds.

3085 M37227 Rat heavy neurofilament (NF-H) polypeptide, partial cds. Rattus norvet 3085 X1 3604 Rat mRNA for heavy neurofliament potypeptide NF-H C-terminus. Rattus sp.

4115 AF1 24600 Corynebactenium glutamicum chorismate synthase (aroC), shkimate kinase Corynebactet (aroK), and 3-dehydroquinate synthase (aroB) genes, complete cds; and putative cytoplasmilc peptidase (pepQ) gene, partial cds.

33818 Z83863 Mycobactedriu tuberculosis H37Rv complete genome; segment 111/162. Mycobacteriu 38914 L78820 Mycobacterium ieprae cosmid B937 DNA sequence. Myrobacteriu 4115 AF124600 Corynebacterumn glutamicum chorismate synthase (aroC), shikimate kinase Corynebacte (aroK), and 3-dehydroqulnate synthase (aroB) genes, complete cds; and putative cytoplasmic peptidase (,pepQ) gene, partial cds.

41097 AF016585 Streptomnyces catelestis cytochrome P-450 hydroxylase homolog (nidi) gene, Slreptomyces partial eds; polykelide synttiase modules 1 through 7 (nidA) genes, complete cds; and N-methyltransferase homolog gene, partial ods.: 399 C19712 C19712 Rice panicle at ripening stage Oryze sativa cON.A clone E108211A, Oryza saliva mlRNA sequence.7.

,binsonii coelicolor eianogaster elanog aster reuteri ;icus um guamicum m tuberculosis m ieprae -him glutarnicurn 40,656 44,262 40.709 40,986 35,364 35,364 41,894 41,712 39.576 39,15 39,157 38,910 60,644 38,037 36,122 48.079 37,093 37,093 100,000 36,323 62,780 100,000 17-Jun-98 9-Feb-96 17-MAY-i1999 17-Jun-98 29-Aug-ge 05-MAY-I 999 28-OCT-1997 28-OCT-1997 28-OCT-i 997 29-Nov-95 14-Jun-96' 1-Jun-99 15-Jan-99 24-Nov-95 2-Jul-99 3-Jun-98 27-Apr-93 14-Jul-95 04-MAY-1 999 17-Jun-98 15-Jun-96 04-MAY-1 999 GBBA1:MTCY159 GSBBAI MSGB937CS rxa01699 693 GBBA2'AF124600 GBBA2:AF01658 GBEST9:C19712 rxa0l7l2 805 GE,,EST21:AA952486 caelesls 40,260 07-DEC-i1997 45,425 24-OCT-I1996 40,876 29-OCT-1998 278 AA952466 TENS1404 T. cruzi epimastigote normalized cDNA Library Trypanosoma aruzi Trypanosoma cruzi cONA clone 1404 mRNA sequence.

2006252111 19 Dec 2006 GB...EST21 AA952466 278 AA952466 rxaOI719 684 GB-HTG1:HSDJ534K7 154416 GB-HTGI:HSDJ534K7 154416 GBEST27:A1447108 rxa0l 720 1332 GB-PR4:AC006322 GB_ PL2:TMO18A1O GB PR4:A0006322 ncaOi746 876 GB-EST3:R46227 GI3EST3:R46227 rxa~l747 1167 GBBAI:MTCY19O GBBA1 :MLCB2 GB-BA1 :SC5F7 nca0l757 924 GB-EST21:AA918454 GBEST4:H34042 GB-EST2:AA899038 rxa01807 915 G13BA1 :AP000063 GB..HTG4:ACO1 0694 GBHTG4:ACO1 0694 nxa01821 401 GBBAI:CGL007732 GB RO:RATALGL GB OVAPIGY2 rxa01835 6.54 GBEST3D:Ai629479 G13STS:G48245 GBGSS3:B49052 431 179640 106184 179640 443 443 34150 40281 40024 416 345 450 185300 115857 115857 4460 7601 1381 353 515 515 AL109925 AL1 09925 A1447108 AC005322 AF01 3294 AC006322 R46227 R46227 Z70283 Z98741 AL096872 A8A9118454 H34042 AA899038 AP000063 AC0l 0694 AC010694 AJ007732 M24108 X78272 Ai629479 G48245 B49052 TABLE 4: ALIGNMENT RESULTS TENS1404 T. cruzi epimastigote normalized cONA U-brary Trypanosoma cauzi Trypanosomna cruzi cONA clone 1404 56, rnRNA sequence.

Homo sapiens chromosome 1 clone RP4-534K7, -SEQUENCING IN Homo sapiens PROGRESS in unordered pieces.

H-omo sapiens chromosome I clone RP4-534K7, SEQUENCING IN Homo sapiens PROGRESS in unordered pieces.

mqgleOB-xl Stratagene mouse heart (#937316) Mus musculus cONA clone Mus musculus IMAGE:586118 mRNA sequence.

Honmo sapiens PAC clone DJ,106OB1 1 from 7q11.23-q21.1, complete Homo sapiens sequence.

Arabidopsis thartana BAC TMOI 8A1O0. Arabidopsis theliana Homio sapiens PAC clone DJ.1O6OBl1 from 7q1 1.23-q21.1, complete Homo sapiens sequence.

yg52a03.sl Soares Infant brain 1 NIB Homo sapiens cDNA clone Homo sapiens IMAGE:36000 mRNA sequence.

ygS2a03.sl Soares infant brain I NIB Homo sapiens cDN'A cdone Homo sapiens IMAGE:36000 3T, mRNA sequence.

Mycobacteriumn tuberculosis H37Rv complete genome; segment 98/1 62. Mycobacterium tube Myoobacteriumn leprae cosmid B22. Mycobacterium lepr; Streptomyces coelicolor cosmid 5F7. Streptomyces coelic om38c02.sl Soares NFL-TGBCSi Homo sapiens cDNA clone Homo sapiens IMAGE:1543298 3' similar to WP:F28F8.3 CE09757 SMALL NUCLEAR RIBONUCLEOPROTEIN mRNA sequence.

ESTI 10563 Rat PC-i 2 cells. NGF-treated (9 days) Rattus sp. cDNA clone Rattus sp.

RPNBI81 6' end, mRNA sequence.

NCP6G8T7 Perithecia] Neurospora crassa cDNA clone NP6G8 3Tend, mRNA Neurospora crassa sequance- Aeropyrum pemix genomic DNA, section 617. Aeropyrum pembc Drosophila melanogaster clone RPCI98-6H2, -SEQUENCING IN Drosophila melanog PROGRESS 75 unordered pieces.

Drosophila melanogaster clone RPC198-61-2, -SEQUENCING IN Drosophila melanog PROGRESS 75 unordered pieces.

Corynebacteriun glutamicumn 3' ppc gene, secG gene, amnt gene, ocd gene Corynebacterium gl and 5' soxA gene.

Rattus norvegicuis (clone A2U42) alpha2u globulin gene, exons 1-7. Rattus norvegicus Arias platyrhynchos (Super M) IgY upsilon heavy chain gene, exon 2. Arias piatyrhynchos 486101 D.10.xl 486 leaf primordia cDNA library from Hake lab Zea mays Zea mays cONA, mRNA sequence.

SHGC-M215 Human Homo sapiens STS genomic, sequence tagged site. Homo sapiens RPCII1.4Il2.TV RPCI-1 I Homio sapiens genomic done RPCI-11-4112, Homo sapiens genomic survey sequence.

rculosls ae eolor A3(2) aster aster jtaricumn 35,651 35,651 39,671 35,817 35,698 37,243 42,812 42,655 59,294 57,584 61,810 39,655 35,942 40,000 40,067 35,450 35.450 100,000 38,692 36,962 38.109 37,021 37,021 41,367 29-OCT-1998 23-Nov-99 23-Nov-99 09-AAR-I 999 1 8-MAR-i 999 12-Jul-97 18-MAR-i1999 22-MAY-I1995 22-MAY-1 995 17-Junv-98 22-Aug-97 22-Jul-99 231-Jun-98 2-Apr-98 12-Apr-98 22-Jun-99 16-OCT-I1999 16-OCT-1999 7-Jan-99 15-DEC-i1994 15,-Feb-99 26-Apr-99 26-MAR-i1999 8-Apr-99 2006252111 19 Dec 2006 rxa0l85O 1470 rxa01878 1002 GEBA2:ECOLN67,.

GB BA2:AE000392 GBBA2:U32715 GB-HTGI:CEY64FI 1 110000 10345 13136 177748 U18997 AE000392 U32715 Z997'76 GBHTG1:CEY64FI 177748 Z99776 GB_-TG:CEY6>4FII 177748 Z997'76 rxa0l 892 852 GBBAl :MTCY274 39991 GB BA1:MLCB25O 40603 GB-BA1 :MSGB1529CS 36965 Z74024 Z97369 L78824 TABLE 4: ALIGNMNT RESULTS Escherlchla coli K-12 chromosomal region from 67.4 to 76.0 minutes. Eschenichiia coli Escherc-ia coi K-12 MG1655 section 282 of 400 of the complete genome. Escherlchla coli Haemophilus influenzae Rd section 30 of 163 of the complete genome. HaemophIlus lnttuenzae Rd Caenorhabditis elegans chromosome IV done Y64F1 1, SEQUENCING IN Caenortiabditis elegans PROGRESS in unordered pieces.

Caenortiabditis elegans chromosome IV done Y64F1 1, -SEQUENCING IN Coenorhabditis elegans PROGRESS in unordered pieces.

Caenorhabdltls elegans chromosome IV done Y64FI 1, -SEQUENCING IN Caenorhabditis elegans PROGRESS In unordered pieces.

Mycobacterium tuberculosis H37Rv complete genome; segment 126/162. Mycobacterium tuberculosis Mycobacterium Ieprae cosmid 8250. Mycobacterium leprae Mycobacterium leprae cosmid B1529 DNA sequence. Mycobacterium Ieprae Mycobacterium tuberculosis H37Rv complete genome; segment 1261162. Mycobacterium tuberculosis Caenorhabditis elegans; cosmid 17461-5. Caenorhabdfits elegans Drosophila melanogaster chromosome 2 done BACRO3E19 (D1033) RPCI-98 Drosophila melanogaster 03.E.19 map 36E-37C strain y; cn bw sp, -SEQUENCING IN PROGRESS 94 unordered pieces.

Coryneba cteriun glutamicum ribonudeotide, reductase beta-chain (nrdF) Corynebacteriurn glutamicun gene, complete cds.

Corynebacterlum ammonlagenes nrdH, nrdl, nrdE, nrdF genes. Corynebacterlum 37,196 38,021 39,860 37,564 37,578 35,910 64.260 64,260 37,229 38,525 31,579 nca01894 978 GBLBA1:MTCY274 GBIN1:CELF46H5 GBHTG3:AC009204 U18997 12-Nov-98 29-MAY-i 998 14-OCT-1 998 37,564 14-OCT-1998 39991 38886 115633 Z74024 U41 543 ACCO9204 rxa0192O 1125 GBBA2:AF1 12536 1798 AF112536 GBBAl :CANRDFGEN 6054 Y09572 GB-BA2:AF050168 1228 AF050168 99,733 70,321 14-OCT-1998 19-Jun-98 27-Aug-99 15-Jun-96 19-Jun-98 29-Nov-96 18-Aug-99 5-Aug-99 18-Apr-98 23-Apr-98 11-MAY-I1999 15-Sep-99 15-sep-99 il-MAY-I 999 19-Sep-96 Corynebacterium ammoniagenes ribonucleoside diphosphate reductase small rxa01928 960 GBBA1:CGPAN GBPL1 AP000423 GBPLI AP000423 rxa0 1929 936 GBBAl :CGPAN GBBAI ,XCU33548 GBBAlYXANHRPB6A rxa0l940 1059 GB-lN2:CFU43371 GSBA2:AE001467 GB ROAF175967 rxa02022 1230 GBBAI:CGDAPE GB_BA1:CGDNAAROP subunit (nrdF) gene, complete ods.

2164 X96580 C.glutamlcum panB, panC xylB genes.

154478 AP000423 Asabidopsis Ihaliana chloroplast genomic DNA, complete sequence, strai:Colunmbia.

154478 AP000423 Arabidopsis thaliana chloroplast genomic DNA, complete sequence, stralmColumbia.

2164 X96580 C.glutamicum panB, panC xylB genes.

8429 U33548 Xanthomonas campestris hrpB pathogenicity locus proteins HrpBl, HrpB2, Hrpp3, HrpB4, HrpB5, HrpB6, HrpB7, HrpB8, HrpAl, and ORF62 genes, complete cds.

1329 M991 74 Xanthornonas campestrls hrpB6 gene, complete cds.

1060 U43371 Crithidla fasciculata ino 'sine-uridine preferring nucdeoside hydrolase (IUNI-) gene, complete cds.

11601 AE001467 Heicobacter pylori, strain J99 section 28 of 132 of the complete genome.

3492 AF175967 Homo sapiens Leman coiled-coil protein (LCCP) mRNA, complete cds.

1966 X8!1379 C.glutaniicum dapE gene and orf2.

2612 X85965 C.glutanhlcum ORF3 and aroP gene.

6469 U47055 Anabaena PCC7120 nitrogen fixation proteins (nifE, nifN, nitX, nAiWf) genes, complete cds, and nltrogenase (nIfK) and hesA genes, partial cds.

29540 Z93777 Mycobacterium tuberculosis H37Rv complete genome; segment 521162.

ammonlagenes Corynebactertumn ammonlagenes CorynebactedumT glutamicum Chloroplast Aj-abidopsis ttialiana Chloroplast Arabldopsls thaliana CorynebacteraTm glutamicumn Xanthomonas campestis pv.

vesicatoria Xanthomnonas campestris Crithidia fasciculata Helicobacter pyloni J99 Mus musculus Corynebactenium gkitamicum Corynebacterlum glutamicum 72,082 100,000 35,917 33,925 100,000 38,749 39,305 14-Sep-93 61,417 18-Jun-95 38,560 40,275 100,000 38,589 36,647 20-Jan-99 26-Sep-99 8-Aug-95 30-Nov-97 17-Feb-96 GBBA1VAPU47O55 Ariabaena PGC7120 rxa02O24 859 GB-BA1:MTC1364 Mycobacterium tuberculosis 59,415 17-Jun-98 2006252111 19 Dec 2006 TABLE 4: ALIGNMENT RESULTS GBBA1:MSGB1912CS 38503 L01536 M. leprae genomic dna sequence, cosmid b1912. Mvycobactedriu ieprae Mycobactertumn leprae 57,093 14-Jun-96 GB-BA1:MLU15180 38675 U15180 Mycobacterium ieprae cosmid B1756. 57.210 09-MAR-1995 rxa02027 rxaO2O31 rxa02072 1464 G13BA1:CGGDHA GB -BAI:CGGDH GBBA1:PAE18494 rxaO2OBS 2358 GB BA1 MTCY22G8 GBBA1:MLCB33 GB -BA1:ECOUWV85 rxa02093 927 GBEST14:AA448146 2037 2037 1628 22550 42224 91414 452 GB-EST17:AA641937 444 rxa02106 1179 GBPR3AC003074 GBBA1;SC1A6 GBPR4IAC005553 GBEST3:R49746 rxaO2iil 1407 GB-BAI:SC6G1O GBBAI:U00010 GB_BAI:MTCY33O rxaO2l 12 960 GBJ-HTG3ACO1 0579 GB-GSS3:B09839 143029 37620 179651 397 36734 41171 32437 157658 1191 X72855 C.glutamicum GOHA gene. Corynebacterium glutamicun X59404 Corynebacterium glutamicum, gdh gen for glutamate dehydrogenase. Corynebacterium glutamicumn Y18494 Pseudompnas aeruginosa gdhA gene, strain PACI- Pseudomonas aeruginosa Z95585 Mycobacterium tuberculosis H37Rv complete genome; segment 49(162. Mycobacterium tuberculosis Z94723 Mycobacterium ieprae cosmid B33. Mycobacterium ieprae M87049 E. coli genomic sequence of the region from 84.5 to 86.5 minutes. Escheridia coil AA448146 zw82h0l.rl Soares-testisNHT Homo sapiens cONA clone IMAGE:782737 Homo sapiens mRNA sequence.

AA641937 ns18b10.rl NCIO GAPGCBI Homo sapiens cO)NA clone IMAGEA1183963 Homo sapiens mRNA sequence.

AC003074 Hum an PAC clone DJ0596009 from 7p1 5, complete sequence. Homo sapiens AL023496 Sireptomyces coeficolor cosmid 1A5. Streptomyces coelicoior AC005553 Homo sapiens chromosome 17, clone hRPK.112_-J_-9, complete sequence. Homo sapiens R49746 yg7lg1O.r1 Soares infant brain 1iNIB Homo sapiens ciJNA clone Homo sapiens IMAGE:38768 5' similar to gb:V00567 BETA-2-MICROGLOBULIN PRECURSOR (HUMAN);, mRNA sequence.

AL049497 Streptomyces coelicolor cosmid 6G 1. Streptomyces coelicolor U00010 Mycobacterium leprae cosn-dd B1 170. Mycobacterium lepre Z95586 Mycobacterium tuberculosis H-37Rv complete genonie; pegment 701162. Mycobacterium tuberculosis AC01 0579 Drosophila melanogaster chromosome 3 clone BACRO008 (01101) RPCI-98 Drosophila melanogaster 09.13.8 map 96F-96F strain y; cn bw sp,- SEQUENCING IN PROGRESS, 121 unordered pieces.

B09839 T1 2A1 2-Sp6 TAMvU Arabidopsis thaliana genomio clone T12A12, gonomic Arabidopsis thaliana survey sequence.

AC01 0579 Drosophila melanogaster chromosome 3 clone BACRO90308 (DI 10) RPCI-98 Drosophila melanogaster 09.D.8 map 96F-96F strain y; cn bw sp, -SEQUENCING IN PROGRESS 121 unordered pieces.

X8301 1 Scoelicolor secY locus DNA- Streptomyces coelicolor A1731 596 B3NLG~i-101 85 Sbc-day Cotton fiber Gossypiumn hirsutumn cDNA V similar to Gossypiumn hirsutumn (ACOO400S) putative ribosomal protein L7 [Arabidopsis Ihaliane], mRNA seuence.

X8301 1 S.coeiicolor secY locus DNA. Streptomyces coeiicoior 99,317 94,387 82,247 38,442 56,486 52,127 34,163 31,917 35,818 34.274 41,162 50,791 37,563 39,504 37,909 6-Nov-97 13-Jan-99 31-DEC-1998 18-MAY-1 995 24-MAR-1 999 01-MAR-1994 24-Jun-99 24-Sep-99 35,586 27-OCT-1997 24-MAY-i1993 30-Jul-99 6-Feb-gg 17-Jun-98 24-Jun-97 29-M4AY-i 995 4-Jun-97 rxafJ2l34 1044 GBHTG3ACOIO579 157658 GB-BA1:SCSECYDNA 6154 GBEST32:A1731596 568 GBBAi:SCSECYDNA 6154 37,843 14-MAY-1997 37,909 24-Sep-99 36,533 02-MAR-i1998 33,451 11-Jun-99 36,756 02-MAR-i 998 2006252111 19 Dec 2006 rxa02135 1197 GBPR3:HS525L6 168111 GBPL2-ATF21PB 85785 GB PL2:U89959 105973 rxa02136 645 GBPL2,ATAC005819 57752 GBPL2:F15K9 71097 GBPL2:U89959 106973 rxa02139 1962 GB BAI:MTCY19O 34150 GBBAI:MSGBI554CS 36548 GBBA1:MSGBI551CS 36548 rxaO2153 903 GBBA2:AF049897 9196 GBBAI AF005242 1044 GBBA1:CGARGCJBD 4355 rxa02154 414 GBBA2:AF049897 9196 TABLE 4: ALIGNMNT RESULTS AL023807 Human DNA sequence from clone RP3-525L6 on chromosome 6p22.3-23 Contains CA repeat, STSs, GSSs and a CpG Island, complete sequence.

AL022347 Arabldopsis thallana DNA chromosome 4. BAC cdone F21PB (ESSA project).

U89959 Arabidopsis thaliana BAC T7123, complete sequence- AC005819 Arabidopsis thaliana chromosome 11 BAC T3A4 genomic sequence, complete sequence.

AC005278 Arabidopsis thaliana chromosome 1 BAC F15K9 sequence, complete sequence.

U89959 Arabidopsis thaliana BAG 17123, complete sequence.

Z70283 Mycobacterium tuberculosis H37Rv complete genome; segment 981162.

L78814 Mycobacterium Ieprae cosmid B31554 DNA sequence.

L78813 Mycobacterium leprae cosmid B1 551 DNA sequence.

AF049897 Corynebactedium glutamlcum N-acetylglutamylphosphate reductase (argO), omnithine acetyltransferase (argJ), N-acetylglutamate kinase (argB), acetylomnithine transaminase (argD), omlithine carbamnoyltransferase (argF), arginine repressor (argR), argininosuccinate synthase (argG), and argininosuccinate lyase (argH) genes, complete cds.

AF005242 C~rynebacterium glutamicum N-acetytglutamfate-5-semlaldehyde dehydrogenase (argC) gene, complete cds.

X86 157 C.glutamicum argC, argJ, argB, argD. and argF genes.

AF049897 Corynebacterium glutanicum N-acetylglutarnylphosphae reductase (argC), omithine acetyltransferase (argJ), N-acetylglutamate kinase (argB), acetylomlihine transaminase (argD), omnithine carbamo 6trnsferase (argF), arginine repressor (argR), argininosuccinate synthase (argG), and arginlnosuccinate lyase (argH) genes, complete cds.

AF005242 Corynebactelium glutarolcum N-acetylglutamnate-5-semlaldehyde dehydrogenase (argO) gene, complete cds.

X86 157 COglutamicum argC, ar9J, argB, argD, and ar9F genes.

X86157 O~glutamicum argC, argJ, argB, argO, and argF genes.

AF049897 Corynebactium glutanicumn N-acetylglutamyphosphate reductase (argC).

omnithine aoetyltransferase (argJ). N-acetylglutamate ktnase (arg13), acetylomlithine transamlnase ornithine carbamnoyltransferase (argF), arginine repressor (argR), argininosuccinate synthase (argG), and argininosucciniate tyase (argH) genes, complete ods.

178811 Mycobacterium leprae cosmid B1133 DNA sequence.

Homo sapiens Arabidopsis thaiiana Arabldopsis thaliana Arabidopsis tallana Arabidopsis thaliana Arabidopsis thaliana Mycobacterlum tuberculosis Mycobacterium leprae Mycobacterium leprue Corynebacterum glutamicum Corynebacteium glutamicum Corynebacterum glutamicum Corynebactenium glutamicum Corynebacterlum glutamloum Corynebacterium glutamicum Corynebacteium glutamicum Corynebacteium glutamicum WAcobacterium lepre 34,365 34,325 33,874 34.123 31,260 34,281 62.904 36,648 36,648 99,104 99.224 1 00,000 98,551 98.477 100,000 99,767 99,378 55,504 2-Jul-97 25-Jul-96 1-Jul-98 2-Jul-97 25-Jul-96 25-Jul-98 1-Jul-98 23-Nov-99 9-Jun-99 28-Jun)-98 3-Nov-98 7-Nov-98 25-Jun-98 1 7-Jun-98 15-Jun)-96 115-Jun-96 1-JuI-98 GBBA1 -AF005242 GB-BAI :CGARGOJBD GBBAl :CGARGCJBD GBBA2-AF049897 1287 GB-BAi:MSGBI 13308 42106 15-Jun)-96 2006252111 19 Dec 2006 rxa02156 1074 GBBA2:AF049897 9196 G BAI:CGARGCJBD 4355 TABLE 4: ALIGNMENT RESULTS AF049897 Corynebacterium glutamicum N-acetylglutamylphasphate neductase (argC), omitine acetyltransferase (argJ), N-acelylglutaniate kinase (argB), acetylornitline transaminase (argD), omnithine carbamoyltransferase (argF).

arglnlne repressor (argR), argininosuccinate synthiase (argG), and argininosuccinate lyase (argH) genes, complete cds.

X86157 C.glutamicum argC, argJ, argB, argl), and argF genes.

GBBA2AEOOI8I6 GBBA2:AF049897 rxa021S7 1296 10007 AE001816 Thermotoga maitime section 128 of 136 oftthe complete genome.

9196 AF049897 Corynebacterum glutamicumn N-acetylglutamylphosphate reductase (argC), omithlne acetyltransibrase (argJ), N-acetylglutamate klnase (argB), acetylornithine transamlnase (argD). omnithine carbamoyltransferase (argF), arginine repressor (argR), arginiosucdn ate synthase (argG), and argininosuccdnate lyase (argH) genes, complete cds.

4355 X86157 Oglutamicumn argO, argJ, argS, argl), and argF genes. GBBAI:CGARGCJBD rxa02158 1080 GBBA1:MTCYO6H11 38000 GBBA2AF049897 9196 GBBA2.AF031518 2045 GB-BA1:CGARGCJBD 4355 Z85982 Mycobacterlum tuberculosis l-37Rv complete genome; segment 73/162.

AF049897 Corynebacterin glutamicum N-acetylglutamylphosphate reductase (argC), omithlne acetyltransferase (argJ), N-acetylglutamate Inase (argB), acetylornithine transaminase (argD), omithine carbamfoyftransferase (argF), arginlne repressor (argR), argininosuccinate synthase (argG), and argininosuccinate lyase (argH) genes, complete ode.

AF031518 Corynebacteium glutamicumn omithine carbamolytransferase (argF) gene, complete cds.

X86157 C.glutamlcumn argC, argJ. argS, argD., and argF genes.

Corynebacterurn glutamicumn 100,000 Corynebacterium glutamicum 100,000 Thermotoga maritime 50,238 Corynebacterium ghjtamicum 99,612 Corynebacterium glutamicum 99,612 Mycobactedriu tuberculosis 57,278 Corynebacterium glutamicum 100,000 Corynebacterium glutamicumn 99.898 Corynebacterum glutamlcum 100.000 Corynebactedrn glutamicum 99,843 Corynebacterium glutamicum 88,679 Corynebacteiurn glutamicum 100,000 Corynebacterium glutamicum 99,774 Corynebacedriu gkitamicumn 99,834 Streptomyces clavuligerus 65,913 I1-Jul-98 25-Jul-96 2-Jun-99 1-Jul-98 25-Jul-96 17-Jun-98 1-Jul-98 5-Jan-99 25-Jul-96 1-Jul-98 5-Jan-99 5-Jan-99 1-Jul-98 rxa02159 636 GBBA2:AF04g8g7 GB-BA2AFO31 518 GBBA2:AF041436 GBBA2:AF049897 9196 AF049897 Corynebacteriur glutamicumn N-acetylglutamylphosphate reductase (argC), omithne acetyliransferase (argJ), N-acetylglutamate Idnase (argB), acetylornithine transaminase (argD), ombtine carbamoyltransferase (argF), arginine repressor (erg argininosuccinate synthase (erg and argininosuccinate lyase (argH) genes, complete cds.

2045 AF031518 Corynebacterium glutamicum omithine carbamolyrnsferase (argF) gene, complete eds.

516 AF041436 Corynebacterium glutamicum arginine repressor (argR) gene, complete ods.

9196 AF049897 Corynebacterium glutamicum N-acetylglutamylphosphate reductase (argC), omithine acetyltransferase (argJ), N-acetylglulamate kinase (argB), acetylornitliine transaminase (argD). omithine carbamoyllransferase (argF), arginine repressor (argR), argininosucainate synthase (argG), and argininosuccanate lyase (argH) genes, complete ode.

1206 AF030520 Corynebacterium gluamicum argininosuccinale synthetase (argG) gene, complete cds.

1909 Z491 11 S.clavuligerus argG gene and argH- gene (partial).

=0a2116O 1326 GBBA2:AF030520 GBBAl :SCARGGH 19-Nov-97 22-Apr-96 2006252111 19 Dec 2006 rxa02I62 1554 GBBAi2AF049897 9 196 GBBA2:AF048764 1437 GEBA:MCYO6HI 1 38000 rxa02176 1251 GBBA1:MTCY31 37630 GBBA1:CGGLTG 3013 GBPL2:PGU65399 2700 rxa02I89 861 GB PRAC0O2468 115888 GBBAI:MSGB19700S 39399 TABLE 4: ALIGNMNT RESULTS AFD49897 Corynebacterium glutamnicumn N-acetylglutamylphosphate reductase (argO), omlithIne acetyltransferase (argJ), N-acetylglutamate kinase (arg B), acetylomlthine transaminase (argD), ornithine carbamoyltransferase (argF), arginine repressor (argR), argininosuccinate synthase (argG), and argininosuccinata lyase (argH) genes, complete cds.

AFD48764 Corynebacterium ghlitamlcum argininosuccinate lyase (argH) gene,complete cds.

Z85982 Mycobacterium tuberailosis H37Rv complete genome; segment 73/162.

Z73101 Mycobacterium tuberculosis H37Rv complete genome; segment 41/162.

X661 12 C.glutamlcum git gene for citate synt1hase and ORF.

U65399 Basidiomycete CECT 20197 phenoloxidase (poxi) gene, complete ods.

AC002468 Human Chromosome 1-5q26.1 PAC clone pDJ4l7d7, complete sequence.

L78815 Mycobacterium leprae cosmid B1970 DNA sequence.

GB PRa.A0002468 rxa021g3 1701 GBBA1:BRLASPA GBPAT:EG4307 GBBA1 :ECOLAN93 nxa02I94 966 GB7BA2:AFOSO166 GBBA1:BRLASPA GB PAT:E08649 rxa02-195 393 GBBA2:AF086704 GBBAI:EAY17145 GBSTS:G01 195 rxa02197 551 GBBA1:MTCY261 GB BA1:MLC82533 GB BA1 :U0017 ,xa02198 2599 GB BA1:U00017 GBBA1 :MLCB2533 GBBAI:MTCY26I rxa02208 1025 GBBA1:U.00017 GBBAI AP000063 GB PR4:AG006236 rxa02229 948 GB BAI:MSGYI54 GBBA1 :MTCYI 54 G13BAI:U00019 rxa02234 3462 GBBA1:MSGB937OS GBBAl1:MTCY2B12 GB-BA2:U01072 115888 AC002468 Human Chromosome 1 5q26.1 PAC clone p0J417d7, complete sequence.

1987 D2531 6 Brevibactenium flavum aspA gene for aspartase, comrplete cds.

1581 E04307 DNA encoding Brevibacterium flavumn aspartase. 338534 U14 *003 Escherichia coi K-12 chromosomal region from 92.8 to 00.1 minutes.

840 AF050166 Ccxynebacterium glutamnicumn ATP phosphonibosyltransferase (hisG) gene, complete cds.

1l987 D25316 Brevibacterium flavum aspA gene for aspartase. complete cds.

188 E08649 DNA encoding part of aspartase from ooryneformn bacteria.

264 AF086704 Corynebacterium glutamicum phosphorlbosyl-ATP-pyrophosphohydrolase (hisE) gene, complete cds.

6019 Y17145 Eubacterium acidaminwophilumn grdR, grdl, grdH genes and partial Idc, grdT genes.

332 G01 195 fruit fly STS Dm1930 clone DS06959 T7.

27322 Z97559 Mycobacterlum tubercuilosis H37Rv complete genome: segment 95/162.

40245 AL035310 Mycobacterium leprae cosmid B2533.

42157 U00017 Mycobacterlum leprae cosmid B2126.

42157 U000I 7 Myobacterium Ieprae cosmid 82126.

40245 AL035310 Mycobacterium leprae cosmid B2533.

27322 Z97559 Mycobacterium tuberculosis H37RY complete genome; segment 95/162.

42157 UD0017 Mycobacterium leprae cosmid B2126.

185300 AP000063 Aeropyrumn pemix genomic DNA, section 6/7.

127593 AC006236 Homo sapiens chromosome 17, dlone hCrT.162_E 12, complete sequence.

40221 AD0O0002 Mycobactedrn tuberculosis sequence from clone yl54$.

13935 Z98209 Mycobacterium tuberculosis H37Rv complete genome; segment 121/162.

36033 U00019 Mycobacterlum leprae cosmid B2235.

38914 L78820 Mycobacterium leprae cosmid B937 DNA sequence.

20431 Z8101 1 Mycobacterium tuberculosis H37Rv complete genome: segment 61/1 62.

4393 U01 072 Mycobacterium bovis BOG orotidin-&-monophosphate decarboxylase (uraA) gene.

Corynebacterium glutamiu 88,524 Corynebactenium glutamicum 87,561 Mycobactertum tuberculosis; 64,732 Mycobacterium tuberculosis 36,998 Corynebacter glutamicumn 39,910 basidiomyoete CECT 20197 38,474 Homo sapiens 35,941 Mycobacterium leprae 40,286 Homo sapiens 33,689 Corynebacterum glutamicum 99,353 Corynebacterium glutamlcum 99,367 Escherichia coli 37,651 Corynebacterium glutamicum 98,214 Corynebacteriumi glutamicumn 93,605 Corynebacterlum glutamicumn 100,000 Corynebactertumn glutamicum 100,000 Eubacterium acidaminophilum 39,075 Drosophila melanogaster 35.542 Mycobactertum tuberculosis 33,938 Mycobacternum leprae 65,517 Mycobacterium leprae 36,770 Mycobacterium leprae 38,674 Mycobacterium leprae 65,465 Mycobacterium tuberculosis 37,577 Mycobacterlum leprae 59,823 Aeropyrum pemnbc 39,442 Homo sapiens 37,191 Mycobacterium tuberculosis 53,5411 Mycobactedrn tuberculosis 40,407 Mycobacterium leprae 40,541 Mycobacterium leprae 66,027 Mycobacterlum tuberculosis 71,723 Mycobacterium bovis 67,101 17-Jun-98 17-Jun-98 17-Feb-95 19-Jul-97 16-Sep-98 15-Jun-96 16-Sep-98 6-Feb-99 29-Sep-97 17-Apr-96 5-Jan-99 6-Feb-99 29-Sep-97 8-Feb-99 5-Aug-98 1-Jul-98 1-Jul-98 28-Feb-95 17-Jun,-98 27-Aug-99 01-MAR-1994 01-MAR-i 994 27-Aug-99 17-Jun-98 01-MAR-1994 22-Jun-99 29-DEC-1 998 03-DEC-1996 17-Jun-98 01-MAR-i1994 15-Jun-96 18-Jun-98 22-DE-1 993 2006252111 19 Dec 2006 rxa02235 727 GBBAl:M5U91572 960 GBHT133:AC009364 GBHTG3:AC009364 rxa02237 693 GBBAI:MTCY21B4 GBBA2:AF077324 GB-EST22AU017763 rxa02239 1389 GBBAI:MTCY21 B4 GBHTG3:AC010745 GBHTG3:AC010745 rxa02240 1344 EMPAr:E09855 192791 192791 39150 5228 586 39150 1938562 193862 1239 5392 2303 5589 5589 5589 2689 5589 TABLE 4: ALIGNMENT RESULTS U91572 Mycobactedrlu smegmatis carbamoyl phosphate synthetase (pyrAB) gene, partial cds and orotidine 5'-monophosphate decarboxylase (pyrF) gene, complete cds.

AC009364 Homo sapiens chromosome SEQUENCING IN PROGRESS, 57 unordered pieces.

AC009364 Homo sapiens chromosome SEQUENCING IN PROGRESS, 57 unordered pieces.

Z80108 Mycobacterium tuberculosis H37Rv complete genome: segment 62/162.

AFDT7324 Rhodococcus equl strain 103 plasmid RE-VP1 fragment f.

AU017763 AU01 7763 Mouse two-cell stage embryo cONA Mus musculus cDNA clone J0744A04 3T, mRNA sequence.

Z80108 Mycobacterium tuberculosis H37Rv complete genome; segment 621162.

AC010745 Homo sapiens clone NH0549D18, -SEQUENCING IN PROGRESS ~,3D unordered pleces.

AC010745 Homo sapiens clone NH-0549018, -SEQUENCING IN PROGRESS ~,30 unordered pieces.

E09855 gDNA encoding S-adenosylmethionine synrthetase.

Mycobacterium smegmatis Homo sapiens Homo sapiens Mycobacterlum tuberculosis Rhodocoocus equi Mus musculus Mycobacterlum tuberculosis H-omo sapiens Homo sapiens Corynebacterium gkztamicum rxa02246 1107 rxa02247 756 rxa02248 1389 rxa02249 600 GBPAT:A37831 GBBA2:AF117274 EM-BAI AB003693 GBPAT:E07957 GBPAT:132742 GBPAT:132743 EMBA1.AB003693 GB_PAT:132742 GBPAT:132742 EM_-BA1 AB003693 GB-PAT:E07957 GBPAT:Eo7957 GBPAT:132742 GB_PAT:132743 A37831 AF1 17274 AB003693 E07957 132742 132743 AB003693 Sequence 1 from Patent W09408014. Streptomyoes pristinaespiralis Streptomyces spectabilis fiavoprotein homolog Dfp (dfp) gene, partial cds; and Streptomyces speclabilis S-adenosylmethionine synthetase (metK) gene, complete cds.

Corynebacterium ammonlagenes DNA for rib operon, complete cds. Corynebacterium ammoniagenes gDNA encoding at least guanosine triphasphate cyclohydrolase and riboflavin Corynebacteium synthase. ammonlagenes Sequence 1 from patent US 5589355. Unknown.

Sequence 2 from patent US 5589355- Unknown.

Corynebacosium ammoniagenes DNA for rib operon, complete cds. Corynebaclerium amrnonlagenes Sequence 1 from patent US 5589355. Unknown.

Sequence 1 from patent US 5589355. Unknown.

Corynebacteium ammoniagenes DNA for rib operon, complete cds. Corynebacterium amrnonlagenes gDNA encoding at least guenosine tuiphosphate cyclohydrolase and riboflavin Corynebacterium synthase. ammoniagenes gDNA encoding at least guanosine trtphosphate cydlohydrolase and riboflavin Corynebacterium syntliase. ammoniagenes Sequence 1 from patent US 5589355. Unknown.

Sequence 2 from patent US 5589355. Unknown.

60,870 37,994 37,994 55,844 41,185 38.616 56,282 36.772 36,772 99,515 63,568 65,000 52,909 52,909 52,909 57,937 57,937 57,937 61,843 61,843 61,843 64,346 64,346 64.348 22-MAR-i1997 1-Sep-99 1-Sep-99 23-Jun-98 5-Nov-98 19-OCT-1998 23-Jun-98 21 -Sep-99 21-Sep-99 07-OCT-1997 (Rel. 52, Created) 05-MAR-1 997 31 -MAR-i 999 03-OCT-1 997 (ReL 52, Created) 29-Sep-97 6-Feb-97 6-Feb-97 03-OCT-1997 (Rel. 52, Created) 6-Feb-97 6-Feb-97 03-OCT-1997 52, Created) 29-Sep-97 29-Sep-97 6-Feb-97 6-Feb-97 5589 132742 5589 132742 5589 AB003693 E07957 E07957 132742 132743 2006252111 19 Dec 2006 rxa02250 643 GB_PAT:E07957 GBPAT:132742 EMBA1 ABa03693 TABLE 4: ALIGNMENT RESULTS '5589 E07957 gDNA encoding at least guanosine triphosphate cydlohydrolase and riboflavin synthase.

5589 132742 Sequence 1 from patent US 5589355.

5589 AB003693 Corynebacterium ammoniageries DNA for rib operon. complete cds.

Corynebacteium ammoniagenes Unknown.

Corynebacterium ammoniagenes 56,318 29-Sep-97 55,318 6-Feb-97 56,318 03-OCT-1997 (Rel. 52, Created) 100.000 7-Jan-99 rxa02262 1269 GBBAl :CGL007732 4460 AJ007732 GBBAI:CGAMTGENE 2028 X93513 rxa02263 488 GB_BAI :CGL007732 GBBAl :CGL007732 2246 A1703 4460 AJ007732 Corynebacterium glutamicum 3' ppc gene, secG gene, amt gene, ocd gene and 5 soxA gene.

C.glutamicum amnt gene.

Human cytomegalovirus strain AD 169 complete genarri8:- Corynebacterium glutamicum 3' ppc gene. secO gene. amt gene. ood gone end 5' soxA gene.

Corynebacteium glutamicum 3' ppc gene, secG gene, amt gene, ocd gene and 5' soxA gene.

Corynebacteulum glutamicum Corynebactesium glutamicum human herpesvinis 5 38,651 Corynebacterium gUamicum 100,000 Corynebacterium ghitamicumn 37,526 7-an-99 7-Jan-99 i00,000 29-MAY-1996 rxa02272 1368 EM-PAT:E09373 GBBAI :038505 GBHTG2:AC006595 GBGSS12AQ4111 1591 E09373 Creatmnine delmninase gene.

1591 146070 551 rxa02281 1545 GBEST23:A1128623 363 GB-PL2:ATACO07O19 102335 rxa02299 531 GB_BA2:AF1 16184 540 GB-GSS9AQ1 64310 507 GB VI:MH68TKH 4557 rxaO2Sll 813 GBHTG4ACOO6OS1 176878 GBHTG4AC006091 176878 038505 Bacillus sp. gene for creatinine dearninase, complete ods.

AC006595 Homo sapiens, -SEQUENCING IN PROGRESS 4 unordered pieces.

AQ41 1010 HS_2257_B1_HOLMvR CIT Approved Human Genomic Sperm Library D Homo sapiens genomic dlone Plate=2257 CoI=3 Row--P, genomnic survey sequence.

A1128623 qa62c0l.sl Soares fetal-heartNbHH-119W Homo sapiens cDNA clone IMAGE:- 691328 mRNA sequence.

AC00701 9 Arabidopsis thaiiana chromosome 11 BAC F7138 genomic sequence, complete sequence.

API116184 Corynebacterlum glutamlcum 1-aspartate-apha-decarboxylase precursor (panD) gene, complete cds.

AQ1 64310 HS_2171_-A2_-E01L-MR CIT Approved Human Genomic Sperm Library 0 Homo sapiens genomic dlone Plate=2171 CoI=2 Row--l, genomic survey sequence.

X93468 Murine herpeavirus type 68 thymidine kinase and glycoprotein H genes.

ACOD6091 Drosophila melanogaster chromosome 3 clone BACR4&GO5 (0475) RPCI-98 Bacillus sp.

Bacillus sp.

Homo sapiens Homo sapiens Homo sapiens Arabidopsis thana 96.928 08-OCT-1997 (Rel. 52.

Created) 96,781 7-Aug-g8 36.264 20-Feb-99 38,197 17-MAR-1 999 37,017 05-OCT-1998 33,988 16-MAR-1 999 Corynebactertum glutamlcum 100,000 02-MAY-1999 Homo sapiens murlne herpesvirus 68 Drosophila melanogaster 37,278 15-OCT-1998 40.288 3-Sep-96 36,454 27-OCT-1999 36,454 27-OCT-1999 AC006091 48.G.5 map 91 Fl-91 F13 strain y; 01 bw sp, **SEQUENCING IN PROGRESS 4 unordered pieces.

Drosophila melanog aster chromosome 3 clone BACR48G05 (0475) RPCI-98 Drosophla melanogaster 48.G.5 map 91F1-91F13 strain y; oi bw sp, -SEQUENCING IN PROGRESS 4 unordered pieces.

2006252111 19 Dec 2006 GB_8A2:RRU65510 16259 U65510 TABLE 4: ALIGNMENT RESULTS Rhodospiriflum rubrum CO-Induced hydrogenase operon (cooM, cocK, cool-, Rhodospirillum rubrum cooX, cooU, cooH) genes, Iron sulfur protein (cooF) gene, carbon monoxide dehyclrogenase (cooS) gene, carbon monoxide dehydrogenase accessory proteins (ccoC, cooT, cooJ) genes, putative transciptional activator (cooA) gene, nlcofinate-nucleotide pyrophosphorylase (nadC) gene, complete cds, L-aspartate oxidase (nadB) gene, and alkyl hydroperoxIde reductase (ahpC) gene, partial eds.

37,828 9-Apr-97

C,'

rxaO2315 1752 GBBAl :MSGY224 GBBA1:MTY25DIO GB-BA1:MSGY224 rxa02318 402 GB-HTG3:ACO1 1348 GBHTG3:AC01 1348 1412 40051 40838 40051 111083 ADOD0004 Z95558 AD000004 AC011348 111083 AC011348 89234 AC)1 1412 rxa02319 1080 rxa02345 1320 rxa02350 618 nxa02373 1038 rxa02375 1350 GB BA1:MSGY224 GB BAI:MTY25DI 0 GB-EST23AI1 7213 GB-BA1:BAPURKE GB BA1 MTCY71 GB-BAI:MTCY7I GBBA1:BAPURKE GB_-PLI:SC13OKBXV GBPLl:SCXVORFS GBPAT:E00311 GB PAT:106030 GB-PAT:100836 GB3BA2:CGU31230 GBHTG&:AC009946 GBHTG3:AC009946 40051 40838 476 AD000004 Z95558 A1117213 2582 X91189 42729 42729 2582 129528 50984 1853 1853 1853 3005 Z92771 Z92771 X91189 X94335 X90518 E00311 106030 100836 U31230 Mycobacterium tuberculosis sequence from Cdne y 224 Mycobacterium tuberculosis H37Rv complete genome: segment 28/162.

Mycobacterium tuberculosis sequence from clone y224.

Homo sapiens ch~romosome 5 clone CIT-HSPC_303E1 3, -SEQUENCING IN PROGRESS 3 ordered pieces.

Homo sapiens chromosome 5 clone CIT-HSPC_303E13, -SEQUENCING IN PROGRESS 3 ordered pieces.

Homo sapiens chromosome 5 clone CIT978SKB_811(21, -SEQUENCING IN PROGRESS 3 ordered pieces.

Mycobacteriumn tuberculosis sequence From clone y224.

Mycobactedriu tuberculosis H37Rv complete genome; segment 28/162.

ub83h02.rl Soares 2NbMT Mus musctilus cDNA clone IMAGE1395123 sequence.

B.ammonlagenes purK and purE genes.

Mycobacteriumn tuberculosis H37Rv complete genome; segment 141/162.

Mycobacteuu tuberculosis H37Rv complete genome; segment 141/162.

Bammoniagenes purK and purE genes.

S.cerevisiae 130kb DNA fragment from chromosome XV.

S.cerevlslae DNA of 51 Kb from chromosome XV fight arm.

DNA coding of 2,5-diketogluconic acid reductase.

Sequence 4 from Patent EP 0305608.

Sequence 1 from Patent US 4758514.

Corynebacterium glulamicum Obg protein homolog gene, partial ads, gamma glutamyl kinase (pr9B) gene, complete cds. and (unkdh) gene, complete ads.

Homo sapiens clone NH0012C17, -SEQUENCING IN PROGRESS ~,1 unordered pieces.

Homno sapiens dlone NH0O12C17. -SEQUENCING IN PROGRESS I unordered pieces.

Mycobacterium tuberculosis H37Rv complete genome; segment 1061162.

Drosophila melanogaster chromosome 31J75C1 clone RPCI98-3B320, SEQUENCING IN PROGRESS 78 unordered pieces.

Drosophila melanogaster chromosome 3LI75CI clone ROC198-3B20, SEQUENCING IN PROGRESS 78 unordered pieces..

Mycobacterum tuberculosis Mycobacterium tuberculosis Mycobacteriumn tuberculosis Homo sapians Homo sapiens Homo sapiens Mycobacteriumn tuberculosis Mycobacterium tuberculosis Mus musculus Corynebaclerlum ammoniagenes Mycobactenumn tuberculosis Mycobacterium tuberculosis Corynebacterium ammoniagenes Sacaharornryces cerevisiae Saceharomyces cerevisiae unidentified Unknown.

Unknown.

Corynebacterium ghlutamicumn Homo sapiens Homo sapiens Mycobactedriu tuberculosis Drosophila melanogaster Drosophila melanogaster 37,792 37,792 35,084 61,731 39,624 39.847 64,286 36,617 36,617 56,123 56,220 56,220 99.332 03-DEC-1996 17-Jun-98 2-Sep-98 14-Jan-97 10-Feb-99 10-Feb-99 14-Jan-97 15-Jul-97 1-Nov-95 29-Sep-97 02-DEC-1994 21 -MAY-1993 2-Aug-96 49,418 49,360 38,150 35.821 35,821 06OCT-1999 36,181 06-OCT-1 999 03-DEC-i1996 17-Jun-98 03-DEC-i1996 06-OCT-1 999 169072 AC009946 169072 AC009946 36,115 8-Sep-99 36,115 8-Sep-99 rxa02380 777 GBBA1:MTCY253 41230 Z81368 GBHTG4:ACO1O65a 120754 AC010658 GBHTG4:AC010658 120754 AC010658 38,088 35,817 17-Jun-98 16-OCT-1999 35,817 16-OCT-1999 2006252111 19 Dec 2006 TABLE 4: ALIGNMNT RESULTS X82929 C.glutarnicumn proA gene. rxa02382 1419 GBBA1:CGPROAGEN 1783 Corynebacterirn glutamicum 98,802 Mycobacterium tuberculosis 38,054 Carynebacterum glutamlcum 98,529 GB BA1 :MTCY428 GB-BA2:CGU31 230 26914 Z81451 Mycobacterium tuberculosis H37RY complete genome; segment 107/162.

3005 U31 230 Corynebacterium glutamicumn Obg protein homolog gene, partial cds, gamma glutamyl kinase (proB) gene, complete cds, and (unkdh) gene, complete cds.

23-Jan-97 17-Jun-98 2-Aug-96 9-Sep-94 10-Jun-98 26-Sep-95 10-Jun-99 rxaO2400 693 GBBA1:CGACEA GBPAr:186191 GBPAT:113693 rxa02432 1098 GB-GSS15:A0606842 GBESTI :T05804 GBPLI AB006699 rxa02458 1413 GBBA2:AF114233 GB-EST37AW01306I GBGSS15:AQ650027 rxa02469 1554 GB BA1:MTCY359 GB BAI:MLCB1788 GB BA1:SCAJ1 0601 rxa02497 1050 GBBA2:CGU31224 GBBAl :MTCY2OG9 GB_BA1:SCE7 rxa02499 933 GB-BA2:CGU31225 GBBA1:NG17PLA GB_HTG2:AC007984 rxaO2501 1188 GBBA1:MTCY2OG9 GSBBA1:U00018

GBVI:I-EICG

rxa02503 522 GB PR3AC005328 GBPR3ACOO5545 GB PR3AC0O5328 rxa02504 681 GBBAI:MTCY2OG9 GB PR3AC005328 GB PR3:AC005545 rxa02516 1386 GBBAI:MLCL536 2427 X75504 Oglutamicum aceA gene and thiX genes (partial). Corynebacteriumn glutamic 2135 186191 Sequence 3 from patent US 5700661. Unknown.

2135 1136593 Sequence 3 ftom patent US 5439822. Unknown.

574 AQ606842 HS_5404_B2_E07_T7A RPCI-1 1 Human Male BAC Library H-omo sapiens Homo sapiens genomic clone Plate=980 Col-14 Row=rJ, genornic survey sequence.

406 T05804 EST03693 Fetal brain, Stratagene (cat#936206) Homo sapiens cIDNA clone Homo sapiens HFBDG63 similar to EST containing Alu repeat, mRNA sequence.

77363 AB006699 Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone: MDJ22, Arabidopsis thaliana complete sequence.

1852 AF1 14233 Corynebacterium glutamicumn 5-enolpynivyishiklmate 3-phosphate synthase Corynebacterlumn glutamic (aroA) gene, complete cds.

578 AW013061 ODT-0033 Winter flounder ovary Pleuronedtes americanus cONA done ODT- Pleuronectes americanus 0033.5' similar to FIRUCTOSE-BISPHOSPH-ATE ALDOLASE B (LIVER), mRNA sequence.

728 AQ650027 Sheared DNA-51-2.TF Sheared DNA Trypanosoma brucei genomic clone Trypanosoma brucel Sheared DNA-51-2, genornic survey sequence.

36021 Z83859 Mycobacterium tuberculosis H37Rv complete genome: segment 841162. Mycobacterium tuberailr 39228 AL00861J9 Mycobacterium Ieprae cosmid 131788. Mycobacterium leprae 4692 AJO10601 Streptomyces coelicolor A3(2) DNA for whiD) and whiK loci. Streptomyces; coelicolor 422 U31224 Corynebacterium glutanicumn (ppx) gene, partial cols. Carynebacterium glutamic 37218 Z77162 Mycobactedrn tuberculosis H37Rv complete genome; segment 25/162. Mycobacterium tuberculo 16911 AL049819 Streptonlyces coelicolor cosmid E7. Streptamyces coelicolor 1817 U31225 Corynebactertum glutamicum L-prollne:NADPi- 5-oxidoreductase (proC) gene, Corynebacterlum glutamc Urn 100,000 100,000 100,000 39,716 um 100,000 7-Feb-99 37,915 30-Jun-93 35.526 20-Nov-99 39,175 10-Sep-99 Ils urn Ils 39.281 39.634 59,343 48,899 96,445 59.429 39,510 97.749 22-Jun-99 17-Jun-98 27-Aug-99 17-Sep-98 2-Aug-98 17-Jun-98 10-MAY-1999 2-Aug-96 1920 X13965 129715 AC007984 37218 42991 152261 35414 43514 35414 37218 35414 43514 36224 ZT'7162 U00011 X14112 AC005328 AC005545 AC005328 Z77162 A0005328 AC005545 Z991 25 complete cds.

Neisserla gonorrhoeae pilA gene.

Drosophila melanogaster chromosome 3 clone BACRO5C10 (D781) RPCI-98 05.C.10 map 97D-97E strain y; cin bw sp, SEQUENCING IN PROGRESS 87 unordered pieces.

Mycobacteriumn tuberculosis H37Rv complete genome; segment 25/162.

Mycobacterium leprae cosmid B2168.

Herpes simplex virus (HSV) type 1 complete genome.

Homo sapiens chromosome 19, cosmid R26660, complete sequence.

Homo sapiens chromosome 19, cosmid R26634, compldte sequence.

Homo sapiens chromosome 19, cosmid R26660, complete sequence.

Mycobacteriumn tuberculosis H37Rv complete genome; segment 25/1162.

Homo sapiens chromosome 19, cosmld R26660, complete sequence.

Homo sapiens chromosome 19, osmid R26634, complete sequence.

Mycobacterium leprae cosmid L536.

Neisseria gonorrhoeae Drosophila melanogaster Mycobacterium tuberculosis Mycobacterium leprae human herpesvirus 1 Homo sapiens Homo sapiens Horno sapiens Mycobacterium tuberculosis Homo sapiens Homo sapiens Mycobacterium lepre 43,249 30-ep-93 33,406 2-Aug-99 39,357 17-Jun-98 51,768 01-MAR-1994 39,378 17-Apr-97 39,922 28-Jul-98 39,922 3-Sep-98 34,911 28-Jul-98 54.940 17-Jun-98 41,265 28-Jul-98 41,265 3-Sep-98 37,723 04-DEC-1 998 2006252111 19 Dec 2006 rxaO2517 570 rxa02532 1170 rxa02536 879 GB_BA1:U00013 GBBA1:MTVOO7 GB_ BA:MILCL5636 GB_ BA1:U00013 GB BAI :SCC22 GBOV:AF137219 GBLEST30:A1645057 35881 32806 36224 35881 22115 831 301 U00013 AL021 184 Z99125 U00013 AL.096839 AF137219 A1645057 TABLE 4: ALIGNMENT RESULTS Mycobacter leprae cosmid B1496. Mycobactedriu leprae Mvycobacterlum tuberculosis H37Rv complete genome: segment 641162. Mycobacterlumn tuberculosis Mycobacterium leprae cosmid L536. Mycobacterlumn leprae Mycobacteriumn leprae cosmid B1496. Mycobacterlum leprae Streptomyces coelicolor cosmid C22. Streptomyces coelicolor Ania calva mixed lineage leukemia-like protein (Mlu) gene, partial ods. Arnia calve vs52alO.y1 Stratagene mouse Tcell 937311 Mus mnusculus cDNA clone Mus musculus IMAGEA 1149882 mRNA sequence.

vsS2alO.rl Stratagene mouse Teell 937311 Mus musculus cDNA done Mus musculus 1MAGE1149882 mRNA sequence.

Homo sapiens chromosome 8 clone PAC 172N1 3 map 8q24, -Homo sapiens SEQUENCING IN PROGRESS 1, in unordered pieces.

Homo sapiens chromosome 8 clone PAC 172N1 3 map 8q24,. Homo sapiens SEQUENCING IN PROGRESS in unordered pieces.

Arabidopsis thallana DNA chromosome 4, BAC dlone T12J15 (ESSAII project). ArabidopsIs thaliana 37,723 61,335 37,018 37,018 37,071 36,853 41,860 01-MAR-I1994 17-Jun-98 04-DEC-i1998 01-MAR-I1994 12-Jul-99 7-Sep-99 29-Apr-99 GBEST20:AA822595 429 AA822595 GBHtTG2:AF130866 118874 AF130866 GBHTG2:AF130866 118874 AF130866 GBPL1:ATT12J5 84499 AL035522 GB BA1:MTCY279 9150 Z97991 GB7BA1:MSGBI97OCS 39399 L78815 42,353 17-Feb-98 40,754 21-MAR-1 999 40,754 21-MAR-1999 35,063 24-Feb-99 37.773 17-Jun-98 39,024 1 5-Jun--96 rxa02550 1434 Mycobacterium tuberculosis H37Rv complete genome; segment 17)1162.

Mycobacterium leprae cosmld B1 970 DNA sequence.

Mycobacterium tuberculosis Mycobacterlumn lepre GBBA2:SC2H4 25970 AL031514 Streptomyces coelicolor cosmid 2H-4.

Streptomyces coelicolor A3(2) 37,906 19-OCT-1 999 rxaO2559 1026 GB BA1 :MTVOO4 GB_ PAT:128684 GB-BA1 :MTU27357 rxa02622 1683 GB_ BA2:AE001780 GB_0V:AF064564 GBOV:AF064564 rxa02623 714 GBGSS5:AQ81 8728 GB-HTG5:AC01 1083 GBGSS6:A0826948 rxe02629 708 GBVl:BRSMGP

GB..VI:BRSMGP

69350 AL009198 Mycobactedrlu tuberculosis H37Rv complete genome: segment 1441162. Mycobactedrlu tuberculosis 5100 128684 Sequence 1 from patent US 5573915. Unknown.

5100 U27357 Mycobacteuum tuberculosis cydloprapane mycolic acid synthase (cmal) gene, Mycobacterium tuberculosis complete cds.

11997 AE001780 Thermotoga maritima section 92 of 136 of the complete genome. Thermotoga maritima 49254 AF064564 Fugu rubripes neurofibromnatosis type I (NFl), A-kinase anchor protein Fugu rubuipes (AKAP84), BAW protein (BAVV), and WSBI protein (WSBi) genes, complete cds.

49254 AF064564 Fugu rubripes; neurofibromatosis type I (NFl), A-kinase anchor protein Fugu rubnipes; (AKAP84), BAW protein (BAW), and WSBI protein (VWSBI) genes, complete eds.

444 AQBI 8728 HS_5268_AlG09_SP6E RPCI-1 1 Human Male BAC Ubrary Homo sapiens Homno sapiens genomic clone Plate=844 Col-I17 Row--M, genomic survey sequence.

198586 AC01 1083 Homo sapiens chromosome 9 clone RP1 1-111 M7 map 9, WORKING DRAFT Homo sapiens SEQUENCE, 51 unordered pieces.

544 A0826948 HS_5014_A2_C12_T7A RPCI-11 Human Male BLAC Librry Homo sapiens Homo sapiens genomic done Plate=590 Col=24 Row-E, genomic survey sequence.

462 M86652 Bovine respiratory syncylial virus membrane glycoprotein mRNA, complete Bovine respiratory synicytial cds. virus 462 M86652 Bovine respiratory syncytlal virus membrane glycoprotein mRNA, complete Bovine respiratory syncytial eds. vius 47,358 39,138 39,138 18-Jun-98 6-Feb-97 26-Sep-95 39,732 17-Aug-99 36,703 17-Aug-99 38,801 26-Aug-99 35,714 19-Nov-99 39,146 27-Aug-99 37,013 28-Apr-93 37,013 28-Apr-93 2006252111 19 Dec 2006 rxa02645 1953 GB PAT:A45577 GBPAT:A45581 GB-BAI :CORILVA rxa02846 1392 GBBAIVOORILVA TABLE, 4: ALIGNMENT R.ESULTS 1925 A45577 Sequence 1 from Patent WV095 19442.

'1925 A45581 Sequence 5 from Patent W095 19442.

1925 101508 Corynebacterium glutamicum threonine dehydratase (ilvA) gene, complete cds.

1925 L01508 Corynebacterlum glutamicuim threonine dehydretase (IlvA) gene, complete ods.

1925 A45585 Sequence 9 from Patent W095119442.

1925 A45583 Sequence 7 from Patent W095 19442.

2049 M831 11 Ictalurus punctatus cyclic nucleotide-gated channel RNA sequenice.

345 AA265464 mx9l cOG.rl Soares mouse NMVL Mus musculus cONA clone 11AGE693706 mRNA sequence.

480 AQ006950 CIT-K-SP-22941E14.TR CIT-I-SP Homo sapiens genornic clone 2294EI4, genomic survey sequence.

Corynebacterium glutamicumn Corynebacterium glutamicumn Corynebacterum glutamlcumn Corynebacterium glutamnicumn 99,138 39,130 39,130 39,130 07-MAR-1 997 07-MAR-1997 26-Apr-93 25,-Apr-93 07-MAR-i1997 07-MAR-1 997 24-MAY-1993 2D-MAR-1997 rxa02648 1326 GBPATLA4S55 GBPAT9A45583 GB OV:ICTCNC GBESTi1 AA265464 Corynebacterium glutemicumn Corynebactelum glutamicum Icialurus punctatus Mus musailus Homo sapiens 99,066 99,066 38.402 38,655 36,074 27-Junl-98 rxa02653 rxa02687 1069 rxa02717 1005 rxa02754 1461 GBBAI :CORPHEA GBPAT:E04483 GBPAT:E06110 GB P1:HVCH4H GB-PR2:HS31OH5 GB-PR3:AC004754 GBHTG2:AC008223 GB.HTG2-AC008223 GBBAIVMTCY71 GBHTG5:AC01 1678 GB-HTG5:ACO1 1678 GBBA2:AF064070 1088 M1 3774 C.glutamicum pheA gene encoding prephenate dehydratase. complete cds. Corynebacterium glutamicum 948 E04483 DNA encoding prephenate dehydratase. Corynebacterlum glutamicum 948 E061 10 DNA encoding prephenate dehydratase. Corynebacterium glutemicumn 59748 Y14573 Hordeum vulgare DNA for chromosome 4H. Hordeum vulgare 29718 Z69705 Human DNA sequence from cosmid 3101-15 from a contlg from the tip of the Homo sapiens short arm of chromosome 16, spanning 2Mb of 16p 1 3 3 Contains EST and CpG island.

39188 AC004754 Homo sapiens chromosome 16, cosmld clone RT286 (LANI), complete Homo sapiens sequence.

130212 AC008223 Drosophila melanogaster chromosome 3 clone BACR16118 (D815) RPCI-98 Drosophila melanogester 16.1.18 map 95A-95A strain y; on bw sp, -SEQUENCING IN PROGRESS-, 101 unordered pieces.

130212 AC008223 Drosophila melanogaster chromosome 3 done BACR16118 (D815) RPCI-98 Drosophila melanogaster 16.1.18 map 95A-95A strain y; on bw sp, SEQUENCING IN PROGRESS 101 unordered pieces.

42729 Z92771 Mycobactedrlu tuberculosis H37Rv complete genome; segment 141/162. Mycobacterium tuberculosis 171967 AC011678 H-omo sapiens clone 14B3_, -SEQUENCING IN PROGRESS .20 Homo sapiens unordered pieces.

171967 ACOI 1678 Homo sapiens clone 14137, -SEQUENCING IN PROGRESS -,20 Homo sapiens unordered pieces.

23183 AF064070 Burkholcleria pseudomailei putative dihydroorotase (pyrC) gene, partial cds; Burkhideria pseudomallel putative I1-acyl-sn-glycerol-3-phosphate acyltransferase (pIsC), putative diadenosine tetraphosphatase (apaH), complete cds; type 11 0-antigen biosynthesis gene cluster, complete sequence; putative undecapranyl phosphate N-acetylglucosamintrtansferase, and putative UDP-glucose 4epimerase genes, complete ods; and putative galactosyl lrnsferase gene, partial cds.

99,715 98,52 98,523 36,593 36,089 36,089 28-MAY-1 998 32,757 2-Aug-99 32,757 2-Aug-99 25-Apr-93 29-Sep-97 29-Sep-97 25-MAR-i1999 22-Nov-99 37,838 35,331 10-Feb-99 5-Nov-99 rxa02758 1422 33,807 5-Nov-99 36,929 20-Jan-99 2006252111 19 Dec 2006 rxa02771 678 GBBA2:AF038651 4077 GB IN1:CELT19B4 37121 GBEST36:AV193572 360 GBBAZ:AF038651 4077 rxa02772 1158 rxa02790 1266 GBBAI :MTCY227 GBBA1:UOOO1 I GB BAI :MTCYI 59 GBPR4:AC006561 3594 40429 33818 172931 TABLE 4: AILIGNMNT RESULTS AF038651 Corynebacterium glutamicumn dipeptide-bindig protein (dciAE) gene, partial Corynebacten cds; adenine phosphorlbosyltansferase (apt) and GTP pyrophospholdnase (reQ genes, complete cds; and unknown gene.

U80438 Caenorhabditis elegans cosmid Ti 9134. Caenorhabdis AV1 93572 AV1 93572 Yuji Kohara unpublished cDNA:Strain N2 hermaphrodite embryo Caenorhabdit Caenorhabditis elegans cDNA clone yk6l 8h8 mRNA sequence.

AF038651 Corynebacteium glutamicumn dipeptide-binding protein (dciAE) gene, partial Corynebacterl edls; adenine phosphoribosytransferase (apt) and GTP pyrophospholdnase (reD genes, complete cds; and unknown gene.

Z77724 Mycobacteriumn tuberculosis H37Rv complete genome: segment 1141162. Mycobacteniuir U00011I Mycobacteriumn Ieprae cosmid Bl 177. Mycobactenriu Z83863 Mycobactedriu tuberculosis H-37Rv complete genome; segment 111/1l62. Mycobacteriuir AC006581 Homo sapiens 12p21 BAC RPCI1 1-259018 (Roswell Park Cancer Institute Homo sapiens Human BAC Library) complete sequence.

AC006581 Homo sapiens l~p21 BAC RPCII11-259018 (Roswell Park Cancer Institute Homo sapiens Human BAC Library) complete sequence.

Z83863 Mycobacterium tuberculosis H37Rv complete genome; segment 111/162. Mycobacteriunm M35195 Chicken tyrosine kinase (cek2) mRNA, complete ods. Gallus gaenus Z1 7372 M.smegmatis asd, ask-alpha, and ask-beta genes. Mycobacteriumr A1223401 qg48gOl.xl Soares -tesisNHT Homo sapiens cDNA clone IMAGE:1838448 Homo sapiens 3 similar to VP.C25D7.8 CE08394 mRNA sequence.

A1223401 qg48g01.xl Soares -testisNHT Homo sapiens cDNA dlone IMAGE:1 838448 Home sapiens 3 sImnilar to WVP:C25D7.8 CE08394;, mRNA sequence.

im glutamicum 99,852 elegans elegans ~m glutamicum ~tuberculosis leprae tuberculosis tuberculosis smegmatis 43,836 48,588 99,914 38,339 38,996 37.640 37,906 14-Sep-98 04-DEC-1996 22-Jul-99 14-Sep-98 17-Jun-98 01-MAR-i1994 17-Jun-98 3-Jun-99 GB-PR4AC006581 172931 35,280 3-Jun-99 rxalJ2791 951 GB BA1 :MTCY1 59 GBOV:CHKCEK2 GBBAl :MSASDASK rxa028O2 1194 GBEST24A223401 33818 3694 5037 169 39,765 38,937 38,495 40,828 17-Jun-98 28-Apr-93 9-Aug-94 27-OCT-1998 GBEST24:A1223401 169 40,828 27-OCT-1 998 rxa02814 494 GBBAl :MTCY7D 1I GBBA1 :MTCY7D1 1 GBPR1:HSAJ2962 rxa02843 6308 GBBAt :CGAJ4934 GB_ BAl :MTC 1364 GBBA1:MLU1518O rxs03205 963 GB BAI:8LSIGBGN GBEST21:AA980237 22070 22070 778 1160 29540 38675 2906 377.

Z95120 Mycobactenriu tuberculosis H37Rv complete genome; segment 138/162.

Z95120 Mycobacteriumn tuberculosis H37Rv complete genome; segment 1381162.

AJO02962 Homo sapiens mRNA for hB-FABP.

AJ004934 Corynebacteium glutamicum dapD gene, complete CDS.

Z93777 Mycobacteiumn tuberculosis H37Rv complete genome; segment 521162.

U15180 Mycobacteilum leprae cosmid B1756.

Z49824 Blactofermentum ortl gene and sigB gene.

AA980237 ua32e12.rl Soeres-man-tmery,gland NbMMG Mus musculus cDNA dlone IMAGE1348414 5' similar to TR:061025 061025 HYPOTHETICAL 152 KD PROTEIN.;, mRNA sequence.

A1158316 ud27c05.rl Soares-thymus 2NbMT Mus musculus cDNA clone IMAGE1447112 mRNA sequence.

AL031910 Loishmania major Frledtin chromosome 4 cosmid L2743.

AL09671 0 Human DNA sequence from clone RP1-61B32 on chromosome 6pi 1.2-12.3 Contains isoforms I and 3 of BPAG1 (bullous pemphigoid antigen 1 (230I24akW), an exon of a gene similar to murine MACF cytoskeletal protein, STSs and GSSs, complete sequence.

Mycobacterium tuberculosis Mycobacterium tuberculosis Home sapiens Corynebacterum glutamicumn Mycobacteriumn tuberculosis Mycobacternum leprae Corynebacterium glutamioumn Mus musculus Mus musculus Leishmania major Homo sapiens 58,418 40,496 39,826 100,000 37.710 39,626 98,854 41,489 17-Jun-98 17-Jun-98 8-Jan-98 17-Jun-98 17-Jun-98 09-MAR-i1995 25-Apr-96 27-MAY-I1998 GBEST23A158316 371 GB INI:MFL2743 3831 GB-PR3:HSDJ61 82 119 38,005 30-Sep-98 39,869 15-DEC-1999 34,930 17-DEC-I1999 rxs03223 1237 38 36 2006252111 19 Dec 2006 TABLE 4: ALIGNMENT RESULTS GBPR3:HSDJ6I B2 119666 AL096710 Human DNA sequence from clone RPl-6182 on chromosome 6p1 1.2-12.3 Homo sapiens Contains isoforms 1 and 3 of BPAGI (bulious pemphigoid antigen 1 (230/24OkD), an exon of a gene similar to murine MACF cytoskeletal protein, STSs and GSSs, complete sequence.

34,634 17-DEC-1999

Claims (39)

1. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, or a full complement thereof.

2. An isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO: 6, or a full complement thereof.

3. An isolated nucleic acid molecule which encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6, or a \full complement thereof. O

4. An isolated nucleic acid molecule comprising a nucleotide sequence which is at least identical to the entire nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, or a full complement thereof. The isolated nucleic acid molecule of claim 4, wherein the nucleic acid molecule encodes a metabolic pathway protein involved in the metabolism of an amino acid.

6. An isolated nucleic acid molecule comprising a fragment of at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, or a full complement thereof.

7. An isolated nucleic acid molecule encoding a polypeptide comprising an amino acid sequence of at least 50% identity to the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6, or a full complement thereof.

8. An isolated nucleic acid molecule comprising the nucleic acid molecule of any one of claims 1-7 and a nucleotide sequence encoding a heterologous polypeptide.

9. A vector comprising the nucleic acid.molecule of any one of claims 1-8. The vector of claim 9, further comprising at least one additional metabolic pathway nucleic acid molecule.

11. The vector of claim 10, wherein the at least one additional metabolic pathway nucleic \O acid molecule comprises a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth as odd-numbered sequences in Table 1, excluding any F- designated nucleic acid molecules.

12. The vector of claim 9 or 10, which is an expression vector.

13. A host cell transfected with the expression vector of claim 12.

14. The host cell of claim 13, wherein said cell is a microorganism. IO The host cell of claim 14, wherein said cell belongs to the genus Corynebacterium or Brevibacterium.

16. The host cell of claim 13, wherein the expression of said nucleic acid molecule results in the modulation in production of a fine chemical from said cell.

17. The host cell of claim 16, wherein said fine chemical is an amino acid.

18. The host cell of claim 17, wherein said amino acid is methionine or lysine.

19. A method of producing a polypeptide comprising culturing the host cell of claim 13 in an appropriate culture medium to, thereby, produce the polypeptide. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6.

21. An isolated polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or SEQ ID

22. An isolated polypeptide comprising an amino acid sequence which is at least identical to the entire amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6.

23. An isolated polypeptide comprising an amino acid sequence of at least 15 contiguous amino acid residues of the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6.

24. An isolated polypeptide comprising a naturally occurring allelic variant of a polypeptide Scomprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6. O S 25. An isolated polypeptide which is encoded by a nucleic acid molecule comprising a d nucleotide sequence which is at least 50% identical to the entire nucleotide sequence of SEQ ID NO:3 or SEQ ID

26. The isolated polypeptide of any one of claims 20-25, further comprising heterologous amino acid sequences. S 27. A method for producing a fine chemical, comprising culturing the cell of claim 13, such that the fine chemical is produced.

28. The method of claim 27, wherein said cell is cultured in the presence of a sulfur source.

29. The method of claim 27, wherein said method further comprises the step of recovering the fine chemical from said culture. The method of claim 27, wherein said fine chemical is an amino acid.

31. The method of claim 30, wherein said amino acid is methionine or lysine.

32. The method of claim 27, wherein said cell belongs to the genus Corynebacterium or Brevibacterium.

33. The method of claim 27, wherein said cell is selected from the group consisting of: Corynebacterium glutamicum, Corynebacterium herculis, Corynebacterium, lilium, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium acetophilum, Corynebacterium ammoniagenes, Corynebacterium fujiokense, Corynebacterium nitrilophilus, Brevibacterium ammoniagenes, Brevibacterium butanicum, Brevibacterium divaricatum, Brevibacterium flavum, Brevibacterium healii, Brevibacterium ketoglutamicum, Brevibacterium ketosoreductum, Brevibacterium lactofermentum, Brevibacterium linens, Brevibacterium paraffinolyticum, and those strains set forth in Table 3.

34. A method for producing a fine chemical, comprising culturing a cell whose genomic NO DNA has been altered by the inclusion of a nucleic acid molecule of any one of claims 1 8. The method of claim 34, wherein the genomic DNA has been altered by the inclusion of at least one additional metabolic pathway nucleic acid molecule.

36. The method of claim 35, wherein the at least one additional metabolic pathway nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth as odd-numbered sequences in Table 1, excluding any F- designated nucleic acid molecules. O

37. The method of claim 35, wherein the at least one additional metabolic pathway nucleic acid molecule is selected from the group consisting of metZ, metC, metB, metA, metE, metH, hom, asd, lysC, lysC /ask, rxa00657, dapA, dapB, dapC, dapD/argD, dapE, dapF, lysA, ddh, lysE, lysG, lysR, hsk, ppc, pycA, accD, accA, accB, accC, gpdh genes encoding glucose-6-phophate-dehydrogenase, opcA, pgdh, ta, tk, pgl, ripe, rpe or any combination thereof.

38. The method of claim 35, wherein said metabolic pathway is methionine or lysine metabolism.

39. A method of modulating the yield of a fine chemical from a cell comprising introducing into a cell one or more metabolic pathway genes, wherein at least one metabolic pathway gene is selected from the group consisting of the nucleic acid molecules of any one of claims 1-8, thereby modulating the yield of a fine chemical. The method of claim 39, wherein said metabolic pathway gene or genes are integrated into the chromosome of the cell.

41. The method of claim 39, wherein said metabolic pathway gene or genes are maintained on a plasmid.

42. The method of claim 39, wherein said fine chemical is an amino acid.

43. The method of claim 42, wherein said amino acid is methionine or lysine.

44. The method of claim 39, wherein the nucleotide sequence of said metabolic pathway gene or genes has been mutated to increase yield of a fine chemical. A method for diagnosing the presence or activity of Corynebacterium diphtheriae in a subject, comprising detecting the presence of at least one of the nucleic acid molecules of claims 1-8 or at least one of the polypeptide molecules of claims 20-25, thereby diagnosing the presence or activity of Corynebacterium diphtheriae in the subject. S 46. Use of at least one of the nucleic acid molecules of claims 1-8 or the polypeptide molecules of claims 20-25 in the diagnosis of the presence or activity of Corynebacterium diphtheriae in a subject.

47. A host cell comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or 5, wherein the nucleic acid molecule is disrupted.

48. A host cell comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or 5, wherein the nucleic acid molecule comprises one or more nucleic acid modifications as compared to the nucleotide sequence of SEQ ID NO:3 or

49. A host cell comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or 5, wherein the regulatory region of the nucleic acid molecule is modified relative to the wild-type regulatory region of the molecule. DATED this 18th day of December 2006 BASF AKTIENGESELLSCHAFT WATERMARK PATENT TRADE MARK ATTORNEYS 290 BURWOOD ROAD HAWTHORN VICTORIA 3122 AUSTRALIA P21779AU01 WO 01/66573 WO 0166573PCTIBOOIO2035 U <110> <120> SEQUENCE LISTING BASF Aktiengeselischaft CORYNEBAqTERIUM GLUTAMICUM GENES.ENCODING METABOLIC PATHWAY PROTEINS <130> BGI-: <140> <141> <150> 09/6( <151> 2000 <150> 60/21 <151> 2000- <160> 125 <170> Pate! <210> 1 <211> 1840 <212> DNA <213> Coryi <22 0> <221> CDS <222> (363: <400> 1 cagaaactgt ctgtatgccg aattcttaac agtggggcta aaaaagtcaa aagctgttca aa atg cca Met Pro 121CP2PC 06740 -06-23 37970 -03-09 itln Vers. -eba ct e rum glutamicum ).(1676) gtgcagaaat gcatgcagaa aaa atgatcggat ctttqacagc tgg aatggaaaag taacattgag aga gtcatacccc cataacccta gct gaaaattacc cgagaattaa ttt gtaggqtgca tgggagaaga att aag tac gac aat too aat g Lys Tyr Asp Asn Ser Asn A .ggaaagt tcgggccaag atgggtgttt rgtatgcq acaaatcacc gagagttgtt tgattta taccatcctg caccatttag gtacgca atcgatttca aatcagttgg ataccac acagtctatt gcaatagacc tcctaat aaaaactctt aaggacctcc 'ct gac cag tgg ggc ttt gaa l1a Asp Gin Trp Gly Phe Glu 10 gta gao gca cag acc agc gca Val Asp Ala Gin Thr Ser Ala 25 gct ttc gtq ttc gac tco gct Ala Phe Val Phe Asp Ser Ala gag gat cta ggc cot gtt tac Giu Asp Leu Gly Pro Val Tyr got ttg gaa aac cgc atc gt aco ogc too att cac gca ggc cag tca Thr Arg Ser Ile His Ala Gly Gin Ser cga aac ott ccg atc tac caa tcc aco Arg Asn Leu Pro Ile Tyr Gin Ser Thr 40 gag cac goc aag cag ogt tto gca ctt Glu His Ala Lys Gin Arg Phe Ala Leu 55 toc cgc ctc acc aac cca acc gtt gag WO 01/66573 WO 0166573PCTIBOOIO2O35 Ser Arg Leu Thr Asn Pro Thr Val Glu Ala Leu Giu Asn 70 Arg Ile Ala tcC Ser gca Al a gt c Val1 act thr ga c Asp ttc Phe 160 gcg Ala aac Asn gac Asp gga Gly gaa Glu 240 gct Ala ct c Leu gca Al a ctc Leu a cc Thr a cc Thr ctt Leu cct Pro 145 ggc Gly gt g Val a cc Thr gtt Val ctg Leu 225 aag Lys tac Tyr aag Lys ttc Phe gaa Giu acc Thr t cc Ser aac Asn 130 gag Glu gag Glu gct Ala atc Ile gt c Val 210 ggc Gly gat Asp cac His gt t Val aac As n 290 ggt Gly aac Asn cca Pro 115 cgc Arg t cc S er act Thr gaa Glu gct Ala 195 gtc Val 99C Gly gga Gly gga Gly cgc Arg 275 gca Ala ggc Gly gcc Ala 100 cgc Arg ctg Leu t gg Trp ttc Phe gtt Val 180 acc Thr gct Ala gt g Val aag Lys ttg Leu 260 gt t Val t gg Trp gt c Val1 85 at t Ile ct c Leu ggt Gly cag Gin gcc Ala 165 gcg Ala gca Ala tcc Ser ctt, Leu cca Pro 245 aag Lys ggc Gly gct Ala cac His ttg Leu tac Tyr at c Ile gca Ala 150 aac Asn cac His gcg Ala ctc Leu atc Ile *230 gta Val tac Tyr ctt Leu gca Ala gct Ala aa c Asn ggt Gi y gat Asp 135 gcc Al1a cca Pro cgc Arg ct c Leu acc Thr 215 gac Asp ttc Phe gca Al a cta Leu gt C Val1 295 gt a Val ct g Leu ggc Gly 120 gtt Val gtt Val ca g Gin aac Asn gtg Val 200 aag Lys ggc Gly ccc Pro gac Asp cgc Arg 280 cag Gln gcg Ala gca Al a 105 a cc Thr t cc Ser cag Gin gca Ala agc Ser 185 cgc Arg tt C Phe gga Gly t ac Tyr ctt Leu 265 gac Asp ggc Gly tt c Phe 90 gga Gly gag Glu ttc Fhe cca Pro gac Asp 170 gt t Val1 ccg Pro tac Tyr aag Lys ttc Phe 250 ggt Gly a cc Thr atc Ile tcc Ser gcg Al a act Thr gt g Val1 aac Asn 155 gt c Val cca Pro ct c Leu acc Thr tt c Phe 235 gt c Val gca Ala ggc Gly gac Asp t cc Ser ggC Gly ct a Leu gaa Glu 140 acc Thr ct g Leu ct g Leu gag Glu ggc Gly 220 gat Asp act Thr cca Pro tcc Ser acc Thr 300 gga Gly gac Asp ttC Phe 125 aac Asn aaa Lys gat Asp atc Ile ctc Leu 205 aac Asn tgg Trp cca Pro gcc Al a acc Thr 285 ctt Leu cag Gin cac His 110 ct t Leu ccc Pro gca Al a att Ile atc Ile 190 ggC Gly ggc Gly act Thr gat Asp tt c Phe 270 ct c Leu t cc Ser gcc Ala atc Ile atc Ile gac Asp tt c Phe cct Pro 175 gac Asp gca Ala t cc Ser gtc Val1 gct Ala 255 ggc Gly tcc Ser ct g ELeu 647 695 743 791 839 887 935 983 1031 1079 1127 1175 1223 1271 1319 cgc ctg gag cgc cac aac gaa Arg Leu Glu Arg His Asn Glu aac gcc atc aag gtt gca gaa ttc ctc Asn Ala Ile Lys Val Ala Glu Phe Leu WO 01/66573 WO 0166573PCTIBOO/02035 aac Asn 320 tcc Ser tcc Ser tt t Phe gt t Val ga c Asp 400 ctg Leu ggc Gly 305 aac cac Asn His cct tgg Pro Trp gtt ctc Val Leu atc gac Ile Asp 370 cgc tcc Arg Ser 385 gaa gct Giu Ala tcc gtt Ser Val ggc ttt Gly Phe 310 gaa aag gtt aac Glu Lys Val Asn aag gaa aag ctt Lys Giu Lys Leu 345 atc aag ggc ggc Ile Lys Gly Gly 360 cta cac tcc aac Leu His Ser Asn 375 cac cca gca acc His Pro Ala Thr 390 cgc gcg ggc gtt Arg Ala Gly Val acc att gat gat Thr Ile Asp Asp 425 tag ctttaaatag i 1367 1415 1463 1511 1559 1607 1655 1706 1766 1826 1840 Ile Ile Ala Asp Leu Glu 430 ~ctcacccca gtgcttaaag cgctgggttt ttctttttca gactcgtgag a tatacactgg acgaagtttt agtcttgtcc ac ccctcgcgcc ttca <210> 2 <211> 437 <212> PRT <213> Corynebacterium glutanicui <400> 2 Met Pro Lys Tyr Asp Asn Ser Asn Ala 1 5 Arq Ser Ile His Ala Gly Gin Ser Val 25 Asn Leu Pro Ile Tyr Gin Ser Thr Ala 40 His Ala Lys Gin Arg Phe Ala Leu Giu 55 Arg Leu Thr Asn Pro Thr Val Glu Ala 70 tgcaaact agactagaca gagctgtcca ccagaaca ggcggttatt ttcatgccca Gin Trp Gly Phe Glu Thr Ala Gin Thr Ser Ala Arq Val Phe Asp Ser Ala Glu Leu Gly Pro Val Tyr Ser Glu Asn Arg Ile Ala Ser 75 WO 01/66573 WO 0166573PCT/IBOO/02035 His Leu Tyr Ile Ala 150 Asn His Ala Leu Ile 230 Val Tyr Leu Al a Glu 310 Glu Lys Ile Leu His 390 Ala Asn Gly Asp 135 Ala Pro Arg Leu Thr 215 Asp Phe Ala Leu Val 295 Asn Lys Glu Lys His 375 Ser Gly Leu Glu 140 Thr Leu Leu Glu Gly 220 Asp Thr Pro Ser Thr 300 Ala Gly Lys Glu Asn 380 Gly Asp Phe 125 Asn Lys Asp Ile Leu 205 Asn Trp Pro Ala Thr 285 Leu Gl u Leu Tyr Al a 365 Ile Ala Ala Ile Val Ile Thr Asp Asp Phe Phe 160 Pro Ala 175 Asp Asn Ala Asp Ser Gly Val Glu 240 Ala Ala 255 Gly Leu Ser Ala Leu Arg Leu Asn 320 Asp Ser 335 Gly Ser Ala Phe Asp'Val Ser Asp 400 Ser Leu Val Val Pro Ala Thr Thr His Ser Gin WO 01/66573 WO 0166573PCT/IBOO/02035 Glu Ala Gly Leu Ala Arg Ala Gly Val Thr Gln Ser Thr Val Arg Leu 405 410 415 Ser Val Gly Ile Glu Thr Ile Asp Asp Ile Ile Ala Asp Leu Glu Gly 420 425 430 Gly Phe Ala Ala Ile 435 <210> 3 <211> 1495 <212> DNA <213> Corynebacterium glutamicum <220> <221> COS <222> (1264) <400> 3 ccatggtttc ctcagcggaa acggcttggc tatcagcact gaagtgcgac ggctaacagg gctgggattg tcctcaactt taataggttc gtagaaaagt ttactagcct agagagtatg attgaaqaat cgccggacct tgaaatggac ccggtttcca ggttgcggaa agtgattttg gcacctgccc gcagttgaag ttcacccgaa cacttcgggc cgatttcctg gaagacgtgc gaagct atg Met cagcctgcaa tccttcttag aactcgaaga ttcctttgtg gca gat Ala Asp gcc Ala aat Asn aat Asn ctt Leu ttg Leu cag Gin aag Lys 100 aac gag Glu gcg Al a gaa Glu att Ile gca Al a at c Ile ttc Phe Ctg gtc Val gga Gly ttC Phe ttc Phe cct Pro gat Asp ggt Gly 105 gt C t ac T yr gag Glu ccg Pro cct Pro gag Glu gag Glu tca Ser gaa gct act Ala Thr ggg ttt Gly Phe cgt ggC Arg Gly atc att Ile Ile gtg act Val Thr aag gaa Lys Glu tgc aat Cys Asn cgc gag 120 180 240 295 343 391 439 487 535 583 631 679 WO 01/66573 PCT/I'BOO/02035 Asn Pro Len Gly Thr Val Phe Ser Giu Giu Tyr Ile Arg Giu Leu Thr C21120 125 130 gat att gcg gcg aag tac gat gcc cgc atc atc gtc gat gag atc cac 727 Asp Ile Ala Ala Lys Tyr Asp Ala Arg Ile Ile Val Asp Gin Ile His 135 140 145 gcg cca ctg gtt tat gaa ggc acc cat gtg gtt gct gct ggt gtt tct 775 Ala Pro Leu Val Tyr Gin Gly Thr His Val Val Ala Ala Giy Val Ser 150 155 160 gag aac gct gca aac act tgc atc acc atc acc gca act tct aag gcg 823 Gin Asn Ala Ala Asn Thr Cys Ile Thr Ile Thr Ala Thr Ser Lys Ala C1165 170 175 C1 tqg aac act gct ggt ttg aag tgt gct cag atc ttc ttc agt aat gaa 871 Trp Asn Thr Ala Gly Leu Lys Cys Ala Gin Ile Phe Phe Ser Asn Glu 180 185 190 195 gcc gat gtg aag gcc tgg aag aat ttg tcg gat att acc cgt gac ggt 919 Ala Asp Val Lys Ala Trp Lys Asn Len Ser Asp Ile Thr Arg Asp Gly 200 205 210 gtg tcc ata ctt gga ttq atc gct gcg gag aca gtg tac aac gag ggc 967 Val Ser Ile Len Gly L eu Ile Ala Ala Giu Thr Val Tyr Asn Gin Giy 215 220 225 gaa gaa ttc ctt gat gag tca att cag att ctc aag gac aac cgt gac 1015 Gin Giu Phe Len Asp Gin Ser Ile Gin Ile Leu Lys Asp Asn Arg Asp 230 235 240 ttt gcg gct gct gaa ctg gaa aag ctt ggc gtg aag gtc tac gca ccg 1063 Phe Ala Ala Ala Gin Len Gin Lys Len Giy Val Lys Val Tyr Ala Pro 245 250 255 gac toc act tat ttg atg tgg ttg gac ttc gct ggc acc aag atc gaa 1111 Asp Ser Thr Tyr Len Met Trp Len Asp Phe Ala Gly Thr Lys Ile Gin 260 265 270 275 gag gcg cct tct aaa att ctt cgt gag gag ggt aag gtc atg ctg aat 1159 Gin Ala Pro Ser Lys Ile Len Arg Giu Gin Giy Lys Val Met Len Asn 280 285 Z9D gat ggc gca gct ttt ggt ggt ttc acc acc tgc gct cgt ctt aat ttt 1207 Asp Gly Ala Ala Phe Gly Gly Phe Thr Thr Cys Ala Arg Len Asn Phe 295 300 305 gcg tgt tcc aga gag acc ctt gag gag ggg ctg cgc cgt atc gcc agc 1255 Ala Cys Ser Arg Gin Thr Leu Gin Gin Gly Leu Arg Arg Ile Ala Ser 310 315 320 gtg ttg taa ataatgagta aaaagtctgt cctgattact tctttgatgc 1304 Val Len 325 tgttttccat gttcttcgga gctggaaacc tcatcttccc gccgatgctt ggattgtcgg 1364 caggaaccaa ctatctacca gctatcttag gatttctagc aacgagtgtt ctgctcccgg 1424 tgctggcgat tatcgqggtg gtgttgtcgg gagaaaatgt caaggacatg gcttctcgtg 1484 WO 01/66573 PCT/IBOO/02035 gcqqtaagat c 1495 <210> 4 <211> 325 <212> PRT <213> Corynebacterium giutarnicum <400> 4 Met Ala Asp Ala Val Glu Arg Glu Val Phe Gay Tyr Pro Pro Asp Ala 1 5 10 Thr Gly Leu Asn Asp Ala Leu Thr Gly Phe Tyr Glu Arg Arg Tyr Gly C120 25 Phe Gly Pro Asn Pro Giu Ser Val Phe Ala Ile Pro Asp Val Val Arg 40 Gly Leu Lys Leu Ala Ile Glu His Phe Thr Lys Pro Gly Ser Ala Ile 55 Ile Val Pro Leu Pro Ala Tyr Pro Pro Phe Ile Glu Leu Pro Lys Val 70 75 Thr Gly Arg Gin Ala Ile Tyr Ile Asp Ala His Giu Tyr Asp Leu Lys 90 Giu Ile Glu Lys Ala Phe Ala Asp Gay Ala Gly Ser Leu Leu Phe Cys 100 105 110 Asn Pro His Asn Pro Leu Gly Thr Val Phe Ser Giu Glu Tyr Ile Arg 115 120 125 Glu Leu Thr Asp Ile Ala Ala Lys Tyr Asp Ala Arg Ile Ile Val Asp 130 135 140 Glu Ile His Ala Pro Leu Val Tyr Glu Gly Thr His Val Val Ala Ala 145 150 155 160 Gly Val Ser Glu Asn Ala Ala Asn Thr Cys Ile Thr Ile Thr Ala Thr 165 170 175 Ser Lys Ala Trp Asn Thr Ala Gly Leu Lys Cys Ala Gin Ile Phe Phe 180 185 190 Ser Asn Glu Ala Asp Val Lys Ala Trp Lys Asn Leu Ser Asp Ile Thr 195 200 205 Arg Asp Gly Val Ser Ile.Leu Gly Leu Ile Ala Ala Giu Thr Val Tyr 210 215 220 Asn Giu Gly Giu Glu Phe Leu Asp Giu Ser Ile Gin Ile Leu Lys Asp 225 230 235 240 Asn Arg Asp Phe Ala Ala Ala Glu Leu Glu Lys Leu Gly Val Lys Val 245 250 255 Tyr Ala Pro Asp Ser Thr Tyr Leu Met Trp Leu Asp Phe Ala Gly Thr 260 265 270 Lys Ile Glu Giu Ala Pro Ser Lys Ile Leu Arg Giu Giu Gly Lys Val WO 01/66573 WO 0166573PCT/IBOO/02035 275 280 285 Met Leu Asn Asp Gly Ala Ala Phe Gly Gly Phe Thr. Thr Cys Ala Arg 290 295 300 Leu Asn Phe Ala Cys Ser Arg Glu Thr Leu Glu Glu Gly Leu Arg Arg 305 310 315 320 Ile Ala Ser Val Leu 325 <210> <211> 1033 <212> DNA <213> Corynebacterium glutamicum <22 0> <221> COS <222> (101)..(1006) <400> gtgcggatcg ggtatccgcg ctacacttag aggtgttaga tgtaacgcag gattcaccaa tcaatgaaag gtcgaccgac gatcatgagt ttccacgaac att Ile Arg gct Ala o ca Pro att Ile atc Ile atg Met gga Gly gt a Val1 gca Ala tac Tyr gag Glu gc Al a acc Thr gat Asp 105 gga Gly gca Ala aat As n a cc Thr ctt Leu cgt Arg atc Ile gcc Al a atg Met tcg gac Ser Asp 15 aaa cgt Lys Arg 30 ttc ctc Phe Leu ctc cag Leu Gin cat gag His Giu agt ccc Ser Pro 95 gtc atg Val Met 110 tcC gtc Ser Val gtc cgt at g Met 1 tca Ser at t Ile gca Al a gaa Giu gcg Al a gac Asp tcc Ser ggt Giy gac caa Gin ctt Leu gga Gly ctg Leu gaa Glu ctg Leu gga Gly 115 gtg Val1 gca gct Al a cgc Arg atg Met gaa Glu at c Ile ttg Leu 100 ct C Leu gt C Val1 gt C ago act gaa gac Ser Thr Giu Asp 115 163 211 259 307 355 403 451 499 547 cac gca aag tgt cca qtc gtt gtt WO 01/66573 PCT[BOOt02035 His gaa Glu 150 gte Val ggC Gly gca Ala gaa Glu gaa Glu 230 cca Pro gtt Va1 acc Thr Ala 135 gac Asp tcc Ser gec Ala tca Ser cgt Arg 215 aag Lys gtt Val ggt Gly tcc Ser Pro Val Val Val Val Arg Glu 140 gte Val tac Tyr cac His get Ala 205 ctg Leu gtc Val gca Ala gga Gly tce Ser 285 Asp 145 gtg Val gaa Glu gac Asp cag Gin etc Leu 225 atc Ile gcg Ala atg Met cca Ser Ala Val Asn gat Asp gct Ala atg Met tgg Trp 210 gca Ala ace Thr cag Gin etc Leu atg tcc gaa Ser Glu 165 get cgt Ala Arg 180 gta cag Val Gin gaa gtg Glu Val ctg gtg Leu Val gac cgc Asp Arg 245 eta gtc Len Val 260 ggc tec Gly Ser gtg gtt Val Val 595 643 691 739 787 835 883 931 979 Pro Cys Pro Met cge cca cct gag aag att aag aag tag tttcttttaa gtttcgatgc cccggtt 1033 Arg Pro Pro Giu Lys Ile Lys Lys 295 300 <210> 6 <211> 301 <212> PRT <213> Corynebacterium giutamicum <400> 6 Met Ser Thr Glu Asp Ile Val Val Val 1 5 Ser Lys Gin Ala Val Arg Tip Ala Ala 25 Ile Pro Leu Arg Leu Ala Ser Ser Tyr 40 Ala Glu Gly Met Val Pro Pro Gin Glu 55 Ala Val Asp Gly Ser Asp Ala 10 Asn Thr Ala Asn Lys Arg Gly Thr Met Pro Gin Phe Len Tyr Leu Phe Asp Asp Leu Gin Ala WO 01/66573 PCTABOO/02035 Glu Ala Leu Glu Lys Ile Asn Glu Ala Arg Asp Ile Ala His Gin Val 70 75 Ala Pro Glu Ile Lys Ile Gly His Thr Ile Ala Giu Gly Ser Pro Ile 90 Asp Met Leu Leu Giu Met Ser Pro Asp Ala Thr Met Ile Val Met Gly 100 105 110 Ser Arg Gly Leu Gly Gly Leu Ser Giy Met Val Met Gly Ser Val Ser 115 120 125 Gly Ala Val Val Ser His Ala Lys Cys Pro Val Val Val Val Arg Gin 130 135 140 Asp Ser Ala Val Asn Gin Asp Ser Lys Tyr Gly Pro Val Val Val Gly 145 150 155 160 Vai Asp Gly Ser Gin Val Ser Gin Gin Ala Thr Giu Tyr Ala Phe Ala 165 170 175 Giu Ala Giu Ala Arg Giy Ala Giu Leu Val Ala Val His Thr Trp Met 180 185 190 Asp Met Gin Vai Gin Ala Ser Leu Ala Gly Leu Ala Ala Ala Gin Gin 195 200 205 Gin Trp Asp Giu Val Gin Arg Gin Gin Thr Asp Met Leu Ile Glu Arg 210 215 220 Leu Ala Pro Leu Val Gin Lys Tyr Pro Ser Val Thr Vai Lys Lys Ile 225 230 235 240 Ile Thr Arg Asp Arg Pro Val Arg Ala Leu Ala Glu Ala Ser Glu Asn 245 250 255 Ala Gin Leu Leu Vai Vai Gly Ser His Gly Arg Gly Giy Phe Lys Gly 260 265 270 Met Leu Leu Gly Ser Thr Ser Arg Ala Leu Leu Gin Ser Ala Pro Cys 275 280 285 Pro Met Met Val Val Arg Pro Pro Giu Lys Ile Lys Lys 290 295 300 <210> 7 <211> 948 <212> DNA <213> Corynebacterium giutanicun <220> <221> CDS <222> (925) <223> RXA02229 <400> 7 gctggttcaa cagagaccac cgcgtgtcct gggtcgacgc ctctggcgat cccaccgcac aagccttgga gattttgggt ctacaatagc gagggtgaat ttg acc atc ccc ttt 115 WO 01/66573 WO 0166573PCTIiBOO/02035 Leu Thr Ile Pro Phe 1 gcc aaa Ala Lys ggc cac gcc Gly His Ala gat Asp cgc Arg gca Ala tao Tyr cgc Arg agc Ser cag Gin gac Asp ggc Gly 150 ggo Gly ttt Phe gaa Glu Gly gcg cgc Ala Arg cgc gcc Arg Ala gac gta Asp Val cgc aac Arg Asn ctq tto Leo Phe ttt gat Phe Asp gca gat Ala Asp 120 gtc acg Val Thr 135 ctt ggo Leu Gly tta agt Leu Ser gat cag Asp Gin tta gaa Leo Glu 200 gaa acc Glu Thr 215 gat Asp at o Ile qgc Gly gat Asp cac His ggt Gly cat His tta Leu gat Asp tog Ser 170 ttc Phe gac Asp tcc Ser acc gaa aac gac ttc atc Thr Glu Asn Asp Phe Ile 15 tta act cca gaa atg gtg Leu Thr Pro Glu Met Val ggt got gat ggt atc ctc Gly Ala Asp Giy Ile Leu 45 toe acg gtc gac cca tcg Ser Thr Val Asp Pro Ser 60 gga tct ttg gct. gaa atg Gly Ser Leu Ala Glu Met 75 80 tgg ctg tao toc ogc ggt Trp Leu Tyr Ser Arg Gly 95 acc cgc gcc ggt gto cgc Thr Arg Ala Gly Val Arg 110 tct gcg cag gte cgc gtt Ser Ala Gin Vai Arg Vai 125 tcc acc tgo gac atc aac Ser Thr Cys Asp Ile Asn 140 atg ggt. aac cca cac cta Met Gly Asn Pro His Leu 155 160 got ott gco gat atg gaa Ala Leu Ala Asp Met Glu 175 tto coo cac ggt gtg aac Phe Pro His Gly Val Asn 190 gca gta tcg atg cgc gtg Ala Vai Ser Met Arg Val 205 tgt ggc acg gga aco gtt Cys Gly Thr Gly Thr Val 220 gga ttg gga gaa ggo aca Gly Leo Gly Glu Gly Thr at c Ile gte Val ogc Arg otg Leu tgc Cys ctt Leu cac His ga t Asp gg C Gly 145 gcg Al a otg Leu gt a Val1 t gg Trp got Aia 225 got Ala at c Ile acg Thr gtg Val1 tgg Trp ggc Giy gtt Val1 gt t Val1 atg Met 130 oa a Gin t go Cys ogo Arg gaa Glu gaa Glu 210 goa Al a aaa Lys ccc Pro ctg Leu gtt Val1 tt 0 Phe aat Asn gat Asp gat Asp 115 ggo Gly gt a Val gtt Val goa Al a ato Ile 195 ogo Arg gog Ala gtg Val gat Asp t gt Cys aaa Lys atg Met ggt Gly aat Asn 100 att Ile atc Ile ttc Phe gt g Val oot Pro 180 gto Val gga Gly t gt Cys t go Cys gag Giu gao Asp got Ala gat Asp gtg Val acg Thr ttg Leu oct Pro got. Ala cog Pro 165 aog Thr aca Thr gtg Val got Ala gtt Val 163 211 259 307 355 403 451 499 547 595 643 691 739 787 835 got tta got gat got. Ala Leu Ala Asp Ala WO 01/66573 WO 0166573PCT[LB00102035 230 235 240 245 cca cgt ggg gaa gta gaa gtc cag atc ttt gac gac ggc tcc aca ctc Pro Arg Gly Gin Val Glu Val Gin Ile Phe Asp Asp Gly Ser Thr Leu 250 255 260 acc ggc cca agc gcc atc atc gca ctc ggt gag gtg cag atc Thr Gly Pro Ser Ala Ile Ile Ala Len Gly Gin Val Gin Ile 265 270 275 taagattcgc gattgtagtt cgg <210> 8 <211> 275 <212> PRT <213> Corynebacterium glutainicum <400> 8 Len Thr Ile Pro Phe Ala Lys Gly His 1 Ile Val Arg Len Cys Leu His Asp Gly 145 Al a Leu Val Ile Thr Val T rp Gly Val Val Met 130 Gln Cys Arg Glu As n Pro Asp Val Leu Tyr Al a Gin 125 Cys Asn Al a His Ser 205 Asp Gin Gly Asp Ala S er Gly Val Asp Pro Asp Gly 190 Met Phe Ile Met Val Ile Leu Pro Ser Gln Met Arg Gly Val Arg Arg Val Ile Asn His Len 160 Met Giu 175 Val Asn Arg Val Trp Glu Arg Gly Val Gly Giu Thr Arg Ser Cys Gly Thr Gly Thr Val I NO WO 01/66573 WO 0166573PCTIBOOIO2O35 Ala Ala Ala Cys Ala Ala Leu Ala Asp Ala Gly Leu Gly Glu Gly Thr 225 230 235 240 Ala Lys Val Cys Val Pro Arg Gly Giu Val Giu Val Gin Ile Phe Asp 245 250 255 Asp Gly Ser Thr Leu Thr Gly Pro Ser Ala Ile Ile Ala Leu Gly Glu 260 265 270 Val Gin Ile 275 <210> 9 <211> 1491 <212> DNA <213> Corynebacterium giutamicum <220> <221> CDS <222> (101)..(1468) <223> RXS02970 <400> 9 aaccgacaaa acagccgttc acgtgctaaa gcagctcggc ttgatctagg gtgaggtgag ttatttaaag acttcataat attttgggga gtgaactggt ttg gca ttg aag ggt tac Tyr aaa Lys cac His gcc Al a at g Met tta Leu ccg Pro t cg Ser gaa Glu gca Ala gac Asp t ac Tyr t cg Ser cgc Arg gtg Val1 tt c Phe tt c ?he gat Asp ccc Pro ggc Gly ggc Gi y 80 cgg Arg gt t Val ttt Phe Leu Ala Leu Lys 1 gga tct gtg caa Gly Ser Val Gin cgc qcg cac gtt Arg Ala His Val aaa gta tgg gca Lys Vai Trp Ala aac gcc ttc ato Asn Ala Phe Ile cac aac aac cct His Asn Asn Pro ttg acc aac ato Leu Thr Asn Ile 100 gct gca aag atc Ala Ala Lys Ile 115 ttc acc aac ggc Phe Thr Asn Giv Giy gca Ala ttc Phe g ct Al a ga c Asp cga Arg aac Asn gt g Val1 Gly WO 01/66573 WO 0166573PCT[IBOO/02035 gco Al a cgc Arg 150 tcc Ser acc Thr toa Ser cac His atc Ile 230 gca Al a ct c Leu ot g Leu acc Thr gt g Val 310 ggc Gly gca Al a oga Arg qac Asp 135 aac As n gog Al a gac Asp ttc Phe ttg Leu 215 gt c Val ggt Gly ttc Phe tt t Phe tt 0 Phe 295 at g Met gga Gly gcg Ala ctt Leu goc atc Ala Ile aaa att Lys Ile atg atg Met Met cca gat Pro Asp 185 ttt gc Phe Ala 200 gaa gat Glu Asp ctg gag Leu Glu tac tta Tyr Leu atc gcc Ile Ala 265 got tac Ala Tyr 280 gcc aag Ala Lys acc caa Thr Gin oto aco Leu Thr otg gag Leu Glu 345 ggo got Gly Ala 360 atc Ile tao Tyr gaa Glu ttc Phe gaa Glu 205 ttt Phe gga Gly ogo Arg atg Met ggo Gly 285 gos Ala gat Asp oac His ga a Glu gaa Glu 365 ogo Arg cgo Arg oao His tgg Trp 190 gaa Glu gaa Glu toa Ser gaa Glu gto Val 270 gao Asp ggt Gly ac Thr coa Pro gga Gly 350 cot Pro atg Met ago Ser ogo Arg 175 goa Al a gaa Glu ggt Gly toa Ser ott Leu 255 gga Gly gat Asp tao Tyr tto Phe ott Leu 335 gag Glu ogo Arg aoo Thr a 00 Thr 000 Pro 180 oao His oto Leu goa Ala ooa Pro ggc Gly 260 gga Gly atg Met ggc Gly tao Tyr gc Ala 340 gta Val g cg Ala 547 595 643 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 WO 01/66573 PCTIEBOO/02035 gaa aac gta gcg atc gct gac gtg cgg ggc atc gga ttc ttc tgg gca 1267 rN~ Glu Asn Val Ala Ile Ala Asp Val Arg Gly Ile Gly Phe Phe Trp Ala 375 380 385 gtg gag ttc aat gca gac gcc act gcc atg gct gcc ggt gct gca gaa 1315 Val Glu Phe Asn Ala Asp Ala Thr Ala Met Ala Ala Gly Ala Ala Glu 390 395 400 405 ttc aag gaa cgc ggc gtg tgg ccg atg atc tcc ggc aac cga ttc cac 1363 Phe Lys Glu Arg Gly Val Trp Pro Met Ile Ser Gly Asn Arg Phe His 410 415 420 atc gcg ccg ccg ctg acc acc act gat gac gaa ttg gta gca ctg ctg 1411 Ile Ala Pro Pro Leu Thr Thr Thr Asp Asp Glu Leu Val Ala Leu Leu 425 430 435 gac gcg gtg gaa gct qca gcc caa gct gtc gag ctg acc ttc gct ggg 1459r Asp Ala Val Giu Ala Ala Ala Gin Ala Val Giu Leu Thr Phe Ala Gly 440 445 450 gcg ttg ttc taagttttct agataacaag gcc 1491 Ala Leu Phe 455 <210> <211> 456 <212> PRT <213> Corynebacterium glutainicum <400> Leu Ala Leu Lys Gly Tyr Thr Asn Phe Asp Gly Giu Phe Ile Glu Phe 1 5 10 Giy Ser Vai Gin Ala Lys Giu Giu Giu Lys Arg Ala Phe Asp Asn Asp 25 Arg Ala His Val Phe His Ser Trp Ser Ala Gin Asp Lys Ile Ser Pro 40 Lys Val Trp Ala Ala Ala Giu Gly Ser Thr Leu Tyr Asp Phe Asp Gly 55 Asn Ala Phe Ile Asp Met Giy Ser Gin Leu Vai Ser Ala Asn Leu Gly 70 75 His Asn Asn Pro Arg Leu Val Giu Ala Ile Gin Arg Gin Ala Ala Arg 90 Leu Thr Asn Ile Asn Pro Ala Phe Gly Asn Asp Val Arg Ser Asp Val 100 105 110 Ala Ala Lys Ile Val Ser Met Ala Arg Gly Giu Phe Ser His Val Phe 115 120 125 Phe Thr Asn Giy Gly Ala Asp Ala Ile Giu His Ser Ile Arg Met Ala 130 135 140 Arg Leu His Thr Gly Arg Asn Lys Ile Leu*Ser Ala Tyr Arg Ser Tyr 145 150 155 160 WO 01/66573 WO 0166573PCTJIBOO/02035 His Gly Ala Thr Gly Ser Ala Met Met Leu Thr Gly Glu His Arg Arg C1165 170 175 Leu Gly Asn Pro Thr Thr Asp Pro Asp Ile Tyr His Phe Trp Ala Pro 180 185 190 Phe Leu His His Ser Ser Phe Phe Ala Thr Thr Gin Glu Glu Giu Cys 195 200 205 Giu Arg Ala Leu Lys His Leu Giu Asp Val Ile Ala Phe Giu Gly Ala 210 215 220 Giy Met Ile Ala Ala Ile Val Leu Giu Pro Vai Val Giy Ser Ser Giy C1 225 230 235 240 Ile Ile Leu Pro Pro Ala Giy Tyr Leu Asn Gly Val Arg Giu Leu Cys 245 250 255 Asn Lys His.Gly Ile Leu Phe Ile Ala Asp Giu Val Met Val Gly Phe 260 265 270 Gly Arg Thr Gly Lys Leu Phe Ala Tyr Giu His Ala Gly Asp Asp Phe 275 280 285 Gin Pro Asp Met Ile Thr Phe Ala Lys Gly Val Asn Ala Giy Tyr Ala 290 295 300 Pro Leu Gly Gly Ile Val Met Thr Gin Ser Ile Arg Asp Thr Phe Gly 305 310 315 320 Ser Glu Ala Tyr Ser Gly Gly Leu Thr Tyr Ser Gly His Pro Leu Ala 325 330 335 Val Ala Pro Ala Lys Ala Ala Leu Giu Ile Tyr Ala Glu Giy Giu Ile 340 345 350 Ile Pro Arg Val Ala Arg Leu Giy Ala Giu Leu Ile Giu Pro Arg Leu 355 360 365 Arg Glu Leu Ala Glu Glu Asn Val Ala Ile Ala Asp Val Arg Gly Ile 370 375 380 Gly Phe Phe Trp Ala Val Giu Phe Asn Ala Asp Ala Thr Ala Met Ala 385 390 395 400 Ala Gly Ala Ala Glu Phe Lys Glu Arg Gly Val Trp Pro Met Ile Ser 405 410 415 Gly Asn Arg Phe His Ile Ala Pro Pro Leu Thr Thr Thr Asp Asp Glu 420 425 430 Leo Val Ala Leu Leo Asp Ala Vai Glu Ala Ala Ala Gin Ala Val Glu 435 440 445 Leu Thr Phe Ala Gly Ala Leu Phe 450 455 <210> 11 <211> 1330 <212> DNA WO 01/66573 WO 0166573PCTIIBOO/02035 <213> Corynebacterium glutamicum <220> <221> COS <222> (1330) <223> FRXA01009 <400> 11 aaccgacaaa acagccgttc acgtgctaaa gcagctcggc ttg ttatttaaag acttcataat attttgggga. qtqaactggt ttg Leu atctagg gtgaggtgag gca Ala tac Tyr ada Lys cac His qCC Al a atg Met tta. Leu ccg Pro tcg Ser gcc Al a cg c Arg 150 t cc Ser acc Thr gaa Glu gca Ala ga c Asp tac Tyr t cg Ser cgc Arg gtg Val ttc Phe t cc S er 140 qca Ala ggC Gly cac His ttc Phe gat Asp ccc Pro ggc Gly ggc Gly 80 cgg Arg gtt Val ttt Phe gct Ala tac Tyr 160 cgc Arg cca Pro ttg aag ggt Leu Lys Gly gtg caa gca Val Gln Ala cac gtt ttc His Val Phe tgg gca gct Trp Ala Ala ttc atc gac Phe Ile Asp aac cct cga Asn Pro Arg aac atc aac Asn Ile Asn 100 aag atc gtg Lys Ile Val 115 aac ggc ggc Asn Gly Gly cac acc gga His Thr Gly gca acc qga Ala Thr Gly 165 aac ccc ace Asn Pro Thr 180 cac cac tcc His His Ser 195 WO 01/66573 WO 0166573PCTIBOO/02035 tca tto ttt Ser Phe Phe cac His at a Ile 230 gca Al a ct a Leu ctg Leu acc Thr gtg Val 310 ggC Gly gca Al a cga Arg gaa Glu gtg Val 390 ttc Phe 200 ttq gaa Leu Glu 215 gtC ctg Val Leu ggt tac Gly Tyr ttc atc Phe Ile ttt gct Phe Ala 280 ttc gcc Phe Ala 295 atg ac Met Thr gga ctc Gly Leu gcg ctg Ala Leu ott ggo Leu Gly 360 aao gta Asn Val 375 gag ttc Glu Phe aag gaa Lys Glu gcc Al a gat Asp gag Glu tta Leu gco Al a 265 tac Tyr aag Lys caa Gin acc Thr gag Glu 345 gct. Ala gcg Al a aat As n ogo Arg acc acc caa Thr Thr Gin gaa gaa Glu Glu gt o Val ca Pr o aat Asn 250 gao Asp gag Giu ggt Gly toa Ser tac Tyr 330 att Ile gaa Glu atc I le gca Ala ggc Gly 410 atc Ile gtg Val 235 ggo Gly g aa Glu oat His gtt Val atc Ile 315 too S er tao Tyr ctg Leu got Ala gao Asp 395 gaa tgo gaa ogo goa oto aag Glu Cys Glu Arg Ala Leu Lys 9g Ala 220 gtg Val gtg Val gto Val got Ala aac Asn 300 ago Arg gga Gly gag Ala at a Ile gao Asp 380 goo Al a 205 ttt Phe gga Gly ogo Arg atg Met ggo Gly 285 goa Ala gat Asp oa o His gaa Glu gaa Giu 365 gtg Val act Thr gaa Giu t oa S er gaa Glu gtC Val 270 gao Asp ggt Gly aoo Thr ooa Pro gga Gly 350 oct Pro ogg Arg goo Al a ggo Gly 225 at o Ile aac Asn gga Gi y cag Gin ooa Pro 305 ta Ser gta Val att Ile ogt Arg gga Gly 385 goo Ala 210 at g Met at o Ile aag Lys ogo Arg oca Pro 290 ot 0 Leu gag Glu gca Ala ooa Pro gaa Gi u 370 tto Phe ggt Gly 787 835 883 931 979 1027 1075 1123 1171 1219 1267 1315 1330 <210> 12 <211> 410 <212> PRT- WO 01/66573 WO 0166573PCTIBOOIO2035 <213> Corynebacterium giutamicum <400> 12 Leu Ala Leu Lys 1 Gly Ser Val Gin Arg Ala His Val Lys Val Trp Ala Asn Ala Phe Ile His Asn Asn Pro Leu Thr Asn Ile 100 Ala Ala Lys Ile 115 Phe Thr Asn Gly 130 Arg Leu His Thr 145 His Gly Ala Thr Leu Gly Asn Pro 180 Phe Leu His His 195 Giu Arg Ala Leu 210 Gly Met Ile Ala 225 Ile Ile Leu Pro Asn Lys His Gly 260 Giy Arg Thr Gly 275 Gin Pro Asp Met 290 Pro Leu Gly Gly Tyr Thr Asn Phe Lys Giu Giu Giu 25 His Ser Trp, Ser 40 Ala Giu Gly Ser 55 Met Giy Ser Gin 70 Leu Val Giu Ala Pro Ala Phe Gly 105 Ser Met Ala Arq 120 Ala Asp Ala Ile 135 Arg Asn Lys Ile 150 Ser Ala Met Met Thr Asp Pro Asp 185 Ser Phe Phe Ala 200 His Leu Giu Asp 215 Ile Val Leu Giu 230 Ala Gly Tyr Leu Leu Phe Ile Ala 265 Leu Phe Ala Tyr 280 Thr Phe Ala Lys 295 Val Met Thr Gin Gly Giu Phe Ile Giu Phe Arg Ala Phe Asp Asn Asp Gin Asp Lys Ile Ser Pro Leu Tyr Asp Phe Asp Gly Val Ser Ala Asn Leu Gly 75 Gin Arg Gin Ala Ala Arg Asp Vai Arg Ser Asp Val 110 Giu Phe Ser His Val Phe 125 His Ser Ile Arg Met Ala 140 Ser Ala Tyr Arg Ser Tyr 155 160 Thr Gly Giu His Arg Arg 175 Tyr His Phe Trp Ala Pro 190 Thr Gin Giu Giu Giu Cys 205 Ile Ala Phe Glu Giy Ala 220 Val Val Gly Ser Ser Gly 235 240 Gly Val Arg Giu Leu Cys 255 Glu Val Met Val Gly Phe 270 His Ala Gly Asp Asp Phe 285 Val Asn Ala Gly*Tyr Ala 300 Ile Arg Asp Thr Phe Gly UN WO 01/66573 WO 0166573PCTA~BOO/02035 305 Ser Val. Ile Arg Gly 385 Ala 315 Ser Gly His Pro Leu 335 Tyr Ala Glu Gly Glu 350 Leu Ile Glu Pro Arg 365 Ala Asp Val Arg Gly 380 Asp Ala Thr Ala Met 395 <210> 13 <211> 792 <212> DNA <213> Corynebacteriun glutamicui <22 0> <221> CDS <222> (101) (769) <223> RXC02390 <400> 13 gctggtggtg ctgacccata cgctggaact ccaactgctg ggccgcgaqg atctcgtaqc tcgcttcgag tcataggccg ttt Phe cct Pro gcg Al a acg Thr att Ile ggg Gly ttgataccgc caagatgttt gtg gag tgg acc gct Val Glu Trp Thr Ala 1 agt tta tcc ccg ggg Ser Leu Ser Pro Gly cgc tcc aga gcg cac Arg Ser Arg Ala His ctc acg gtg tgg gtg Leu Thr Val Trp Val acc act tat ccg tcg Thr Thr Tyr Pro Ser tac cta agc ttc att Tyr Leu Ser Phe Ile ctt atc gac gcc cgc Leu Ile Asp Ala Arg 100 WO 01/66573 WO 0166573PCT/IBOO/02035 cag Gin gca Al a ct g Leu ft g Leu 150 gcg Al a gt c Val ttt Phe cgt Arg gga Gly 120 aac Asn cca Pro tta Leu acg Thr ct g Leu 200 tt C Phe 105 a cc Thr cct Pro gcg Al a gtg Val1 gag Gi u 185 ct t Leu aac Asn cgc Arg aaa Lys cac His cag Gin 170 cgt Arg gct Ala gcc Ala act Thr gtt Val cca Pro 155 acc Thr gtg Val ggc Gly Val Val Gly 210 Val Thr Leu ctg tat gaa qgc ctq acc tta ctc ggg taaaggcata aaaaatggct Leu Tyr Giu Gly Leu Thr Gly Leu Leu 215 220 tcc <210> 14 <211> 223 <212> PRT <213> Corynebacterium glutamicum <400> 14 Vai Glu Trp Thr Ala Phe Gly Thr Leu 1 Ser Leu Ser Pro Gly Pro Asp Thr Phe Arg Ser Arg Ala His Ala Ile Ala Gly Leu Thr Vai Trp Val Thr Leu Thr Val Thr Thr Tyr Pro Ser Ile Leu Gly Ile Tyr Leu Ser Phe Ile Gly Tyr Lys Leu Leu Ile Asp Ala Arg Gin Phe Arg Phe Giy WO 01/66573 WO 0166573PCT/IBOO/02035 100 105 Pro Asp Ala Val Giu Ala Leu Gly Thr Arg Thr 115 120 Gly Leu Ala Thr Asn Leu Ser Asn Pro Lys Val 130 135 Ala Ie Leu Ala Pro Leu Met Pro Ala His Pro 145 150 155 Phe Ser Ile Ile Val Ala Ile Leu Val Gin Thr 165 170 Ala Val Cys Leu Ile Val. Ser Thr Glu Arg Val 180 185 Arg Ala Gly Pro Trp Phe Asp Leu Leu Ala Gly 195 200 Val Gly Val. Thr Leu Leu Tyr Glu Gly Leu Thr 210 215 <210> <211> 897 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (874) <223> RXCO1796 <400> atgtaactcg atcaggtgga aatgcccgca aaagtggcgg ttgqtqcqgc atcggtqgco tqotactagt cgctcttc Gin Val. 140 Ser Phe Arg Val. Gly 220 Val 125 Met Pro Val. Lys Val. 205 Leu aac Asn gag Giu Giy ttc Phe at c Ile cc Al a gga Gly gat Asp gtc Val. tac Tyr at o Ile too Ser aac Asn gaa Giu gag Glu cggtggccga gggatggccg ttg otc ott ggc gqt Leu Leu Leu Gly Gly 1 gat caa acc cag atc Asp Gin Thr Gin Ile gat cac tgc caa acc Asp His Cys Gin Thr ott tac tac acc tca Leu Tyr Tyr Thr Ser cca got cag got ggt Pro Ala Gin Ala Gly aaa aac too acc caa Lys Asn Ser Thr Gin WO 01/66573 WO 0166573PCTIIBOO/02035 acc ggc tgc ggt ttc gct tet gcg tcc act ggg ceg ttt tac tgt ccg 403 Thr Gly Cys Gly Phe Ala Ser Ala Ser Thr Gly Pro Phe Tyr Cys Pro 090 95 100 tea gac caa gat get tat ttt gac ttg act ttc ttc gat cag atg egt 451 Ser Asp Gin Asp Ala Tyr Phe Asp Leu Thr Phe Phe Asp Gin Met Arg 105 110 115 cag ttc ggt gca gaa aac gec ccg ctt gcc cag atg tac atc gtg gcg 499 Gin Phe Gly Ala Glu Asri Ala Pro Leu Ala Gin Met Tyr Ile Val Ala 120 125 130 cac gag tac ggc cac cac gte caa aac ctc gag ggc aca etc gga ctg 547 His Giu Tyr Gly His His Val Gin Asn Leu Giu Gly Thr Leu Gly Leu 135 140 145 tcc aat tac aac gat ccg ggc get gat tcc aac gcc gte aag atc gag 595 Ser Asn Tyr Asn Asp Pro Giy Ala Asp Ser Asn Ala Vai Lys Ile Giu 150 155 160 165 ttg cag gcc gat tgc tac gca ggc att tgg gct aat eac tcc age gaa 643 Leu Gin Ala Asp Cys Tyr Ala Gly Ile Trp Ala Asn His Ser Ser Giu 170 175 180 ggc ccg gat ccg cta ctc caa ccc atc ace gaa tct gag cta gat tcc 691 Giy Pro Asp Pro Leu Leu Gin Pro Ile Thr Glu Ser Giu Leu Asp Ser 185 190 195 gct ctc ctt get gca agc gcc gtg ggc gac gac aat atc cag caa cga 739 Ala Leu Leu Ala Ala Ser Ala Val Gly Asp Asp Asn Ile Gin Gin Arg 200 205 210 tcc ggt ggc gat gtc aat cet gaa agc tgg act cac ggc tca tcg cag 787 Ser Gly Gly Asp Val Asn Pro Glu Ser Trp Thr His Gly Ser Ser Gin 215 220 225 cag cge aaa gac geg tte etc gee gge tac aac acc gge cag atg age 835 Gin Arq Lys Asp Ala Phe Leu Ala Gly Tyr Asn Thr Giy Gin Met Ser 230 235 240 245 gee tgc gae tte etc gge egg ggc gtc tac aae gac get taaageattg 884 Ala Cys Asp Phe Leu Giy Arg Gly Val Tyr Asn Asp Ala 250 255 ettttegaeg tet 897 <210> 16 <211> 258 <212> PRT <213> Corynebacterium glutamicun <400> 16 Leu Leu Leu Gly Gly Asn Pro Ala Glu Ile Asp Gin Val Leu Gly Gly 1 5 10 Asp Gin Thr Gin Ile Giu Ser Gly Giu Ser Thr Gly Ala Gly Asp Phe 25 Asp His Cys Gln Thr Gly Ala Asp Ala Asri Ala Ser Asp Asp Cys Arg 40 WO 01/66573 PCTIEBOO/02035 WO0/673PTNOO/23 Leu Tyr Tyr Thr Ser Phe Ser Val Asn Glu Met Trp Gin Thr Leu Leu 050 55 Pro Ala Gin Ala Gly Ile Giu Tyr Thr Glu Pro Thr Leu Thr Leu Phe 70 75 Lys Asn Ser Thr Gin Thr Gly Cys Giy Phe Ala Ser Ala Ser Thr Gly 90 Pro Phe Tyr Cys Pro Ser Asp Gin Asp Ala Tyr Phe Asp Leu Thr Phe 100 105 110 Phe Asp Gin Met Arg Gin Phe Gly Ala Giu Asn Ala Pro Leu Ala Gin 115 120 125 INO Met Tyr Ile Val Ala His Gin Tyr Giy His His Val Gin Asn Leu Giu 130 135 140 Gly Thr Leu Gly Leu Ser Asn Tyr Asn Asp Pro Gly Ala Asp Ser Asn 145 150 155 160 Ala Vai Lys Ile Giu Len Gin Ala Asp Cys Tyr Ala Gly Ile Trp Ala 165 170 175 Asn His Ser Ser. Gin Gly Pro Asp Pro Len Leu Gin Pro Ile Thr Gin 180 185 190 Ser Giu Len Asp Ser Ala Leu Leu Ala Ala Ser Ala Val Gly Asp Asp 195 200 205 Asn Ile Gin Gin Arg Ser Gly Giy Asp Val Asn Pro Giu Ser Trp Thr 210 215 220 His Gly Ser Ser Gin Gin Arg Lys Asp Ala Phe Leu Ala Gly Tyr Asn 225 230 235 240 Thr Gly Gin Met Ser Ala Cys Asp Phe Len Gly Arg Gly Val Tyr Asn 245 250 255 Asp Ala <210> 17 <211> 771 <212> DNA <213> Corynebacterium gintamicum <220> <22i> COS <222> (748) <223> RXCO1207 <400> 17 cttcatgatc tcaccggcag agcgcgtttt gttacagcgc gtaaactgtg actttgaaaa atttttgaac aatccgtaca ccaacttcag gagaaaaaca gtg agc aga atc tat 115 Val Ser Arg Ile Tyr 1 WO 01/66573 WO 0166573PCTIIBOO/02035 gac Asp gat Asp tat Tyr ct g Leu ggC Gly gca Al a gtt Val a cc Thr cgc Arg act Thr 150 gt o Val1 acc Thr gc Al a tgt gcc gao Cys Ala Asp gca gto aaa Ala Val Lys gga otc ggc Gly Leu Gly gcc aco aaa Ala Thr Lys ago tgg gac Ser Trp Asp aaa gcg ott Lys Ala Leu ccg cag gca Pro.Gin Ala 105 gta atg ctg Val Met Leu 120 caa acc gga Gin Thr Gly 135 cot oca aco Pro Pro Thr got gtc tac Ala Val Tyr atc gtg gat Ile Vai Asp 185 ato ago gca Ile Ser Ala caa Gin gc Al a tgc Cys cac His aoo Thr gt g Val oca Pro ogo Arg ca Pro aco Thr ctc Leu 170 at t Ile qaa Glu gao too Asp Ser ggt cag Gly Gin gao got Asp Ala ogt ggc Arg Giy 60 att oaa Ile Gin 75 gag gcg Glu Ala ago ott Ser Leu atg oca Met Pro atg got Met Ala 140 gtg ctg Val Leu 155 gat ggt Asp Gly toa ggc Ser Gly ogc gtt Arg Val goa ggo ota aag gog got gto Ala Gly Leu Lys Ala Ala Val 15 gto ott coo acg gat aco ott Val Leu Pro Thr Asp Thr Leu aac gag goa gta goo aao ott Asn Giu Ala Val Ala Asn Leu atg coo gtt oca gtg oto gto Met Pro Val Pro Val Leu Val gtg cac too tat tot gog oag Vai His Ser Tyr Ser Ala Gin 80 cot ggt gga otg too ato ato Pro Gly Giy Leu Ser Ile Ile 95 100 aao Ott ggo gat aco ogt ggo Asn Leu Gly Asp Thr Arg Gly 115 oca gtt goc att gaa ttg otg Pro Val Ala Ile Giu Leu Leu 130 too gco aao ato too gga cat Ser Ala Asn Ile Ser Giy His 145 ogt cag cag oto aao oaa aat* Arg Gin Gin Leu Asn Gin Asn 160 165 tgo gog ctg gcc aco oct tca Cys Ala Leu Ala Thr Pro Ser 175 180 cca aag att ttg ogt gag ggt Pro Lys Ile Leu Arg Giu Gly 195 gta ott gga gtg tog gca gaa Val Leu Gly Val Ser Ala Giu 163 211 259 307 355 403 451 499 547 595 643 691 739 200 ago otg ogo taaatgggag toggtttogo ggg Ser Leu Arg 215 <210> 18 <211> 216 <212> PRT <213> Corynebacterium giutamioum WO 01/66573 PCT/IBOO/02035 (N2~ <400> 18 Val Ser Arg Ile Tyr Asp Cys Ala Asp Gin Asp Ser Arg Ala Ala Gly 1 5 10 Leu Lys Ala Ala Val Asp Ala Val Lys Ala Gly Gln Leu Val Val Leu Pro Thr Asp Thr Leu Tyr Gly Leu Gly Cys Asp Ala Phe Asn Asn Giu 40 Ala Val Ala Asn Leu Leu Ala Thr Lys His Arq Gly Pro Asp Met Pro 55 Val Pro Val Leu Vai Gly Ser Trp Asp Thr Ile Gin Gly Leu Val His 70 75 Ser Tyr Ser Ala Gin Ala Lys Ala Leu Val Giu Ala Phe Trp Pro Gly 90 Gly Leu Ser Ile Ile Val Pro Gin Ala Pro Ser Leu Pro Trp Asn Leu 100 105 110 Gly Asp Thr Arg Gly Thr Val Met Leu Arg Met Pro Leu His Pro Val 115 120 125 Ala Ile Glu Leu Leu Arg Gin Thr Gly Pro Met Ala Val Ser Ser Ala 130 135 140 Asn Ile Ser Gly His Thr Pro Pro Thr Thr Val Leu Giu Ala Arg Gin 145 150 155 160 Gin Leu Asn Gin Asn Vai Ala Val Tyr Leu Asp Giy Gly Glu Cys Ala 165 170 175 Leu Ala Thr Pro Ser Thir Ile Val Asp Ile Ser Gly Pro Ala Pro Lys 180 185 190 Ile Leu Arg Giu Gly Ala Ile Ser Ala Glu Arg Vai Gly Glu Val Leu 195 200 205 Gly Val Ser Ala Giu Ser Leu Arg 210 215 <210> 19 <211> 1026 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (101)..(1003) <223> RXC00657 <400> 19 gtgcggatcg ggtatccgcg ctacacttag aggtgttaga gatcatgagt ttccacdaac tgtaacgcag gattcaccaa tcaatgaaag gtcgaccgac atg agc act gaa gac 115 Met Ser Thr Glu Asp 1 IN WO 01/66573 WO 0166573PCTJIBOO/02035 at t Ile Arg gct Ala oca Pro att Ile at c Ile atg Met gga Gly cac His gaa Glu 150 gtc Val ggc Gly gca Ala gaa Giu gaa Glu 230 gtc Val gct Al a agc Ser caa Gin gaa Giu cac His ccc Pro too Ser 120 aag Lys ago Ser caa Gin gaa Glu ctt Leu 200 cag Gin tac Tyr gt a Val gca Al a t ac Tyr gag Glu gcc Al a ac Thr gat Asp 105 gga Gly tgt Cys aag Lys cag Gin ct C Leu 185 gca Al a caa Gin cca Pro gca Ala aat Asn acc Thr ott Leu cgt Arg atc Ile gco Ala atg Met ooa Pro tac Tyr gca Ala 170 gt t Val ggt Gly aco Thr agt Ser gt a Val acc Thr atg Met ttc Phe gao Asp got Ala aoa Thr gto Val gto Val ggo Gly 155 a co Thr goa Ala ott Leu gao Asp gta Val 235 gat Asp goo Ala cot Pro gat Asp ato Ile gaa Giu atg Met atg Met gtt Val 140 0 ca Pro gaa Glu gtt Val gca Al a atg Met 220 a oo Thr ggO Gly aac Asn cag Gin 45 gao Asp goo Ala ggo Gly ato Ile ggo Gly 125 gtt Vai gto Val tao Tyr oac His got Ala 205 ctg Leu gto Val toa Ser att Ile goa Al a ga a Glu gog Al a gao Asp t cc Ser ggt Gly gao Asp 145 gt g Val gaa Glu gao Asp oag Gin ot 0 Leu 225 ato Ile aaa Lys ooa Pro gag Giu goo Al a ca Pro atg Met ogo Arg goa Ala 130 ago Ser gat Asp got Al a atg Met tgg Trp 210 goa Ala ac Thr WO 01/66573 WO 0166573PCT/IBOO/02035 cca gtt cgc gca ctt gca gaa gca t Pro Val Arg Ala Leu Ala Glu Ala S 250 gtt ggt tcc cat ggt cgt ggc gga t Val Gly Ser His Gly Arg Gly Gly E 2652 ace tcc cgc gca ctg ctg caa tcc Thr Ser Arg Ala Leu Leu Gin Ser 7Z 280 285 cgc cca cct gag aag att aag aag t Arg Pro Pro Glu Lys Ile Lys Lys 295 300 <210> <211> 301 <212> FRT <213> Corynebacterium glutamicum :ct gaa aac gcg cag ctc eta gtc ;er Glu Asn Ala Gin Leu Leu Val 255 260 ~tt aag ggc atg ctc ctt ggc tcc 'he Lys Gly Met Leu Leu Gly Ser ~70 275 rca eeg tge cca atg atg gtg gtt l1a Pro Cys Pro Met Met Val Val 290 :agtttcttt taagtttcga tgc 883 931 979 1026 <400> Met Ser Thr Giu Asp Ile Val Val Val Val Leu Val Lys Lys Glu Gly Ser Asn Giu 165 Arg Gin Arg Al a Pro Ile Ile Met Gly His Glu 150 Val Gly Ala Ala Asn Thr Leu Arg Ile Ala Met Pro Tyr Ala 170 Val Gly Giy Asn Gin Asp Ala Gly Ile Gly 125 Val Val1 Tyr His Ala 205 Ser Lys Phe Leu His Ser Val1 110 Se r Val Val Al a Thr 190 Ala Al a Gly Tyr Ala Val Ile Gly Ser Glu Gly 160 Al a Met Gin WO 01/66573 WO 0166573PCT/IBOOIO 2035 Gin Trp Asp Giu Val Glu Arg Gin Gin Thr Asp 210 215 Leu Ala Pro Leu Val Glu Lys Tyr Pro Ser Val 225 230 235 Ie Thr Arg Asp Arg Pro Val Arg Ala Leu Ala 245 250 Ala Gin Leu Leu Val Val Gly Ser His Gly Arg 260 265 Met Leu Leu Gly Ser Thr Ser Arg Ala Leu Leu 275 280 Pro Met Met Val Val Arg Pro Pro Glu Lys Ile 290 295 <210> 21 <211> 1059 <212> DNA <213> Corynebacterium giutamioum <220> <221> COS <222> (1036) <223> RXC00552 <400> 21 cogccaacaa ggcagcaaag ctcgatooaa ttgacgcott gtttttaagg tagocacaca tcgcactaga ctgaagaact Leu Ile Giu Arg Val Lys Lys Ile 240 Ala Ser Glu Asn 255 Gly Phe Lys Gly 270 Ser Ala Pro Cys 285 Lys at t Ile ca g Gin at o Ile gat Asp aac As n aag Lys gcgttatgag taaaagcctc gtg gct acc tca aaa Vai Ala Thr Ser Lys 1 gac cot aaa gcg gtt Asp Pro Lys Ala Val aat ott cgt ggo cgc Asn Leu Arg Gly Arg gtg ggo gqa gat att Val Gly Gly Asp Ile gag tao cca ggt ttc Glu Tyr Pro Gly The got gag gat tto ooa Ala Glu Asp Phe Pro gco ttc ggo got coa Ala Phe Gly Ala Pro 100 WO 01/66573 WO 0166573PCTIBOOIO2035 gat Asp ctg Leu gtt Val1 tt c Phe 150 gca Al a gt C Val1 atg Met gtt Val Ct c Leu 230 aaa Lys gag Glu cct Pro tgt Cys aaa gtg Lys Val 105 cag cag Gin Gin ttt gac Phe Asp gct qtt Ala Val gag tct Giu Ser 170 tgc acc Cys Thr 185 cgt ggt Arg Gly ggc gag Gly Giu ttc gat Phe Asp gga cac Gly His 250 ctc aac Leu Asn 265 ttc gcC Phe Ala att gct Ile Ala gat gaa Asp Glu gtc aat Val Asn ggc cgc Gly Arg 140 gtc cct Val Pro 155 gga aaa Gly Lys ggc gga Gly Gly ttc aaa Phe Lys cag ttt Gin Phe 220 aag cgc Lys Arg 235 tgc atc Cys Ile gaa gat Glu Asp aat gtt Asn Val gcg gat Ala Asp 300 gtt cac Val His gat gaa Asp Glu ggc aag Gly Lys ttc atc Phe Ile 165 cct gtg Pro Val 180 tca ctc Ser Leu ggc atc Gly Ile ggc tcc Gly Ser gat tac Asp Tyr 245 aaa ttt Lys Phe 260 atg tgc Met Cys gaa cgc Glu Arg ccg. ctc Pro Leu 451 499 547 595 643 691 739 787 835 883 931 979 1027 1059 Phe Ala Glu gtt act tct taaaaagggt atggtggctg ggt Val Thr Ser 310 (210> 22 <211> 312 <z212> PRT (213> Corynebacterium glutamicum WO 01/66573 WO 0166573PCTIIBOO/02035 <400> 22 Val Ala 1 Asp Pro Asn Leu Val Gly Glu Tyr Ala Glu Ala Phe Gly Gly Ala Arg 130 Ala Gln 145 Thr His Lys Asp Ile Leu Ile Asp 210 Leu Trp 225 Phe Gly Pro Thr Leu Val Cys Lys 290 Gly Ile 305 Lys Ile Val Gin Arg Ile Ile Asp Phe Asn 70 Pro Lys Pro Asp His Leu Giu Val Lys Phe 150 Ile Ala 165 Val Val Leu Met Ile Val Ser Leu 230 Tyr Lys 245 Phe Giu Cys Pro Arg Cys Leu Val 310 Leu Leu Leu Asp 55 Arg Len Gin Lys Val 135 Lys Gin Thr Ile Arg 215 Tyr Gin H is Asp Al a 295 Thr Phe Thr Leu Cys Gly Ile Ile Lys Trp, Ser Arg Asp Giu Asn Asn Gin 125 Arg Asn 140 Pro Asp Lys Tyr Gly Ile Lys Giu 205 Phe Gly 220 Arg Met Ile His Asp Asp Val -Gin 285 Asp Phe 300 Ser Leu Thr Arg Gly Val Val Gin Gin Thr 160 Leu Glu Gln Gly Gin 240 Thr Glu His Gin WO 01/66573 WO 0166573PCTIBOOIO2035 <210> 23 <211> 1386 <212> DNA <213> Coryriebacteriun glutamicun <220> <221> CDS <222> (101)..(1363) <223> RXA00534 <400> 23 ctgtgcagaa agaaaacact cctctggcta ggtagacaca gtttataaag gtagagttga gegggtaact gtcagcacgt agatcgaaag gtgcacaaag gtg gcc ctg gte gta Val Ala Leu Val Val cag aaa Gin Lys gtc gct Val Ala gtt gtC Val Val gca geg Ala Ala ctg act Leu Thr gag tcc Glu Ser gtg etc Val Leu eca ggt Pro Gly gct ggt Ala Gly 135 ggt cgt Gly Arg 150 aac get Asn Ala WO 01/66573 WO 0166573PCT/iBOOIO 2035 gct Ala ttc Phe ctg Leu ogo Arg 230 gag Giu aag Lys gag Giu gac Asp atc Ile 310 ttg Leu gac Asp cca Pro aac Asn cgt Arg 390 cag Gin gac Asp gaa Glu ogc Arg 215 t cg Ser gat Asp tcc Ser gct Al a at g Met 295 acc Thr aag Lys cag Gin ggt Gly at c Ile 375 gaa Glu ct g Leu cog Pro gaa Giu 200 agt Ser tct Ser att Ile gaa Giu gog Al a 280 gtt Val ttc Phe aag Lys gt c Val1 gtt Vai 360 ga a Giu gat Asp ggo Gly ogc Arg 185 atg Met gtt Val tat Tyr cot Pro gcC Al a 265 aag Lys ctg Leu a cc Thr ctt Leu ggc Gly 345 acc Thr ttg Leu gat Asp ggc Gly 170 at c Ile ctg Leu ga a Giu agt Ser gtg Vai 250 aaa Lys gtt Val1 ca g Gin tgc Cys cag Gin 330 aaa Lys gca Aia att Ile ctg Leu gaa Giu 410 gt t Val gaa Giu tac Tyr aat Asn 235 gaa Giu gta Val1 tto Phe aac Asn cct Pro 315 gtt Vai gt o Vai gag Giu t cc Ser gat Asp 395 gac Asp 175 cag Gin gtt Val ttc Phe act Thr ott Leu 255 ggt Gly got Ala gta Val ggc Gly tgg Trp 335 ggt Giy gct Ala att Ile cgt Arg gtt Val 415 aag Lys 9gC Giy aat Asn ttg Leu 240 a cc Thr att Ile gat Asp gaa Glu cgc Arg 320 acc Thr got Ala ctg Leu cgt Arg gca Al a 400 tat Tyr gaa Giu aag Lys 210 oca Pro gcc Al a gt 0 Val1 gat Asp gaa Giu 290 ggc Gly gog Al a gtg Val at g Met gat Asp 370 too Ser cat His ggC Gly 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 1267 1315 1363 WO 01/66573 PCT/IB00/02035 O O S taaagtttta aaggagtagt ttt 1386 U Q <210> 24 <211> 421 S <212> PRT <213> Corynebacterium glutamicum <400> 24 Val Ala Leu Val Val Gin Lys Tyr Gly Gly Ser Ser Leu Glu Ser Ala -1 5 10 Glu Arg Ile Arg Asn Val Ala Glu Arg Ile Val Ala Thr Lys Lys Ala (f 20 25 S Gly Asn Asp Val Val Val Val Cys Ser Ala Met Gly Asp Thr Thr Asp 40 Glu Leu Leu Glu Leu Ala Ala Ala Val Asn Pro Val Pro Pro Ala Arg 55 Glu Met Asp Met Leu Leu Thr Ala Gly Glu Arg Ile Ser Asn Ala Leu 70 75 Val Ala Met Ala Ile Glu Ser Leu Gly Ala Glu Ala Gin Ser Phe Thr 90 Gly Ser Gin Ala Gly Val Leu Thr Thr Glu Arg His Gly Asn Ala Arg 100 105 110 Ile Val Asp Val Thr Pro Gly Arg Val Arg Glu Ala Leu Asp Glu Gly 115 120 125 Lys Ile Cys Ile Val Ala Gly Phe Gin Gly Val Asn Lys Glu Thr Arg 130 135 140 Asp Val Thr Thr Leu Gly Arg Gly Gly Ser Asp Thr Thr Ala Val Ala 145 150 155 160 Leu Ala Ala Ala Leu Asn Ala Asp Val Cys Glu Ile Tyr Ser Asp Val 165 170 175 Asp Gly Val Tyr Thr Ala Asp Pro Arg Ile Val Pro Asn Ala Gin Lys 180 185 190 Leu Glu Lys Leu Ser Phe Glu Glu Met Leu Glu Leu Ala Ala Val Gly 195 200 205 Ser Lys Ile Leu Val Leu Arg Ser Val Glu Tyr Ala Arg Ala Phe Asn 210 215 220 Val Pro Leu Arg Val Arg Ser Ser Tyr Ser Asn Asp Pro Gly Thr Leu 225 230 235 240 Ile Ala Gly Ser Met Glu Asp Ile Pro Val Glu Glu Ala Val Leu Thr 245 250 255 Gly Val Ala Thr Asp Lys Ser Glu Ala Lys Val Thr Val Leu Gly Ile 260 265 270 WO 01/66573 WO 0166573PCT/IBOO/02035 U Ser Ala Asp 305 Arg As n Gly Arg Ile 385 Leu Al a Pro Asn Thr Glu Tyr 340 Ser As n Leu Gln Gly 420 Al a Val1 Gly Trp 335 Gly Ala Ile Arg Val 415 <210> <211> 1155 <212> DNA <213> Corynebacterium glutarnicum <22 0> <221> CDS <222> (1132) <223> RXA00533 <400> ctgcacgtgc attgcatgaq cagttccagc tgggcgqcga. caggcaccgg acgctaaagt tttaaaggag tagttttaca gt t Val gaa Glu cgt Ar g ga a agacgaagcc gtcgtttatg atg acc acc atc gca Met Thr Thr Ile Ala 1 atg cgc acc ctt ttg Met Arg Thr Leu Leu ttc ttt gct tcc cca ?he ?he Ala Ser Pro acg gaa atc gag gta Thr Glu Ile Glu Val aag gac atc gac gtt WO 01/66573 WO 0166573PCTfIBOOIO2035 Giu gog Al a ttc Phe aag Lys aag Lys atg Met gt a Val 150 gca Al a aac Asn gga Gly aac Asn cgc Arg 230 ggC Gly cac His ttg Leu Ile ttc Phe gct Ala gac Asp tcc Ser 120 gcg Ala ct t Leu gt g Val gag Glu tat Tyr 200 gt c Val1 gaa Glu t gc Cys gaa Giu gcc Ala 280 Gin Ala Thr Glu Glu Ser Leu Asp Ile Asp Val gct Ala qgo Gly gt t Val gt c Val oca Pro gtt Val a cc Thr 170 gt o Val t ca Ser gao Asp cgc Arg cgc Arg 250 gao Asp tca Ser acc Thr gtt Val at c Ile att Ile 125 aag Lys tac Tyr aag Lys gga Gly gct Ala 205 ttc Phe ctc Leu gtt Val at c Ile aag Lys 285 t cc S er gat Asp 95 tct Ser gcg Ala ctt Leu got Ala gtt Vai 175 got Ala aac Asn acc Thr ctc Leu aco Thr 255 gtg Val gt o Val gtt Val oca Pro tgg Trp 100 tcc Ser aco Thr ggt Gly ggt Gly gao Asp 180 gat Asp gcc Al a aag Lys gt c Val acc Thr 260 gag Giu ca Pro ca g Gin ctg Leu cgc Arg gao Asp aco Thr ott Leu ott Leu 165 cac His gt c Val gga Gly ctg Leu toa Ser 245 att Ile at c Ile ctt Leu gac Asp 355 403 451 499 547 595 643 691 739 787 835 883 931 979 1027 goa got gcc ggc att gao gaa tcc otc Ala Ala Ala Giy Ile Asp Glu Ser Leu WO 01/66573 WO 0166573PCTIBOO/02035 295 300 305 too act gtc gao gat aac cgc gqt ctq qtt ctc gtc gta tct ggc qac Ser Thr Val Asp Asp Asn Arg Gly Leu Val. Leu Val Val Ser Gly Asp 310 315 320 325 aac otc cgc aag ggt gct gcg cta aac acc atc cag atc gct gag ctg Asn Leu Arg Lys Gly Ala Ala Leu Asn Thr Ile Gin Ile Ala Giu Leu 330 335 340 ctg gtt aag taaaaacccg ccattaaaaa ctc Leu Val Lys <210> 26 <211> 344 <212> PR T <213> Corynebacteriun giutamicum 1075 1123 1155 <400> 26 Met Thr Thr Ile Ala Val Val Gly Ala 1 Met Phe Thr Lys Gin Ser Val Pro Asp 145 Se r Ala Asp Arg Thr Phe Ala Giu Ile Asp Ile Tyr Ala Ser Ala Asn Pro 115 Asn Cys 130 Ala Ala Giy Ser Val Gly Ala Gly 195 Thr Phe Arg Gin Ala Gly Vai Val Pro Val Thr 170 Val S er Asp Val Asp Giu Giu Thr Val1 Ile Ile 125 Lys Tyr Lys Gly Ala 205 Phe Gly Thr Phe Giu Al a Val Val 110 Ile Pro Gin Gin Gin 190 Tyr Glu Val Arg Gly Leu Lys Asn Giu As n His Val 160 Ala Ala Val1 Asp Leu Pro Phe Ala Gly Asn Leu Val Asp WO 01/66573 PCT/IBOO/02035 210 215 220 Giu Glu Gin Lys Leu Arg Asn Glu Ser Arg Lys Ile Leu Gly Leu Pro 225 230 235 240 S Asp Leu Lys Val Ser Gly Thr Cys Vai Arg Vai Pro Vai Phe Thr Giy 245 250 255 His Thr Leu Thr Ile His Ala Glu Phe Asp Lys A-la Ile Thr Val. Asp 260 265 270 Gin Ala Gin GJlu Ile Leu Gly Ala Ala Ser Gly Val Lys Leu Val Asp 275 260 285 Val. Pro Thr Pro Leu Ala Ala Ala Gly Ile Asp Glu Ser Leu Val. Giy rl290 295 300 Arg Ile Arg Gin Asp Ser Thr Val. Asp Asp Asn Arg Giy Leu Val. Leu 305 310 315 320 Va]. Val. Ser Gly Asp Asn Leu Arg Lys Gly Ala Aia Leu Asn Thr Ile 325 330 335 Gin Ile Ala G].u Leu Leu Val. Lys 340 <210> 27 <211> 608 <212> DNA <213> Corynebacterium giutamicun <22 0> <221> CDS <222> (608) <223> RXA02843 <400> 27 cccattgcgc ggaggtogca ccccttccga cttgaactga taggccgata gaaattattc tggacgtc atg act act gct tcc gca acc gga att gca aca ctg aco tcc 110 Met Thr Thr Ala Ser Ala Thr Giy Ile Ala Thr Leu Thr Ser 1 5 acc ggc gac gtc ctg gac gtg tgg tat cca gaa atc ggg too acc gac 158 Thr Gly Asp Val. Leu Asp Vai Trp Tyr Pro Glu Ile Giy Ser Thr Asp 20 25 cag too gcg cto aca cot ota gaa ggc gtc gat gaa gat oga aac gtc 206 Gin Ser Ala Leu Thr Pro Leu Glu Gly Val. Asp Giu Asp Arg Asn Val 40 acc ogo aaa atc gtg aog aoa act ato gao acc gao goa gco coo aco 254 Thr Arg Lys Ile Val. Thr Thr Thr Ile Asp Thr Asp Ala Ala Pro Thr 55 gao aco tac gat goa tgg ctg cgc ott cac cto otc too cac cgc gtt 302 Asp Thr Tyr Asp Ala Trp Leu Arg Leu His Leu Leu Ser His Arg Val 70 ttc cgc cot cac aco ato aac ota gao ggc att tto ggc ctc oto aac 350 WO 01/66573 PCTIBOOIO2O35 Phe Arg Pro His Thr Ile Asn Leu Asp Gly Ile Phe Gly Leu Leu Asn c180 85 aat gtc gtg tgg acc aac ttc gga ocg tgc gca gtt gac ggt ttc gca 398 Asn Val Val Trp Thr Asn Phe Gly Pro Cys Ala Val Asp Gly Phe Ala 100 105 110 ctc acc ogo qcg cgc ctg toa cgc cga. ggc caa gtt acg gtt tat ago 446 Leu Thr Arg Ala Arg Leu Ser Arg Arg Gly Gin Val Thr Val Tyr Ser 115 120 125 gtc gao aag tto oca cgc atg gto gac tat qtg gtt ccc tog ggc gtg 494 Val. Asp Lys Phe Pro Arg Met Val Asp Tyr Val Val Pro Ser Gly Val C1130 135 140 cgc atc ggt gac goc gao cgc gtc cga ctt ggc gog tac otg gca. gat 542 IND Arg Ile Gly Asp Ala Asp Arg Val Arg Leu Gly Ala Tyr Leu Ala Asp 145 150 155 ggo aco aco gtg atg oat gag ggc tto gtg aao ttc aac got ggc aog 590 Gly Thr Thr Val Met His Glu Gly Phe Val Asn Phe Asn Ala Giy Thr 160 165 170 oto ggc got too atg gtt 608 Leu Giy Ala Ser Met Val 175 180 <210> 28 <211> 180 <212> PRT <213> Corynebacterium giutamioum <400> 28 Met Thr Thr Ala Ser Ala Thr Gly Ile Ala Thr Leu Thr Ser Thr Gly 1 5 10 Asp Val Leu Asp Val Trp Tyr Pro Giu Ile Gly Ser Thr Asp Gin Ser 25 Ala Leu Thr Pro Leu Glu Giy Vai Asp Glu Asp Arg Asn Vai Thr Arg 40 Lys Ile Vai Thr Thr Thr Ile Asp Thr Asp Ala Ala Pro Thr Asp Thr 55 Tyr Asp Ala Trp Leu Arg Leu His Leu Leu Ser His Arg Val. Phe Arg 70 75 Pro His Thr Ile Asn Leu Asp Giy Ile Phe Giy Leu Leu Asn Asn Val 90 Vai Trp Thr Asn Phe Gly Pro Cys Ala Vai Asp Giy Phe Ala Leu Thr 100 105 110 Arg Ala Arg Leu Ser Arg Arg Gly Gin Val. Thr Vai Tyr Ser Vai A.1p 115 120 125 Lys Phe Pro Mrg Met Val Asp Tyr Val Vai Pro Ser Gly Val Arg Ile 130 135 140 WO 01/66573 WO 0166573PCT/IBOO/02035 Gly Asp Ala Asp Arg Val Arg 1.eu Gly Ala Tyr Leu Ala Asp Gly Thr 145 150 155 160 Thr Val Met His Glu Cly Phe Val Asn Phe Asn Ala Gly Thr Leu Gly 165 170 175 Ala Ser Met Val 180 <210> 29 <211> 1230 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (1207) <223> RXA02022 <400> 29 tatttgcgat tccaactqct tqggctccgc gaatgttttc actcattttt taatcgaccg cttccatcat gttttaacta aggtttgtag gcttaaacct gtg aac tct gaa ctc Val Asn Ser Glu Leu ggC Gly tcg Ser aac Asri ctt Leu cat His gac Asp gcg Ala a aa Lys 125 cac His WO 01/66573 PCT[IBOO/02035 IN0/6D3PCJBO/23 135 140 145 gat gag cat ccg gag tgg ttg gcg gct gat ttg gcg ttg ttg ggt gag 595 Asp Giu His Pro Giu Trp Leu Ala Ala Asp Leu Ala Leu Leu Gly Giu S 150 155 160 165 cct act ggc ggc tgg att gag gcg ggc tgc cag ggc aat ctg cgc atc 643 Pro Thr Gly Gly Trp Ile Glu Ala Giy Cys Gin Gly Asn Leu Arg Ile 170 175 180 aag gtg acg gcg cat .ggt gtg cgt gcc cat tcg gcg aga agc tgg ttg 691 Lys Val Thr Ala His Gly Val Arg Ala His Ser Ala Arg Ser Trp Leu 185 190 195 ggt gat aat gcg atg cat aag ttg tcg ccg atc att tog aag gtt gct 739 Gly Asp Asn Ala Met His Lys Leu Ser Pro Ile Ile Ser Lys Val Aia ID200 205 210 gcg tat aag gcc gca gaa gtc aac att gat ggc ttg acc tac cgt gaa 787 Ala Tyr Lys Aia Ala Glu Val Asn Ile Asp Gly Leu Thr Tyr Arg Glu 215 220 225 ggc ctc aac atc gtt ttc tgc gaa tcg ggc gtg gca aac aac gtc att 835 Gly Leu Asn Ile Val Phe Cys Glu Ser Gly Val Ala Asn Asn Val Ile 230 235 240 245 cca gao ctc gcg tgg atg aac ctc aac ttc cgt ttc gog ccg aat cgc 883 Pro Asp Leu Ala Trp Met Asn Leu Asn Phe Arg Phe Ala Pro Asn Arg 250 255 260 gat ctc aac gag gcg atc gag cat gtc gtc gaa acg ctt gag ctt gac 931 Asp Leu Asn Giu Ala Ile Glu His Val Val Giu Thr Leu Giu Leu Asp 265 270 275 ggt caa qac qgc atc gaa tgg gcc gta gaa gac ggg gca ggc ggt gcc 979 Gly Gin Asp Giy Ile Giu Trp Ala Val Giu Asp Gly Ala Gly Gly Ala 280 285 290 ctt cca ggc ttg ggg cag cag gtg aca agc ggg ctt atc gac gcc.gtc 1027 Leu Pro Giy Leu Gly Gin Gin Vai Thr Ser Gly Leu Ile Asp Ala Val 295 300 305 ggc cgc gaa aaa atc cgc gca aaa ttc ggc tgg acc gat gtc tca cqt 1075 Gly Arg Glu Lys Ile Arg Ala Lys Phe Giy Trp Thr Asp Val Ser Arg 310 315 320 325 ttt tca gcc atg gga att cca gcc cta aac ttt ggc gct ggt gat cca 1123 Phe Ser Ala Met Gly Ile Pro Ala Leu Asn Phe Giy Ala Giy Asp Pro 330 335 340 agt ttc gcg cat aaa cgc gac gag cag tgc cca gtg gag cas atc acg 1171 Ser Phe Ala His Lys Arg Asp Glu Gin Cys Pro Vai Giu Gin Ile Thr 345 350 355 gat gtg gca gca att ttg aag cag tac ctg agc gag taaccgcatt 1217 Asp Val Ala Ala Ile Leu Lys Gin Tyr Leu Ser Giu 360 365 cggggttatc gtg 1230 WO 01/66573 PCTIBOOIO2035 <210> (KI <211> 369 <212> PRT <213> Corynebacterium glutamicum <400> G30e y r lyLuApLuLu l s r i Val Asn e l eLyPr l eAs e e lAsPoIe 1 510 Val Leu Thr Gin Arg Leu Val Asp Ile Pro Ser Pro Ser Gly Gin Giu 25 Lys Gin Ile Ala Asp Giu Ile Giu Asp Ala Leu Arg Asn Leu Asn Leu C135 40 Pro Gly Val Glu Val Phe Arg Phe Asn Asn Asn Val Leu Ala Arg Thr 55 Asn Arg Gly Leu Ala Ser Arg Val Met Leu Ala Gly His Ile Asp Thr 70 75 Val Pro Ile Ala Asp Asn Leu Pro Ser Arg Val Giu Asp Gly Ile Met 90 Tyr Gly Cys Gly Thr Val Asp Met Lys Ser Gly Leu Ala Val Tyr Leu 100 105 110 His Thr Phe Ala Thr Leu Ala Thr Ser Thr Glu Leu Lys His Asp Leu 115 120 125 Thr Leu Ile Ala Tyr Giu Cys Glu Giu Val Ala Asp His Leu Asn Gly 130 135 140 Leu Gly His Ile Arg Asp Giu His Pro Glu Trp Leu Ala Ala Asp Leu 145 150 155 160 Ala Leu Leu Gly Giu Pro Thr Gly Gly Trp Ile Glu Ala Gly Cys Gin 165 170 175 Gly Asn Leu Arg Ile Lys Val Thr Ala His Gly Val Arg Ala His Ser 180 185 190 Ala Arg Ser Trp Leu Gly Asp Asn Ala Met His Lys Leu Ser Pro Ile 195 200 205 Ile Ser Lys Vai Ala Ala Tyr Lys Ala Ala Glu Val Asn Ile Asp Gly 210 215 220 Leu Thr Tyr Arg Giu Giy Leu Asn Ile Val Phe Cys Glu Ser Gly Vai 225 230 235 240 Ala Asn Asn Val Ile Pro Asp Leu Ala Trp Met Asn Leu Asn Phe Arg 245 250 255 Phe Ala Pro Asn Arg Asp Leu Asn Giu Ala Ile Giu His Val Val Glu 260 265 270 Thr Leu Glu Leu Asp Gly Gin Asp Gly Ile Glu Trp Ala Val Glu Asp 275 280 285 Gly Ala Gly Gly Ala Leu Pro Gly Leu Gly Gin Gin Val Thr Ser Gly WO 01/66573 WO 0166573PCTIBOOO2035 Leu 305 Thr Gly Val Giu 290 295 300 Ile Asp Ala Val Gly Arg Glu Lys Ile Arg Ala Lys Phe Gly Trp 310 315 320 Asp Val Ser Arg Phe Ser Ala Met Gly Ile Pro Ala Leu Asn Phe 325 330 335 Ala Gly Asp Pro Ser Phe Ala His Lys Arg Asp Giu Gin Cys Pro 340 345 350 Glu Gin Ile Thr Asp Val Ala Ala Ile Leu Lys Gin Tyr Leu Ser 355 360 365 <210> 31 <211> 1059 <212> DNA <213> Corynebacterium glutamicum <220> <z221> CDS <222> (101)..(1036) <223> RXA00044 <400> 31 attacctcag ccttccaagc tgatgatgca ttacttaaaa ttctcacccq cactcgttcc ctcaacccac aaggagcacc actgcagaca cttgaaaaac atg qet Met Ala tcc gca act Ser Ala Thr tt C Phe agt Ser ggt Gly ttc Phe ca c His act Thr ggc Gly gat Asp gt c Val acc Thr gca Al a cgc Arg acc Thr ctc Leu ggc Gi y gca Ala gct Al a gat Asp c ca Pro gtt Val t cc S er ctg Leu ggt Giy 80 gcc Ala acc Thr 1 ctc Leu gac Asp t ca Ser acc Thr gtc Val ctg Leu cgc Arg ca c His cac His ggc Gly acc Thr att Ile gag Glu a cc Thr gcc Ala Cc Le u gaa Giu at c Ile gaa Giu qct Ala cac His gac ggc Asp Gly atc aat Ile Asn gcg gca Ala Ala atc gag Ile Giu acc acc Thr Thr ggt gcc Gly Ala 100 gat gtg Asp Val gaa ggc ctc gtt gcc act gca Glu Gly Leu Val Aia Thr Ala cct ttc tac Pro Phe Tyr WO 01/66573 WO 0166573PCTIBOO/02035 gaa Glu cca Pro cca Pro 150 aag Lys cgt Arg gaa Glu cca Pro ct C Leu 230 at c Ile tcc Ser ct t Leu agc Ser tac Tyr 310 at t Ile ct g Leu 135 gt c Val gat Asp gat Asp acc Thr 9gc Gly 215 tgc Cys aac Asn gga Gly ggc Gly ga c Asp 295 acc Thr 105 gaa Glu gcc Al a ctt Leu agt Ser gct Al a 185 gtt Val qgC Gly gat Asp ctc Leu agc Ser 265 att Ile gaa Glu ca c His tac Tyr ttg Leu ggC Gly 170 gga Gly gat Asp aat Asn gga Gly ttc Phe 250 gct Ala gaa Glu act Thr ct t Leu aac Asn acc Thr 165 gct Ala agc Ser qt c Val aaa Lys cgc Arg 245 atg Met cac His ctc Leu ctg Leu 499 547 595 643 691 739 787 835 883 931 979 1027 1059 Arg Ile His taaggcccac acctcatgac tga <210> 32 <211> 312 <212> PRT <213> Corynebacterium glutarnicum <400> 32 WO 01/66573 WO 0166573PCT/IBOO/02035 Met Leu Asp Ser Thr Val Leu Arg Ala His 145 Val1 Ser Ile Al a Ala 225 Al a Asp Thr Pro Val 305 Thr Val Gly Leu Thr Ala Gly Ile Leu 135 Val Asp Asp Thr Gly 215 Cya Asn Gly Gly Asp 295 Thr Pro Leu Phe Arg Pro Leu Al a Arg Ile 140 Leu Asp Thr Al a Asp 220 Trp Ile Leu Asn Arg 300 Val Ax g Al a Lys Val Val1 Pro Lys 125 Pro Al a Gly Glu Tyr 205 Pro Ala Val Gly Al a 285 Ile WO 01/66573 WO 0166573PCTILBOO/02035 <210> 33 <211> 867 <212> DNA <213> Corynebacteriumn giutamicum <220> <221> CDS <222> (101) (84 4) <223> RXA00863 <400> 33 aacggtcagt taggtatgga tatcageacc ttctgaacgg gta gtttgaaaaa ctcttcgccc cacgaaaatg aaggagcata atg cgtctag actggtgggc gga ggc Gly gtc Val gat Asp ttc Phe aac Asn tt g Leu ctg Leu t cc Ser cac His gct Al a 150 aaa Lys gat Asp ctg Leu gct Ala gtt Val 75 gac Asp ttt Phe cge Arg ctg Leu gcg Ala 155 ggc Gly ctg Leu gta Val gt g Val gtt Val t gg Trp gct Ala ttc Phe gat Asp 140 gea Ala cgt Arg gag Giu gac. Asp atg Met gga Gly ctt Leo ate Ile t tc Phe 125 gca Ala ege Arg Met Gly 1 act att Thr Ile gag ate Glu Ile gaa gtt Giu Val gag ttc Glu Phe ttc gat Phe Asp gac aat Asp Asn ttg acc Leu Thr gaa gtt Giu Val 130 aec gcg Thr Ala 145 ggc atg Gly Met ate aag gtt Ile Lys Val gtg gca gca Val Ala Ala ggc gtc gac Gly Val Asp gtc gtt gac Val Val Asp tgc atc aac Cys Ile Asn gat gct cgt Asp Ala Arg gtc ggt gtt Val Gly Val 100 atg gtc ttt Met Vai Phe 115 att gag ctg Ile Glu Leo ate cae act Ile His Thr gac gca eag Asp Ala Gin 165 eca gat gog ace gag cag gca ett gag ggt tee cgt Pro Asp Ala Thr Glu Gin Ala Leu Glu Gly Ser Arg gge gea age gta Gly Ala Ser Val 180 WO 01/66573 PCT/IBOO/02035 gat gga atc ccg gtt cat gca gte cgc atg tec ggc atg gtt gct eac 691 rN~ Asp Gly Ile Pro Val His Ala Val Arg Met Ser Gly Met Val Ala His 185 190 195 gag caa gtt ate ttt ggc ace cag ggt cag ace ttg acc atc aag cag 739 Gia Gin Val Ile Phe Gly Thr Gin Gly Gin Thr Leu Thr Ile Lys Gin 200 205 210 gac tcc tat gat cgc aae tea ttt gca eca. ggt gtc ttg gtq ggt gtg 787 Asp Ser Tyr Asp Arg Asn Ser Phe Ala Pro Gly Val Leu Val Gly Val 215 220 225 cgc aac att gca. cag cac cca. ggc eta gtc gta gga ctt gag cat tac 835 Arg Asn Ile Ala Gin His Pro Gly Leu Val Val Gly Leu Glu His Tyr 230 235 240 245 eN ta gge etg taaaggetea ttteageage ggg 867 Leu Gly Leu <210> 34 <211> 248 <212> PRT <213> Corynebacterium giutamicum <400> 34 Met Gly Ile Lys Val Gly Val Leu Gly Ala Lys Gly Arg Val Gly Gin 1 5 10 Thr Ile Val Ala Ala Val Asn Giu Ser Asp Asp Leu Giu Leu Vai Ala 25 Giu Ile Gly Val Asp Asp Asp Leu Ser Leu Leu Val Asp Asn Gly Ala 40 Glu Vai Val Val Asp Phe Thr Thr Pro Asn Ala Val Met Giy Asn Leu 55 Glu Phe Cys Ile Asn Asn Gly Ile Ser Ala Val Val Gly Thr Thr Gly 70 75 Phe Asp Asp Ala Arg Leu Giu Gin Vai Arg Asp Trp Leu Giu Gly Lys 90 Asp Asn Val Gly Val Leu Ile Ala Pro Asn Phe Ala Ile Ser Ala Val 100 105 110 Lou Thr Met Val Phe Ser Lys Gin Ala Ala Arg Phe Phe Giu Ser Ala 115 120 125 Giu Vai Ile Giu Leu His His Pro Asn Lys Leu Asp Ala Pro Ser Gly 130 135 140 Thr Ala Ile His Thr Ala Gin Gly Ile Ala Ala Ala Arg Lys Giu Ala 145 150 155 160 Gly Met Asp Ala Gin Pro Asp Ala Thr Glu Gin Ala Leu Giu Gly Ser 165 170 175 Arg Gly Ala Ser Val Asp Gly Ile Pro Val His Ala Val Arg Met Ser WO 01/66573 WO 0166573PCT/IBOO/02035 Gly Met Val 195 Leu Thr Ile 210 Val Leu Vai 225 Gly Leu G2lu 180 185 190 Ala His Giu Gln Val Ile Phe Gly Thr Gin Gly Gin Thr 200 205 Lys Gin Asp Ser Tyr Asp Arg Asn Ser Phe Ala Pro Gly* 215 220 Giy Val Arg Asn Ile Ala Gin His Pro Gly Leu Val Val 230 235 240 His Tyr Leu Gly Leu 245 <210> <21 1> 873 <212> DNA <213> Corynebacteriui giutaiuicum <220> <221> CDS <222> (101)..(850) <223> RXA00864 <400> acagcaccca ggcctagtcg taggacttga gcattaccta ggcctgtaaa ggctcatttc agcagcgggt ggaatttttt aaaaggagcg tttaaaggct gtg gcc gaa caa gtt Val Ala Glu Gin Val gag Giu t ca Ser gcc Aia gct Ala gag Giu acc Thr cag Gin at c ttg Leu act Thr tgc Cys gcg Ala cat His cat His cgt Arg gat gct Al a gag Giu cga Arg cac His att Ile ttc Phe gtg Val1 atg WO 01/66573 PCT/IBOO/02035 Val Pro Thr Leu Ile Asp Glu Asp Pro Gin Leu Arg Glu Leu Phe Met 120 125 130 oac gcc atg gat gag tot cgg tto got ttc aat gag ctg ott aat gog 547 His Ala Met Asp Glu Ser Arg Phe Ala Phe Asn Glu Leu Leu Asn Ala 135 140 145 ctg qaa gaa aaa ctt ggc gat gaa ccg aat gca ctt tta agg aaa aag 595 Leu Glu Glu Lys Leu Gly Asp Glu Pro Asn Ala Leu Leu Arg Lys Lys 150 155 160 165 cag gct cgt caa gca gct cgc gct gtg ctg ccc aac gct aca gag tcc 643 Gin Ala Arg Gin Ala Ala Arg Ala Val Leu Pro Asn Ala Thr Glu Ser C1170 175 180 aga atc gtg gtg tct gga aac ttc cgc acc tgg agg cat ttc att ggc 691 Arg Ile Val Val Ser Gly Asn Phe Arg Thr Trp Arg His Phe Ile Gly 185 190 195 atg cga gcc agt gaa cat gca gac gtc gaa atc cgc gaa gta gcg gta 739 Met Arg Ala Ser Glu His Ala Asp Val Glu Ile Arg Giu Val Ala Val 200 205 210 gaa tgt tta aga aag ctg cag gta gca gcg cca act gtt ttc ggt gat 787 Glu Cys Leu Arg Lys Leu Gin Val Ala Ala Pro Thr Val Phe Gly Asp 215 220 225 ttt gag att gaa act ttg gca gac gga tcg caa atg gca aca agc ccg 835 Phe Glu Ile Glu Thr Leu Ala Asp Gly Ser Gin Met Ala Thr Ser Pro 230 235 240 245 tat gtc atg gac ttt taacgcaaag ctcacacoca cga 873 Tyr Val Met Asp Phe 250 <210> 36 <211> 250 <212> PRT <213> Corynebacteriun glutamicum <400> 36 Val Ala Giu Gin Val Lys Leu Ser Val Glu Leu Ile Ala Cys Ser Ser 1 5 10 Phe Thr Pro Pro Ala Asp Val Giu Trp Ser Thr Asp Val Glu Gly Ala 25 Giu Ala Leu Val Giu Phe Ala Gly Arg Ala Cys Tyr Giu Thr Phe Asp 40 Lys Pro Asn Pro Arg Thr Ala Ser Asn Ala Ala Tyr Leu Arg His Ile 55 Met Giu Val Giy His Thr Ala Leu Leu Glu His Ala Asn Ala Thr Met 70 75 Tyr Ile Arg Gly Ilie Ser Arg Ser Ala Thr His Glu Leu Vai Arg His 90 Arg His Phe Ser Phe Ser Gin Leu Ser Gin Arg Phe Val His Ser Gly WO 01/66573 WO 0166573PCTIBOO/02035 100 105 110 Glu Ser Glu Val Val Val Pro Thr Leu Ile Asp Giu Asp Pro Gin Leu 115 120 125 Arg Giu Leu Phe Met His Ala Met Asp Glu Ser Arg Phe Ala Phe Asn 130 135 140 Glu Leu Leu Asn Ala Leu Glu Glu Lys Leu Gly Asp Giu Pro Asn Ala 145 150 155 160 Leu Leu Arg Lys Lys Gin Ala Arg Gin Ala Ala Arg Ala Val Leu Pro 165 170 175 Asn Ala Thr Glu Ser Arg Ile Val Val Ser Gly Asn Phe Arg Thr Trp 180 185 190 Arg His Phe Ile Gly Met Arg Ala Ser Glu His Ala Asp Val Glu Ile 195 200 205 Arg Glu Val Ala Val Glu Cys Leu Arg Lys Leu Gin Val Ala Ala Pro 210 215 220 Thr Val Phe Gly Asp Phe Giu Ile Glu Thr Leu Ala Asp Gly Ser Gin 225 230 235 240 Met Ala Thr Ser Pro Tyr Val Met Asp Phe 245 250 <210> 37 <211> 608 <212> DNA <213> Corynebacterium giutamicum <220> <221> COS <222> (608) <223> RXA02943 <400> 37 cccattgcgc ggaggtcgca ccccttccga cttgaactga taggccgata gaaattattc tggacgtc atg act act gct tcc gca acc gga att gca aca ctg acc tcc 110 Met Thr Thr Ala Ser Ala Thr Gly Ile Ala Thr Leu Thr Ser 1 5 acc ggc gao gtc ctg gac gtg tgg tat cca gaa atc ggg tcc acc gac 158 Thr Gly Asp Val Leu Asp Val Trp Tyr Pro Glu Ile Gly Ser Thr Asp 20 25 cag tcc gcg ctc aca cct cta gaa ggc gtc gat gaa gat cga aac gtc 206 Gin Ser Ala Leu Thr Pro Leu Giu Gly Val Asp Glu Asp Arg Asn Val 40 acc cgc aaa atc gtg acg aca act atc qac acc gac gca gcc ccc acc 254 Thr Arg Lys Ile Val Thy Thy Thr Ile Asp Thr Asp Ala Ala Pro Thr 55 gac acc tac gat gca tgg ctg cgc ott cac ctc ctc tcc cac cgc gtt 302 Asp Thr Tyr Asp Ala Trp Leu Arg Leu His Leu Leu Set His Arg Val WO 01/66573 PCT/IBOO/02035 70 ttc cgc cct cac acc atc aac cta gac ggc att ttc ggc ctc ctc aac 350 Phe Arg Pro His Thr Ile Asn Leu Asp Gly Ile Phe Gly Leu Leu Asn 85 aat gtc gtg tgg acc aac ttc gga ccg tgc gca gtt gac ggt ttc gca 398 Asn Val Val Trp Thr Asn Phe Gly Pro Cys Ala Val Asp Gly Phe Ala 100 105 110 ctc acc cgc gcg cgc ctg tca cgc cga ggc caa gtt acg gtt tat agc 446 Leu Thr Arg Ala Arg Leu Ser Arg Arg Gly Gin Val Thr Val Tyr Ser 115 120 125 gtc gac aag ttc cca cgc atg gtc gac tat gtg gtt ccc tcg ggc gtg 494 Val Asp Lys Phe Pro Arg Met Val Asp Tyr Vai Val Pro Ser Gly Val. ID130 135 140 cgc atc ggt gac gcc gac cgc gtc cga ctt ggc gcg tac ctg gca gat 542 Arg Ile Gly Asp Ala Asp Arg Val Arg Leu Gly Ala Tyr Leu Ala Asp 145 150 155 ggc acc acc gtg atg cat gag ggc ttc gtg aac ttc aac gct ggc acg 590 Gly Thr Thr Val Met His Glu Gly Phe Val Asn Phe Asn Ala Gly Thr 160 165 170 ctc ggc gct tcc atg gtt 608 Leu Gly Ala Ser Met Val 175 180 <210> 38 <211> 180 <212> PRT <213> Corynebacteriui giutainicum <400> 38 Met Thr Thr Ala Ser'Ala Thr Gly Ile Ala Thr Leu Thr Ser Thr Giy 1 5 10 Asp Val Leu Asp Val Trp Tyr Pro Glu Ile Gly Ser Thr Asp Gin Ser 25 Ala Leu Thr Pro Leu Glu Gly Val Asp Glu Asp Arg Asn Vai Thr Arg 40 Lys Ile Val Thr Thr Thr Ile Asp Thr Asp Ala Ala Pro Thr Asp Thr 55 Tyr Asp Ala Trp Leu Arg Leu His Leu Leu Ser His Arg Val Phe Arg 70 '75 Pro His Thr Ile Asn Leu Asp Gly Ile Phe Gly Leu Leu Asn Asn Val 90 Val Trp Thr Asn Phe Gly Pro Cys Ala Val Asp Gly Phe Ala Leu Thr 100 105 110 Arg Ala Arg Leu Ser Arg Arg Gly Gin Val Thr Val Tyr Ser Val Asp 115 120 125 WO 01/66573 WO 0166573PCTIBOOIO203S Lys Phe Pro Arg Met Val Asp Tyr Val Val Pro Ser Gly Val Arg Ile 130 135 140 Gly Asp Ala Asp Arg Val Arg Leu Gly Al1a Tyr Leu Ala Asp Gly Thr 145 150 155 160 Thr Vai Met His Giu Gly Phe Val Asn Phe Asn Ala Gly Thr Leu Gly 165 170 175 Ala Ser Met Val 180 <210> 39 <211> 1143 <212> DNA <213> Corynebacterium glutarnicum <220> <221> CDS <222> (101)..(1120) <223> RXN00355 <400> 39 aatagatcag cgcatccgtg gtggaaccaa aaggctcaac aatacgaaac gttcgcttte ggtcctqatg aaagagatgt ccctgaatca tcatctaagt atg cat ctc ggt aag Met His Leu Gly Lys cag Gin at c Ile aag Lys cgc Arg gt g Val tcc Ser t gc Cys cag Gin 120 ga c Asp cgc Arg ct t Leu cgg Arg ga c Asp gcc Al a ac Thr 105 gte Val agt Ser gt a Val att Ile gcc Ala aag Lys acc Thr gta Vai atg Met gcc Ala gct Ala gcc Ala ace Thr eac His gac Asp gac Asp aac Asn ace Thr ate Ile aag Lys etc Leu gee Ala ate Ile ace Thr gaa Glu gag Glu ga Gi y atg Met aeg Thr gac Asp 80 gca Ala cac His 1 gat Asp aa e Asn gac Asp cca Pro gt g Val1 eca Pro ege Arg tae Tyr et g Leu et t Leu gte Val ctg Leu aag Lys ga e Asp aag aae atg Lys Asn Met gga ege age Gly Arg Ser gta gga ate Vai Gly Ile ttt gat gte Phe Asp Val ttc etg tgc Phe Leu Cys tte geg cag Phe Ala Gin 100 ate eca cge Ile Pro Arg 115 aac gtt gca Asn Val Ala gca gee gqe Ala Ala Gly 130 WO 01/66573 WO 0166573PCTJ IBOOI 02035 ctg Leu tae Tyr 150 ca Pro gtt Val aag Lys aag Lys gaa Giu 230 gaa Glu at g Met aac Asn acc Thr cag Gin 31.0 ctg gte Val 135 gca Ala ggt Glty caa Gin gee Ala cgc Arg 215 aac Asn gte Val cca Pr o eac His gct Ala 295 eag Gin etc t et Ser geg Al a ttg Leu aag Lys egc Arg 200 caa Gin gac Asp aac Asn eac His acc Thr 280 tee S er ggc Gly tee tgg gat eca Trp Asp Pro 140 tta gee gag Leu Ala Glu 155 ge eac tee Gly His Ser eag tae ace Gin Tyr Thr gaa gee gge Giu Ala Gly 205 gtg gtt gee Val Val Ala 220 ace atg cct Thr Met Pro 235 gac gaa gca Asp Glu Ala eae gtg att His Val Ile tac ate ctc Tyr Ile Leu 285 ate get tte Ile Ala Phe 300 gga get tte Gly Ala Phe 315 aac ttg gac Asn Leu Asp at g Met cag Gin get Al a 175 cca Pro et t Leu geg Ala tac Tyr tt c Phe 255 ace Thr et g Leu ege Arg gte ValI etg Leu 335 ege Arg t gg Trp ect Pro 180 et g Leu ace Thr ege Arg gaa Giu ace Thr 260 gge Gly gat Asp at g Met e ca Pro gte Val 340 gte Val gge Gly 165 ggC Gly gaa Glu eac His ate Ile gte Val 245 ggc Gly ttc Phe t te Phe aag Lys tac Tyr 325 547 595 643 691 739 787 835 883 931 979 1027 1075 Leu Leu Ser Pro 1120 1143 taatttaget egaggggeaa gga <210> <211> 340 <212> PRT <213> Corynebacterium glutamicumn WO 01/66573 <400> Met His Leu I Asp Tyr Lys Asn Leu Giv PCTIBOO/02035 Asp Pro Val2 Pro Arg Al a Ser 145 His Arg Glu Gly Asp 225 Val Ser Asp Arg Al a 305 Lys 5 Met Ser Ile Val Cys Gin Arg Al a Val Gly 165 Gly Glu His Ile Val 245 Gly Phe Phe Lys Leu Thr Val Phe Ala 70 Met Phe His Leu Tyr 150 Pro Val Lys Lys Glu 230 Giu Met As n Thr Gin 310 Asp Asn Glu Ser Asp Gly Ala Arg Val 135 Ala Gly Gin Ala Arg 215 Asn Val Pro His Ala 295 Gin Ser Val Ile Ala Lys Thr Val Met Gly Val Gin 170 Val Gly Phe Arg Ile 250 Gly Glu Gin Ser Ala Ala Ala Thr His 75 Asp Asp Asn Trp Leu 155 Gly Gin Giu Val Thr 235 Asp His Tyr Ile Gly 315 Glu Gi y Met Thr Asp Al a His Ala Phe Gin 160 Leu Ser Thr Ala Phe 240 Asp Gly Asp Ala Leu 320 WO 01/66573 WO 0166573PCT/IBOO/02035 Glu Val Ala Pro Tyr Leu Leu Ser Pro Glu Asn Leu Asp Asp Leu Ile 325 330 335 Ala Arg Asp Val 340 <210> 41 <211> 958 <212> DNA <213> Corynebacterium glutainicum <220> <221> COS <222> (101)..(958) <223> FRXA00352 <400> 41 aatagatcag cgcatccgtq gtggaaccaa aaggctcaac aatacgaaac gttcgctttc ggtcctgatg aaagagatgt ccctgaatca tcatctaagt atg cat ctc Met His Leu agt Ser gt a Val att Ile gocc Al a aag Lys a cc Thr gt a Val1 atg Met ggc Gly gt c ggt aag Gly Lys aac atg Asn Met cgc ago Arg Ser gga atc Gly Ile gat gtc Asp Val ctg tgc Leu Cys gcg cag Ala Gin 100 cca cqc Pro Arg gtt gca Val Ala cgc gtc Arg Val tgg ggc 115 163 211 259 307 355 403 451 499 547 595 WO 01/66573 WO 0166573PCTIIBOO/02035 Tyr Ala Ala Ala Val Leu Ala Glu His Gin Gin His Thr Phe Trp Gly CNI 150 155 160 165 cca ggt ttg tca cag ggc cac tcc gat gct ttg ega cgc ate cct ggc 643 Pro Gly Leu Ser Gln Gly His Ser Asp Ala Leu Arg Arg Ile Pro Gly 170 17 5 180 gtt caa aag gca gtc cag tac ace ctc cca tcc gaa gac gcc ctg gaa 691 Val Gin Lys Ala Val Gin Tyr Thr Leu Pro Ser Giu Asp Ala Leu Giu 185 190 195 aag gcc egc cgc gge gaa gec qgc gac ctt acc gga aag caa acc cac 739 Lys Ala Arg Arg Gly Glu Ala Gly Asp Leu Thr Gly Lys Gin Thr His C1200 205 210 aag cgc caa tgc tte gtg gtt gee gac gcg gcc gat cac gag cgc atc 787 Lys Arg Gin Cys Phe Val Val Ala Asp Ala Ala Asp His Glu Arg Ile 215 220 225 gaa aac gac atc cge acc atg cct gat tac ttc gtt ggc tac gaa gtc 835 Glu Asn Asp Ile Arg Thr Met Pro Asp Tyr Phe Val Gly Tyr Giu Val 230 235 240 245 gaa gtc aac ttc ate gac gaa gca acc ttc gac tcc gag cac acc ggc 883 Giu Val Asn Phe Ile Asp Giu Ala Thr Phe Asp Ser Glu His Thr Gly 250 255 260 atg cca cac ggt ggc cac gtg att aec acc ggc gac ace ggt ggc ttc 931 Met Pro His Gly Gly His Val Ile Thr Thr Gly Asp Thr Gly Gly Phe 265 270 275 aac cac acc qtg qaa tac atc etc aag 958 Asn His Thr Val Glu Tyr Ile Leu Lys 280 285 <210> 42 <211> 286 <212> PRT <213> Corynebaeteriun giutarnicum <400> 42 Met His Leu Gly Lys Leu Asp Gin Asp Ser Ala Thr Thr Ile Leu Glu 1 5 10 Asp Tyr Lys Asn Met Thr Asn Ile Arg Val Ala Ile Val Gly Tyr Gly 25 Asn Leu Gly Arg Ser Vai Giu Lys Leu Ile Ala Lys Gin Pro Asp Met 40 Asp Leu Val Gly Ile Phe Ser Arg Arg Ala Thr Leu Asp Thr Lys Thr 55 Pro Vai Phe Asp Val Ala Asp Val Asp Lys His Ala Asp Asp Val Asp 70 75 Val Leu Phe Leu Cys Met Giy Ser Ala Thr Asp Ile Pro Giu Gin Ala 90 Pro Lys Phe Ala Gin Phe Ala Cys Thr Val Asp Thr Tyr Asp Asn His WO 01/66573 WO 0166573PCT[IBOO/02035 100 Pro Arg Arg Asp Ile 115 His Arg Gin Ala Ser 145 His Arg Giu Gly Asp 225 Val1 Ser Asn Asn Phe Ile Al a 195 Gin Giu Tyr His Vai Arg Trp Pro 160 Leu Thr Arg Glu Thr 260 Al a Val Gly 165 Gly Giu His Ile Val 245 Giy Leu Tyr 150 Pro Vai Lys Lys Giu 230 Giu Met Val 135 Ala Gly Gin Ala Arg 215 Asn Val Pro 105 Val Thr Ala Ser Ala 185 Arg Cys Ile Phe Giy 265 110 Met Asn Glu Ala Ala Thr Ala 125 T rp Leu 155 Gly Gin Glu Val1 Thr 235 Asp His Asp 140 Ala His Tyr Ala Val 220 Met Glu Val1 Met Gin Al a 175 Pro Leu Ala Tyr Phe 255 Thr Phe Gin 160 Leu S er Thr Ala Phe 240 Asp Gly Asp Thr Gly 275 Gly Phe Asn His Thr Val Glu Tyr Ile Leu Lys <210> 43 <211> 1400 <212> DNA <213> Corynebacterium giutamicum <220> <221> COS <222> (1)..(1377) <223> RXA00972 <400> 43 cct gca cct ggt tgg cgt ttc cgc Pro Aia Pro Gly Trp Arg Phe Arg 1 aca gtt gaa aat ttc aat gaa ctt Thr Vai Giu Asn Phe Asn Giu Leu gcc gtg cgc caa. gaa gac ggc gtt Ala Val Arg Gin Giu Asp Gly Val cct gac ctc gct gaa gaa tac gga Pro Asp Leu Ala Giu Glu Tyr Gly WO 01/66573 WO 0166573PCTJIBOO/02035 55 gao gat ttc cgt tcc ogc tgt cgc gao atg gct acc goa tto ggt gga 240 4) Asp Asp Phe Arg Ser Arg Cys Arg Asp Met Ala Thr Ala Phe Gly Gly 70 75 cca ggc aat gtg oao tac gca tct aaa gcg ttc ctg acc aag acc att 288 Pro Gly Asn Val His Tyr Ala Ser Lys Ala Phe Leu Thr Lys Thr Ile 90 gca cgt tgg gtt gat gaa gag ggg otg gca ctg gao att gca tcc atc 336 Ala Arg Trp Val Asp Giu Giu Gly Leu Ala Leu Asp Ile Ala Ser Ile 100 105 110 aao gaa ctg ggc att. gco otg gco gct. ggt ttc 000 gcc ago ogt ato 384 Asn Glu Leu Gly Ile Ala Leu Ala Ala Gly Phe Pro Ala Ser Arg Ile 115 120 125 aco gog cao ggc aao aao aaa ggo gta gag tto otg ogo gcg ttg gtt 432 Thr Ala His Gly Asn Asn Lys Gly Val Glu Phe 1.eu Arg Ala Leu Val 130 135 140 caa aao ggt gtg gga oao gtg gtg otg gao too goa oag gaa ota gaa 480 Gin Asn Gly Val Giy His Val Val Leu Asp Ser Ala Gin Glu Leu Glu 145 150 155 160 otg ttg gat tao gtt goo got ggt gaa ggo: aag att oag gao gtg ttg 528 Leu Leu Asp Tyr Val Ala Ala Gly Glu Gly Lys Ile Gin Asp Val Leu 165 170 175 ato ogo gta aag ooa ggo ato gaa goa cac aco cac gag tto ato goo 576 Ile Arg Val Lys Pro Gly Ile Glu Ala His Thr His Glu Phe Ile Ala 180 185 190 aot ago cao gaa gao oag aag tto gga tto too otg gca too ggt too 624 Thr Ser His Giu Asp Gin Lys Phe Gly Phe Ser Leu Ala Ser Gly Ser 195 200 205 goa tto gaa goa goa aaa goo goo aao aao goa gaa aao ctg aao otg 672 Ala Phe Giu Ala Ala Lys Ala Ala Asn Asn Ala Glu Asn Leu Asn Leu 210 215 220 gtt ggo otg oao tgo oao gtt ggt too oag gtg tto gao goo gaa ggo 720 Val Gly Leu His Cys His Val Gly Ser Gln Val Phe Asp Ala Glu Gly 225 230 235 240 tto aag otg gca gca gaa ogo gtg ttg ggc otg tao toa oag ate oao 768 Phe Lys Leu Ala Ala Glu Arg Val Leu Gly Leu Tyr Ser Gin Ile His 245 250 255 ago gaa otg ggo gtt goc ott. oot gaa otg gat oto ggt ggo gga tao 816 Ser Glu Leu Gly Val Ala Leu Pro Glu Leu Asp Leu Gly Gly Gly Tyr 260 265 270 ggo att goo tat aoo goa got. gaa gaa ooa oto aao gto goa gaa gtt 864 Gly Ile Ala Tyr Thr Ala Ala Giu Glu Pro Leu Asn Val Ala Glu Val 2'75 280 285 goo too gao otg cto ace gca gte gga aaa atg goa geg gaa ota ggo 912 Ala Ser Asp Leu Leu Thr Ala Val Gly Lys Met Ala Ala Giu Leu Gly 290 295 300 WO 01/66573 WO 0166573PCTJIBOO/02035 atc gac gca cca acc Ile Asp Ala Pro Thr gtg ctt gtt Val Leu Val gag ccc ggc cgc gct atc gca ggc Glu Pro Gly 315 Arg Ala Ile Ala 310 atc Ile acc Thr cca Pro gcc Al a t cc Ser 390 agc Ser at g Met cgc Arg tac Tyr cgc Arg gca Ala gaa Glu 375 ggC Gly ggC Gly agc Ser gct Al a acc aaa Thr Lys gtg gac Val Asp gaa tac Glu Tyr 365 agc acc Ser Thr 380 aac gat Asn Asp ctc gca Leu Ala gcc ttc Ala Phe ctc atg Leu Met 445 gac gtc cac Asp Val His 335 gga ggc atg Gly Gly Met 350 gac gcc cgc Asp Ala Arg cgc atc gtg Arg Ile Val gaa atc tac Glu Ile Tyr 400 gcc acc ggc Ala Thr Gly 415 aca cgg ccc Thr Arg Pro 430 ctg cgc cgc Leu Arg Arg 1008 1056 1104 1152 1200 1248 1296 1344 gaa acg ctc gac gac atc ctc tca cta Glu Thr Leu Asp Asp Ile Leu Ser Leu 450 455 ccc <210> 44 <211> 459 <212> PRT <213> Corynebacterium glutainicum <400> 44 Pro Ala Pro Gly Trp Arg Phe Arg Thr 1 5 Thr Val Glu Asn Phe Asn Glu Leu Pro 25 Ala Val. Arg Gin Glu Asp Gly Val Val 40 Pro Asp Leu Ala Glu Glu Tyr Gly Thr 55 gag gca Glu Ala taacgctttt cgacgcctga 1397 1400 Gly Glu Asp Val Thr Met Ala 10 Ala His Val Trp Pro Arg Asn Thr Val Ala Gly Val Pro Leu Pro Leu Phe Val Val Asp Glu WO 01/66573 WO 0166573PCTJIBOO/02035 Arg Ser Arg Val His Tyr Val Asp Giu 100 Gly Ile Ala Gly Asn Asn Val Giy His 150 Tyr Val Ala 165 Lys Pro Giy 180 Glu Asp Gin Ala Ala Lys His Cys His 230 Ala Ala Gin 245 -Gly Val Ala 260 Tyr Thr Ala Leu Len Thr Pro Thr Vai 310 Vai Thr Ile 325 Asp Lys Thr 340 Ile Arg Pro Cys Arg Asp Met Ala Thr Ala Phe Gly Ser Gly Ala 120 Gly Val Giy Giu Phe 200 Ala Giy Val Pro Giu 280 Val Val Glu Arg Leu 360 Lys Leu 105 Ala Val1 Leu Glu Al a 185 Gly Asn Ser Leu Giu 265 Glu Gly Giu Val Tyr 345 Tyr Thr Ile Al a 125 Arg Gin Gin Giu Al a 205 Asn Asp Ser Gi y Vali 285 Ala Al a Lys Asp Tyr 365 Gly Ile Ile Ile Val Giu 160 Leu Al a Ser Leu Giy 240 His Tyr Vai Gly Gly 320 His Met Arg Val Val Ser Arg Phe Ala Giu Gly Asp Pro Val Ser Thr Arg Ile Val WO 01/66573 WO 0166573PCTIBOOIO2035 Gly Ser His Cys Glu Ser Gly Asp Ile Leu Ile Asn Asp Glu Ile Tyr 385 390 395 400 Pro Ser Asp Ile Thr Ser Gly Asp Phe Leu Ala Leu Ala Ala Thr Gly 405 410 415 Ala Tyr Cys Tyr Ala Met Ser Ser Arg Tyr Asn Ala Phe Thr Arg Pro 420 425 430 Ala Val Val Ser Val Arg Ala Gly Ser Ser Arg Leu Met Leu Arg Arg 435 440 445 Clu Thr Leu Asp Asp Ile Leu Ser Leu Giu Ala 450 455 <210> <211> 2121 <212> DNA <213> Corynebacteriun glutamicum <220> <221> CDS <222> (101)..(2098) <223> RXA02653 <400> agacagagtg ttagtgcgtg gggcagctct cactttcatc gacatcactc gagtatgctc accggccgta ttcattccaa taacccgcac agggaaacta ata ccg aag ccc Ile Pro Lys Pro tat Tyr aag Lys att Ile act Thr ggg Gly aqa Arg ggt Gi y gtt Val1 gat Asp at c Ile gat As p gaa Giu gaa Glu aa Lys gaa Glu qa a Glu tta Leu ttt Phe gaa tac ctc caa gaa ctc gta aaa tcc gga gtg gta gac atc act cac Glu Tyr Leu Gin Giu Leu Val Lys Ser Gly Val Val Asp Ile Thr His WO 01/66573 WO 0166573PCTIIBOO/02035 cgg gaa cca ctg aca gat tta Arg Glu Pro Leu Thr Asp Leu gct Ala 140 ttg Leu gat Asp gt c Val. cga Arg gac Asp 220 gca Ala tgc Cys t ca Ser cag Gin ggt Gly 300 gt a Val1 gga Gly gca Al a gaa ccg Pro gga Gly 160 gac Asp a eg Thr gao Asp tat Tyr ccc Pro 240 att Ile ect Pro gat Asp gtt Val cga Arg 320 att Ile gaa Glu att gtt cgt gaa ctt gaa Val Arg Glu Leu Glu 130 ceg gga gta gtg cca Pro Gly Val Val Pro 145 tat gcc aga atg egt Tyr Ala Arg Met Arg 165 ggc acc gtt caa ggg Gly Thr Val Gin Gly 180 gaa gat gtg gtt ttg Giu Asp Val Val Leu 195 ata ate ecg aag tgg Ile Ile Pro Lys Trp 210 ccc gat agg gta cat Pro Asp Arg Val His 225 tgg geg gaa aag cte Trp Ala Glu Lys Leu 245 gaa gaa ttc ggg agt Glu Giu Phe Gly Ser 260 cgt aat ata aat gag Arg Asn Ile Asn Giu 275 act cga ata ttt ttt Thr Arg Ile Phe Phe 290 gat gcc gtt aaa gac Asp Ala Val Lys Asp 305 gag tta tct cag gtg Glu Leu Ser Gin Val 325 cta tcc gea get atc Leu Ser Ala Ala Ile 340 aat gge gtg ate ate Asn Gly Val Ile Ile 355 teg get ttg gtt ggt 547 595 643 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 WO 01/66573 WO 0166573PCTIIBOOIO2035 Ser gac Asp tta Leu 390 ct t Leu ot c Leu tgc Cys att Ile gat Asp 470 gc Al a ttc Phe aag Lys gag Glu gtt Val 550 gct Ala ga t Asp tat Tyr Val. ogo Ar g 375 oct. Pro acc Thr cat His caa Gin gao Asp 455 tgg Trp gaa Giu tat Tyr ggg Gly oct. Pro 535 gct Al a at g Met ccc Pro ct a Leu Asp 360 gtt Val1 ca Pro gag Glu ggo Gly ct C Leu 440 ott. Leu at o Ile tcc Ser cag Gin gt a Val 520 ggt Gly ttt Phe aac Asn Ctg Leu gtg Val Arg Asp Giu Leu Asp Arg Ile Ser Ala Leu Val Giy 365 370 gca Al a aat Asn gtt Val 420 gaa Giu cag Gin gag Giu ggg Gly tac Tyr 500 ott Leu ca c His gc Al a gga Gly ot 0 Leu 580 gaa Glu ogo Arg gt o Val ogg Arg 405 oao His tgt Cys ttt Phe gaa Glu tat Tyr 485 ccg Pro tot Ser ata Ile gaa Giu otg Leu 565 att Ile gca Al a Cgg Arg 1267 1315 1363 1411 1459 1507 1555 1603 1651 1699 1747 1795 1843 1891 1939 WO 01/66573 PCT[IBOO/02035 600 605 610 ega atc cgc ttc ccg aga gga gte aaa cca gga gat atc ate gga att 1987 Arg Ile Arg Phe Pro Arg Gly Val Lys Pro Gly Asp Ile Ile Gly Ile 615 620 625 ect aac ace gca gga tac ttc atg cat atc ttg gaa agt gca tcg cae 2035 Pro Asn Thr Ala Gly Tyr Phe Met His Ile Leu Giu Ser Ala Ser His 630 635 640 645 caa atc ccg ttg geg aaa aat gta gtg tgg ccg gag ggg cag tta gac 2083 Gin Ile Pro Leu Ala Lys Asn Val Val Trp Pro Giu Gly Gin Leu Asp 650 655 660 gat ate gat gcg gat taagacataa ecattcgcta atc 2121 Asp Ile Asp Ala Asp 665 <210> 46 <211> 666 <212> PRT <213> Corynebacterium giutamicum <400> 46 Met Ile Pro Lys Pro Asp.Val Thr Asp Leu Tyr Leu Giu Asp Leu Leu 1 5 10 Asn Gin Gly Ser Gin Lys Ile Arg Ser Ala Lys Asp Len Ser Giu Len 25 Arg Thr Val Len Lys Gin Val Ser Ser Gin Ile Gin Gin Arg Ala Gly 40 Lys Lys Asp Gin Gin Trp Gly Met Gly Ala Thr Trp Arg Gin Leu Tyr 55 Pro Ser Ile Vai Gin Arg Ala Ser Tyr Gin Gly Arg Asp Ser Leu Ile 70 75 Gly Phe Asp His Len Ala Arg Gin Met Gin Arg Leu Ala Phe Gly Pro 90 Pro Ser Gin Ser Phe Gin Tyr Leu Gin Gin Len Vai Lys Ser Giy Val 100 105 110 Val Asp Ile Thr His Leu His Arg Gly Arg Gin Pro Leu Thr Asp Leu 115 120 125 Vai Arg Gin Len Gin Ile Thr Val Vai Ile Asp Ala Val Leu Pro Pro 130 135 140 Pro Gly Val Val Pro Gly Thr Len Val His Asn Len Val Lys Gin Gly 145 150 155 160 Tyr Ala Arg Met Arg Pro Gly Thr Arg Gly Leu Asp Val Ala Ala Asp 165 170 175 Gly Thr Val Gin Giy Gin Arg His Len Ala Ala Val Giy Arg Met Thr 180 185 190 WO 01/66573 WO 0166573PCT/IBOO/02035 Glu Ile Pro 225 Trp Gi u Arg Thr Asp 305 Glu Leu Asn Ser Pro 385 Asp Gly Al a His Ile 465 Thr Ser Lys Leu Trp His Leu 245 S er Glu Phe Asp Val 325 Ile Ile Gly Val Arg 405 His Cys Phe Giu Tyr 485 Pro Ser Gly Ala G2ly 230 Thr Pro Leu Ala Thr 310 Leu Lys Ser Asp Leu 390 Leu Leu Cys Ile Asp 470 Ala Phe Lys Arg Asp 220 Ala Cys Ser Gin Gi y 300 Val Gly Ala GJlu Ala 380 Gly Gi y Lys Leu Val 460 Ser Lys Arg Leu Asp Tyr Pro 240 Ile Pro Asp Val Arg 320 Ile Glu Ile Ala Al a 400 Val Leu Gly Tyr Al a 480 Leu Leu Gly WO 01/66573 WO 0166573PCTJIBOOIO2035 Leu Val1 545 Pro Asp GJ.u Leu Asp 625 Glu Glu His Al a Gly Leu 580 Glu Arg Gly Ser Leu 660 <210> 47 <211> 993 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (970) <223> RXA01393 <400> 47 caaaagcaga cctgtaatga agatttccat gatcaccatc agtaaaatga ttgqttctta acatggttta atatagcttc ct g Leu tcc Se r gct. Al a gcc Al a gac Asp tt a Leu ctc Leu aaa Lys gtgacctatg gaagtactta atg aac ccc att caa Met Asn Pro Ile Gin 1 agc ttc gaa ggc gcc Ser Phe Glu Gly Ala agt cag cgc gtt aaa Ser Gin Arg Val Lys tcg cgc acc caa ccg Ser Arg Thr Gin Pro caa gca gcg cgg aaa Gin Ala Ala Arg Lys WO 01/66573 WO 0166573PCTIBOOIO2035 atg gtg ttg ctg Met Val Leu Leu gct gaa atc ccg Ala Giu Ile Pro tgg ttt cct ccc Trp Phe Pro Pro 105 ctc acg etg cgc Leu Thr Leu Arg 120 cgt gga gat gtt Arg Giy Asp Val 135 gqa tgt gaa gta Gly Cys Glu Val 150 acc ccc tca ttg Thr Pro Ser Leu get gcg atg ccc Ala Ala Met Pro 185 cgt gac ctg gac Arg Asp Leu Asp 200 tcc att gtc ccg Ser Ile Val Pro 215 ctt ggt tgg gga' Leu Gly Trp Gly 230 gca gga gaa gtg Ala Gly Glu Val tat tgg caa cga Tyr Trp Gin Arg 265 gac gcc gtc gtt Asp Ala Val Val 280 tgaaaaggtt eag caa Gin tta Leu gt g Val ttg Leu tta Leu gt a Val egg Arg 170 gte Val ggg Gly teg Ser ett Leu ate Ile 250 tgg Trp gaa Giu ate Ile aac As n gat Asp geg Ala 140 ctt Leu gee Ala ege Arg gt c Val1 gaa Glu 220 c Pro ctc Leu etg Leu t Ser teg Ser ggt Gi y tee Ser 130 aat Asn tt g Leu aaa Lys gt g Val cge Arg 210 att Ile ec Pro gac Asp get Ala ect Pro 290 gat gca gca ate Asp Ala Ala Ile 285 gag gga ttg egg Giu Gly Leu Arg tagttacttc WO 01/66573 WO 0166573PCT/IBOO/02035 <210> 48 <211> 290 <212> PRT <213> Corynebacterium giutanicun <400> 48 Met Asn Pro Ile Gin Leu Asp Thr Leu 1 Ser Ser Ser Gin Leu Asp Trp Leu Al a 145 His Gly Asp Gly Al a 225 Al a Ile Leu Phe Gin Arg Al a Ser Ser Gly Ser 130 Asn Leu Lys Val Arg 210 Ile Pro Asp Al a Giu Gly Arq Val Thr Gin Ala Arg Gly Arg Len Ser 100 Gly Ala 115 Leu Len Pro Val Ala Ile Leu Asp 180 Leu Gin 195 Arg Arg Arg Arg Met Leu Thr Pro 260 Arg Leu 275 5 Al a Lys Pro Lys Len Thr Thr Arg Ala Ala 165 Trp Asp Val Gly Lys 245 Met Len 10 Ser His Gin Gin Len 90 Val Leu Leu Val Arg 170 Val Gly Ser Len Ile 250 Trp Ser Ile Val Ala Ala 75 Thr Phe Gin Gly Glu 155 Asp Len Arg Al a Len 235 Len Arg Gin Ala Leu Len Al a Asn Al a His Arg Met Val 175 Pro Pro Gly Gin Ile 255 Arg Gly Val Val Val Gin Al a Ser Thr Gin Arg 160 Asp Lys Val Gin Ala 240 Pro Ser Thr Asp Ala Val Val Asp Ala Ala Ile Gin Gly Leu Arg Pro WO 01/66573 PCT/IBOO/02035 290 <210> 49 <211> 1626 <212> DNA <213> Corynebacteriun gJlutamicun <220> <221> CDS <222> (1603) <223> RXA00241 <400> 49 ggtctccagc ctttctaaac aattcatctg cacttgatta aagtttagcg acttcgccgt acgtcaacta cgttaaatga attggcccca agattacgcg aat act caa tca Asn Thr Gin Ser IN WO 01/66573 WO 0166573PCT/IBOO/02035 Thr 170 ttc Phe gat Asp t ac Tyr cgc Arg ttt Phe 250 ggt Gly gcg Ala tog Ser atg Met cca Pro 330 cag Gin ct C Leu tac Tyr a ca Thr gat Asp Val1 ttg Leu ggt Gly acc Thr cag Gin 235 gt g Val1 gta Val t cg Ser ttg Leu ct C Leu 315 ago Ser ctg Leu aac Asn ttg Leu cgt Arg 395 toc Ser Ala ggC Gly ggC Gly gtg Val 220 gca Ala gct Ala ctg Leu gtg Val ggt Gly 300 tgc Cys aaa Lys at c Ile gag Glu gtg Val 380 gga Gi y ggt Gly Phe 180 gtt Val gtg Val ggt Gi y cga Arg att Ile 260 tta Leu tgg Trp gc Ala gca Ala ggt Gly 340 ttc Phe caa Gin tat Tyr gcc Ala aac Asn Ile gat Asp cgc Arg gca Al a got Ala 245 t ct Ser cca Pro ggt Gly tat Tyr at g Met 325 got Al a at o Ile ttg Leu ct g Leu ggo Gly 405 cgo Arg 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 1267 1315 1363 WO 01/66573 PCT/IBOO/02035 410 415 420 aaa cac cto ato gtc ggt tta gta gca acg gtg tat tca gtg tqg ctg 1411 Lys His Leu Ile Val Gly Leu Val Ala Thr Val. Tyr Ser Val Trp Leu 425 430 435 ttt tac gct gca gaa. ccq cag ttt gtc ctc ttc gga gcc atg gog atg 1459 Phe Tyr Ala Ala Glu Pro Gin Phe Val Leu Phe Gly Ala Met Ala Met 440 445 450 ctt ccc ggc tta ato ccc tat gtg tgg aca agg att tat cgt ggc gaa 1507 Leu Pro Gly Leu Ile Pro Tyr Val. Trp Thr Arg Ile Tyr Arg Gly Giu 455 460 465 cag gtg ttt aac cgc ttt gaa atc ggc gtg gtt gtt gtc ctg gtc gtt 1555 Gin Val Phe Asn Arg Phe Glu Ile Gly Val Val Val Vai Leu Val Val 470 475 480 485 got gcc ago gcg ggc gtt att ggt ttg gtc aac gga tca cta tog ctt 1603 Ala Ala Ser Ala Gly Val Ile Gly Leu Val Asn Gly Ser Leu Ser Leu 490 495 500 taaacaccga aaccttcctg cta 1626 <210> <211> 501 <212> PRT <213> Corynebacterium glutamioum (400> Val Asn Thr Gin Ser Asp Ser Ala Gly Ser Gin Gly Ala Ala Ala Thr 1 5 10 Ser Arg Thr Val Ser Ile Arg Thr Leu Ile Ala Leu Ile Ile Giy Ser 25 Thr Vai Gly Ala Gly Ile Phe Ser Ile Pro Gin Asn Ile Gly Ser Val 40 Ala Gly Pro Gly Ala Met Leu Ile Gly Trp Leu Ile Ala Gly Val Gly 55 Met Leu Ser Val Ala Phe Val Phe His Val Leu Ala Arg Arg Lys Pro 70 75 His Leu Asp Ser Gly Val Tyr Ala Tyr Ala Arg Val. Gly Leu Gly Asp 90 Tyr Val Gly Phe Ser Ser Ala Trp Gly Tyr Trp Lau Giy Ser Val Ile 100 105 110 Ala Gin Val Gly Tyr Ala Thr Leu Phe Phe Ser Thr Leu Gly His Tyr 115 120 125 Val Pro Leu Phe Ser Gin Asp His Pro Phe Val Ser Ala Leu Ala Val 130 135 140 Ser Ala Leu Thr Trp Leu Val Phe Gly Vai Val Ser Arg Gly Ile Ser 145 150 155 160 WO 01/66573 WO 0166573PCT[IBOO/02035 Gin Ala Ala Phe Leu Thr Thr Val Thr Thr Val Ala Lys Ile Leu Pro 165 170 175 U Leu Leu Cys Phe Ile Ile Leu Val Ala Phe Leu Gly Phe Ser Trp Giu 180 185 190 Lys Phe Thr Val Asp Leu Trp Ala Arg Asp Gly Gly Val Gly Ser Ile __195 200 205 Phe Asp Gin Val Arg Gly Ile Met Val Tyr Thr Val Trp Val Phe Ile 210 215 220 Gly Ile Glu Gly Ala Ser Val Tyr Ser Arg Gin Ala Arg Ser Arg Ser 225 230 235 240 rN~ Asp Val Ser Arg Ala Thr Val Ile Gly Phe Val Ala Val Leu Leu Leu ID245 250 255 Leu Val Ser Ile Ser Ser Leu Ser Phe Gly Val Leu Thr Gin Gin Glu C1260 265 270 Leu Ala Ala Leu Pro Asp Asn Ser Met Ala Ser Val Leu Giu Ala Val 275 280 285 Val Gly Pro Trp Gly Ala Ala Leu Ile Ser Leu Gly Leu Cys Leu Ser 290 295 300 Val Leu Gly Ala Tyr Val Ser Trp Gin Met Leu Cys Ala Giu Pro Leu 305 310 315 320 Ala Leu Met Ala Met Asp Gly Leu le Pro Ser Lys Ile Gly Ala Ile 325 330 335 Asn Ser Arg Gly Ala Ala Trp Met Ala Gin Leu Ile Ser Thr Ile Val 340 345 350 Ile Gin Ile Phe Ile Ile Ile Phe Phe Leu Asn Giu Thr Thr Tyr Val 355 360 365 Ser Met Val Gin Leu Ala Thr Asn Leu Tyr Leu Val Pro Tyr Leu Phe 370 375 380 Ser Ala Phe Tyr Leu Val Met Leu Ala Thr Arg Gly Lys Gly Ile Thr 385 390 395 400 His Pro His Ala Gly Thr Arg Phe Asp Asp Ser Gly Pro Glu Ile Ser 405 410 415 Arg Arg Glu Asn Arg Lys His Leu Ile Val Gly Leu Vai Ala Thr Vai 420 425 430 Tyr Ser Val Trp Leu Phe Tyr Ala Ala Glu Pro Gin Phe Val Leu Phe 435 440 445 Giy Ala Met Ala Met Leu Pro Gly Leu Ile Pro Tyr Val Trp Thr Arg 450 455 460 Ile Tyr Arg Gly Giu Gin Val Phe Asn Arg Phe Giu Ile Gly Val Val 465 470 475 480 Val Val Leu Val Val Ala Ala Ser Ala Gly Val Ile Gly Leu Val Asn WO 01/66573 WO 0166573PCT/iBOO/02035 Gly Ser Leu Ser Leu 500 <210> 51 <211> 822 <212> DNA <213> Corynebacterium glutamicun <220> <221> CDS <222> (799) <223> RXA01394 <400> 51 gagcaaagtg tccagttgaa tggggttcat gaagctatat taaaccatgt taagaaccaa tcattttact taagtacttc cataggtcac gatggtgatc atg gaa atc ttc att Met Glu Ile Phe Ile aca Thr aat As n gtt Val acc Thr att Ile gca Ala gaa Glu gcg Al a gat Asp acc Thr 1 tcc Ser gaa Glu tt g Leu ccg Pro tgg Trp gcg Ala oct Pro gtg Val atg Met 145 ttt Phe at c Ile gga Gly ttc Phe at c Ile ttt Phe cca Pro ttg Leu gag Glu 130 gca Ala gt y Val WO 01/66573 WO 0166573PCTIBOOIO2035 150 155 160 ggc gto ggc gcg caa tat ggo gac aoo gga cgg Gly Val Gly Ala Gin Tyr Gly Asp Thr Gly Arg 170 175 ggc gcg ttc gcg gca agc ctg atc tgg ttc ccg Gly Ala Phe Ala Ala Ser Leu Ile Trp Phe Pro 185 190 gca gca gca ttg tca cgc cog ctg tcc ago ccc Ala Ala Ala Leu Ser Arg Pro Leu Ser Ser Pro 200 205 atc aac gtc gtc gtg gca gtt gtg atg acc gca Ile Asn Val Val Val Ala Val Val Met Thr Ala ID215 220 atg ttg atg ggt tagttttcgc gggttttgga ato Met Leu Met Gly 230 <210> 52 <211> 233 <212> PRT <213> Corynebacterium giutamicum <400> 52 Met Giu Ile Phe Ile Thr Gly Leu Leu Leu Gly 1 5 Ser Ile Gly Pro Gin Asn Val Leu Val Ile Lys Giu Gly Leu Ile Ala Val Leu Leu Val Cys Leu Leu Phe Ile Ala Gly Thr Leu Gly Val Asp Leu Pro Ile Val Leu Asp Ile Met Arg Trp Gly Gly 70 Trp Phe Ala Val Met Ala Ala Lys Asp Ala Met Ala Pro Gin Ile Ile Glu Giu Thr Glu Pro Thr 100 105 Pro Leu Gly Gly Ser Ala Val Ala Thr Asp Thr 115 120. Val Giu Val Ser Val Asp Lys Gin Arg Val Trp 130 135 Met Ala Ile Val Leu Thr Trp Leu Asn Pro Asn 145 150 155 Phe Val Phe Ile Gly Gly Val Gly Ala Gin Tyr 165 170 74 165 got Ala ggc Gly tgg Trp ot g Leu WO 01/66573 WO 0166573PCT/iBOO/02035 Trp Ile Phe Ala Ala Gly Ala Phe Ala Ala Ser Leu Ile Trp Phe Pro 180 185 190 Leu Val Gly Phe Gly Ala Ala Ala Leu Ser Arg Pro Leu Ser Ser Pro 195 200 205 Lys Val Trp Arg Trp Ile Asn Val Val Val Ala Val Val Met Thr Ala 210 215 220 Leu Ala Ile Lys Leu Met Leu Met Gly 225 230 <210> 53 <211> 1026 <212> DNA <213> Corynebacterium glutamicum <220> <221> GUS <222> (101)..(1003) <223> RXA00865 <400> 53 ttatcggaat gtggcttggg cgattgttat gcaaaagttg ttaggttttt tgcggggttg tttaaccccc aaatgaggga agaaggtaac cttgaactct atg agc aca ggt tta 11 Met Ser Thr Gly Leu aca Thr gtt Val1 gaa Glu gcg Al a gaa. Giu at c Ile gaa Glu tat Tyr aag Lys cca Pro gcg Ala acc Thr ctc Leu ggt Gly gct Ala t cc Ser acc Thr ttc Phe gct Ala act Thr aag Lys gt c Val gct Ala 105 aag Lys gga Gly acg Thr tat Tyr ggt Gly gc c Al a gga Gly t ct Ser ccg Pro acc Thr gat Asp tt g Leu ac c Thr ggq Gly 80 aca Thr ctt Leu ctg Leu gga Gly gct Ala t ct Ser gct Al a cgg Arg gt g Val gtt Val cac His gca Al a 9gc Gly gtt Val aaa Lys aag Lys ct t Leu 100 act Thr ggt Gly atg Met cgc Arg ct c Leu ct a Leu ct c Leu gcg Al a cct Pro gca Al a WO 01/66573 WO 0166573PCTIIBOOIO2035 120 125 130 att got gca gca aca gag gtt cca att tgt otc tat gac att cct ggt 547 Ile Ala Ala Ala Thr Giu Val Pro Ile Cys Leu Tyr Asp Ile Pro Gly 135 140 145 cgg tca ggt att cca att gag tct gat acc atg aga cgo ctg agt gaa 595 Arq Ser Gly Ile Pro Ile Glu Ser Asp Thr Met Arg Arg Leu Ser Glu 150 155 160 165 tta cot acg att ttg gcg gtc aag gao goc aag ggt gac ctc gtt gca 643 Leu Pro Thr Ile Leu Ala Val Lys Asp Ala Lys Gly Asp Leu Val Ala 170 175 180 gcc acg tca ttg atc aaa gaa acg gga ctt goc tgg tat tca ggc gat 691 Ala Thr Ser Leu Ile Lys Glu Thr Gly Leu Ala Trp Tyr Ser Gly Asp ID185 190 195 gac cca cta aac ott gtt tgg ott gct ttg ggc gga tca ggt ttc att 739 Asp Pro Leu Asn Leu Val Trp Leu Ala Leu Gly Gly Ser Gly Phe Ile 200 205 210 tco gta att gga cat gca goc 000 aca gca tta cgt gag ttg tao aca 787 Ser Val Ile Gly His Ala Ala Pro Thr Ala Leu Arg Glu Leu Tyr Thr 215 220 225 ago ttc gag gaa. ggo gao otc gtc cgt gcg cgg gaa atc aac goc aaa 835 Ser Phe Glu Glu Gly Asp Leu Val Arg Ala Arg Glu Ile Asn Ala Lys 230 235 240 245 ota tca ccg ctg gta got goc caa ggt cyc ttg ggt gga gtc agc ttg 883 Leu'Ser Pro Leu Val Ala Ala Gin Gly Arg Leu Gly Gly Val Ser Leu 250 255 260 gca aaa got got otq ogt otg cag ggo ato aao gta gga gat oot cga 931 Ala Lys Ala Ala Leu Arg Leu Gin Gly Ile Asn Val Gly Asp Pro Arg 265 270 275 ott cca att atg got oca aat gag cag gaa ott gag got oto oga gaa 979 Leu Pro Ile Met Ala Pro Asn Glu Gin Giu Leu Giu Ala Leu Arg Glu 280 285 290 gao atg aaa aaa got gga gtt cta taaatatgaa tgattoocga aat 1026 Asp Met Lys Lys Ala Gly Val Leu 295

300. <210> 54 <211> 301 <212> PRT <213> Corynebacterium glutamioum <400> 54 Met Ser Thr Gly Leu Thr Ala Lys Thr Gly Val Glu His Phe Gly Thr 1 5 10 Val Gly Val Ala Met Val Thr Pro Phe Thr Glu Ser Gly Asp Ile Asp 25 Ile Ala Ala Gly Arg Glu Val Ala Ala Tyr Leu Val Asp Lys Gly Leu 40 WO 01/66573 WO 0166573PCTIIBOO/02035 Asp Ser Leu Val Leu Ala Gly Thr Thr Gly Giu Ser Pro Thr Thr Thr 55 Ala Ala Glu Lys Leu Glu Leu Leu Lys Ala Val Arg Giu Giu Val Gly 70 75 Asp Arg Ala Lys Leu Ile Ala Gly Val Gly Thr Asn Asn Thr Arg Thr 90 Ser Val Glu Leu Ala Glu Ala Ala Ala Ser Ala Gly Ala Asp Gly Leu 100 105 110 Leu Val Val Thr Pro Tyr Tyr Ser Lys Pro Ser Gin Giu Gly Leu Leu 115 120 125 INO Ala His Phe Gly Ala Ile Ala Ala Ala Thr Gin Val Pro Ile Cys Len 130 135 140 Tyr Asp Ile Pro Gly Arg Ser Gly Ile Pro Ile Gin Ser Asp Thr Met 145 150 155 160 Arg Arg Leu Ser Giu Leu Pro Thr Ile Leu Ala Val Lys Asp Ala Lys 165 170 175 Gly Asp Len Val Ala Ala Thr Ser Leu Ile Lys Gin Thr Gly Len Ala 180 185 190 Trp Tyr Ser Gly Asp Asp Pro Leu Asn Leu Val Trp Len Ala Leu Gly 195 200 205 Gly Ser Gly Phe Ile Ser Val Ile Gly His Ala Ala Pro Thr Ala Len 210 215 220 Arg Giu Leu Tyr Thr Ser Phe Gin Gin Gly Asp Leu Val Arg Ala Arg 225 230 235 240 Gin Ile Asn Ala Lys Leu Ser Pro Len Val Ala Ala Gin Gly Arg Len 245 250 255 Gly Gly Val Ser Leu Ala Lys Ala Ala Leu Arg Len Gin Gly Ile Asn 260 265 270 Val Gly Asp Pro Arg Leu Pro Ile Met Ala Pro Asn Giu Gin Glu Len 275 280 285 Glu Ala Len Arg Gin Asp Met Lys Lys Ala Gly Val Leu 290 295 300 <210> <211> 1071 <212> DNA <213> Corynebacterium gintainicum <220> <221> CDS <222> (1048) <223> RXS02021 <400> WO 01/66573 WO 0166573PCT/IBOO/02035 ttgggtcgcc gaggagatct aatcctggtt tgagttcaga gttcacaggt ttaagcctac aaaocttagt taaaacatga tggaagcggt cgattaaaaa atg agt gaa aac att Met Ser Glu Asn Ile ogo Arg ato Ile t gg Trp aac Asn cgc Arg caa Gin tcc Ser gag Giu gaa Glu cac His 150 ccc Pro tac Tyr aao Asn ggt Gly gga Gly ct g Leu got Al a gaa Glu ct c Leu cot Pro cac His ct g Leu aac Asn 135 gt c Val cct Pro ott Leu t cc Ser gtg Val 215 gcc Aila gac Asp gaa Giu ctc Leu gt c Val1 cca Pro cgg Arg ct g Leu 120 ttt Phe tao Tyr gga Gly gct Al a ggC Gly 200 gt c Val atc Ile gaa Glu gaa Glu 45 ctg Leu gtc Vai gat Asp cac His tgg Trp 125 ggt Gly ctt Leu gaa Glu gtg Val gca Ala 205 t cc Ser gca Ala 000 Pro gtg Vai cag Gin ogo Arg gtt Vai gaa Glu 110 a ca Thr gct Ala coo Pro gca Ala ctg Leu 190 aag Lys gag Glu aat atc Asn Ile oaa att Gin Ile ggc acc Gly Thr ttg gta Leu Val aco gtt Thr Val tao otg Tyr Leu atg cac Met His aao aag Asn Lys ctg ogg Leu Arg cgc atg Arg Met 160 gaa cgc Glu Arg 175 cgt gaa Arg Giu gtg gaa Val Glu att gga Ile Gly 1 gcc Ala ttc Phe aca Thr aaa Lys atc Ile ogo Arg at g Met ggC Gly too Ser 145 gt c Vai gtg Val ggt Gly ggc Gly ctg Leu 225 at g Met aa 0 Asn cgo Arg ct g Leu ccc Pro ct 0 Leu aa Gin cct Pro 130 cgc Arg gao Asp cgc Arg tt C Phe cgo Arg 210 tot Ser gac Asp cog Pro ctc Leu gao Asp ga t Asp ca c His aac Asn 115 tgc Cys gga Gly tat Tyr cta Leu gt g Val 195 ctg Leu tct Ser ggg Gi y gat Asp gga Gly caa Gin ctg Leu otg Leu 100 acc Thr ott Leu ot 0 Leu gtg Val ggt Giy 180 tot Ser agt Ser aot Thr 115 163 211 259 307 355 403 451 499 547 595 643 691 739 787 WO 01/66573 WO 0166573PCT/IBOO/02035 cag tec ccg aga gat gaa cag cgc cgc Gin Ser Pro Arg Asp Giu Gin Arg Arg 230 235 caa aac tgc aac ttt ggt gtc agc tcc Gin Asn Cys Asn Phe Gly Val Ser Ser 250 gga gac aat tgc gac atc gga aat aac Gly Asp Asn Cys Asp Ile Giy Asn Asn 265 270 ccc att tgg ttc gca gcc gat gag gag Pro Ile Trp Phe Ala Ala Asp Giu Giu 280 285 gaa ggc caa gca aat tgg tca atc aag Giu Giy Gin Aia Asn Trp Ser Ile Lys 295 300 cca gtt gcc cgc ctc aaa gct tgacccal Pro Val Ala Arg Leu Lys Ala 310 315 <210> 56 '211> 316 <212> PRT <2i3> Corynebacterium glutanicui <400> 56 Met Ser Giu Asn Ile Arg Gly Ala Gin 1 Aia Met Asp Giy Thr Ile Leu Asp Thr Phe Asn Pro Asp Gin Trp Ala Glu Arg Thr Arg Leu Gly Ala Asn Giu Leu Thr Lys Leu Asp Gin Asp Arg Leu Val Giu 70 Ile Pro Asp Leu Ser Gin Pro Pro Vai Arg Leu His Leu Leu Ser His Arg Leu 100 105 Met Gin Asn Thr Leu Giu Leu Leu Ser 115 120 Gly Pro Cys Leu Pro Giu Asn Phe Giu 130 135 Ser Arg Gly Leu Ile His Val Tyr Cys 145 150 cgt ttg ccg ttg agc Arg Leu Pro Leu Ser 240 gga atc atc gga gtc Gly Ile Ile Giy Val 255 att gtc ttg gat gga Ile Val Leu Asp Gly 275 tta cgc act atc gac Leu Arg Thr Ile Asp 290 cgt gaa tcc ggc ttc Arg Giu Ser Gly Phe 305 ttt tcataaccag tgc 835 883 931 979 1027 1071 Val Tyr Pro Arg Val 75 Ala Arg Val Val Asp 155 Ile Ile Thr Val Val Leu His Lys Arg Met 160 WO 01/66573 WO 0166573PCT/1FB00102035 Val Val Gly Gi y Leu 225 Pro Ile Leu Thr Ser 305 Val Val 165 Gly Ala 180 Ser Phe Ser Ser Thr Ile Ile Gly 245 Ser Leu 260 Asp Thr Ser Ile His Giu Pro Pro Gly Val Ile Ser Glu Ala Glu Arg 175 Tyr Asn Gly Gin 230 Gin Gly Pro Giu Pro 310 (210> 57 <211> 1296 <212> DNA <213> Corynebacteriuu giutaxaicum <220> <221> CDS <222> (101)..(1273) <223> RXS02157 <400> 57 gggtggaatt ggcacgatgg tgctgccgga tgtttttgat caccgttttt agaaaagacg acaaggatgg ggaactgtaa act tgg cca cag gtc att att aat acg tac ggc Thr Trp Pro Gin Val Ile Ile Asn Thr Tyr Giy 15 ctg qtg tcc qqc aag ggc qca acc gtc act gat Leu Vai Ser Gly Lys Gly Ala Thr Vai Thr Asp 30 tac atc gac ttg ctc gcg ggc atc gca gtc aac Tyr Ile Asp Leu Leu Ala Gly Ile Ala Vai Asn 45 cgggagaatt atcctgaagg atg agc acg ctg gaa 115 Met Ser Thr Leu Giu 1 acc cca cca gtt gag 163 Thr Pro Pro Val Giu gac cag ggc aat gtc 211 Asp Gin Gly Asn Vai gca ttg ggc cac gcc 259 Ala Leu Gly His Ala WO 01/66573 WO 0166573PCTIBOOIO2035 cac His cac His gag Giu acc Thr tt C Phe cat His cca Pro 150 tac Tyr cca Pro ggc Gly tgc Cys gtt Val 230 ccc Pro ggt Gly aag Lys aag cog Pro gt c Val. ct c Leu cgg Arg aag Lys ggt Gly 135 ga c Asp cot Pro acg Thr gtt Val gat Asp 215 ggc Gly gat Asp got Al a ca 0 His gca gog Al a tca Ser at c Ile gtt Val att Ile 120 tte Phe aag Lys tao Tyr gat Asp gt t Val 200 gag Giu cgt Arg gtg Val tgt Cys ggc Gi y 280 gt g ato Ile ttg Leu ogt Arg tte Phe cgc Arg ggc Gly gaa Glu gao Asp 170 got Al a gca Al a ggc Gly ggc Gly ace Thr 250 gc Al a act Thr tot gag Glu ttc Phe 75 t tt Phe t go Cys ttg Leu ego Arg gog Ala 155 ac Thr got Ala cot Pro ato Ile gat Asp 235 atg Met act Thr tt 0 Phe gtt gog Al a gca Ala tog Ser aac As n act Thr acc Thr 140 ttc Phe gat Asp ato Ile gaa Glu ttg Leu 220 ttc Phe gee Ala ggc Gly ggt Gly gte ggt Gly gag Glu ca a Gin got Ala gtt Val cag Gin ttc Phe 165 aa 0 As n aog Thr et g Leu ggc Gly gtt Val 245 ate Ile gge Gly gc Ala gee 307 355 403 451 499 547 595 643 691 739 787 835 883 931 979 1027 WO 01/66573 WO 0166573PCTIBOOO2035 Lys Ala Val Leu Ser Val Val Asp Asp Ala Phe Cys Ala Glu Val Ala c-1295 300 305 cgc aag ggc gag ctg ttc aag gaa ott ctt goc aag gtt gac ggc gtt 1075 Arg Lys Gly Glu Leu Phe Lys Glu Leu Leu Ala Lys Val Asp Gly Val 310 315 320 325 gta gao gtc cgt ggc agg ggo ttg atg ttg ggc gtg gtg ctg gag cgc 1123 Val Asp Val Arg Gly Arg Gly Leu Met Leu Gly Val Val Leu Glu Arg 330 335 340 gac gtc gca aag caa got gtt ott gat ggt ttt aag cac ggc gtt att 1171 Asp Val Ala Lys Gln Ala Val Leu Asp Gly ?he Lys His Gly Val Ile cI345 350 355 cI ttg aat gca ccg gcg gac aac att atc ogt ttg aco cog cog ctg gtg 1219 IND Leu Asn Ala Pro Ala Asp Asn Ile Ile Arg Leu Thr Pro Pro Leu Val 360 365 370 c-I atc ace gac gaa gaa ato goa gao gca gtc aag gct att gco gag aca 1267 Ile Thr Asp Giu Giu Ile Ala Asp Ala Val Lys Ala Ile Ala Glu Thr 375 380 385 atc gca taaaggactc aaacttatga ott 1296 Ile Ala 390 <210> 58 <211> 391 <212> PRT <213> Corynebacterium giutamicum (400> 58 Met Ser Thr Leu Glu Thr Trp Pro Gin Val Ile Ile Asn Thr Tyr Gly 1 5 10 Thr Pro Pro Val Glu Leu Val Ser Gly Lys Gly Ala Thr Val Thr Asp 25 Asp Gin Gly Asn Val Tyr Ile Asp Leu Leu Ala Gly Ile Ala Val Asn 40 Ala Leu Gly His Ala His Pro Ala Ile Ile Giu Ala Val Thr Asn Gln 55 Ile Gly Gin Leu Gly His Val Ser Asn Leu Phe Ala Ser Arg Pro Val 70 75 Val Giu Val Ala Giu Giu Leu Ile Lys Arg Phe Ser Leu Asp Asp Ala 90 Thr Leu Ala Ala Gin Thr Arg Val Phe Phe Cys Asn Ser Gly Ala Giu 100 105 110 Ala Asn Giu Ala Ala Phe Lys Ile Ala Arg Leu Thr Gly Arg Ser Arg 115 120 125 Ile Leu Ala Ala Val His Gly Phe His Gly Arg Thr Met Gly Ser Leu 130 135 140 WO 01/66573 WO 0166573PCT/IBOO/02035 U Al a 145 Ser Met Ile Al a Glu 225 His Gly Leu Al a Cys 305 Lys ValI Lys Thr Gin Phe 1.65 As n Thr Leu Gly Val 245 Ile Gly Al a Ala Val 325 Arg Ile Val Pro 150 Tyr Pro Giy Cys Val 230 Pro Giy Lys Lys Arg 310 Val Asp Leu Ile Asp Pro Thr Val Asp 215 Gly Asp Ala His Ala 295 Lys Asp Val. Asn Thr 375 Phe Asp Ile Glu Leu 220 Phe Al a Gi y Gi y Val 300 Lys Gly Val1 As n Leu Pro Met Tyr Phe Gly 205 Met Phe Lys Arg Gly 285 Asp Glu Leu Leu Ile 365 Asp Glu Glu Ile Ala Asp Ala Val Lys 380 Ala Ile Ala Giu Thr Ile Ala 385 390 <210> 59 <211> 1008 <212> DNA <213> Corynebacterium glutamicun <220>- <221> CDS <222> (985) <223> RXC00733 <400> 59 acggcgaggt tgtcggtatt gqaacgcaca cgaatttgct gaacacgtgc ggtacctacc WO 01/66573 WO 0166573PCTIIBOO/02035 qtgaaattgt tgaatcccaa gagactgcgc aggcgcaatc agt aat act gca Ser Asn Thr Ala ggc Gly gca Ala cat His gtt Vai gtg Val aag Lys gct Ala ttt Phe atc Ile gt g Val1 150 cac His ctt Leu caa Gln ccc Pro cag Gin gac Asp gga gt g Vai ga a Giu too Ser gaa Giu ggt Gly 135 caa Gin cgc Arg a gc Ser acc Thr ogo Arg aat Asn cgt Arg- ott Leu ttt Phe gat Asp atg Met aaa Lys 120 agc Ser agt Ser cta Leu cgt Arg tt g Leu 200 cat His tot Ser att Ile Giy 60 cta Leu cag Gin atg Met ato Ile ttg Leu 140 cgg Arg tat Tyr gat Asp at 0 Ile cag Gin gco Ala ttt Phe 45 cca Pro tct Ser t tg Leu aac Asn ctc Leu 125 tto Phe otg Leu t to Phe gtg Vai act Thr 205 gog Al a tt C Phe ot a Leu ggt Gly cg Pro ggt Gly ggc Gly at c Ile atg Met 145 gtg Val aaa Lys ggt Gly acc Thr ccg Pro gga Gly gc Al a aaa Lys got Al a aaa Lys toa Ser gg t Gly 130 ct c Leu gag Glu ogt Arg caa Gin gt 0 Val 210 aat Asn att Ile gt 0 Vai gc Al a ggt Gly oat His ggc Gly 115 got Ala aac Asn gaa Giu ggt Gi y too Ser 195 ato Ile caa Gin ot a Leu ot g Leu acc Thr gog Al a aat Asn 100 att Ile tat Tyr ogo Arg aaa Lys gat Asp 180 ctg Leo ggt Gly 163 211 259 307 355 .4 03.. 451 499 547 595 643 691 739 787 ttg gtg Leu Vai 215 atg atg ttt ato ato too oca ctg oto gca oto gtg gog otg Met Met Phe Ile Ile Ser Pro Leo Leo Ala Leu Val Aia Leu 220 225 WO 01/66573 WO 0166573PCTIBOOIO2035 gta tcc att ccg gtc acc atc gtg gtc Val Ser Ile Pro Val Thr Ile Val Val 230 235 tcc cag aaa ctc ttt gcg gaa cag tgg Ser Gin Lys Leu Phe Ala Glu Gin Trp 250 gcg cgc ctg gag gaa acc tac tct ggc Ala Arg Leu Giu Glu Thr Tyr Ser Gly 265 270 gga cac caa aag gat gtt caa gaa gca Giy His Gin Lys Asp Val Gin Glu Ala 280 285 tgt gta taaggccagc tttggtgccc agt Cys Vai 295 <210> <211> 295 <212> PRT <213> Corynebacterium giutamicum <400> Met Ser Asn Thr Ala Gly Pro Arg Giy cgt Arg 245 a at Asn ttc Phe gct Ala 1008 Ser His Gin Ala 1 Al a Phe Leu Giy Pro Gly Giy Ile Met 145 Val Pro Gi y Aila Lys Al a Lys Ser Giy 130 Le u Glu Asn Ile Val Al a Gly His Gly 115 Al a Asn Glu Gin Leu Leu Thr Al a As n 100 Ile Tyr Arg Lys Gin Asp Gly 55 Val Glu Ser Glu Gly 135 Gin Arg Asn Arg 40 Leu Phe Asp Met Lys 120 Ser S er Leu Phe Asn Thr Glu Ile Met 105 Leu Leu Ala Pro Ser Ile Gly Leu Gin Met Ile Leu 140 Arg T yr Ala Phe Pro Ser Leu Asn Leu 125 Phe Leu Phe Asp Ala Arg Leu Ile Phe Leu Leu Arg Met Ala Ala Val Pro Leu Val Ala Arg Met Giu 160 Ser Ile 175 Lys Arg Gly Asp Leu Leu Ser Arg Val Thr Asn Asp Val Asp Asn Ile WO 01/66573 PCT/iBOOIO2035 180 185 190 Gly Gin Ser Leu Gin Gin Thr Leu Ser Gin Ala Ile Thr Ser Leu Leu 195 200 205 Thr Val Ile Gly Val Leu Val Met Met Phe Ile Ile Ser Pro Leu Leu 210 215 220 Ala Leu Val Ala Leu Val Ser Ile Pro Val Thr Ile Val Val Thr Val 225 230 235 240 Vai Val Ala Ser Arg Ser Gin Lys Leu Phe Ala Glu Gin Trp Lys Gin 245 250 255 Thr Giy Ile Leu Asn Ala Arg Leu Giu Glu Thr Tyr Ser Gly His Ala 260 265 270 Val Val Lys Vai Phe Gly His Gin Lys Asp Val Gln Giu Ala Phe .Giu 275 280 285 Giu Giu Asn Gin Ala Cys Val 290 295 <210> 61 <211> 426 <212> DNA <213> Corynebacterium giutamicum <22 0> <221> CDS <222> (426) <223> RXCO0861 <400> 61 atg gct cct cac aag gtc atg ctg att acc act ggt act cag ggt gag 48 Met Ala Pro His Lys Val Met Leu Ile Thr Thr Gly Thr Gin Gly Giu 1 5 10 cct atg gct gcg ctg tct cgc atg gcg cgt cgt gag cac cga cag atc 96 Pro Met Ala Ala Leu Ser Arg Met Ala Arg Arg Glu His Arg Gin Ile 25 act gtc cgt gat gga gac ttg att atc ctt tct tcc tcc ctg gtt cca 144 Thr Vai Arg Asp Giy Asp Leu Ile Ile Leu Ser Ser Ser Leu Vai Pro 40 ggt aac gaa gaa gca gtg ttc ggt gtc atc aac atg ctg gct cag atc 192 Giy Asn Glu Giu Ala Val Phe Gly Val Ile Asn Met Leu Ala Gln Ile 55 ggt gca act gtt gtt acc ggt cgc gac gcc aag gtg cac acc tcg ggc 240 Giy Ala Thr Val Val Thr Gly Arg Asp Ala Lys Vai His Thr Ser Gly 70 75 cac ggc tac tcc gga gag ctg ttg ttc ttg tac aac qcc gct cgt ccg 288 His Gly Tyr Ser Gly Glu Leu Leu Phe Leu Tyr Asn Ala Ala Arg Pro 90 aag aac gct atg cct gtc cac ggc gag tgg cgc cac ctg cgc gcc aac 336 Lys Asn Ala Met Pro Val His Gly Glu Trp Arg His Leu Arg Ala Asn WO 01/66573 WO 0166573PCT/IBOO/02035 100 105 aag gaa ctg gct atc tcc act gqt gtt Lys Glu Leu Ala Ile Ser Thr Gly Val 115 120 gca caa aac ggt qtt gtg gtt gat atg Ala Gln Asn Gly Val Val Val Asp Met 130 135 <210> 62 <211> 142 <212> PRT <213> Corynebacterium glutamicum <400> 62 110 aac cgc gac aac gtt gtg ctt. Asn Arg Asp Asn Val Val Leu 125 gtc aac ggt. cgc gca Val Asn Gly Arg Ala 140 Met Ala Pro His Lys Val Met Leu Ile Thr Thr Giy Thr Gin Gly Glu 1 5 10 Pro Met Ala Ala Leu Ser Arg Met Ala Arq Arg Glu His Arg Gin Ile 2D 25 Thr Val Arg Asp Gly Asp Leu Ile Ile Leu Ser Ser Ser Leu Val Pro 40 Giy Asn Glu Giu Ala Val Phe Gly Val Ile Asn Met Leu Ala Gin Ile 55 Gly Ala Thr Val Val Thr Gly Arg Asp Ala Lys Val His Thr Ser Gly 70 75 His Giy Tyr Ser Gly Glu Leu Leu Phe Leu Tyr Asn Ala Ala Arg Pro 90 Lys Asn Ala Met Pro Val His Gly Glu Trp Arg His Leu Arg Ala Asn 100 105 110 Lys Giu Leu Ala Ile Ser Thr Gly Val Asn Arg Asp Asn Val Val Leu 115 120 125 Ala Gin Asn Gly Val Val Val Asp Met Val Asn Gly Arg Ala 1130 135 140 <210> 63 <211> 1066 <212> DNA <213> Corynebacteriun glutamicum <220> <221> CDS <222> (1066) <223> RXC00866 <400> 63 gcatcaacgt aggagatcct. cgacttccaa ttatggctcc aaatgagcag gaacttgagg ctctccgaga agacatgaaa aaagctggag ttctataaat atg aat gat tcc cga 115 Met Asn Asp Ser Arg 1 WO 01/66573 WO 0166573PCT/IBOO/02035 aat Asn cag Gin tct Ser gat Asp aac Asn cgt Arg aac Asn ggc Gly L cg Ser gca Ala 150 ate Ile gtg Val et g Leu gat Asp gtt Val gat Asp gt a Val gct Ala cag Gin 75 cgt Arg gcg Ala aac As n gat Asp ctg Leu 155 ace Thr ct C Leu ttC Phe act Thr ace Thr acc Thr aaa Lys caa Gin aac As n cgc Arg aac As n cgc Arg ctg Leu 140 cgt Arg gt 9 Val ttC Phe ggc Gly ca c His 220 qgc Gly eag Gin gec Ala gat Asp gga Gly 80 gga Gly ggt Gly cgc Arg ctg Leu ctt Leu 160 aac Asn qgt Gly gat Asp gac Asp gct Ala 2G gct Ala aat Asn tee Ser egc Arg tee Ser 100 cgt Arg gt t Val1 cca Pro tee Ser etc Leu 180 gtt Val ege Arg get Ala ggt Gly tee Ser egg Arg cag Gin aac Asn gga Gly ca g Gin aag Lys aaq Lys gaa Giu 165 atc Ile gac Asp gte Val att Ile eec tgg ctg ctg aag ctg cgc aae gat ate cca ate ttg gca tcc cgt Pro Trp Leu Leu Lys Leu Arg Asn Asp Ile Pro Ile Leu Ala Ser Arg WO 01/66573 WO 0166573PCT/IBOO/02035 U ttc acc ttg gct ctg att gca gct aag Phe Thr Leu Ala Leu Ile Ala Ala Lys 250 ccg aag ctg atc gag gtc aac gag cag Pro Lys Leu Ile Glu Val Asn Glu Gln 265 270 ttc aac att cgc ttc tgg gct gtt aac Phe Asn Ile Arg Phe Trp Ala Val Asn 280 285 ggt ctt gct atc aag act cct got ggt Gly Leu Ala Ile Lys Thr Pro Ala Gly 295 300 atc aag ctg gat cag act cct cot gat Ile Lys Leu Asp Gin Thr Pro Pro Asp 310 315 <210> 64 <211> 322 <212> PRT <213> Corynebacterium giutamicum <400> 64 Met Asn Asp Ser Arg Asn Arg Gly Arg 883 931 979 1027 1066 Gly Ser Arg Gin Asn Giy Gin Lys Lys Glu Gin Ser Asp Asn Arg Asn Gly Ser Al a 150 Ile Gi u Asn Ala Al a Ser Ala Gly Met 135 Pro Gly Lys Val 10 Leu Asp Ala Val Gly Ala Ser Gin 75 Asn Arg 90 Gly Ala Gly Asn Ala Asp Gly Leu 155 Met Thr 170 Val Lau Al a Phe Thr Gin Ser Arg Ser Gly Arg Ala Tyr 175 Ser Gly Gin Ala Asp Gly Gi y Gly Arg Leu Leu 160 Asn' Gly Asn Arg Leu Leu Ile Val Asp Cys Gly WO 01/66573 WO 0166573PCT/tBOO/02035 Giu His His 225 Ile Glu Glu Ile Ile 305 Pro 180 Val Arg Ala Ser Gin 260 Giy Cys Gly 190 Ile His Asp Lys Gin 270 Asn Giy Asp Glu Giu Ile Cys 255 Ser His Leu Gly Asp Asp Pro 240 Lys Asn S er Vai Arg 320 <210> <211> 1527 <212> DNA <213> Corynebacterium giutamioum <220> <221> CDS <222> (1504) <223> RXC02095 <400> ctctcttqgt octotoocca cccattttta agtactcaag tactcooca acaggctcaa aaatactgaa aggctcacgc tc Ser ogc Arg tca Ser ott Leu tta gc Leu Ala att tcc Ile Ser ago got Ser Ala ggt ggo Gly Gly acccttccaa cagaaaggat atg aaa act gag oaa Met Lys Thr Giu Gin 1 cct gaa aag coa caa Pro Giu Lys Pro Gin oga cot tgg oto aco Arg Pro Trp Leu Thr ttg ttt gaa ott a~±a Leu Phe Giu Leu Thr gog ctc gga aat acc Ala Leu Giy Asn Thr WO 01/66573 WO 0166573PCT/1BOO/02035 egg ttc act ccg gga Gly tt a Leu ctt Leu age Ser cag Gin gte Val1 150 atg Met gt g Val ttg Leu ttt Phe cat His 230 cag Gin ttt Phe atg Met gat act tta acc act Asp agc Ser ege Arg at g Met aac Asn 135 agt Ser tt g Leu at c Ile qt g Val gcg Al a 215 gtg Val gaa Glu gcc Al a gtt Val Thr 75 agc Ser caa Gin cat His cca Pro t cg S er 155 ate Ile at t Ile ttg Leu t cg Ser gt c Val 235 ace Thr egc Arg ccg Pro gac ctg ctg gac Asp Leu Leu Asp gte att gcc ctt Val Ile Ala Leu ttt gga cgg cga Phe Gly Arg Arg 110 gat gte egg ctt Asp Val Arg Leu 125 ggt cag gac tct Gly Gin Asp Ser 140 gat atc aac atg Asp le Asn Met gga aat gtg gtc Gly Asn Val Val 175 tec ccg ccg ctg Ser Pro Pro Leu 190 tgg gec gtg gcc Trp Ala Val Ala 205 gcc cag caa aag Ala Gin Gin Lys 220 acg ggt atc cgc Thr Gly Ile Arg gac aaa ttg gat Asp Lys Leu Asp 255 act gca cgt ctg Thr Ala Arg Leu 270 cag ctt gct ttg Gin Leu Ala Leu 285 act ggt cac ate Thr Gly His Tie 300 Arg Phe atc gtg Ile Val tac acc Tyr Thr aaa aeg Lys Thr att cge Ile Arg 145 gtg caa Val Gin 160 aag ctt Lys Leu ace atc Thr Ile tat teg Tyr Ser get gcg Ala Aia 225 gtg gte Val Val 240 ctc ace Leu Thr acg gca Thr Ala gtg gte Val Val acg gtg Thr Val 305 Thr ctt Leu gca Al a at g Met 130 aca Thr age Ser gt g Val ate Ile cga Arg 210 gat Asp aag Lys gea Al a aag Lys aa c Asn 290 gge Gly Pro etc Leu 9gc Gly 115 cgc Arg ggc Gly et t Leu etc Leu get Al a 195 aaa Lys ct g Leu gca Ala egt Arg ttc Phe 275 at t Ile aeg Thr agt Ser geg Al a 100 aag Lys tea Ser ca a Gin gtg Val1 act Thr 180 gca Al a geg Al a ace Thr ttt Phe gag Giu 260 ate Ile gt t Val ttt Phe 355 403 451 499 547 595 643 691 739 787 835 883 931 979 1027 ggt ggc tat ttg gee atg Gly Gly 295 Tyr Leu Ala Met WO 01/66573 WO 0166573PCT/IBOO/02035 gcg Ala 310 tcg Ser atc Ile ccc Pro gat Asp gaa Glu 390 gtg Val ttt Ph e gat Asp tcc ttt Phe ggc Gly tt t Phe ct g Leu ttc Phe 375 a cc Thr cag Gin gat Asp at c Ile tcc tcc tat ctc Ser Tyr Leu 315 ctc atg cgc Leu Met Arg 330 gtc att gat Val Ile Asp 345 ctt ccc gac Leu Pro Asp ggg att ctc Gly Ile Leu gtg ttg gtg Val Leu Val 395 gct gga aac Ala Gly Asn 410 aac ggc cat Asn Gly His 425 agg aat ctc Arg Asn Leu ata ccg cga act agc ttg tcg gcg gtg gct Thr Ser Leu Ser Ala Val Ala agg tcc ctg Arg Ser Leu 320 gtg cag ttg gcg ctg Val Gin Leu Aia Leu 335 ctt cag cot gaa cgc Leu Gin Pro Giu Arg 350 act ccc ctg ggt ctg Thr Pro Len Gly Leu 365 aac ggt ttt gag ctg Asn Giy Phe Glu Leu 380 ggc cot cca ggt tca Gly Pro Pro Gly Ser 400 ttt tat caa cca gac Phe Tyr Gin Pro Asp 415 cgc act cgc ttc gac Arg Thr Arg Phe Asp 430 atc gcg gtt ttt gat Ile Ala Vai Phe Asp 445 gaa cat ctc gat ggq Gin His Len Asp Gly 460 t ct Ser aco Thr t cg Ser ggt Gly 385 ggc Gly agc S er gao Asp gag Gin t tt Phe 465 1075 1123 1171 1219 1267 1315 1363 1411 1459 Ser Ser Ser Ile Pro Arg 455 1504 1527 tgatgagcag atcgaacacg cag <210> 66 <211> 468 <212> PRT <213> Corynebacteriir glutamicum <400> 66 Met Lys Thr Gin Gin Ser Gin Lys Ala Gin Leu Ala Pro Lys Lys Ala 1 5 10 Pro Gin Lys Pro Gin Arg Ile Arg Gin Le Ile Ser Val Aia Trp, Gin 25 Arg Pro Trp Leu Thr Ser Phe Thr Vai Ile Ser Ala Leu Ala Ala Thr 40 Leu Phe Gin Leu Thr Len Pro Leu Len Thr Giy Gly Ala Ile Asp Ile 55 WO 01/66573 WO 0166573PCT[I]BOO/02035 U Ala 65 Phe Val Thr Thr Arg 145 Gin Leu Ile Ser Al a 225 Val1 Thr Al a Val Val 305 Val Ser Thr Leu Thr Leu Ala Met 130 Thr Ser Val Ile Arg 210 Asp Lys Al a Lys Asn 290 Gly Al a Ser Asp Gly Pro Leu Gly 115 Arg Gly Leu Leu Ala 195 Lys Leu Al a Arq Phe 275 Ile Thr Arg Val Pro 355 Asn Ser Al a 100 Lys Ser Gin Val Thr 180 Al a Al a Thr Phe Glu 260 Ile Val Phe Ser Glu 340 Al a Thr Gly ILeu Leu Leu Val1 Al a 165 Leu Val Leu Thr Al a 245 Leu Pro Gly Val1 Leu 325 Arg His Thr Thr 90 S er Gin Gly Ile Leu 170 Ala Leu Trp Thr Glu 250 Met Leu Ala Tyr Met 330 Ile Pro Leu Ile Gly Val 125 Gin Ie Asn Pr o Al a 205 Gin Gly Lys Ala Leu 285 Gly Ser Gin Gln Pro 365 Leu Al a Arg 110 Arg Asp As n Val Pro 190 Val1 Gin Ile Leu Arg 270 Al a His Leu Leu Pro 350 Leu Asp Leu Arg Leu Ser Met Val1 175 Leu Al a Lys Arg Asp 255 Leu Leu Ile Ser Ala 335 Glu Gly Arg Ile Tyr Lys Ile Val 160 Lys Thr Tyr Al a Val 240 Leu Thr Val Thr Al a 320 Leu Arg Leu Ser Phe Asn Asn Val Asp Phe Arg Gly Ile Leu GyPeGuLu Gly Phe Glu Leu WO 01/66573 WO 0166573PCT/IBOO/02035 Gly Val Gin Ala Gly Giu Thr Val Val Leu Val Gly Pro Pro Giy Ser 385 390 395 400 Gly Lys Thr Met Ala Val Gin Leu Ala Gly Asn Phe Tyr Gin Pro Asp 405 410 415 Ser Giy His Ile Ala Phe Asp Ser Asn Gly His Arq Thr Arg Phe Asp 420 425 430 Asp Leu Thr His Ser Asp Ile Arg Arg Asn Leu Ile Ala Vai Phe Asp 435 440 445 Giu Pro Phe Leu Tyr Ser Ser Ser Ile Pro Arg Glu His Leu Asp Gly 450 455 460 Phe Gly Cys Gin 465 <210> 67 <2i1> 295 <212> DNA <213> Corynebacterium giutamilcum <22 0> <221> CDS <222> (272) <223> RXC03185 <400> 67 agcgcccaac cgttcagacc agcggtttct ctgaggatgc aaagtccatg atgggtnagg tcactgagct gtccgaaacc acc atg aat gat ctt gca gct gaa ggt gas aac 113 Met Asn Asp Leu Ala Ala Giu Giy Giu Asra 1 5 gat cct tac cgc atg gtt cag cag ctg cgc cqc aag ctc tct cgc ttc 161 Asp Pro Tyr Arg Met Val Gin Gin Leu Arg Arg Lys Leu Ser Arg Phe 20 gtc gag cag aag tgg aag cgc cag ccg gtc atc atg cca acc gtc att 209 Val Giu Gin Lys Trp Lys Arg Gin Pro Val Ile Met Pro Thr Val Ile 35 ccg stg act gcg gaa ace acg cac ate ggt gac gat gag gtt cgc gct 257 Pro Met Thr Ala Giu Thr Thr His Ile Giy Asp Asp Giu Val Arg Ala 50 tca cgc gag tcc ctg taaaageatt tcgcttttcg acg 295 Ser Arg Giu Ser Leu <210> 68 <211> 63 <212> PRT <213> Corynebacterium giutamicum <400> 68 Met Asn Asp Leu Ala Ala Glu Giy Giu Asn Asp Pro Tyr Arg Met Val 1 5 10 WO 01/66573 WO 0166573PCTIBOOO2O35 Gin Gin Leu Arg Arg Lys Leu Ser Arg Phe Val Giu Gin Lys Trp Lys 25 Axq Gin Pro Val Ile Met Pro Thr Val Ile Pro Met Thr Ala Giu Thr 40 Thr His Ile Gly Asp Asp Glu Val Arq Ala Ser Arq Glu Ser Leu 55 (210> 69 <211> 1170 <212> DNA <213> Corynebacterium giutainicum (220> <221> CDS <222> (101)..(1147) (223> RXA00115 (400> 69 tggattctcg agtctgtaca cccttgatca aagcccgagt gttccgtaga ttaactttgt cgtatattgt gacctacacc ccatactgtt aggagttttc atg ctc gac aat agt 11! Met Leu Asp Asn Ser gt t Val1 gaa Glu acg Thr t cc Ser gcg Ala aat Asn atg Met gac Asp gtt cag Gin ggg Gly ctc Leu gga Gly ct g Leu ggt Gly t cc Ser Cgg Arg ggt ggC Gly gct Al a ct c Leu ta C Ty~r tc Ser gct Al a gat Asp acc Thr tat WO 01/66573 WO 0166573PCT/BOO/02035 Glu gag Glu 150 gcg Al a ott Leu tc Ser tgg Tirp cgt Arg 230 gat Asp tgg Trp gca Al a ago Ser ct c Leu 310 ct t Leu aat Asn Leu 135 tgg Trp ggc Gly aat Asn too Ser gCt Ala 215 cgo Arg cog Pro aag Lys gcg Al a gag Glu 295 at c Ile ggg Gly ctg Leu Ala gt t Val gcg Ala acc Thr 185 gaa Giu atg Met gga Gly tt 0 Phe cag Gin 265 ctt Leu atg Met ggo Gly ttt Phe gag Glu 345 Gly Ser Met gac caa gtt Asp Gin Val cot oat gat Pro His Asp 175 gat ooa ggg Asp Pro Gly 190 gat gga ott Asp Gly Leu 205 aca gag tto Thr Giu Phe aag gag tca Lys Glu Ser gat cct aat Asp Pro Asn 255 gto tot ogo Val Ser Arg 270 aag gct aag Lys Ala Lys 285 gtt ogt gac Val Arg Asp oga gtg ato Arg Val Ile gag aat tao Giu Asn Tyr 335 Gin gca Ala ttc Phe ggo Gly caa Gin 210 cag Gin gog Al a ot 0 Leu ggo Gly gtt Val1 290 gca Ala atc Ile cag Gln gct Al a aco Thr Gly 195 tog Ser gag Glu gao Asp aao Asn ggo Gi y 275 atg Met gaa Giu gco Ala ato 595 643 691 739 787 835 883 931 979 1027 1075 1123 Ile Pro Gln Ile Asp Lys 340 ctg ttc gag agc Leu Phe Giu Ser taaacactga tgtoaaagag cot 1170 <210> <211> 349 <212> PRT <213> Corynebacterium giutamicun WO 01/66573 WO 0166573PCTJIBOO/02035 <400> Met Leu Asp Ash Ser Phe Tyr Thr Ala Glu Vai Gin Gly Pro Tyr GJlu 1 5 10 Thr Ala Ser Ile Giy Arg Leu Glu Leu Giu Glu Gly Gly Vai Ile Giu 25 Asp Cys Trp Leu Ala Tyr Ala Thr Ala Gly Thr Leu Asn Glu Asp Lys 40 Ser Asn Ala Ile Leu Ile Pro Thr Trp Tyr Ser Gly Thr His Gin Thr 55 Trp Phe Gin Gin Tyr Ile Giy Thr Asp His Ala Leu Asp Pro Ser Lys 70 75 Tyr Phe Ile Ile Ser Ile Asn Gin Ile Gly Asn Gly Leu Ser Val Ser 90 Pro Ala Asn Thr Ala Asp Asp Ser Ile Ser Met Ser Lys Phe Pro Asn 100 105 110 Val Arg Ile Gly Asp Asp Val Val Ala Gin Asp Arg Leu Leu Arg Gin 115 120 125 Giu Phe Gly Ile Thr Giu Leu Phe Ala Vai Val Gly Gly Ser Met Giy 130 135 140 Ala Gin Gin Thr Tyr Giu Trp Ile Val Arg Phe Pro Asp Gin Vai His 145 150 155 160 Arg Ala Ala Pro Ile Ala Gly Thr Ala Lys Asn Thr Pro His Asp Phe 165 170 175 Ile Phe Thr Gin Thr Leu Asn Giu Thr Val Giu Ala Asp Pro Gly Phe 180 185 190 Asn Gly Gly Giu Tyr Ser Ser His Giu Giu Val Ala Asp Gly Leu Arg 195 200 205 Arg Gin Ser His Leu Trp Aia Ala Met Gly Phe Ser Thr Glu Phe Trp 210 215 220 Lys Gin Glu Ala lrp Arg Arg Leu Gly Leu Glu Ser Lys Glu Ser Val 225 230 235 240 Leu Ala Asp Phe Leu Asp Pro Leu Phe Met Ser Met Asp Pro Asn Thr 245 250 255 Leu Leu Asn Asn Ala Trp Lys Trp Gin His Gly Asp Val Ser Arg His 260 265 270 Thr Gly Gly Asp Leu Ala Ala Ala Leu Gly Arg Val Lys Ala Lys Thr 275 280 285 Phe Val Met Pro Ile Ser Giu Asp Met Phe Phe Pro Val Arg Asp Cys 290 295 300 Ala Ala Glu Gin Ala Leu Ile Pro Gly Ser Glu Leu Arg Val Ile Glu 305 310 315 320 WO 01/66573 WO 0166573PCT/IBOO/02035 Asp Ile Ala Gly His Leu Giy Leu Phe Asn Val Ser Giu Asn Tyr Ile 325 330 335 Pro Gin Ile Asp Lys Asn Leu Lys Glu Leu Phe Glu Ser 340 345 <210> 71 <211> 1254 <212> DNA <213> Corynebacterium giutamicum <220> <221> 005 <222> (101)..(1231) <223> RXN00403 <400> 71 tttttcagac tcgtgagaat geaaactaga etagacagag aagttttagt cttgtccaee cagaacaggc ggttattttc ctgtccatat acactqgacq ct t Leu at t Ile gat Asp gga Gly aaa Lys ggt Gly aat Asn aac Asn gca Ala gca gaa Giu a ca Thr aaa Lys gat Asp gcc Ala ggt Gly ttc Phe gcc Ala gta Vai atg atc Ile aac Asn gaa Glu tcc Ser ate Ile t ge Cys t gg Trp gaa Glu ctt Leu 140 t ac atg Met 1 gat Asp tat Tyr gte Val1 tgg Trp tac Tyr gga Gly ccc Pro ga e Asp ggt Gly 145 ggC eec ace etc Pro Thr Leu geg Ala gaa Gi u ggt Giy gaa Giu ttg Leu tgt Cys atg Met at t Ile ate Ile ace Thr gt~t WO 01/66573 WO 0166573PCTIIB0OO(02035 Leu Giu 150 ctt gca Leu Ala gcc caa Ala Gin tac tac Tyr Tyr cgc ate Arg Ile 215 ttc gge Phe Gly 230 aag ccc Lys Pro gac aag Asp Lys gac gcc Asp Ala aag gca Lys Ala 295 acc gat Thr Asp 310 ctg gga Leu Gly gat get Asp Ala ttc ttc Phe Phe gag ttc Glu Phe 375 <210> 7; Trp Ala gtt tct Val Ser att aag Ile Lys 185 gaa tee Glu Ser 200 gcc cac Ala His acc aaa Thr Lys gac cag Asp Gin cta gta Leu Val 265 etc aac Leu Asn 280 etc gaa Leu Glu att ttg Ile Leu aat eta Asn Leu ttc ctc Phe Leu 345 agc etc Ser Leu 360 tac atc Tyr Ile Ala Met Tyr 155 gca cgc gee Ala Arg Ala 170 gcg att. gaa Ala Ile Glu ggc tgc aac Gly Cys Asn ctc acc tac Leu Thr Tyr 220 gcc caa aag Ala Gin Lys 235 cgc ttc gcc Arg Phe Ala 250 cag cgt tte Gin Arg Phe cgc cac gac Arg His Asp tcc ate aaa Ser Ile Lys 300 tac ccc tae Tyr Pro Tyr 315 ctg qca atg Leu Ala Met 330 acc gaa agc Thr Glu Ser atc tcc eca Ile Ser Pro Glu Thr Val 160 gce tgg caa Ala Trp Gin 175 gac cac cac Asp His His 190 gcc ace gga Ala Thr Gly ggc gaa eta Gly Giu Leu gaa aac cca Giu Asn Pro 240 gaa tec tac Giu Ser Tyr 255 gec ggc tc Ala Giy Ser 270 ggt cgc gac Gly Arg Asp cca gte ctt Pro Val Leu cag caa gaa Gin Gin Giu 320 aaa ate gta Lys Ile Val 335 caa atg gat Gin Met Asp 350 gaa gac aac Giu Asp Asn Gly atc Ile t gg Trp ct c Leu gaa Giu 225 ct C Leu ttg Leu tac Tyr cgc Arg gte Val 305 cac H is tee Ser cgc Arg cct Pro Ala ca a Gin 180 gqc Gly gcc Ala gaa Giu tac Tyr caa Gin 260 etc Leu etc Leu gt a Val aga Arg gge Gly 340 agg Arg tac Tyr Val 165 tee Ser aae Asn ega Arg ege Arg ege Arg 245 gea Ala ace Thr aac As n gat Asp aa e Asn 325 ca c His aae As n at c Ile 643 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 1254 taataggtat ttacgaeaaa tag WO 01/66573 WO 0166573PCT/IBOO/02035 <211> 377 <212> PRT <213> Corynebacterium glutamlcui <400> 72 Met Pro Thr Leu Ala Pro Ser Gly Gin Leu Giu Ile Gin Ala Ile Gly 1 5 10 Asp Val Ser Thr Glu Ala Gly Ala Ile Ile Thr Asn Ala Giu Ile Ala 25 Tyr His Arg Trp Gly Giu Tyr Arg Val Asp Lys Glu Gly Arg Ser Asn 40 Val Val Leu Ile Glu His Ala Leu Thr Gly Asp Ser Asn Ala Ala Asp 55 Trp Trp Ala Asp Leu Leu Gly Pro Gly Lys Ala Ile Asn Thr Asp Ile c~1 65 70 75 Tyr Cys Val Ile Cys Thr Asn Val Ile Giy Gly Cys Asn Gly Ser Thr 90 Gly Pro Gly Ser Met His Pro Asp Gly Asn Phe Trp Gly Asn Arg Phe 100 105 110 Pro Ala Thr Ser Ile Arg Asp Gin Val Asn Ala Giu Lys Gin Phe Leu 115 120 125 Asp Ala Leu Gly Ile Thr Thr Val Ala Ala Val Leu Gly Gly Ser Met 130 135 140 Gly Gly Ala Arg Thr Leu Glu Trp Ala Ala Met Tyr Pro Giu Thr Vai 145 150 155 160 Gly Ala Ala Ala Val Leu Ala Val Ser Ala Arg Ala Ser Ala Trp Gin 165 170 175 Ile Gly Ile Gin Ser Ala Gin Ile Lys Ala Ile Glu Asn Asp His His 180 185 190 Trp His Giu Gly Asn Tyr Tyr Giu Ser Giy Cys Asn Pro Ala Thr Gly 195 200 205 Leu Gly Ala Ala Arg Arg Ile Ala His Leu Thr Tyr Arg Gly Giu Leu 210 215 220 Giu Ile Asp Glu Arg Phe Gly Thr Lys Ala Gin Lys Asn Glu Asn Pro 225 230 235 -240 Leu Gly Pro Tyr Arg Lys Pro Asp Gin Arg Phe Ala Vai Glu Ser Tyr 245 250 255 Leu Asp Tyr Gin Ala Asp Lys Leu Val Gin Arg Phe Asp Ala Gly Ser 260 265 270 Tyr Val Leu Leu Thr Asp Ala Leu Asn Arg His Asp Ile Gly Arg Asp 275 280 285 Arg Gly Gly Leu Asn Lys Ala Leu Giu Ser Ile Lys Vai Pro Val Leu 290 295 300 WO 01/66573 WO 0166573PCT/[BOO/02035 UN Val. Ala Gly Val Asp Thr Asp Ile Leu Tyr Pro Tyr His Gin Gin Glu 305 310 315 320 His Lea Ser Arg Asn Leu Gly Asn Leu Leu Ala Met Ala Lys Ile Val 325 330 335 Ser Pro Val Gly His Asp Ala Phe Lea Thr Glu Ser Arg Gin Met Asp 340 345 350 Ar Ile Val. Arg Asn Phe Phe Ser Lea Ile Ser Pro Asp Giu Asp Asn 355 360 365 Pro Ser Thr Tyr Ile Giu Phe Tyr Ile 370 375 <210> 73 <211> 1210 <212> DNA <213> Corynebacteriui giutamicum <220> <221> CDS <222> (1210) <223> FRXA00403 <400> 73 tttttcagac tcgtgagaat gcaaactaga ctagacagag ctgtccatat acactggacg aagttttagt cttgtccacc cagaacaggc ggttattttc atg Met I gat Asp tat Tyr gtc. Vai tgg Trp tac Tyr gga Gly ccc Pro ccc acc ctc Pro Thr Leu gtc tcc acc Val Ser Thr cac cgo tgg His AMg Trp gtt ctc atc Val Le Ile tgg gct gac Trp Ala Asp tgc gtg atc Cys Val Ile cct ggc tcc Pro Gly Ser 100 gcc acg tcc Ala Thr Ser 115 115 163 211 259 307 355 403 451 WO 01/66573 WO 0166573PCT/IBOO/02035 cgt Arg acc Thr ct a Leu 150 ct t Leu gcc Ala tac Tyr cgc Arg ttc Phe 230 aag Lys gac Asp gac Asp sag Lys acc Thr 310 ctg Leu cag Gln 120 gt c Val tgg Trp gtt Val att Ile gaa Glu 200 gcc Ala acc Thr gac Asp ct a Leu ctc Leu 280 ctc Leu att Ile sat Asn sac Asn gca Ala gca Ala gca Ala 170 gcg Ala ggC Gly ctc Leu gcc Al a cgc Arg 250 cag Gln CYC Arg t cC Ser tac Tyr ct g Leu 330 caa Gin ggt Gly gaa Giu gcc Ala gac Asp 190 gcc Ala ggC Gly gas Giu gaa Giu gcc Ala 270 ggt Gly cca Pro cag Gln aas Lys ttc Phe tcc Ser act Thr tgg Trp 175 ca c His acc Thr gas Giu sac Asn tcc Ser 255 ggc Gly cgc Arg qt c Val ca a Gin atc Ile 335 ct c Leu at g Met gtt Val 160 055 Gin ca C His gga Gly ct a Leu cca Pro 240 tac Tyr tcc Ser ga c Asp ctt Leu ga Giu 320 gta Val ctc Leu gcc Ala gct Ala att Ile gas Glu 195 gcc Al a gac Asp ccc Pro tac Tyr ttg Leu 275 gy c Gly ggc Gly tcc Ser gt c Val1 ggc atc Gly Ile cgc aCC Arg Thr gct gtt Ala Val 165 cas tcc Gin Ser 180 ggc aac Gly Asn gcc cga Ala Arg gas cgc Giu Arg tac cgc Tyr Arg 245 Cas gca Gin Ala 260 ctc acc Leu Thr ctc sac Leu Asn gta gat Val Asp aga sac Arg Asn 325 ggc cac Gly Pis 340 499 547 595 643 691 739 787 835 883 931 979 1027 1075 1123 1171 gat gct Asp Ala ttc ctc acc Phe Leu Thr 345 agc cgc cas atg gat cgc atc Ser Arg Gin Met Asp Arg Ile 350 gtg agg sac Val Arg Asn 355 WO 01/66573 WO 0166573PCTIBOOO2035 ttc ttc agc ctc atc tco cca gac gaa gac aac oct tcg Phe Phe Ser Leu Ile Ser Pro Asp Glu Asp Asn Pro Ser 360 365 370 <210> 74 <211> 370 <212> PRT <213> Corynebacterium glutamicum 1210 <400> 74 Met Pro Thr Leu Ala Pro Ser Gly Gin 1 Asp T yr Val Trp Tyr Gly Pro Asp Gly 145 Gly Ile Trp Leu Glu 225 Leu Ser Arg Leu Ala Val1 Gly Thr 115 Leu Ala Ala Ile Giu 195 Al a Asp Pro Thr T rp Ile Asp Ile Ser 100 S er Gly Arg Ala Gin 180 Gly Al a Glu Tyr 5 Glu Gly Glu Leu Cys Met Ile Ile Thr Val 165 Ser Asn Arg Arg Arg 245 Ile 25 Val Thr Gly Ile Gly 105 Val Ala Ala Ser Lys 185 S er His Lys Gin Val 265 Leu Glu Ile Thr Asp Lys Gly Asp Lys Ala 75 Gly Gly Asn Phe Asn Ala Ala Val Ala Met 155 Ala Arg 170 Ala Ile Gly Cys Leu Thr Ala Gin 235 Arg Phe 250 Gin Arg Ala Giu Arg Al a Thr Gly Asn 110 Gin G.1y Glu Al a Asp 190 Ala Gly Glu Glu Al a 270 Gly Al a Asn Asp Ile Thr Phe Leu Met Val 160 Gin His Gly Leu Pro 240 Tyr Ser Leu Asp Tyr Gln Ala Asp Lys Len 260 WO 01/66573 WO 0166573PCTIBOOO 2035 Tyr Val Leu Leu Thr Asp Ala Leu Asn Arg His 275 280 Arg Gly Gly Leu Asn Lys Ala Leu Glu Ser Ile 290 295 Val Ala Gly Val Asp Thr Asp Ile Leu Tyr Pro 305 310 315 His Leu Ser Arg Asn Leu Gly Asn Leu Leu Ala 325 330 Ser Pro Val Gly His Asp Ala Phe Leu Thr Glu 34G 345 Arg Ile Val Arg Asn Phe Phe Ser Leta Ile Ser 355 360 Pro Ser 370 <210> <211> 687 <212> DNA <213> Corynebacterium giutamicum <220> <221> CDS <222> (664) <223> RXS03158 <400> caaagctcac cgaaggcacc aacgccaagt tggttgttga acctgcagca gccactaaaa ctcggcgcac acgcaagtcc aag Lys aac Asn gga Gly aag Lys atc Ile cca tco Ser ga a Glu tto Phe atg Met tco Ser cca caacaccttg gcatccccat ttg cac too acc acc Leu His Ser Thr Thr 1 ggc ctt gtg ggt acc Gly Leu Val Gly Thr atg cag ggc ggc atc Met Gin Giy Gly Ile acc gcc cgt ggc ctc Thr Ala Arg Gly Leu gac aac gca gaa aag Asp Asn Ala Gita Lys tco acc gtg ctc tao Ser Thr Val Leu Tyr gca gcg aag cag atg WO 01/66573 WO 0166573PCTIBOOIO2035 Pro Gly Leu Lys Asn His Pro Gly His Giu Val Ala Ala Lys Gin Met 95 100 aag cgc ttc ggc ggc atg atc tcc gtc cgt ttc gca ggc ggc gaa gaa 451 Lys Arg Phe Gly Gly Met Ile Ser Val Arg Phe Ala Gly Giy Giu Giu 105 110 115 gca got aag aag ttc tgt acc tcc acc aaa ctg atc tgt ctg goo gag 499 Ala Ala Lys Lys Pho Cys Thr Ser Thr Lys Leu Ile Cys Lou Ala Glu 120 125 130 tcc ctc ggt ggc gtg gaa tcc ctc ctg gag cac cca gca acc atg acc 547 Ser Leu Gly Gly Val Giu Ser Lou Lou Giu His Pro Ala Thr Met Thr cI135 140 145 cI cac cag tca got gcc ggc tct cag ctc gag gtt coo cgc gac ctc gtg 595 His Gin Ser Ala Ala Gly Sor Gin Leu Giu Vai Pro Arg Asp Leu Val 150 155 160 165 cgc atc tcc att ggt att gaa gac att gaa gac ctg ctc gca gat gtc 643 Arg Ile Ser Ile Gly Ile Giu Asp Ile Glu Asp Leu Leu Ala Asp Val 170 175 180 gag cag gcc ctc aat aac ott tagaaactat ttggcggcaa gca 687 Giu Gin Ala Lou Asn Asn Lou 185 <210> 76 <211> 188 <212> PRT <213> Corynebacterium giutamicum <400> 76 Leu His Ser Thr Thr Lys Tyr Ile Giu Gly His Ser Asp Val Val Gly 1 5 10 Gly Leu Val Gly Thr Asn Asp Gin Giu Met Asp Glu Giu Lou Leu Phe 25 Met Gin Gly Gly Ile Gly Pro Ile Pro Ser Vai Phe Asp Ala Tyr Leu 40 Thr Ala Arg Gly Leu Lys Thr Leu Ala Val Arg Met Asp Arg His Cys 55 Asp Asn Ala Giu Lys Ile Ala Glu Phe Lou Asp Ser Arg Pro Giu Val 70 75 Ser Thr Val Lou Tyr Pro Gly Lou Lys Asn His Pro Gly His Giu Val 90 Ala Ala Lys Gin Met Lys Arg Phe Gly Gly Met Ile Ser Val Arg Phe 100 105 110 Ala Gly Gly Giu Giu Ala Ala Lys Lys Phe Cys Thr Sor Thr Lys Lou 115 120 125 Ile Cys Lou Ala Giu Ser Lou Giy Gly Vai Glu Ser Leu Leu Giu His 130 135 140 WO 01/66573 WO 0166573PCT[LBOO/02035 Pro Ala Thr Met Thr His Gin Ser Ala Ala Gly Ser Gin Leu Giu Val 145 150 155 160 Pro Arg Asp Leu Val Arg Ile Ser Ile Gly Ile Giu Asp Ile Giu Asp 165 170 175 Leu Leu Ala Asp Val Giu Gin Ala Leu Asn Asn Leu 180 185 <210> 77 <211> 617 <212> DNA <213> Corynebacteriun giutamicun <2 <221> CDS <222> (594) <223> FRXA00254 <400> 77 cag Gin 1 tac T yr gac Asp ceg Pro acc Thr geg Ala ggt Gly cgc Arg gct Al a cca Pro ate Ile caq Gin atc Ile ctt Leu gaa Giu ctg Leu ttc Phe aag Lys 130 aaa Lys gga Gly atg Met t ca Ser gtg ValI ctg Leu aac Asn 100 9gc Gly ttc Phe gca Al a gtt Val 25 ctg Leu tac Tyr cac His gag Giu gaa Giu 105 cgt Arg a aa Lys gte Val 10 ggc Gly tt c Phe ctg Leu tgc Cys gte Val gte Val ttc Phe ctg Leu ttg Leu gge Gly atg Met ace Thr gac Asp 75 tee Ser gca Ala gca Ala ate Ile tee S er gt g Val ggc Gi y egt Arg gca Al a gt g Val aag Lys gge Gi y 2.25 ctg Leu acc Thr gt t Val1 gge Gly gge Gi y gaa Gi u etc Leu eag Gin 110 gaa Giu gee Ala ac Thr ace Thr ate Ile etc Leu aag Lys tac Tyr at q Met gaa Giu gag Glu aag Lys aac Asn gga Giy aag Lys ate Ile eca Pro aag Lys gca Ala tee Ser 48 96 144 192 240 288 336 384 432 480 etc ggt gge gtg gaa tee etc etg gag cac eca gca ace Gly Gly Val Giu Ser 150 Leu Leu Giu His Pro Ala Thr 155 atg ace cac Met Thr His 160 WO 01/66573 WO 0166573PCTIIBOO/02035 cag tca gct gcc ggc tct cag ctc gag gtt ccc cgc gac ctc gtg cgc Gin Ser Ala Ala Gly Ser Gin Leu Glu Val Pro Arg Asp Leu Val Arg 165 170 175 atc too att ggt att gaa. gac att gaa gac ctg ctc gca gat gto gag Ile Ser Ile Gly Ile Glu Asp Ile Glu Asp Leu Leu Ala Asp Val Glu 180 185 190 cag gcc ctc aat aac ctt tagaaactat ttggcggcaa gca Gin Ala Leu Asn Asn Leu 195 <210> 78 <211> 198 (212> PRT <213> Corynebacterium giutamicum <400> 78 Gin Pro Leu Lys Leu Giy Ala His Ala 1 Tyr Asp Pro Thr Ala Giy Arg Ala Leu 145 Gin Ile Ile Gin Ile Leu Glu Leu Phe Lys 130 Gly S er Ser Giy Giu Pro Al a Phe Lys Giy 115 Lys Gly Ala Ile Giy Met Ser Vai Leu Asn 100 Giy Phe Vai Ala Gly 180 5 His Asp Val Arg Asp His Met Cys Giu Giy 165 Ile Ser Glu Phe Met 70 Ser Pro Ile Thr Ser 150 Ser Git' Asp Glu Asp Asp Arg Giy Ser Ser 135 Let' Gin Val 10 Gly Phe Let' Cys Val1 90 Val Phe Let' His Val 170 Leu Gly Met Thr Asp 75 Ser Ala Aila Ile Pro 155 Pro Thr Vai Gly Gly Git' Let' Gin 110 Glu Al a Met Let' Thr Thr Ile Let' Lys Tyr Met Git' Git' Thr Val1 175 Lys As n Giy Lys Ile Pro Lys Ala Ser His 160 Arg Asp Ile Giu Asp Let' Leu Ala 185 Asp Val Git' 190 Gin Ala Leu Asn Asn Let' 195 <210> 79 <211> 1170 WO 01/66573 WO 0166573PCTIEBOO/02035 <212> DNA <213> Corynebacterium gJlutamicui <220> <221> COS <222> (101)..(1147) <223> RXA02532 <400> 79 gatgaatttt tacccaccat otgtacctat taaccctgcg tggcgtocao ccacagtaac tgtgcaagcg ggacggccag ooagaactoc tggtgcgccg atg aao cca cct atc Met Asn Pro Pro Ile aog Thr gat Asp gat Asp tog Ser gct Ala gga Gi y att Ile aat Asn cgt Arg ct t Leu 150 gca Ala ttg Leu ggc Gly ggt Gly att Ile gcc Al a agg Arg gct Al a ocg Pro ggg Gly 135 cgt Arg acc Thr act Thr gga Gly gcg Ala ttg Leu ggo Gly gtt Val caa Gin gt g Val gtt Val cca Pro atc Ile 170 gat Asp t tt Phe tot Ser ggt Gly att Ile gat Asp gtg Val 110 ato Ile gt t Val ggt Gly t ct Ser gaa Glu got Ala ggt Gly aca Thr gcc Ala gac Asp t gg Trp goa Ala gog Ala gat Asp 160 ott Leu ott Leu 1 aaa Lys gc Al a ttg Leu gtt Val agg Arg aat Asn gtg Val ata Ile act Thr 145 att Ile ott Leu gc Ala got Ala at g Met gca Al a gt t Val at g Met aco Thr gaa Glu gtc Val 130 tto Phe gt g Val ott Leu act Thr tat Tyr gga Gly gog Al a tta Leu gaa Glu ga a Glu tog Ser 115 gao Asp goa Al a ott Leu gga Gly oao His ggg Gly act Thr goa Al a oct Pro gc Ala gaa Glu 100 ato Ile ggt Gly acg Thr tao Tyr gto Val 180 ogt Arg 115 163 211 259 307 355 403 451 499 547 595 643 691 gtg tgo aag tot gag Val Cys Lys Ser Giu cac oat gog oag ttt His His Ala Gin Phe WO 01/66573 WO 0166573PCT[IBOO/02035 IN cat His ttg Leu 215 gaa Glu tat Tyr ct a Leu ect Pro gcg Al a 295 Cgg Arg tc Ser tca Ser 185 ggt tca gtg ccg gga ggt Gly Ser Val Pro Gly Gly 200 205 tat tcc ttg gcg gtg cgt Tyr Ser Leu Ala Val. Arg 220 ctt teg egg ega ctt aac Leu Ser Arg Arg Leu Asn 235 cca gga ctt cct gat gat Pro Gly Leu Pro Asp Asp 250 ccc tct gga tgt qga aac Pro Ser Gly Cys Gly Asn 265 gas cga act gat gag att Glu Arg Thr Asp Giu Ile 280 285 ace agt tgg gga ggt gtg Thr Ser Trp Gly Gly Val. 300 gat gct gaa gtg gtg gca Asp Ala Giu Val Val Ala 315 gta gga att gaa gac gtt Val Gly Ile Giu Asp Val. 330 atc gac aaa gtt ctg ggt Ile Asp Lys Val Leu Gly 190 ett ga Leu Glu ett gat Leu Asp geg cat Ala His eec caa Pro Gin 255 atg ttg Met Leu 270 etc ga Leu Glu gas sa Giu Thr gsa gta Glu Val gsa gat Giu Asp 335 195 geg ttt ctt gct Ala Phe Leu Ala 210 ega ges gsa tc Arg Ala Glu Ser 225 ect teg gtt ace Pro Ser Val Thr 240 eat gaa ass gee His Glu Lys Ala tea ttt gag ett Ser Phe Glu Leu 275 age ctg tca ctt Ser Leu Ser Leu 290 gee att gaa cgt Ala Ile Glu Arg 305 ccg atg act ctt Pro Met Thr Leu 320 cta tgg gaa gac Leu Trp Glu Asp ct c Leu aac Asn cgc Arg gtg Val 260 gat Asp tta Leu ege Arg tgc cys etc Leu 340 cgt Arg ges Al a gt a Val 245 cga Arg gca Ala ace Thr ace Thr ege Arg 325 sac As n 739 787 835 883 931 979 1027 1075 1123 1170 tagaactcgt agccagtaac cag <210> <211> 349 <212> PRT <213> Corynebacteriun glutanicun <400> Met Asn Pro Pro Ile Thr Leu Ser 1 5 Lys Ala Tyr Gly Arg Asp Gly Asn Ala Met Gly Thr Leu Asp Gly Gly 40 Leu Ala Ala Ala Thr Ser Ile Ala 55 Ser Thr Tyr Val His Asp Ser Glu 10 Asp Gly Trp Gly Ala Phe Giu Ala 25 Phe Ala Val Ser Tyr Ser Ser Gly Asp Leu Val Pro Thr Gly Gly Thr WO 01/66573 WO 0166573PCTJIiBOO/02035 Val1 Arg Asn Val Ile Thr 145 Ile Leu Al a Phe Al a 225 Ser Glu Phe Leu Ile 305 Met Trp Val Met Thr Glu Val 130 Phe Val Leu Thr Leu 210 Glu Val1 Lys Glu Ser 290 Glu Thr Gi u Leu Glu Giu Ser 115 Asp Ala Leu Gly His 195 Al a Ser Thr Al a Leu 275 Leu Arg Leu Asp Pro Lys Ala 70 Ala Arg Gly Glu Val Ile 100 Ile Ala Asri Gly Val Arg Thr Pro Leu 150 Tyr Ser Ala 165 Val Ala Val 180 Arg His Asp Leu Arg Gly Asn Ala Ala 230 Arg Val Asn 245 Val Arg Val 260 Asp Ala Thr Leu Thr His Arg Thr Arq 310 Cys Arg Val 325 Leu Asn Ala 340 Ala Tyr Tyr Gly Val Thr Asn Ile Phe Ala 75 Lys Ala 105 Met Gly Arg Leu Ser 185 Ser S er Ser Gly Ser 265 Arg Ser Ala Gly Asp 345 Val1 Asp Asp 125 Val Leu His Al a Gly 205 Arg Asn Asp Asn I le Val Ala Val Gly Asp Val 110 Ile Val Gly Ser Gln 190 Leu Leu Al a Pro Met 270 Leu Glu Glu Glu Ala Val Pro Asp Al a Asp 175 Phe Glu Asp His Gin 255 Leu Glu Thr Val Asp 335 Asp Trp Ala Ala Asp 160 Leu Leu Ala Arg Pro 240 His Ser Ser Ala Pro 320 Leu <210> 81 <211> 861 <212> DNA <213> Corynebacterium glutamicu' <220> WO 01/66573 WO 0166573PCTfIiBOO/02035 <221> CDS <222> (838) <223> RXS03159 <400> 81 aggggctagt tttacacaaa agtggacagc ttggtctatc attgccagaa gaccggtcct tttagggcca tagaattctg attacaggag ttgatctacc ttg tct ttt gac cca Leu Ser Phe Asp Pro aac Asn gac Asp ttc Phe cgt Arg ct c Leu acc Thr ct C Leu tt C Phe gaa Glu gaa Glu 150 gca Ala ttg Leu agt Ser ttc Phe ggt Gly gct Al a ccc Pro aag Lys ttc Phe gct Ala ggc Gl y gca Al a aac Asn gaa Glu 170 tac Tyr cca Pro tcc Ser t cg S er cca Pro acc Thr tat Tyr 75 cgc Arg tac Tyr gt c Val1 gcg Al a cca Pro 155 ggc Gly ct g Leu cca Pro act Thr at t Ile aac Asn at c Ile ggc Gly atc Ile Gly gaa Gl u atc Ile 140 gca Ala acc Thr cag Gin cca Pro att Ile 15 cca Pro cgc Arg tta Leu ttc Phe aag Lys 95 t ac Tyr gtt Val aac Asn atc Ile aag Lys 175 ct a Leu tcg Ser cac His atc Ile aaa Lys gag Giu t cc Ser so Ccg Pro cgc Arg gtt Val acc Thr a cc Thr 160 ttg Leu aaa Lys aag Lys 1 gct Al a tat Tyr ggc Gly cag Gin 65 t cc Ser ggC Gly ctg Leu gat Asp aag Lys 145 gac Asp gtt Val ctc Leu gac Asp gag Glu 20 acc Thr tac Tyr gca Al a gct Al a at c Ile 100 acc Thr gt c Val tgg Trp gca Ala aac Asn 180 cac His acg Thr cca Pro acc Thr acc Thr gca Al a gca Al a gt c Val gt a Val gt g Val gtg Val gt a Val 165 acc Thr gca Ala ttg Leu 115 163 211 259 307 355 403 451 499 547 595 643 691 739 WO 01/66573 PCT/IBOO/02035 200 205 210 ttg gcg gcc ttg tgg gta cca acg acc agg aaa tgg acg aag aac tgc 787 Leu Ala Ala Leu Trp Val Pro Thr Thr Arg Lys Trp Thr Lys Asn Cys 215 220 225 tgt tca tgc agg gcg gca tcg gac cga tcc cat cag ttt tcg atg cat 835 Cys Ser Cys Arg Ala Ala Ser Asp Arg Ser His Gin Phe Ser Met His 230 235 240 245 acc tgaccgcccg tggcctcaag acc 861 Thr C1 <210> 82 <211> 246 <212> PRT <213> Corynebacterium giutamicum <400> 82 Leu Ser Phe Asp Pro Asn Thr Gin Gly Phe Sex Thr Ala Ser Ile His 1 5 10 Ala Gly Tyr Giu Pro Asp Asp Tyr Tyr Gly Ser Ile Asn Thr Pro Ile 25 Tyr Ala Ser Thr Thr Phe Ala Gin Asn J.1a Pro Asn Giu Leu Arg Lys 40 Gly Tyr Giu Tyr Thr Arg Val Gly Asn Pro Thr Ile Val Ala Leu Glu 55 Gin Thr Val Ala Ala Leu Giu Gly Ala Lys Tyr Gly Arg Ala ?he Ser 70 75 Ser Gly Met Ala Ala Thr Asp Ile Leu Phe Arg Ile Ile Leu Lys Pro 90 Gly Asp His Ile Val Leu Gly Asn Asp Ala Tyr Gly Gly Thr Tyr Arg 100 105 110 Leu Ile Asp Thr Val Phe Thr Ala Trp Gly Val Giu Tyr Thr Val Val 115 120 125 Asp Thr Ser Val Val Giu Glu Val Lys Ala Aia Ile Lys Asp Asn Thr 130 135 140 Lys Leu Ile Trp Val Giu Thr Pro Thr Asn Pro Ala Leu Gly Ile Thr 145 150 155 160 Asp Ile Glu Aia Val Ala Lys Leu Thr Glu Gly Thr Asn Ala Lys Leu 165 170 175 Val Vai Asp Asn Thr Leu Ala Ser Pro Tyr Leu Gin Gin Pro Leu Lys 180 185 190 Leu Gly Ala His Ala Ser Pro Cys Thr Pro Pro Pro Ser Thr Ser Lys 195 200 205 Asp Thr Pro Thr Leu Leu Ala Ala Leu Trp Val Pro Thr Thr Arg Lys WO 01/66573 PCTJI1BOO/02035 210 215 220 Trp Thr Lys Asn Cys Cys Ser Cys Arg Ala Ala Ser Asp Arg Ser His 225 230 235 240 S Gin Phe Ser Met His Thr 245 <210> 83 <211> 703 <212> DNA <213> Corynebacterium glutamicui <220> <221> CDS <222> (101) (703) <223> FRXA02768 <220> <223> All occurrences of n any nucleotide <220> <223> All occurrences of Xaa any amino acid <400> 83 aggggctagt tttacacaaa agtggacagc ttggtctatc attgccagaa gaccggtcct tttagggcca tagaattctg attacaggag ttgatctacc ttg tct ttt gac cca 115 Leu Ser Phe Asp Pro 1 aac acc cag ggt ttc tcc act gca tcg att cac gct ggg tat gag cca 163 Asn Thr Gin Gly Phe Ser Thr Ala Ser Ile His Ala Gly Tyr Giu Pro 15 gac gac tac tac ggt tcg att aac acc cca atc tat gcc tcc acc acc 211 Asp Asp Tyr Tyr Gly Ser Ile Asn Thr Pro Ile Tyr Ala Ser Thr Thr 30 ttc gcg cag aac gct cca aac gaa ctg cgc aaa ggc tac gag tac acc 259 Phe Ala Gin Asn Ala Pro Asn Glu Leu Arg Lys Gly Tyr Giu Tyr Thr 45 cgt gtg ggc aac ccc acc atc gtg gca tta gag cag acc gtc gca gca 307 Arg Val Gly Asn Pro Thr Ile Vai Ala Leu Giu Gin Thr Val Ala Ala 60 ctc gaa ggc gca aag tat ggc cgc gca ttc tcc tcc gqc atg gct gca 355 Leu Glu Gly Ala Lys Tyr Gly Arg Ala Phe Ser Ser Gly Met Ala Ala 75 80 acc gac atc ctg ttc cgc atc atc ctc aag ccg ggc gat cac atc gtc 403 Thr Asp Ile Leu Phe Arg Ile Ile Leu Lys Pro Gly Asp His Ile Val 95 100 ctc ggc aac gat gct tac ggc gga acc tac cgc ctg atc gac acc: gta 451 Leu Gly Asn Asp Ala Tyr Gly Gly Thr Tyr Arg Leu Ile Asp Thr Val 105 110 115 ttc acc gca tgg ggc gtc gaa tac acc gtt gtt gat acc tcc gtc gtg 499 WO 01/66573 WO 0166573PCTA~BOO/02035 Phe Thr Ala Trp Gly Val Glu Tyr Thr Val Val Asp Thr Ser Val Val (I120 125 130 gaa gag gtc aag gca gcg atc aag gac aac acc aag gct gat ctt ggt 547 Giu Glu Val Lys Ala Ala Ile Lys Asp Asn Thr Lys Ala Asp Leu Gly 135 140 145 gga aac ccc aac caa ccc agc act ttg gca tta ccc gac atc gaa gca 595 Gly Asn Pro Asn Gin Pro Ser Thr Leu Ala Leu Pro Asp Ile Glu Ala 150 155 160 165 gtn tgc aaa act tca ccc gaa agg cac caa ccc caa gct tgt tgt ttg 643 Val Cys Lys Thr Ser Pro Glu Arg His Gin Pro Gin Ala Cys Cys Leu 170 175 18D aca aca cct tcg cat tcc cca tac ctg cag can cca ctt aaa ant tnn 691 Thr Thr Pro Ser His Ser Pro Tyr Leu Gin Xaa Pro Leu Lys Xaa Xaa 185 190 195 gng cac acg cag 703 Xaa His Thr Gin 200 <210> 84 <211> 201 <212> PRT <213> Corynebacterium glutamicun <220> <223> All occurrences of Xaa any amino acid <400> 84 Leu Ser Phe Asp Pro Asn Thr Gin Gly Phe Ser Thr Ala Ser Ile His 1 5 10 Ala Gly Tyr Giu Pro Asp Asp Tyr Tyr Gly Ser Ile Asn Thr Pro Ile 25 Tyr Ala Ser Thr Thr Phe Ala Gin Asn Ala Pro Asn Glu Leu Arg Lys 40 Gly Tyr Giu Tyr Thr Arg Val Gly Asn Pro Thr Ile Val Ala Leu Glu 55 Gin Thr Val Ala Ala Leu Giu Gly Ala Lys Tyr Gly Arg Ala Phe Ser 70 75 Ser Gly Met Ala Ala Thr Asp Ile Leu Phe Arg Ile Ile Leu Lys Pro 90 Gly Asp His Ile Val Leu Gly Asn Asp Ala Tyr Gly Gly Thr Tyr Arg 100 105 110 Leu Ile Asp Thr Val Phe Thr Ala Trp Gly Val Giu Tyr Thr Val Val 115 120 125 Asp Thr Ser Val Val Giu Glu Val Lys Ala Ala Ile Lys Asp Asn Thr 130 135 140 Lys Ala Asp Leu Gly Gly Asn Pro Asn Gin Pro Ser Thr Leu Ala Leu WO 01/66573 WO 0166573PCT/LBOO/02035 145 150 155 160 Pro Asp Ile Giu Ala Val Cys Lys Thr Ser Pro Giu Arg His Gin Pro 165 170 175 Gin Ala Cys Cys Leu Thr Thr Pro Ser His Ser Pro Tyr Leu Gin Xaa 180 185 190 Pro Leu Lys Xaa Xaa Xaa His Thr Gin 195 200 <210> (211> 1113 <212> DNA <213> Corynebacteriun giutamicum <22 0> <221> CDS <222> (1090) <223> RXA00216 <400> gtgttgctcg cggccaggca gcagtgctgt acctgcctga ttggatcagg caccatctgc cacacggagt cttaaqaaaa tt a Leu cag Gin ggt Gly atc Ile agc Ser gcg Al a gtt Val aaa Lys ctt Leu atc Ile gcc Al a acc Thr gga GI y tta Leu cgcggatggt gacatcgttc ttg ggc gct tat ggt 11 Leu Gly Ala Tyr Gly 1 gcc gcc gac att att 16 Ala Ala Asp Ile Ile cag ctt ccg gcg cga 21: Gin Leu Pro Ala Arg ggt ctg ctg gac atg Gly Leu Leu Asp Met atg agc aca cyc ccc Met Ser Thr Arg Pro gac atg gat ttg gat Asp Met Asp Leu Asp aag cta aaa atc caa 402 Lys Leu Lys Ile Gin 100 gag ttg gcc aat ggc Glu Leu Ala Asn Gly 115 cat cgc gtt ttg tct gat cgc ggt gcg His Arg Val Leu Ser Asp Arg Gly Ala atg cgt gat ctc acg cag gcg Met Arg Asp Leu Thr Gin Ala 130 WO 01/66573 WO 0166573PCTJIBOO/02035 atc gat gcg cat gca cgc aag gtt gct Ile Asp Ala His Ala Arg Lys Val Ala ggg cga ttt Gly Arg Phe 140 145 cag gtg Gin Val 155 ctc cct Leu Pro 170 gat gcc Asp Ala aca tat Thr Tyr ggt gcg Gly Ala aat gaa Asn Giu 235 ctt ggt Leu Gly 250 gag cga Glu Arg tta ggt Leu Gly ggt gag Gly Giu cgc atg Arg Met 315 caa att gat gag ccg gag Gin Ile Asp Giu Pro Giu 160 ggc act tcc acc ttt gac Gly Thr Ser Thr Phe Asp 175 agt gaa cgt ttg cag cag Ser Giu Arg Leu Gin Gin 190 ctc aac ctc acc ggc cag Leu Asn Leu Thr Gly Gin 205 ggc gcc gat act gtg cag Gly Ala Asp Thr Val Gin 220 225 cat ttg gat ggt ttt ggt His Leu Asp Gly Phe Giy 240 ttg ggc att acg aca gga Leu Giy Ile Thr Thr Gly 255 ccg cgg caa aag gcc gtt Pro Arg Gin Lys Aia Val 270 gtg ggc cga aac tat ctc Val Gly Arg Asn Tyr Leu 285 gat ttg gtg cag ggg acc Asp Leu Vai Gin Giy Thr 300 305 gcc cgg gtg atg tcg gag Ala Arg Val Met Ser Giu ctg Leu att Ile gt c Val att Ile 210 att Ile gaa Giu aaa Lys gag Giu gt g Val 290 atc Ile at g Met t cg Ser cct Pro 180 agc Ser act Thr atg Met at c Ile gt c Val1 260 gca Ala gct Ala gag Glu t cg Ser ct t Leu 165 gcg Al a tcg Ser tgg Trp gat Asp acc Thr 245 gt a Val cgc Arg gt t Val1 gcc Al a aag Lys 325 547 595 643 691 739 787 835 883 931 979 1027 1075 1113 gac ctt Asp Leu 330 taaggcttta ccggcgctgg gtg <210> 86 <211> 330 <212> PRT <213> Corynebacteriun glutamicun <400> 86. Leu Gly Ala Tyr Gly Leu Gly Glu Leu Pro Gly Lys Ser Ala Ala Glu 1 5 10 WO 01/66573 WO 0166573PCT/IBOO/02035 Ala Ala Asp Ile Ile Gin Gly Glu Thr Gly Asp Leu Leu His Ile Pro 25 Gin Leu Pro Ala Arg Gly Leu Gly Ala Asp Leu Ile Gly Arg Thr Val 40 Gly Leu Leu Asp Met Ile Asn Val Asp Arg Giy Ala Arg Ser Trp Val 55 Met Ser Thr Arq Pro Ser Arg Leu Thr His Leu Thr Gly Asp Phe Leu 70 75 Asp Met Asp Leu Asp Ala Cys Giu Glu Thr Trp, Gly Thr Gly Val Asp 90 Lys Leu Lys Ile Gin Val Ala Gly Pro Trp Thr Leu Gly Ala Arg Ile 100 105 110 Giu Leu Ala Asn Gly His'Arg Val Leu Ser Asp Arg Gly Ala Met Arg 115 120 125 Asp Leu Thr Gin Ala Leu Ile Ala Gly Ile Asp Ala His Ala Arg Lys 130 135 140 Val Ala Gly Arg Phe Arg Ala Giu Val Gin Val Gin Ile Asp Giu Pro 145 150 155 160 Glu Leu Lys Ser Leu Ile Asp Gly Ser Leu Pro Giy Thr Ser Thr Phe 165 170 175 Asp Ile Ile Pro Ala Val Asn Val Ala Asp Ala Ser Glu Arg Leu Gin 180 185 190 Gin Val Phe Ser Ser Ile Glu Gly Pro Thr Tyr Leu Asn Leu Thr Gly 195 200 205 Gin Ile Pro Thr Trp, Asp Val Ala Arg Gly Ala Gly Ala Asp Thr Val 210 215 220 Gin Ile Ser Met Asp Gin Val Arg Gly Asn Giu His Leu Asp Gly Phe 225 230 235 240 Gly Giu Thr Ile Thr Ser Gly Ile Arg Leu Gly Leu Gly Ile Thr Thr 245 250 255 Gly Lys Asp Vai Val Asp Giu Leu Leu Glu Arg Pro Arg Gin Lys Ala 260 265 270 Val Giu Vai Ala Arg Phe Phe Asp Arg Leu Gly Val Gly Arg Asn Tyr 275 280 285 Leu Val Asp Ala Val Asp Ile His Pro Gly Giu Asp Leu Val Gin Gly 290 295 300 Thr Ile Thr Giu Ala Ala Gin Ala Tyr Arg Met Ala Arg Val Met Ser 305 310 315 320 Giu Met Leu Ser Lys Asp Ser Cys Asp Leu 325 330 WO 01/66573 WO 0166573PCT/IB00102035 <210> 87 <211> 551 <212> DNA <213> Corynebacterium qiutamicum <220> <221> CDS <222> <223> RXA02197 <400> 87 gcc gaa Ala Giu I ttq tqc Leu Cys ggc caa Gly Gin att gct Ile Ala tac ttg Tyr Leu gag tac Glu Tyr qga tct Gly Ser ctg gat Leu Asp gat ctg Asp Leu 130 atc ggc Ile Gly 145 aca aac atg Met gcg Al a gac Asp ttc Phe gt t Val cac His gct. Al a 100 cgc Arg gac Asp gag Glu ttt cgc Arg gat Asp gtc Val gcC Al a cac His tcC Ser gat Asp ggc Gly cgc Arg tt g Leu gtg ttt Phe ttc Phe atg Met aac As n, Gly cga Arg ttt Phe gcc Ala gca Ala t cC Ser 150 ct c Thr Asp Ala Phe Val Leu Tyr 165 taacaccttt gagagggaaa act <210> 88 <211> 176 WO 01/66573 WO 0166573PCTIBOOIO2035 (212> PRT <213> Corynebacteriun giutamicun <400> 88 Ala Glu Arg Met Phe Ser Phe Pro 1 Leu G1 y Ile Tyr Giu Gly Leu Asp Ile 145 Thr Cys Gin Al a Leu Tyr Ser Asp Leu 130 Gly Asp Gin Gin Thr Asn Thr Lys Thr Tyr Leu 140 His Lys Arg Ala Met Glu Giu Leu Lys Gly 125 Glu Pro Tyr Gly Val Gly Tyr Ala Asn Phe 110 Ser Pro Glu Phe <210> 89 <211> 2599 <212> DNA <213> Corynebacteriun giutamicum <220> <221> CDS <222> (101)..(2599) <223> RXN02198 <400> 89 agactagtgg cgctttgcct gtgttgctta ggcggcgttg aaaatgaact acgaatgaaa agttcgggaa ttgtctaatc cgtactaagc tgtctacaca atg tct act tca gtt Met Ser Thr Ser Val 1 act tca cca gcc cac aac aac gca cat tcc tcc gaa ttt ttg gat gcg Thr Ser Pro Ala His Asn Asn Ala His Ser Ser Glu Phe Leu Asp Ala 15 ttg gca aac cat gtg ttg atc ggc gac ggc gcc atg ggc acc cag ctc Leu Ala Asn His Val Leu Ile Gly Asp Gly Ala Met Gly Thr Gin Leu WO 01/66573 WO 0166573PCTIBOOIO2035 caa ggc ttt Gin Gly Phe gao ctg gac gtg Asp Leu Asp Val aag gat ttc ott Lys Asp Phe Leu otg gag ggg Leu Glu Gly tgt aat gag att otc aac Cys Asn Giu Ile Leu Asn acc cgc cct gat Thr Arg Pro Asp ttg agg cag att Leu Arg Gin Ile cgc gcc tac ttt Arg Ala Tyr Phe gcg gga got gac ttg gtt gag acc aat Ala Gly Ala Asp Leu Val Glu Thr Asn ttt ggt tgo aac ctg ccg aao ttg gcg Phe Gly Cys Asn Leu Pro Asn Leu Ala tat gac ato gct Tyr Asp Ile Ala gat cgt Asp Arg 100 tgCc gt gag Cys Arg Glu goc tac aag ggc Ala Tyr Lys Gly gca gtg got agg gaa gtg got Ala Val Ala Arg Glu Val Ala 115 gat gag atg ggg ccg ggo oga aac: ggc atg cgg cgt ttc Asp Glu Met Gly Pro Gly Arg Asn Gly Met Arg Arg Phe 120 125 130 gtg gtt ggt Val Val Gly tcc otg Ser Leu 135 gga cot gga aog Gly Pro Gly Thr ctt cca tog ctg ggc cat gca cog tat Leu Pro Ser Leu Gly His Ala Pro Tyr gca gat ttg cgt ggg cac tao aag gaa. gca gcg ott ggc ato atc gac Ala Asp Leu Arg Gly His Tyr Lys Glu Ala Ala Leu Gly Ile Ile Asp 150 155 160 165 ggt ggt ggc gat gcc ttt ttg att gag Gly Gly Gly Asp Ala Phe Leu Ile Giu 170 gtc aacg got gog gtt oac ggc gtt oaa Val Lys Ala Ala Val His Gly Val Gin 185 .190 got cag gao ttg Ala Gin Asp Leu ott cag Leu Gin 180 gat goc atg got Asp Ala Met Ala gaa ott gat Glu Leu Asp 195 aco ggc aoo Thr Gly Thr aca tto ttg Thr Phe Leu 200 coo att att tgo Pro Ile Ile Cys gtc. aco gta gag Val Thr Val Glu 739 atg ctc atg ggt tot gag Met Leu Met Gly Ser Giu ggt gc gog ttg Gly Ala Ala Leu gog otg cag oca Ala Leu Gin Pro ggt ato gao atg Gly Ile Asp Met ggt otg aac tgc Giy Leu Asn Cys aoc ggc oca gat Thr Gly Pro Asp atg ago gag cac Met Ser Glu His cgt tao otg too Arg Tyr Leu Ser oac goo gat att His Ala Asp Ile cot gtg Pro Val 260 tog gtg atg Ser Val Met aac goa ggt ott Asn Ala Gly Leu gto otg ggt aaa Val Leu Gly Lys aao ggt goa Asn Gly Ala 275 WO 01/66573 WO 0166573PCTIIBOOIO2035 gaa Glu gte Val cct Pro 310 cag Gin gcc Ala t eg Ser ac Thr qat Asp 390 gca Al a gcc Ala cca Pro gag Giu Gly 470 cag Gin tao Tyr t cc S er 295 gag Giu gaa Glu t cc Ser gt g Val1 aac Asn 375 tgg Trp cac H-i s ga t Asp ate Ile cac His 455 ga t Asp ca c His eca Pro 280 gaa Glu cac His ac Thr cgo Arg cca Pro 360 tce Ser gaa Glu atg Met atg Met atg Met 440 ttg Leu gge Gly qgt Gly ct t Leu tat Tyr atc Ile tce Ser gag Glu 345 ttg Leu aac Asn aag Lys ctg Leu qcg Ala 425 att. Ile ggt Gly cct Pro gcg Al a gag got gag gat ttg gcg cag gog ctg qct. gga ttc Giu Ala Glu Asp Leu Ala Gin Ala Leu Ala Gly Phe gge Gly cgt Arg aca Thr 330 gtg Vai t cc Ser ggt Giy t gt, Cys gat Asp 410 ace Thr gac Asp gga Gly gag Glu gcc Aila 490 ctg Leu gcg Aia 315 ctg Leu gag Giu cag Gin t cc S er gtg Val 395 ctt Leu ttg Leu t cc Ser cga Arg tcC Ser 475 gtq Val tcC Ser 300 gtC Val a cc Thr a aa Lys gaa Giu aag Lys 380 gat Asp tgt Cys gca Ala acc Thr agc S er 460 cgc Arg qt t Val gtg Val gat Asp atc Ile gac Asp 350 ggC Gly ttc Phe gco Ala gat Asp ctt Leu 430 c ca Pro gtt Val cag Gin ctg Leu ggt Gly gcg Ala cct Pro 335 too Ser att Ile cgt Arg aag Lys tac Tyr 415 ctt Leu gag Glu aac Asn ego Arg a cc Thr 495 ggt Gly gt g Val 320 gca Ala gtc Val tcc Ser gag Glu cag Gin 400 gtg Val gct Ala gtt Val too Ser ate Ile 480 att Ile 290 tgt Cys ggt Gly cct Pr o tcg Ser at c Ile 370 at g Met acc Thr cga Arg ago Se r cgc Arg 450 aac As n aaa Lys gag Glu ggc ace Gly Thr gtt ooa Val Pro gtt gag Val Glu 340 ctg tao Leu Tyr 355 ggt gag Gly Glu ctg tot Leu Ser ego gat Arg Asp gac ggo Asp Giy 420 too act Ser Thr 435 aoa ggc Thr Gly ttt gaa Phe Glu ctg gta Leu Val gaa ggc Giu Gly 500 aca Thr gag Giu 325 cag Gin aco Thr ego Arg ggC Gly ggt Gly 405 ace Thr ttg Leu ott Leu gac Asp aag Lys 485 cag Gin 979 1027 1075 1123 1171 1219 1267 1315 1363 1411 1459 1507 1555 1603 1651 gca cgt acc get Ala Arg Thr Ala 505 gag cac aag gtg ego att got Glu His Lys Val Arg Ile Ala 510 aaa oga ctg att gac Lys Arg Leu Ile Asp 515 WO 01/66573 WO 0166573PCTJIBOO/02035 gat Asp tgC Cys ggC Gly 550 gaa Glu cct Pro gag Giu atg Met tat Tyr 630 ctg Leu cag Gin gac Asp gag Giu aag Lys 710 gtg Val ccg Pro ggC acc Thr 520 acc Thr gaa Giu cac His gca Al a ggt Gly 600 cgc Arg cgc Arg gag Glu gcc Al a gat Asp 680 tct Ser gt g Val1 caa Gin atg Met ggc ggc Gly tt c Phe acc Thr acc Thr cgc Arg 585 ctg Leu at t Ilie cgc Arg ggc Gly gct Al a 665 aag Lys cct Pro ggt Gi y tcg Ser gaa Glu 745 aaa agc Ser ccg Pro at c Ile acc Thr 570 cag Gin gac Asp gat Asp acc Thr gtt ValI 650 atg Met aat Asn att Ile gag Giu gca Al a 730 gag Glu at c tac Tyr atc Ile gaa Glu 555 ctg Leu gtt Val t ct Ser gat Asp gag Giu 635 t ct Ser cct Pro ggC Gly gcg Ala ctg Leu 715 gaa Glu ga Giu gt c gat Asp ggc Gly cgC Arg tcC Ser t ct Ser 590 gcg Ala cgc Arg gat Asp gat Asp gag Glu 670 gat Asp aac Asn t CC Ser aaa Lys gct Ala 750 acc atc Ile cag Gin gag Giu aat Asn 575 gtg Val cac His gaa Giu ccg Pro gcc Ala 655 cgt Arg gat Asp gag Glu qga Gly act Thr 735 acc Thr gt C at c Ile 530 acc Thr aag Lys ttc Phe aat Asn aag Lys 610 ttg Leu gas Glu gct Ala cag Gin gca Ala 690 ctc Leu cag Gin gcc Ala gcg Al a ga c gt t Val agg krg ct c Leu ggc Gly gag Giu 595 att Ile gat Asp ttc Phe cgc Arg cgc Arg 675 ggc Gly aac Asn ctg Leu tat Tyr cag Gin 755 gt g gtg Val cga Arg ta c Tyr ctg Leu 580 tgc Cys ttg Leu atg Met atg Met gct Ala 660 atc Ile atg Met ggC Gly cca Pro ttg Leu 740 gca Ala cac 1699 1747 1795 1843 1891 1939 1987 2035 2083 2131 2179 2227 2275 2323 2371 2419 WO 01/66573 WO 0166573PCT/LBOO/02035 Gly Lys Gly Lys Ile Val Val Ala Thr Val Lys Gly Asp Val His Asp (I760 765 770 atc ggo aag aac ttg gtg gao atc att ttg toc aac aac ggt tac gac 2467 Ile Giy Lys Asn Leu Val Asp Ile Ile Leu Ser Asn Asn Gly Tyr Asp 775 78078 gtg gtg aac ttg ggc ato aag cag cca ctg tcc gcc atg ttg gaa goa 2515 Val Val Asn Leu Gly Ile Lys Gin Pro Leu Ser Ala Met Leu Giu Ala 790 795 800 805 gog gaa gaa cac aaa gca gao gto ato ggo atg tog gga ott ott gtg 2563 Ala Giu Giu His Lys Ala Asp Vai Ile Gly Met Ser Gly Leu Leu Vai C1810 815 820 aag too aco gtg gtg atg aag caa acc ato ago gao 2599 IND Lys Ser Thr Val Val Met Lys Gin Thr Ile Ser Asp 825 830 <210> <211> 833 <212> PRT <213> Corynebacterium giutamioum <400> Met Ser Thr Ser Val Thr Ser Pro Ala His Asn Asn Ala His Ser Ser 1 5 10 Glu Phe Leu Asp Ala Leu Ala Asn His Val Leu Ile Gly Asp Gly Ala 25 Met Gly Thr Gin Leu Gin Gly Phe Asp Leu Asp Val Giu Lys Asp Phe 40 Leu Asp Leu Giu Gly Cys Asn Giu Ile Leu Asn Asp Thr Arg Pro Asp 55 Val Leu Arg Gin Ile His Arg Ala Tyr Phe Glu Ala Gly Ala Asp Leu 70 75 Val Giu Thr Asn Thr Phe Gly Cys Asn Leu Pro Asn Leu Ala Asp Tyr 90 Asp Ile Ala Asp Arg Cys Arg Giu Leu Ala Tyr Lys Gly Thr Ala Val 100 105 110 Ala Arg Giu Val Ala Asp Giu Met Gly Pro Gly Arg Asn Gly Met Arg 115 120 125 Arg Phe Val Val Gly Ser Leu Gly Pro Gly Thr Lys Leu Pro Ser Leu 130 135 140 Gly His Ala Pro Tyr Ala Asp Leu Arg Gly His Tyr Lys Glu Ala Ala 145 150 155 160 Leu Gly Ie Ile Asp Gly Gly Gly Asp Ala Phe Leu Ile Giu Thr Ala 165 170 175 Gln Asp Leu Leu Gin Val Lys Ala Ala Val His Gly Val Gin Asp Ala 180 185 190 WO 01/66573 WO 0166573PCT/IBOO/02035 Ala Thr 210 Al a Gly Asp Lys Leu 290 Cys Gly Pro Ser Ile 370 Met Thr Arg Ser Arg 450 Asn Lys Glu Giu 195 Thr Leu Pro Ile Asn 275 Ala Gly Val1 Val Leu 355 Gly Leu Arg Asp Ser 435 Thr Phe Leu Glu Leu Gly Gin Asp Pro 260 Gly Gly Thr Pro Giu 340 Tyr Giu Ser Asp Gly 420 Thr Gly Glu Val Gly 500 Leu 200 Met Ile Glu Met Pro 280 Glu His Thr Arg Pro 360 Ser Glu Met Met Met 440 Leu Gly Gly Thr Pro Gly Asp His Pro 265 Leu Tyr Ile S er Giu 345 Leu As n Lys Leu Ala 425 Ile Gly Pro Al a Al a 505 Ile Ser Met Leu 250 Asn Glu Giy Arq Thr 330 Val Ser Gly Cys Asp 410 Thr Asp Gly Glu Ala 490 Giu His 205 Gly Leu Leu Leu Asp 285 Met Arg Lys Glu Thr 365 Ala Ile Val Al a Giu 445 Ile Tyr Ala Val. Val Ala Asn Ser Pro 210 Leu Val Asp Ile Asp 350 Gly Phe Al a Asp Leu 430 Pro Val Gin Leu Arg 510 Thr Al a Cys Lys 255 Val Al a Gly Ala Pro 335 Ser Ile Arg Lys Tyr 415 Leu Glu Asn Arg Thr 495 Ile Val Leu Al a 240 His Leu Gin Gly Val1 320 Al a Vai Ser Glu Gin 400 Val Al a Val1 Ser Ile 480 Ile Al a WO 01/66573 WO 0166573PCT/IBOO/02035 Lys Asp 545 Lys Ser Leu Ser Ala 625 Gin Asp Al a Giu Leu 705 Met Val S er Gly Asn 785 Al a Ser Asp Arg Ile 530 Thr Lys Phe Asn Lys 610 Leu Giu Ala Gin Ala 690 Leu Gin Al a Ala Asp 770 Asn Met Gly Leu 515 Val Arg Leu Gly Giu 595 Ile Asp Phe Arg Arg 675 Gly Asn Leu Tyr Gin 755 Val Giy Leu Leu Asp Cys Gly 550 Glu Pro Glu Met Tyr 630 Leu Gin Asp Glu Lys 710 Val Pro Gly Ile Vai 790 Ala Lys Gly Phe Thr Thr Arg 585 Leu Ile Arg Gly Al a 665 Lys Pro Giy Ser Glu 745 Lys Asn Leu His Val 825 Ser Pro Ile Thr 570 Gin Asp Asp Thr Val 650 Met Asn Ile Glu Al a 730 Giu Ile Leu Giy Lys 810 Val Tyr Ile Glu 555 Leu Val1 Ser Asp Giu 635 Ser Pro Gly Al a Leu 715 Giu Glu Val Val Ile 795 Ala Met Gly Ser 540 Al a Gly Leu Ala Arg 620 Asp Ala Leu Leu Ile 700 Phe Thr Al a Val Asp 780 Lys Asp Lys Leu Asp 525 Thr Gly Ile Arg Leu Ser Asn Ser 590 Ile Ala 605 Gin Ary Tyr Asp Ala Asp Phe Giu 670 Glu Asp 685 Ile Asn Gly Ser Met Lys Giia Ala 750 Ala Thr 765 Ile Ile Gin Pro Vai Ile Gin Thr 830 Ile Gin Giu Asn 575 Val His Giu Pro Ala 655 Arg Asp Giu Gly Thr 735 Thr Val Leu Leu Giy 815 Ile Lys Glu Leu 560 Ile Phe Ser Val Leu 640 Lys Leu Leu Asp Gin 720 Al a Gly Lys Ser Ser 800 Met Ser WO 01/66573 WO 01/66573PCTJ IBOOI 02035 <210> 91 <211> 2578 <212> DNA <213> Corynebacterium glutamicum <2 <221> CDS <222> (101)..(2578) <223> FRXA02198 <400> 91 agactagtgg cgctttgcct gtgttgctta ggcggcgttg aaaatgaact acgaatgaaa aqttcgggaa ttgtctaatc cgtactaagc tgtctacaca atg tct act tca gtt Met Ser Thr Ser Val act Thr ttg Leu caa Gin tgt Cys cac His ttt Phe tgc Cys gat Asp tcc Ser gca Ala 150 t ca Ser gca Ala ggc- Gly aat Asn cgc Arg ggt Gly cgt Arg gag Glu ctg Leu 135 gat Asp cca Pro aac Asn ttt Phe gag Glu gcc Ala tgc Cys gag Glu atg Met 120 gga Gly ttg Leu cac His gtg Val Ct g Leu ct C Leu ttt Phe ct g Leu gcc Ala ccg Pro gga Gly ggg Gly gca cat Ala His ggc gac Gly .Asp gaa aag Glu Lys acc cgc Thr Arg gga gct Gly Ala ttg gcg Leu Ala ggc act Gly Thr 110 aac ggc Asn Gly 125 ctt cca Leu Pro aag gaa Lys Glu tcc Ser 15 ggC Gly gat Asp cct Pro gac Asp gat Asp 95 gca Ala atg Met t cg S er gca Ala act tcc Ser gcc Ala t tc Phe gat Asp ttg Leu 80 tat Tyr gtg Val cgg Arg ctg Leu gcg Ala 160 gct gat Asp 20 cag Gin gag Glu cag Gin aat Asn gat Asp 100 gtg Val gtt Val ccg Pro at c Ile ctt gcg Ala ct c Leu ggg Gly at t Ile act Thr cgt Arg gct Al a ggt Gly tat Tyr gac Asp 165 cag ggt ggt ggc gat gcc ttt ttg att gag WO 01/66573 WO 0166573PCTf[BOO/02035 Gly gt c Val aca Thr atg Met ctg Leu 230 atg Met tcg Ser gaa Giu gtc Val cct Pro 310 cag Gin gcc Ala t cg Ser a cc Thr gat Asp 390 Asp gcg Al a 185 ccc Pro ggt Gi y gac Asp cac His cct Pro 265 ctt Leu tat Tyr at c Ile tcc Ser gag Glu 345 ttg Leu aac Asn aag Lys Al a 170 gt t Val at t Ile t ct Ser at g Met ct g Leu 250 aa c Asn gag Giu Gly cgt Arg aca Thr ~33 0 gt g Val tcc Se r ggt Gly tgt Cys Phe cac His att Ile gag Glu att Ile 235 cgt Arg gca Ala gct Aia ct g Leu gcg Al a 315 ct g Leu gag Glu cag Gin tcc Ser gt g Val 395 Leu ggc Gly tgc Cys atc Ile 220 ggt Gly tac Tyr ggt GJ.y gag Glu tcc Ser 300 gt c Val1 acc Thr aaa Lys gaa Glu aag Lys 380 gat Asp Thr 175 gat Asp a cc Thr gog Ala t gc Cys aag Lys 255 gt c Val gcg Ala qgt Gly gcg Ala cct Pro '335 t cc Ser at t Ile cgt Arg aag Lys tac Tyr Ala gcc Ala gta Val ttg Leu gcc Ala 240 C ac His ctg Leu cag Gin ggt Gi y gt g Val 320 gca Al a gt c Val1 t cc Ser gag Glu cag Gin 400 Leu 180 ctt Leu ggC Gly cag Gin gat Asp cct Pro 260 ggt Gly gga Gly acc Thr cca Pro gag Glu 340 tac Tyr gag Glu tct Ser gat Asp Gin gat Asp acc Thr cca Pro gag Glu 245 gtg Val1 gca Ala ttc Phe aca Thr gag Glu 325 cag Gin acc Thr cgc Arg ggc Gly ggt Gly 405 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 1267 1315 1363 gca cac atg ctg gat ctt tgt gtg gat Ala His Met Leu Asp Leu Cys Val Asp gtg gga cga gac ggc acc Val Gly Arg Asp Gly Thr WO 01/66573 WO 0166573PCTI]BOO/02035 U 4) gcc gat atg gcg acc ttg gca gca ott ctt gct acc agc tcc act ttg Ala cca Pro gag Giu Gly 470 cag Gin gca Ala gat Asp tgc Cys ggo Gly 550 gaa Giu oct Pro gag Giu atg Met tat Tyr 630 Asp atc Ile cac His 455 gat Asp cac His cgt Arg at c Ile ctg Leu 535 att Ile atc Ile gct Al a got Ala aac As n 615 gat Asp Met atg Met 440 ttg Leu ggc Gly ggt Giy aco Thr acc Thr 520 a cc Thr gaa Giu cac His gca Ala ggt Giy 600 ogo Arg cgc Arg Ala 425 att Ile ggt Gly ct Pro gog Ala get Ala 505 ggC Gly ttC Phe a cc Thr acc Thr cgc Arg 585 otg Leu att Ile cgc Arg Leu Ala Ala Leu Leu 430 cca gag Pro Giu gtt aac Val Asn cag cgc Gin Arg ctq aco Leu Thr 495 cgc att Mrg Ile 510 gat atc Asp Ile ggc cag Gly Gin ogo gag Arg Giu too aat Sex Asn 575 tot gtg Sex Val 590 gog cac Ala His ogo gaa Arg Giu gat ccg Asp Pro gat gc Asp Ala 655 Ser 435 aca Thr ttt Phe ctg Leu ga a Giu ctg Leu 515 gt t Val agg Arg ot 0 Le u ggc Giy gag Giu 595 at t Ile gat Asp tt 0 Phe cgc Arg Thr ggc Gly gaa Giu gt a Val1 ggc Gly 500 att Ile gtg Val1 cga Ar g tac Tyr ot g Leu 580 tgo Cys ttg Leu atg Met atg Met- got Al a 660 Leu ctt Leu gao Asp aag Lys 485 cag Gin gac Asp gao Asp ga t Asp co a Pro 565 aac Asn att Ile cog Pro gt c Val1 cag Gin 645 gaa Giu '1411 1459 1507 1555 1603 1651 1699 1747 1795 1843 1891 1939 1987 2035 2083 ctg ttt gag ggc gtt Len Phe Giu Gly Val 650 tot got gc Ser Ala Ala WO 01/66573 WO 0166573PCT[IBOO/02035 cag ctg gcc gct atg cct ttg ttt gag cgt ttg gca cag cqc atc atc 2131 Gin Leu Ala Ala Met Pro Leu Phe Giu Arg Leu Ala Gin Arg Ile Ile 665 670 67 S gac ggc gat aag aat ggc ctt gag gat gat ctg gaa gca ggc atg aag 2179 Asp Gly Asp Lys Asn Gly Leu Giu Asp Asp Leu Glu Ala Gly Met Lys 680 685 690 gag aag tct cct att gog atc atc aac gag gac ctt cto aac ggo atg 2227 Giu Lys Ser Pro Ile Ala Ile Ile Asn Giu Asp Leu Leu Asn Gly Met 695 700 705 aag acc gtg ggt gag ctg ttt ggt tcc gga cag atg cag ctg cca ttc 2275 Lys Thr Val Giy Giu Leu Phe Gly Ser Gly Gin Met Gin Leu Pro Phe 710 715 720 725 gtg ctg caa tcg gca gaa acc atg aaa act gcg gtg gcc tat ttg gaa 2323 Val Leu Gin Ser Ala Glu Thr Met Lys Thr Ala Val Ala Tyr Leu Glu 730 735 740 ccg ttc atg gaa gag gaa gca gaa gct acc gga tct gcg cag gca gag 2371 Pro Phe Met Giu Glu Giu Ala Glu Ala Thr Gly Ser Ala Gin Ala Giu 745 750 755 ggc aag ggc aaa atc gtc gtg gcc acc gtc aag ggt gac gtg cac gat 2419 Gly Lys Gly Lys Ile Val Val Ala Thr Val Lys Gly Asp Val His Asp 760 765 770 atc ggc aag aac ttg gtg gac atc att ttg tcc aao aac ggt tac gac 2467 Ile Gly Lys Asn Leu Val Asp Ile Ile Leu Ser Asn Asn Gly Tyr Asp 775 780 785 gtg gtg aac ttg ggc atc aag cag cca ctg tcc gcc atg ttg gaa gca 2515 Val Val Asn Leu Gly Ile Lys Gin Pro Leu Ser Ala Met Leu Giu Ala 790 795 800 805 gcg gaa gaa cac aaa gca gac gtc atc ggc atg tcg gga ott ott gtg 2563 Ala Giu Giu His Lys Ala Asp Val Ile Gly Met Ser Gly Leu Leu Val 810 815 820 aag toc acc gtg gtg 2578 Lys Ser Thr Val Val 825 <210> 92 <211> 826 <212> PRT <213> Corynebacteriun giutamicum <400> 92 Met Ser Thr Ser Val Thr Ser Pro Ala His Asn Asn Ala His Ser Ser 1 5 10 Glu Phe Leu Asp Ala Leu Ala Asn His Val Leu Ile Gly Asp Giy Ala 25 Met Gly Thr Gin Leu Gin Gly Phe Asp Leu Asp Val Giu Lys Asp Phe 40 WO 01/66573 PCT/IB00/02035 O p Leu Asp Leu Glu Gly Cys Asn Glu Ile Leu Asn Asp Thr Arg Pro Asp 50 55 Val Leu Arg Gin lie His Arg Ala Tyr Phe Glu Ala Gly Ala Asp Leu 70 75 S Val Glu Thr Asn Thr Phe Gly Cys Asn Leu Pro Asn Leu Ala Asp Tyr 85 90 Asp Ile Ala Asp Arg Cys Arg Glu Leu Ala Tyr Lys Gly Thr Ala Val S. 100 105 110 -4 Ala Arg Glu Val Ala Asp Glu Met Gly Pro Gly Arg Asn Gly Met Arg CK1 115 120 125 Arg Phe Val Val Gly Ser Leu Gly Pro Gly Thr Lys Leu Pro Ser Leu I N 130 135 140 Gly His Ala Pro Tyr Ala Asp Leu Arg Gly His Tyr Lys Glu Ala Ala 145 150 155 160 Leu Gly Ile Ile Asp Gly Gly Gly Asp Ala Phe Leu Ile Glu Thr Ala 165 170 175 Gin Asp Leu Leu Gin Val Lys Ala Ala Val His Gly Val Gin Asp Ala 180 185 190 Met Ala Glu Leu Asp Thr Phe Leu Pro Ile Ile Cys His Val Thr Val 195 200 205 Glu Thr Thr Gly Thr Met Leu Met Gly Ser Glu Ile Gly Ala Ala Leu 210 215 220 Thr Ala Leu Gin Pro Leu Gly Ile Asp Met Ile Gly Leu Asn Cys Ala 225 230 235 240 Thr Gly Pro Asp Glu Met Ser Glu His Leu Arg Tyr Leu Ser Lys His 245 250 255 Ala Asp Ile Pro Val Ser Val Met Pro Asn Ala Gly Leu Pro Val Leu 260 265 270 Gly Lys Asn Gly Ala Glu Tyr Pro Leu Glu Ala Glu Asp Leu Ala Gin 275 280 285 Ala Leu Ala Gly Phe Val Ser Glu Tyr Gly Leu Ser Met Val Gly Gly 290 295 300 Cys Cys Gly Thr Thr Pro Glu His Ile Arg Ala Val Arg Asp Ala Val 305 310 315 320 Val Gly Val Pro Glu Gin Glu Thr Ser Thr Leu Thr Lys Ile Pro Ala 325 330 335 Gly Pro Val Glu Gin Ala Ser Arg Glu Val Glu Lys Glu Asp Ser Val 340 345 350 Ala Ser Leu Tyr Thr Ser Val Pro Leu Ser Gin Glu Thr Gly Ile Ser 355 360 365 Met Ile Gly Glu Arg Thr Asn Ser Asn Gly Ser Lys Ala Phe Arg Glu WO 01/66573 WO 0166573PCTIIBOO/02035 375 Trp His Asp Ile His 455 Asp His Arg Ile Leu 535 Ile Ile Al a Al a Asn- 615 Asp Phe Leu Gly Lys 695 380 Asp Cys Ala Thr Ser 460 Arg Val Lys Gly Ser 540 Ala Gly Leu Ala Arg 620 Asp Ala Leu Leu Ile 700 Ile Val Al a Giu 445 Ile Tyr Ala Val Leu 525 Thr Ile Leu Asn Ile 605 Gin Tyr Ala Phe Giu 685 Ile Al a Asp Leu 430 Pro Val Gin Leu Arg 510 Asp Gly Arg Ser Ser 590 Ala Arg Asp Asp Giu 670 Asp Asn Lys Tyr 415 Leu Giu Asn Arg Thr 495 Ile Ile Gin Giu Asn 575 Val His Glu Pro Ala 655 Arg Asp Giu WO 01/66573 WO 0166573PCTIBOOIO2035 U Leu 705 Met Val1 Ser Gly As n 785 Al a Ser Leu Gin Ala Ala Asp 770 Asn Met Gly Asn Leu Tyr Gln 755 Val1 Gly Leu Leu Gly Pro Leu 740 Al a His Tyr Glu Leu 820 Gly Thr 735 Thr Val Leu Leu Gly 815 <210> 93 <211> 621 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (101)..(598) <223> RXN03074 <400> 93 tttgtgggca atctggtttt ttcgtaattq tqtgggatga tagcaggaca agcatactgt tttagttcta tgctgtgggc eca Pro gcg Ala tt c Phe ct g Leu gat Asp atctcttaaa aattcacatt atg act caa agt qct 115 Met Thr Gin Ser Ala 1 atc atc ggc gac aac 163 Ile Ilie Gly Asp Asn gga ggt gcc aca gaa 211 Gly Gly Ala Thr Glu caa gac aac gcc ctc 259 Gin Asp Asn Ala Leu gga gtg ctg gtt atc 307 Gly Val Leu Val Ile ggc gac atc att gca 355 Gly Asp leIle Ala WO 01/66573 WO 0166573PCTI[BOO/02035 qga G.1y att Ile ct t Leu gac Asp gtc Val 150 cag Gin ctt gga aaa gat cat ggt t( Leu Gly Lys Asp His Gly Tj cga gac tcc gca gte atc g( Arg Asp Ser Ala Val Ile G' 105 gga ace aac ccg egg aaa t( Gly Thr Asn Pro Arg Lys S4 120 1 gta gtg gta tcg att ggt g( Val Val Val Ser Ile Gly G' 135 140 tac gcg gac tct gac gga al Tyr Ala Asp Ser Asp Gly 1' 155 taatttgttt tgacgacgca gta <210> 94 <211> 166 <212> PRT <213> Corynebacterium giutamicum <400> 94 Met Thr Gin Ser Ala Pro Glu Phe Ile I Ile Giy Gin GJ y Gly Ile Phe Gly Asp Thr Ala Val1 Ile Gly 100 Lys Glu Ala Asp Ile Leu Ser Asp Ala Pro Ser Ser Thr Thr Thr Ser Val His Vai Arg Ile Asp 130 135 Ile Pro Giy His Tyr Val Tyr Ala Asp WO 01/66573 WO 0166573PCT/IBOO/02035 145 150 Giu Ala Pro Ile Lys Gin 165 <210> <211> 62). <212:> DNA <213> Corynebacterium giutaiou <220> <221> CDS <222> (598)1 <223> FRXA02906 <400> tttgtgggca atotggtttt ttcgtaattg tgtgggatga tagoaggaca agoataotgt tttagttcta tgctgtgggc 160 atctcttaaa aattcacatt cca Pro gog Ala ttc Phe ct g Leu gat Asp gga Gly att Ile ct t Leu gac Asp gt o Val gaa Giu caa Gin cac His aaa Lys ggc Gly ct t Leu cga Arg qga Gly gt a Vai 135 tac Tyr gac Asp ttt Phe gt g Val gat Asp cc Thr tgg Trp ggC Gly tc Ser 125 ggc Gly at t Ile ct c Leu caa Gin asa Lys at Asn gcg Ala too Ser acc Thr 110 act Thr att Ile at c Ile at g Met I at o Ile gga Gly ca a Gin gga Gly ggc Gly att Ile ttt Phe ggt Gly att Ile 145 ggo Gly gcc Ala as o Asn ct g Leu at o Ile aac Asn tgt Cys 115 ggC Gly ggt Gly gao Asp aca Thr gcc Ala gtt Val att Ile gga Gly 100 aa a Lys gas Giu cat His act osa agt Thr Gin Ser got Ala sac As n gaa Giu cto Leu stc Ile gca Aila gca Ala gc Ala oga Arg tao Tyr 115 163 211 259 307 355 403 451 499 547 595 aco gag gog oca att sag Thr Giu Ala Pro Ile Lys WO 01/66573 WO 0166573PCT/EBOO/02035 150 155 cag taatttgttt tgacgacgca gta Gin <210> 96 <211> 166 <212> PP.T <213> Corynebacterium giutamicun <400> 96 Met Thr Gin Ser Ala Pro Glu Phe Ile 1 Ile Gly Gin Gly Giy Ile Phe Giy Ile 145 Glu 5 Asn Giu Leu Ile Al a Ala Al a Arg Tyr Lys 165 Al a Asp Ile Leu Ser Asp Ala Pro Ser S er Thr Thr Thr Ser Val .75 His Val Arg Ile Asp 155 Al a Gin Thr Giu His Gly Ile Lys Gly 140 Gly Asp Leu Phe Giy Vai Val Thr Thr Phe Thr 160 <210> 97 <211> 1557 <212> DNA <213> Corynebacterium giutamicun <220> <221> CDS <222> (1534) <223> RXN00132 <400> 97 aacagcttca atcaattcgg tgtccactcc aacatgtaga gtggtgcgcg ttaaaaaagt tttcctaatt ttcattttct taaaaggagc tcgccaggac atg gca cag gtt atg 115 WO 01/66573 WO 01/66573PCTA BOOt 02035 tca Ser atg Met ttg Leu gcc Ala gct Ala gtt Val 9C9 Ala ato Ile 125 ggt Gly ggt Gly ttc Phe ggc Gly ggt Gly 205 cca Pro aag Lys cta Leu cca Pro aag Lys gtq Val1 tcc Ser gtc Val t gg Trp 110 ttc Phe gac Asp ctg Leu t tg Leu aag Lys 190 gtg Val gcg Al a tac Tyr gca Al a ggt Gly ggc Gly ctt Leu tgc Cys ggc Gly aag Lys agc Ser gcc Al a gtt Val ggc Gly 175 at c Ile ca a His atg Met ggc Gly Gin cgt Arg ttg Le u gct Al a ct C Leu tcc Ser gt C Val ctg Leu 115 gag Glu gtt Va 1 gag Glu gag Glu gtt Val1 195 ca c His ga a Asp Ser 163 211 259 307 355 403 451 499 547 595 643 691 739 787 835 WO 01/66573 PCT/IBOO/02035 230 gac Asp ctt Leu gac Asp gct Ala 9CC Ala 310 atc Ile ggc Gly cac His ttc Phe ctg Leu 390 aac Asn gaa Glu gaa Glu gaa Glu atg Met ggc Gly 270 gtc Val tac Tyr atc Ile aag Lys gag Glu 350 acg Thr atc Ile gga Gly gcg Ala tac Tyr 430 gag Glu tac Tyr ggc Gly gct Ala gac Asp 290 acc Thr gga Gly cac His cat His cag Gin 370 tcc Ser ttt Phe ctg Leu aaq Lys ggt Gly 450 gac aac Asn 260 gct Ala atc Ile gat Asp aag Lys ctg Leu 340 atg Leu gac Asp ggt Gly atg Met caa Gin 420 atc Leu atc Leu gca 883 931 979 1027 1075 1123 1171 1219 1267 1315 1363 1411 1459 1507 Ile Gly Val Asp Val Ala Gly 465 taatgattgt aagcattgag gga ttc aag ccg gag Phe Lys Pro Glu tac cga tac Tyr Arg Tyr 1557 WO 01/66573 WO 0166573PCT/IBOO/02035 <210> 98 <211> 478 <212> PRT <213> Corynebacterium glutamicum <400> 98 Met Ala Gin Val Met Asp Phe Lys Val I Ala Met Arg Giu Ile Gly Giu Gly Met 145 Pro Leu Glu Leu Val 225 Arg Gi y Cys Arg His Leu Arg Ala Gly Leu Thr Ser Thr Val Giu 100 Leu Giu 115 Giu Leu Val Ile Giu Ala Giu Vai 180 Val Lys 195 His Phe Asp Ala Ser Leu Lys Asn 260 Giu Ala 275' Leu Ala Ala Asp Met Thr Ala Giu Ala Ala Gly Val 105 Trp Cys 120 Ile Leu Giu Tyr Asp Giu Gin Pro 185 Gin Giu 200 Gly Val Ser Lys Ile Asn Cys.Gly 265 Gin Gly 280 WO 01/66573 PCT/IB00/02035 O O I Ala Asp Pro Ile Asn Ala Leu Gin Ala Leu Met Asp Gly Tyr Ser Val S290 295 300 Val Thr Val Asp Glu Ala Ile Glu Asp Ala Asp Ile Val Ile Thr Ala 305 310 315 320 Thr Gly Asn Lys Asp Ile Ile Ser Phe Glu Gin Met Leu Lys Met Lys 325 330 335 Asp His Ala Leu Leu Gly Asn Ile Gly His Phe Asp Asn Glu Ile Asp 340 345 350 C Met His Ser Leu Leu His Arg Asp Asp Val Thr Arg Thr Thr Ile Lys l 355 360 365 C\ S Pro Gin Val Asp Glu Phe Thr Phe Ser Thr Gly Arg Ser Ile Ile Val S370 375 380 Leu Ser Glu Gly Arg Leu Leu Asn Leu Gly Asn Ala Thr Gly His Pro 385 390 395 400 Ser Phe Val Met Ser Asn Ser Phe Ala Asp Gin Thr Ile Ala Gin Ile 405 410 415 Glu Leu Phe Gin Asn Glu Gly Gin Tyr Glu Asn Glu Val Tyr Arg Leu 420 425 430 Pro Lys Val Leu Asp Glu Lys Val Ala Arg Ile His Val Glu Ala Leu 435 440 445 Gly Gly Gin Leu Thr Glu Leu Thr Lys Glu Gin Ala Glu Tyr Ile Gly 450 455 460 Val Asp Val Ala Gly Pro Phe Lys Pro Glu His Tyr Arg Tyr 465 470 475 <210> 99 <211> 128 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> <223> FRXA00132 <400> 99 cac gtt gag gct ctc ggc ggt cag ctc acc gaa ctg acc aag gag cag 48 His Val Glu Ala Leu Gly Gly Gin Leu Thr Glu Leu Thr Lys Glu Gin 1 5 10 gct gag tac atc ggc gtt gac gtt gca ggc cca ttc aag ccg gag cac 96 Ala Glu Tyr Ile Gly Val Asp Val Ala Gly Pro Phe Lys Pro Glu His 25 tac cgc tac taatgattgt cagcattgag gga 128 Tyr Arg Tyr WO 01/66573 WO 0166573PCT/IBOOIO 2035 <210> 100 <211> <212> PRT <213> Corynebacterium glutanilcum <400> 100 His Val GJlu Ala Leu Gly Gly Gin Leu Thr Glu Leu Thr Lys Glu Gin 1 5 10 Ala Glu Tyr Ile Gly Val Asp Val Ala Gly Pro Phe Lys Pro Glu His 25 Tyr Arg Tyr <210> 101 <211> 1396 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (1396) <223> FRXA01371 <400> 101 aaoagcttca atcaattcgg tgtocactcc aaoatgtaga gtgc tttcctaatt ttcattttct taaaaggagc tcgccaggac atg Itgogog ttaaaaaagt gca. Met Ala gac Asp at t Ie gaa Glu atc Ile ttg Leu gat Asp aag Lys ott Leu gca Al a atg Met got Al a got Ala gtt Val goa Al a gao Asp acg Thr gag Glu goa Al a goo Al a gag Glu gag Glu gt 0 Val1 gt t Val gog Ala ott Leu gag Glu oct Pro aoo Thr t gg Trp at c Ile 1 goa Ala at g Met oga Arg gag Glu att I le ggo Gly gga Gly cag Gln att Ile aoo Thr tto Phe a oo Thr oag gtt atg Gln Val Met. cgt oao oag Arg His Gln ttg cgc aag Leu Arg Lys got ggt tot Ala Gly Ser oto aot got Leu Thr Ala too aoc cag Ser Thr Gln gto gaa gag Val Glu Glu 100 115 163 211 259 307 355 403 ooa got ggt Pro Ala Gly gtt oca gta Val Pro Val 105 tto gog tgg aag ggt gag Phe Ala Trp Lys Gly Glu 110 toa otg gag gag Ser Leu Glu Glu 115 WO 01/66573 WO 0166573PCTA~BOO/02035 tao Tyr aac Asn ggt Gly 150 gat Asp gct Al a gt c Val gaa Giu acc Thr 230 ga c Asp ct t Leu ga c Asp gct Al a gc c Ala 310 at o Ile t gg Trp atg Met 135 ogo Arg t CC Ser gca Ala aco Thr gaa Giu 215 aag Lys ggc Giy gt o Val ggo Gly ct t Leu 295 at c Ile att Ile tgg T rp 120 at c Ile gaa Glu gat Asp gag Giu gag Glu 200 ggc Gly too Ser at c Ile t gc Cys cag Gin 280 cag Gin gag Glu too Ser tgC Cys Ct c Leu tao Tyr gag Giu cct Pro 185 gaa Glu gtg Val aag Lys aac As n ggt Gly 265 ggC Gly gct Al a gac Asp ttC Phe atc aao cag ato ttc ago tgg Ile Asn Gin Ile Phe Ser Trp 125 gao Asp gag Giu tao Tyr 170 Gly a 00 Thr ot g Leu ttt Phe ogo Arg 250 tao Tyr got Ala otg Leu gc Ala gag Glu 330 gao. Asp oag Gin 155 ato Ile aag Lys a no Thr oot Pro gat Asp 235 gc Ala ggo Gi y ogo Arg atg Met gac Asp 315 oag Gin ggo Gly 140 got Ala gca Ala t gg Trp a cc Thr tto Phe 220 aao Asn acot Thr gat Asp gto Val gat Asp 300 at c Ile atg Met gac Asp ot g Leu ttg Leu aag Lys 190 gtg Val gog Ala tao Tyr atg Met ggc Gly 270 gtc Val tao Tyr ato Ile aag Lys gco Ala gtt Vai ggo Gi y 175 atc Ile oa o His atg Met ggC Gly oto Leu 255 aag Lys a cc Thr tot S er acc Thr atg Met 335 aco Thx ooa Pro 160 atg Met got Al a ogo Arg aac Asn aoo Thr 240 atg Met ggc GSly gaa Giu gtg Val gog Ala 320 aag Lys ggo Gly atg Met 145 ooa Pro otg Leu gag Glu ot g Leu gt o Val1 225 ogo Arg ggo Gly tgo Cys got Ala gto Val 305 a co Thr gat Asp gat gag ctg oca Asp Giu Leu Pro 130 got Al a goa Al a ogt Arg goo Al a tao Tyr 210 aao Asn cac His ggo Gly got Ala gao Asp 290 acc Thr ggo Gly cac His gtt Val gag Giu gag Glu gt t Val 195 oao His gao Asp too Ser aag Lys gag Glu 275 ooa Pro gt t Val aa c Asn gct Ala att Ile goo Al a gtt Vai 180 aag Lys tto Phe got Al a Ct g Leu aao Asn 260 got Ala at c Ile gat Asp aag Lys otg Leu 340 ogo Arg aac As n 165 ott Leu ggt Gly got Ala gt o Val at o Ile 245 gt g Val tto Phe aao Asn gag Giu gao Asp 325 otg Leu 547 595 643 691 739 7B7 835 883 931 979 1027 1075 1123 1171 ggo aac ato ggt oao ttt gat aat Gly Asn Ile Gly 345 His Phe Asp Asn gag ato gat atg Giu Ile Asp Met 350 oat too ctg ttg His Ser Leu Leu 355 WO 01/66573 WO 0166573PCTIBOO/02035 cac cgc gao gao gtc aoo ogc aoo acg atc aag coa cag gto gao gag 1219 His Arg Asp Asp Val Thr Arg Thr Thr Ile Lys Pro Gin Val Asp Giu 360 365 370 ttc aoc ttc tco aco ggt ogc tco atc atc gtc ctg too gaa ggt cgc 1267 Phe Thr Phe Ser Thr Gly Arg Ser Ile Ile Val Leu Ser Giu Gly Arg 375 380 385 ctg ttg aac ott ggc aao goc aco gga cac cca tca ttt gtc atg too 1315 Leu Leu Asn Leu Gly Asri Ala Thr Gly His Pro Ser Phe Val Met Ser 390 395 400 405 aac tot tto gcc gat cag aco att gcg cag atc gaa ctg ttc caa aao 1363 Asn Ser Phe Ala Asp Gin Thr Ile Ala Gin Ile Giu Leu Phe Gin Asn 410 415 420 ID gaa gga oag tao gag aao gag gto tao ogt ctg 1396 Glu Gly Gin Tyr Giu Asn Glu Val Tyr Arg Leu 425 430 <210> 102 <211> 432 <212> PRT <213> Corynebacteriun giutaxnioum <400> 102 Met Ala Gin Vai Met Asp Phe Lys Val Ala Asp Leu Ser Leu Ala Giu 1 5 10 Ala Gly Arg His Gin Ile Arg Leu Ala Giu Tyr Giu Met Pro Gly L~eu 25 Met Gin Leu Arg Lys Glu Phe Ala Asp Glu Gin Pro Leu Lys Giy Ala 40 Arg Ile Ala Gly Ser Ile His Met Thr Val Gin Thr Ala Val Leu Ile 55 Giu Thr Leu Thr Ala Leu Gly Ala Glu Vai Arg Trp Ala Ser Cys Asn 70 75 Ile Phe Ser Thr Gin Asp Giu Ala Ala Ala Ala Ile Val Vai Giy Ser 90 Giy Thr Val Giu Glu Pro Ala Gly Val Pro Val Phe Ala Trp Lys Gly 100 105 110 Giu Ser Leu Giu Glu Tyr Trp Trp Cys Ile Asn Gin Ile Phe Ser Trp 115 120 125 Gly Asp Glu Leu Pro Asn Met Ile Leu Asp Asp Gly Gly Asp Ala Thr 130 135 140 Met Ala Vai Ile Arg Gly Arg Glu Tyr Giu Gin Ala Gly Leu Val Pro 145 150 155 160 Pro Ala Glu Ala Asn Asp Ser Asp Glu Tyr Ile Ala Phe Leu Gly Met 165 170 175 Leu Arg Glu Val Leu Ala Ala Giu Pro Gly Lys Trp Gly Lys Ile Ala WO 01/66573 WO 0166573PCTIiBOO/02035 190 Val Al a Tyr Met Gly 270 Val3 Tyr Ile Lys Glu 350 Thr Ile Gly Al a Tyr 430 <210> 103 <211> 2358 <212> DNA <213> Corynebacterium glutamicun <220> <221> COS <222> (101)..(2335) <223> RXN02085 <400> 103 cacccggtga tttcgcgaac cttgaaacat cgtcagaaga ttgccgtgcg tcctagccgg WO 01/66573 WO 0166573PCT/iBOOIO2035 gatccgcacg ttcggctcaa gcagaaagtc tttaactcac tct Ser aag Lys ctt Le u t ct Ser atg Met gao Asp tac Tyr acc Thr gcg Al a cgt Arg 150 cca Pro ttg Leu t ct Ser gat Asp ttg tcc Ser tt C Phe gcg Al a gga Gly ct c Leu at c Ile ttt Phe aag Lys gat Asp 135 tgc Cys ctg Leu gat Asp ttc Phe gt t Val 215 gct act Thr gog Ala cag Gin ttg Leu gat Asp gct Ala ggo Gly tgg Trp 120 aca Thr cag Gin act Thr cac His ga t Asp 200 gct Al a aag gtC gct. Val Ala ctc gaa Leu Glu aco gcc Thr Ala gat tco Asp Ser acc gcc Thr Ala gat cat Asp His gct gct, Ala Ala 105 ttt gat Phe Asp cgt ttc Arg Phe cag gtt Gin Val ttc ctt. Phe Leu 170 ctg cct Leu Pro 185 act gag Thr Glu oct gag Pro Glu ogo gat ggt ctt Gly Leu ggc tac Gly Tyr cgc caa Arg Gin gtt ccg Val Pro 60 got att Ala Ile 75 gaa aac Glu Asn cgo ggt Arg Gly aco aac Thr Asn gtt ttg Val Leu 140 cgt ggc Arg Gly 155 tcc ctt Ser Leu goa ctg Ala Leu tgg gtt Trp Val gtt ttg Val Leu 220 ggc gtg oct Pro t gg Trp ttg Leu 45 ttt Phe ttg Leu gat Asp act Thr t ac Tyr 125 gat Asp gtt Val got Ala t tt Phe cag Gin 205 gag Glu ttt cgc Arg aat Asn 30 gt c Val gca Ala ggt Gly ggt Giy gag Glu 110 cac His gcg Ala aat Asn cgc Arg gag Giu 190 atc Ile cag Gin gt c at c Ile 15 gga Gly aac Asn gga Gly gt g Val ct c Leu 95 acc Thr tac Tyr t cc Ser gc Al a acc Thr 175 gto Val gat Asp gtc Val aat gga Gly tca Ser act Thr cgt Arg otg Leu 80 cca Pro ctg Leu ct c Leu gcg Al a cgc Arg 160 act Thr ta c Tyr gag Glu cgc Arg act atg act Met Thr gog aag Ala Lys att gaa Ile Giu gca tcg Ala Ser tcc tac Ser Tyr oog gag Pro Giu otg tgg Leu Trp oct gca Pro Ala gtg ccg Val Pro 130 ctg att Leu Ile 145 oct gtt Pro Val gat ggt Asp Gly gag cgc Glu Arg oct gcg Pro Ala 210 got ggt Ala Gly 225 tao ttc cgt Arg ggt Gly gat Asp tao Tyr Cgt Arg att Ile cag Gin 115 gag Giu gag Giu ctg Leu too Ser ot 0 Leu 195 tt g Leu tao Tyr ggo gaa Gi u ogo Ar g tot Ser gao Asp ttt Phe gao Asp 100 goa Ala t tq Leu gat Asp gtt Val aat As n 180 ato le gto Val aco Thr tct ot g LeuJ gaa Giu ttg Leu gca Al a gat Asp ogo Arg atg Met tot Ser ot 0 Leu ggt Gly 165 ct Pro aag Lys aco Thr act Thr ggo 163 211 259 307 355 403 451 499 547 595 643 691 739 787 835 too aac ttt Ser Asn Phe WO 01/66573 WO 0166573PCTIBOO/02035 Arg ct g Leu gt c Val 265 ctg Leu t gt Cys gca Ala gct Ala gag Giu 345 at c Ile cgc Arg agc Ser gag Glu ca Pro 425 ttg, Leu gcc Al a Asp aac Asn 250 acc Thr gtt Val gct Ala gtg Val gag Glu 330 aag Lys gac Asp a cc Thr cgt Arg ctt Leu 410 t cc Ser gag Giu aag Lys Gly 235 act Thr cat His gog Al a got Ala t ct Ser 315 aac Asn atc Ile gcg Ala t cc Ser gga Gi y 395 oca Pro att Ile cag Gin cag Gln Val ctt Leu ggo Gly ggC Gly ott Leu 300 acc Thr att Ile acc Thr gct Al a cos Pro 380 toc Ser got Al a cgt Arg tac Tyr gaa Glu 460 Thr 240 ggc Gly ctt Leu ggt Gly aag Lys ot g Leu 320 gtc Val ctg Leu gcg Ala oca Pro cgt Arg 400 ace Thr gCt Al a atg Met ctt Leu tao Tyr Tyr ctt Leu gct Ala cgt Arg ogo Arg 305 ctg Leu cgc Arg ctt Leu gog Ala atc Ile 385 gtt Val. a cc* Thr cgt Arg. ego Arg gat Asp 465 ttc Phe Phe ggc Gly gcg Ala aae Asn 290 ctg Leu cac His gao Asp gc Ala too Ser 370 acg Thr a og Thr att Ile ctg Leu gaa Glu 450 gtg Val tot S er Ser att Ile 260 aag Lys tgg Trp got Al a ct Pro ott Leu 340 gc Al a goa Al a gaa Glu cag Gin tot Ser 420 aag Lys ato Ile gtt Val ctt Leu Gly 245 ggo Gly ggt Gly cgc Arg ogo Arg tao Tyr 325 gc Ala ot a Leu att Ile ct C Leu gag Gi u 405 tt 0 Phe ga GNu gat Asp cac His cto Leu 883 931 979 1027 1075 1123 1171 1219 1267 1315 1363 1411 1459 1507 1555 ggt gag oca gag Gly Glu Pro Giu ogo aac gao atg gtt cag Arg Asn Asp Met Val Gin WO 01/66573 WO 0166573PCT/IBOO/02035 470 gac Asp cgc Arg cca Pro cat His ttc Phe 550 ct g Leu at a Ile gac Asp ctg Leu tgc Cys 630 gcc Al a gat Al a tgg Trp at c Leu aa c Asn 710 ggt Gly tgt Cys atg Met gt a Val 535 gt t Val gca Al a at c Ile gt a Val 9cg Al a 615 tac Tyr gat Asp gct Ala gat Asp ctc Leu 695 cca Pro ct C Leu cgt Arg 505 gt a Val1 gga Gly gat Asp cgc Arg gt g Val 585 aag Lys gc Al a gag Glu a cc Thr aaa Lys 665 ca c His gat Ala tgt Cys t ca Ser 490 act Pro aag Lys atg Met gat Asp gat Asp 570 gat Asp act Pro 9qc Gly ttc Phe acc Thr 650 tat Ser tcc Ser ga Al a ggt Gly 475 aca Thr cca Pro tgg Trp at a Leu cag Gin 555 gaa Glu gag Glu cc Al a gca Al a aaa Asn 635 at a Ile tac Ser ccg Pro at g Leu ctg Leu 715 gc Ala gtg Val ttc Phe a cc Thr 540 cag Pro att Ile C at Pro tac Tyr ccc Pro 620 gaa Giu gaa Giu Gly aga Arg cag Gin aag Lys aac Asn ttg Leu cag Gin 525 ggt Giy at g Leu aaa Asn gag Al a at g Leu 605 ga a Asp gtg Val1 gca Al a tt a Phe gtt Vai 685 tac Ser aca Thr ggC Gly t ta Phe 510 tac Tyr ca Pro gat Ala gat Asp att Ile 590 cag Gin gac Asp at c Ile gca Ala gag Glu 670 act Pro gt g Val cgt Arg 480 gta Val aaa Asn cag Gin aca Thr act Thr 560 ata Ile gaa Giu tcc Ser caa Gin tag Ser 640 tca Ser gga Gi y gag Ala cat Pro tgg Trp 720 ca a Gin gtt Val aga Ser ata Ile 545 gat Ala gag Giu ctg Leu gtg Val ata Ile 625 gtc Val gac Asp gtc Val cag Gin aga Arg 705 cca Pro aga Ser tac Ser at g Leu 530 at t Leu gac Asp gat Al a ttg Leu gac Asp 610 cac His ata Ile atg Met gga Giy aaa Lys 690 aag Gin ga a Glu taa Tyr aga Arg 515 aca Thr gca Al a ca g Gin Gly cag Pro 595 tac Ser aca Thr gag Ala cag Gin cat Pro 675 gtg Val atg Leu gtg Val gga Gly 500 aca Pro cag Gin tgg Trp gtt Val gag Al a 580 ct a Leu tt a Phe ca a His ttg Leu gt a Val 660 ggt Gly gac Asp t gg Trp ga Glu 485 t cc Ser gag Ala aag Lys t cc Ser ga Al a 565 aag Lys aga Arg aga Arg at g Met gat Asp 645 at a Leu gtg Val ggt Gly gtc Val gat Ala 725 1603 1651 1699 1747 1795 1843 1891 1939 1987 2035 2083 2131 2179 2227 2275 WO 01/66573 WO 0166573PCT/IBOO/02035 U tcc cta aag gtt ctc gtt gag tcc gct aag cag gct cgt gag aaa atc 2323 Ser Leu Lys Val Leu Val Giu Ser Ala Lys Gin Ala Arg Glu Lys Ile 730 735 740 gga gca act atc taaattgggt taccgctagg aac 2358 Gly Ala Thr Ile 745 <210> 104 <211> 745 <212> PRT <213> Corynebacteriun glutaniicum <400> 104 Met Thr Ser Asn Phe Ser Ser Thr Val 1 Ala Ile Al a Ser Pro Leu Pro Val Leu 145 Pro Asp Giu Pro Al a 225 Phe Ala Gly Leu Ile Phe Lys Asp 135 Cys Leu Asp Phe Val 215 Leu Thr Asp Thr Asp Ala 105 ?he Arg Gin Phe Leu 185 Thr Pro Al a Giu Al a Ser Ala His Ala Asp Phe Val Leu 170 Pro Giu Glu Gly Leu Gly Tyr Arg Gin Val Pro Ala Ile 75 Giu Asn Arg Gly Thr Asn Val Leu 140 Arg Gly 155 Ser Leu Ala Leu Trp Val Val Leu 220 Pro Trp Leu Phe Leu Asp Thr Tyr 125 Asp Val Al a Phe Gin 205 Glu Arg Asn Val Al a Gly Gly Giu 110 His Ala Asn Arg Giu 190 Ile Gin Ile Gly Asn Gly Val1 Leu Thr Tyr Ser Al a Thr 175 Val1 Asp Val Gly Ser Thr Arg Leu Pro Leu Leu Al a Arg 160 Thr Tyr Glu Arg Gly Tyr Thr Thr Leu Ala Lys Arg Asp Gly Val Phe Vai Asn Thr WO 01/66573 WO 0166573PCTIIBOO/02035 Tyr Phe Gly Ser Gly Asp Gin Ala Leu Asn Thr Leu Ala Gly Ile Gly 245 250 255 Leu Gly Ala Ile Gly Val Asp Leu Val Thr His Gly Val Thr Giu Leu 260 265 270 Ala Ala Trp Lys Gly Giu Giu Leu Leu Val Ala Gly Ile Val Asp Gly 275 280 285 Arg Asn Ile Trp Arg Thr Asp Leu Cys Ala Ala Leu Ala Ser Leu Lys 290 295 300 Arg Leu Ala Ala Arg Gly Pro Ile Ala Val Ser Thr Sex Cys Ser Leu C1 305 310 315 320 Leu His Val Pro Tyr Thr Leu Giu Ala Giu Asn Ile Giu Pro Giu Vai 325 330 335 Arg Asp Trp Leu Ala Phe Gly Ser Giu Lys Ile Thr Glu Val Lys Leu 340 345 350 Leu Ala Asp Ala Leu Ala Gly Asn Ile Asp Ala Ala Ala Phe Asp Ala 355 360 365 Ala Ser Ala Ala Ile Ala Ser Arg Arg Thr Ser Pro Arg Thr Ala Pro 370 375 380 Ile Thr Gin Giu Leu Pro Gly Arg Ser Arg Giy Ser Phe Asp Thr Arg 385 390 395 400 Val Thr Leu Gin Giu Lys Sex Leu Glu Leu Pro Ala Leu Pro Thr Thr 405 410 415 Thr Ile Gly Sex Phe Pro Gin Thr Pro Ser Ile Arg Ser Ala Arg Ala 420 425 430 Arg Leu Arg Lys Giu Ser Ile Ti-r Leu Giu Gin Tyr Giu Giu Ala Met 435 440 445 Arg Glu Glu Ile Asp Leu Val Ile Ala Lys Gin Giu Giu Leu Gly Leu 450 455 460 Asp Vai Leu Val His Gly Glu Pro Giu Arg Asn Asp Met Val Gin Tyr 465 470 475 480 Phe Sex Giu Leu Leu Asp Gly Phe Leu Ser Thr Ala Asn Gly Trp Vai 485 490 495 Gin Ser Tyr Gly Ser Arg Cys Val Arg Pro Pro Val Leu Phe Gly Asn 500 505 510 Val Ser Arg Pro Ala Pro Met Thr Vai Lys Trp Phe Gin Tyr Ala Gin 515 520 525 Sex Leu Thr Gin Lys His Val Lys Gly Met Leu Thr Gly Pro Val Thr 530 535 540 Ile Leu Ala Trp Sex Phe Val Arg Asp Asp Gin Pro Leu Ala Thr Thr 545 550 555 560 Ala Asp Gin Val Ala Leu Ala Leu Arg Asp Glu Ile Asn Asp Leu Ile WO 01/66573 PCT/IBOO/02035 565 570 575 Giu Ala Gly Ala Lys Ile Ile Gin Val Asp Giu Pro Ala Ile Arg GJlu 580 585 590 S Leu Leu Pro Leu Arg Asp Val Asp Lys Pro Ala Tyr Leu Gin Trp Ser 595 600 605 Val Asp Ser Phe Arg Leu Ala Thr Ala Gly Ala Pro Asp Asp Vai Gin 610 615 620 Ile His Thr His Met Cys Tyr Ser Glu Phe Asn Giu Val Ile Ser Ser 625 630 635 640 Val Ile Aia Leu Asp Ala Asp Val Thr Thr Ile Giu Ala Ala Arg Ser 645 650 655 Asp Met Gin Vai Leu Ala Ala Leu Lys Ser Ser Gly Phe Giu Leu Giy 660 665 670 Vai Giy Pro Giy Val Trp Asp Ile His Ser Pro Arg Vai Pro Ser Ala 675 680 685 Gin Lys Val Asp Gly Leu Leu Giu Ala Ala Leu Gin Ser Val Asp Pro 690 695 700 Arg Gin Leu Trp Vai Asn Pro Asp Cys Giy Leu Lys Thr Arg Giy Trp 705 710 715 720 Pro Giu Val Giu Ala Ser Leu Lys Val Leu Val Giu Ser Ala Lys Gin 725 730 735 Ala Arg Glu Lys Ile Gly Ala Thr Ile 740 745 <210> 105 <211> 1923 <212> DNA <213> Corynebacteriun giutamicum <220> <221> CDS <222> (1900) <223> FRXA02085 <400> 105 cacccggtga tttcgcgaac cttgaaacat cgtcagaaga ttgccgtgcg tcctagccgg gatccgcacg ttcggctcaa gcagaaagtc tttaactcac atg act tcc aac ttt 115 Met Thr Ser Asn Phe 1 tct tcc act gtc gct ggt ott oct cgo atc gga qog aaq cgt qaa ctg 163 Ser Ser Thr Val Aia Gly Leu Pro Arg Ile Gly Ala Lys Arg Giu Leu 15 aag ttc gcg ctc gaa ggc tac tgg aat gga tca att gaa ggt cgc gaa 211 Lys Phe Ala Leu Giu Giy Tyr Trp Asn Gly Ser Ile Glu Gly Arg Giu 30 WO 01/66573 WO 0166573PCTJ/IBOO/02035 ctt Leu t ct Ser at g Met ga c Asp tac Tyr acc Thr gcg Ala cgt Arg 150 cca Pro ttg Leu tct Ser ga t Asp ttg Leu 230 gat Asp gtt Val gag gcg Al a gga Gly ct c Leu atc Ile ttt Phe aag Lys gat Asp 135 tgc Cys ctg Leu gat Asp ttc Phe gtt Val. 215 gct Al a cag Gin ga c Asp gag cag Gin ttg Leu gat Asp gct. Al a ggc Gly tgg Trp 120 aca Thr cag Gin act Thr cac His gat Asp 200 gct Al a aag Lys gcg Ala ttg Leu ctg gtc Val gca Ala ggt Gly ggt Gly gag Glu 110 cac His gcg Ala a at Asn cgc Arg gag Glu 190 atc I le cag Gln gtc Val ggc Gly act Thr 270 gtt aac Asn gga Gly gt g Val ct C Leu acc Thr tac Tyr tcc Ser gcc Ala ac Thr 175 gtc Val gat Asp gtc Val. aat Asn atc Ile 255 gag Glu gat gca Al a tcc Ser ccg Pro ct g Leu cct Pro gt g Val ctg Leu 145 cct Pro gat Asp gag Glu cct Pro gct Ala 225 tac Tyr ctt Leu gct Ala cgt tcg Ser tac Tyr gag Glu tgg Trp gca Al a ccg Pro 130 at t Ile gt t Val ggt Gly cgc Arg gcg Al a 210 ggt Gly ttc Phe ggc Gly gcg Ala aac gat Asp ta c Tyr cgt Arg att Ile cag Gin 115 gag Glu gag Glu ct g Leu tcc Ser ct c Leu 195 ttg Leu tac Tyr 9gC Gl y gcg Ala tgg Trp 275 att t ct Ser gac Asp ttt Phe gac Asp 100 gca Ala ttg Leu gat Asp gtt Val. aat As n 180 atc Ile gt c Val. acc Thr tct Ser att Ile 260 aa g Lys tgg ttg Leu gca Al a gat Asp cgc Arg at g Met t ct Ser ct c Leu ggt Gly 165 cct Pro aag Lys acc Thr act Thr ggc Giy 245 ggc Gly ggt Gi y cgc WO 01/66573 WO 0166573PCT/iBOO/02035 Glu acc Thr ggc Gly 310 a cc Thr ttc Phe gcc Ala got Al a ct Pro 390 aag Lys cca Pro tcC Ser ctg Leu ggt Gly 470 gac Asp cgc Arg cca Pro Glu gac Asp 295 cca Pro ctc Leu ggc Gly ggc Gly t ct Ser 375 ggc Gly t Ca Ser cag Gln atc I le gt c Val 455 gag Giu ggt Gly tgt Cys atg Met Leu 280 ctg Leu ato I le gag Glu t cg S er aac Asn 360 cga Arg cgt Arg ctg Leu a cc Thr act Thr 440 at c Ile oca Pro ttc Phe gt t Val act Thr Leu t gt Cys gca Ala got Ala gag Glu 345 atc Ile cgc Arg agc Ser gag Glu oca Pro 425 ttg Leu gcc Al a gag Glu ct o Leu Ogt Arg 505 gtc Val Val1 gct Al a gt g Val gag Giu 330 aag Lys gac Asp acc Thr cgt Arg ctt Leu 410 toc Ser gag Glu aag Lys cgc Arg tca S er 490 cot Pro aag Lys Al a gct Al a tot Ser 315 aac Asn at o Ile gcg Ala too Ser gga Gly 395 cca Pro at t Ile ca g Gin oag Gin aa o Asn 475 acc Thr o ca Pro t gg Trp Gly ct t Leu 300 aco Thr att Ile aco Thr got Al a oca Pro 380 too Ser got Ala cgt Arg tao Tyr gaa Gi u 460 gao Asp goo Al a gtg Val tto Phe Ile 285 gct Ala tot Ser gag Glu gag Gl u gog Ala 365 ogc Arg tt C Phe otg Leu t ct Ser gaa Glu 445 gaa Giu atg Met aa 0 Asn ttg Leu cag Gin Val too Ser t gt Cys ct Pro gto Val1 350 tto Phe aco Thr gao Asp oca Pro got Al a 430 gag Glu ott Leu gt t Val ggc Gly ttc Phe 510 tao Tyr Asp ct g Leu t ca Ser gag Giu 335 aag Lys gat Asp gca Al a act Thr aco Thr 415 ogo Arg gca Al a ggt Gly cag Gin tgg Trp 495 gga Gly goa A1 a Gly aag Lys ot g Leu 320 gt o Val ct g Leu gcg Ala oca Pro cgt Arg 400 aco Thr got Al a atg Met ott Leu tao Tyr 480 gt o Val aa o Asn Arg cgc Arg 305 ot g Leu cgc Arg ott Leu gog Al a at o Ile 385 gt t Val acc Thr ogt Arg ogo Arg gat Asp 465 ttc Phe caa Gin gtt Val Asn 290 ctg Leu oao His gao Asp gc Ala too Ser 370 acg Thr a og Thr att Ile ot g Leu gaa Giu 450 gtg Val tot Ser ago Ser too Ser Ile goa Ala gtt Val tgg Trp. gao Asp 355 goa Ala cag Gin ctg Leu ggt Gly cgc Arg 435 gaa Giu ttg Leu gaa Glu tao Tyr ogo Arg 515 Trp got Ala oct Pro ott Leu 340 goo Ala gca Ala gaa Glu cag Gin tot Ser 420 aag Lys atc Ile gtt Val ott Leu ggo Gly 500 oca Pro' Arg ogo Arg tao Tyr 325 gc Ala dt a Leu att Ile oto Leu gag Glu 405 tto Phe gaa Giu gat Asp cac His ct 0 Leu 485 too Ser gcg Ala 1027 1075 1123 1171 1219 1267 1315 1363 1411 1459 1507 1555 1603 1651 1699 cag ago otg aco cag aag Gin Ser Leu Thr Gin Lys WO 01/66573 PCTIBOO/02035 \O O d) C) \o cat His ttc Phe 550 ctg Leu atc Ile aga Arg 520 aag Lys cgC Arg ctg Leu cag Gin cga Arg 600 525 gga atg ctc acc ggt cca gtc Gly Met Leu Thr Gly Pro Val 540 gat gat cag ccg ctg gct acc Asp Asp Gin Pro Leu*Ala Thr 555 cgc gat gaa att aac gat ctc Arg Asp Glu Ile Asn Asp Leu 570 575 gtg gat gag cot gcg att cgt Vai Asp Giu Pro Aia Ile Arg 585 590 taagcctgcc tacctgcagt ggt 1747 1795 1843 1891 1923 <210> 106 <211> 600 <212> PRT <213> Corynebacterium glutamicum <400> 106 Met Thr Ser Asn Phe Ser Ser Thr Val Ala Gly Leu Pro Arg Ile Gly 1 Ala Ile Ala Ser Pro Leu Pro Val Leu 145 Pro Lys Glu Ser Tyr Glu Trp Ala Pro 130 Ile Val Arg Gly Asp Tyr Arg Ile Gin 115 Glu Glu Leu Ala Gin 40 Leu Asp Ala Gly Trp 120 Thr Gin Thr 10 Leu Glu Thr Ala Asp Ser Thr Ala Asp His Ala Ala 105 Phe Asp Arg Phe Gln Val Phe Leu 170 Tyr Gin Pro Ile Asn Gly Asn Leu 140 Gly Trp Leu Phe Leu Asp Thr Tyr 125 Asp Val Asn Val Ala Gly Gly Glu 110 His Ala Asn Gly Asn Gly Val Leu Thr Tyr Ser Ala Ser Thr Arg Leu Pro Leu Leu Ala Arg 160 Ser Leu Ala Axg Thr Thr 175 WO 01/66573 PCT/IB00/02035 UO Asp Glu Pro Ala 225 Tyr Leu Ala Arg Arg 305 Leu Arg Leu Ala Ile 385 Val Thr Arg Arg Asp 465 Phe Gly Arg Ala 210 Gly Phe Gly Ala Asn 290 Leu His Asp Ala Ser 370 Thr Thr Ile Leu Glu 450 Val Ser Ser Leu 195 Leu Tyr Gly Ala Trp 275 Ile Ala Val Trp Asp 355 Ala Gin Leu Gly Arg 435 Glu Leu Glu Asn P 180 Ile L Val T Thr T Ser G 2 Ile G 260 Lys G Trp A Ala A Pro T 3 Leu A 340 Ala L Ala I Glu L Gin G 4 Ser P 420 Lys G Ile A Val H: Leu Li 4 ro Leu Asp His Leu Pro Ala Leu Phe Glu Val Tyr 185 190 ys hr hr ly 45 ly ly rg rg yr 25 la eu le eu lu 05 he lu sp is eu 85 Ser Asp Leu 230 Asp Val Glu Thr Gly 310 Thr Phe Ala Ala Pro 390 Lys Pro Ser Leu Gly 470 Asp Phe Val 215 Ala Gin Asp Glu Asp 295 Pro Leu Gly Gly Ser 375 Gly Ser Gin Ile Val 455 Glu Gly Asp 200 Ala Lys Ala Leu Leu 280 Leu Ile Glu Ser Asn 360 Arg Arg Leu Thr Thr 440 Ile Pro Phe Glu Glu Asp Asn 250 Thr Val Ala Val Glu 330 Lys Asp Thr Arg Leu 410 Ser Glu Lys Arg Ser 490 Trp Val Gly 235 Thr His Ala Ala Ser 315 Asn Ile Ala Ser Gly 395 Pro Ile Gin Gin Asn 475 Thr Val Leu 220 Val Leu Gly Gly Leu 300 Thr Ile Thr Ala Pro 380 Ser Ala Arg Tyr Glu 460 Asp Ala Gin 205 Glu Phe Ala Val Ile 285 Ala Ser Glu Glu Ala 365 Arg Phe Leu Ser Glu 445 Glu Met Asn Ile Gln Val Gly Thr 270 Val Ser Cys Pro Val 350 Phe Thr Asp Pro Ala 430 Glu Leu Val Gly Asp Val Asn Ile 255 Glu Asp Leu Ser Glu 335 Lys Asp Ala Thr Thr 415 Arg Ala Gly Gin Trp 495 Glu Arg Thr 240 Gly Leu Gly Lys Leu 320 Val Leu Ala Pro Arg 400 Thr Ala Met Leu Tyr 480 Val WO 01/66573 WO 0166573PCTIIBOO/02035 Gin Val1 Ser Ile 545 Ala Glu Leu Tyr Arg Thr Ala Gin Gly Pro 595 <210> 107 <211> 603 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (101)..(580) <223> FRXA02086 <400> 107 gatgatcagc cgctggctac cactgctgac caggttgcac aacgatctca tcgaggctgg cgcgaagatc atccaggtgg gtg Val. tgg Trp gt c Val tcc Ser cgt Arg ct c Leu cta Leu ttc Phe cac His ttg Leu gt c Val 75 ggt Gly cga Arg cgc Arg atg Met gat Asp ctc Leu gtg Val aag Lys gc Al a gag Glu acc Thr a aa Lys 80 cac His tggcactgcg cgatgaaatt atg agc ctg cga ttc Met Ser Leu Arg Phe 1 oct gcc tac ctg cag Pro Ala Tyr Leu Gin ggc gca ccc gac gac Gly Ala Pro Asp Asp ttc aac gaa gtg atc Phe Asn Glu Val Ile acc atc gaa gca gca Thr Ile Glu Ala Ala tct tcc ggc ttc gag Ser Ser Gly Phe Glu tcc ccg cgc gtt cct Ser Pro Arg Val Pro WO 01/66573 WO 0166573PCTIBOOIO2035 INO INO tcc gcg cag aaa gtg gac ggt ctc ctc Ser Ala Gin Lys Val Asp Gly Leu Leu 105 110 gat cct cgc cag ctg tgg gtc aac cca Asp Pro Arg Gin Leu Trp, Val Asn Pro 120 125 gga tgg cca gaa gtg gaa gct tcc cta Gly Trp Pro Giu Val Giu Ala Ser Leu 135 140 aag cag gct cgt gag aaa atc gga gca Lys Gin Ala Arg Giu Lys Ile Gly Ala 150 155 aac <210> 108 <211> 160 <212> PRT <213> Corynebacterium giutamicum <400> 108 Met Ser Leu Arg Phe Val Asn Cys Cys 100 gct gca ctg cag tcc gtg 451 Ala Ala Leu Gin Ser Val 115 tgt ggt ctg aag acc cgt 499 Cys Gly Leu Lys Thr Arg 130 gtt ctc gtt gag tcc gct 547 Val Leu Val Giu Ser Ala 145 atc taaattgggt taccgctagg 600 Ile 160 1 Pro Ala Ty Gly Ala Pr 3 Phe Asn Gi Thr Ile G1~ Ser Ser GI. Ser Pro Ar, Ala Leu Gl] 11. Gly Leu Ly 130 Leu Val Gli 145 <210> 109 <211> 1326 <212> DNA Leu Asp Val Al a Phe Val 100 Ser Thr Ser Gin Asp Ile Ala Glu Pro Val Arg Ala Trp Val Ser Arg 70 Leu Ser Asp Gly Lys 150 S er Gin Ser 55 Ser Gly Ala Pro Trp 135 Gin Leu Phe His Leu Val 75 Gly Asp Trp Glu Lys 155 Arg Arg Met Asp Leu Val Gi y Val Ala 140 Ile Asp Leu Cys Al a Al a Trp Leu As n 125 Ser Gly Lys Al a Glu Thr Lys His Al a Cys Val Ile 160 WO 01/66573 WO 0166573PCT/IBOO/02035 <213> Corynebacterium glutamicum <220> 0 <221> CDS <222> (101)..(1303) <223> RXN02648 atgataaattcogggtgo agtgaccgta ggtgaggtaa gagtttgata otttotttog acttttagat tggattttoa acgcggttag agtcgaatga atc Ile gat Asp tto Phe gac Asp too Ser ct g Leu gca Al.a cgt Arg ggc Gly cct Pro 150 ct g Leu gtt Val cgt Arg tot Ser at c Ile ttc Phe 75 atg Met cct Pro ttg Leu ogo Arg ggc Gly 155 aac Asn ggt Gly tot Ser t ct Ser ctt Leu ggt Gly aco Thr ggc Gly ttc Phe gct Ala- 140 cag Gin gca Ala t cc Ser aao Asn gta Val. aao Asn goa Ala gat Asp aac Asn ago Ser 125 tot Ser ga a Glu gog Al a ttg Leu ggt Gly gat Asp gag Glu t gg Trp ac Thr atc Ile 110 gaa Glu gtg Val gaa Glu gga Gly at g Met 1 aco Thr ggg Gly at c Ile tac Tyr tao Tyr tgg Trp aco Thr gag Glu cca Pro 145 aog Thr gao Asp ago cag aac ogo oca gag Pro Giu gag gag Giu Glu aag ogo Lys Arg ggo cac Gly His too tto Ser Phe goa ago Ala Ser ago tto Ser Phe 115 gat oca Asp Pro 130 gag tto Glu Phe gat gtt Asp Val ggo tto Gly Phe ot a Leu gaa Giu cag Gin gt 0 Val aco Thr cag Gin 100 tot Ser gta Val1 aco Thr gat Asp gtt Val 180 Ser Gin Asn Arg ott Leu ttc Phe gtt Val a c Thr ogo Arg gaa Gl u gat Asp tot Ser gga Gly ot g Leu 165 goa Al a 115 163 211 259 307 355 403 451 499 547 595 643 691 gca eta too oca gga tot goa Ala Leu Ser Pro Gly Ser Ala 185 got cga ttg aoo aao aag tto tao gao Ala Arg Leu Thr Asn Lys Phe Tyr Asp WO 01/66573 WO 0166573PCT/IBOO/02035 act Thr tac Tyr gac Asp 230 ga t Asp gt g Val1 t ct S er ggt Gly t ct Ser 310 oct Pro gct Al a aag Lys ggo Gly gaa Glu ato Ile gaa Glu gac Asp ctt Leu 265 gga Gly ctg Leu cac His tot Ser cac His 345 ggc Gly ctg Leu gtc Val a cc Thr gca Ala t gg Trp 250 cca Pro c ca Pro cgc Arg gca Ala gtt Val 330 cca Pro ct Pro cat His gt c Val1 gat Asp tgg Trp 235 atc Ile aag Lys cac His gca Ala cac His 315 atc Ile ogo Arg gag Giu tc Ser gos Al a gos Al a 220 gat Asp ggt Gly gaa Glu gtc Val1 gag Glu 300 gag Glu tac Tyr ctg Leu aac Asn cag Gin 380 gca Al a 205 ggt Gly cag Gin aca Thr ca g Gin act Thr 285 gt C Val1 tgg Trp cct Pro gtt Val gtc Val 365 atc Ile tgt gct Cys Ala ctg acc Leu Thr ato aac Ile Asn cgc ato Arg Ile 255 aoc cgc Thr Arg 270 gao atc Asp Ile ggt gqc Giy Gly cgt gta Arg Val ggt gtt Gly Val 335 got gat Ala Asp 350 att gcg Ile Ala gos tgg Ala Trp, gat Asp gtt Val1 cca Pro 240 gat Asp ctg Leu oca Pro tt 0 Phe tgg Trp 320 gtg Val cgt Arg t cc S er gca Ala gog Al a cag Gin 225 gag Giu gcc Al a cac His tt 0 Phe tco Ser 305 gaa Glu t ct Ser ato Ile act Thr aag Lys 385 ott Leu 210 ct c Leu oca Pro at c Ile at c Ile ggt Gly 290 ttc Phe ga a Glu ca o His gtt Val gao Asp 370 ctg too Ser gao Asp ago Ser sac Asn t go Cys 275 gao Asp ga Glu sac Asn tc Ser cag Gin 355 tgt Cys gag cag Gin gcs Ala gt g Val agt Ser 260 tgg Trp at 0 Ile Gly sag Lys at c Ile 340 tt 0 Phe ggt Gi y too gaa Glu cog Pro a ag I~ys 245 gca Al a ggC Gly att Ile gca Al a ott Leu 325 aac Asn gc Ala ctg Leu ct a 739 787 835 883 931 979 1027 1075 1123 1171 1219 1267 1313 1326 Leu Glu Ser Leu gta gag ggc got ogc att Val Giu Gly Ala Arg Ile gca tos sag gsa otg tto Ala Ser Lys Glu Leu Phe taagotagac aaogagggtt got <210> 110 <211> 401 'z212> PRT <213> Corynebsoterium glutamicum WO 01/66573 WO 0166573PCT/IBOO/02035 (400> 110 Met Ser Gin Asn Arg Ile Arg Thr Thr His Val Gly Ser Leu Pro Arg 1 5 10 Thr Pro Giu Leu Leu Asp Ala As Ile Lys Arg Ser Asn Gly Giu Ile 25 Gly Glu Giu Giu Phe Phe Gin Ile Leu Gin Ser Ser Vai Asp Asp Val 40 Ile Lys Arg Gin Val Asp Leu Giy Ile Asp Ile Leu Asn Giu Gly Giu 55 Tyr Gly His Val Thr Ser Gly Ala Val Asp Phe Giy Ala Trp Trp Asn 70 75 IND Tyr Ser Phe Thr Arg Leu Gly Gly Leu Thr Met Thr Asp Thr Asp Arg 90 Trp Ala Ser Gin Giu Ala Vai Arg Ser Thr Pro Giy Asn Ile Giu Leu 100 105 110 Thr Ser Phe Ser Asp Arg Arg Asp Arg Ala Leu Phe Ser Giu Ala Tyr 115 120 125 Giu Asp Pro Val Ser Gly Ile Phe Thr Gly Arg Ala Ser Val Giy Asn 130 135 140 Pro Giu Phe Thr Gly Pro Ile Thr Tyr Ile Gly Gin Giu Giu Thr Gin 145 150 155 160 Thr Asp Val Asp Leu Leu Lys Lys Gly Met Asn Ala Ala Gly Ala Thr 165 170 175 Asp Giy Phe Val Ala Ala Leu Ser Pro Gly Ser Aia Ala Arg Leu Thr 180 l85 190 Asn Lys Phe Tyr Asp Thr Asp Giu Giu Vai Vai Ala Ala Cys Ala Asp 195 200 205 Ala Leu Ser Gin Giu Tyr Lys Ile Ile Thr Asp Ala Giy Leu Thr Val 210 215 220 Gin Leu Asp Ala Pro Asp Leu Ala Giu Ala Trp Asp Gin Ile Asn Pro 225 230 235 240 Giu Pro Ser Val Lys Asp Tyr Leu Asp Trp Ile Gly Thr Arg Ile Asp 245 250 255 Ala Ile Asn Ser Aia Val Lys Gly Leu Pro Lys Giu Gin Thr Arg Leu 260 265 270 His Ile Cys Trp Gly Ser Trp His Gly Pro His Val Thr Asp Ile Pro 275 280 285 Phe Gly Asp Ile Ile Gly Giu Ile Leu Arq Ala Giu Val Gly Giy Phe 290 295 300 Ser Phe Giu Gly Ala Ser Pro Arg His Ala His Glu Trp Arg Val Trp 305 310 315 320 WO 01/66573 WO 0166573PCTIIBOO/02035 Gi u Ser Ile Thr Lys 385 Phe Lys Leu 325 Ile Asn 340 Phe Ala Giy Leu Ser Leu Pro Glu Gly Ser Val 330 Ala Val Glu His Pro 345 Lys Leu Val Gly Pro 360 Gly Gly Arg Leu His 375 Val Glu Gly Ala Arg 390 Ile Tyr Pro Gly Val 335 Arg Leu Val Ala Asp 350 Glu Asn Val Ile Ala 365 Ser Gin Ile Ala Trp 380 Ile Aia Ser Lys Giu 395 <210> Ill <211> 548 <212> DNA <213> Corynebacterium giutamicum <220> <221> CDS <222> (525) <223> FRXA02648 <400> 111 gac Asp 1 ago Ser aac As n tgc Cys gao Asp ga a Giu aac As n cc~g Pro aag Lys gca Ala ggo Gly att Ile gca Ala ctt Leu gca Ala t gg Trp oca Pro 40 oca Pro ogo Arg gca Ala gt t Val t gg Trp atc Ile aag Lys cac His gca Ala cac His ate I le 105 gat Asp 10 ggt Gly g aa Glu gtc Val gag Glu gag Glu t ac Tyr otg Leu aac Asn at c Ile cgo Arg at o Ile Gly gt a Vai gt t Val1 gat As p 125 cca. Pro gat Asp ct g Leu cca Pro tt 0 Phe tgg Trp gtg Val 110 ogt Arg gag Giu gc Ala cac His tt 0 Phe tcc Ser gaa Giu tct Ser at c Ile cca Pro atc Ile at c Ile ggt Gly ttc Phe gaa Giu cac His gtt Val 48 96 144 192 240 288 336 384 tco atc aac Ser Ile Asn 115 get gtg gag Ala Val Glu cac cca ego His Pro Arg 120 WO 01/66573 WO 0166573PCT/IB00102035 cag ttc gcc aag ctt gtt ggc cct gag aac gtc att gcg tcc act gac Gin Phe Ala Lys Leu Val Gly Pro Glu Asn Val Ile Ala Ser Thr Asp 130 135 140 tgt ggt ctg ggc gga cgt ctg cat tcc cag atc gca tgg gca aag ctg Cys Gly Leu Gly Gly Arg Leu His Ser Gin Ile Ala Trp Ala Lys Leu 145 150 155 160 gag tec cta gta gag ggc gct cgc att gca tca aag gaa ctg ttc Glu Ser Leu Val Glu Gly Ala Arg Ile Ala Ser Lys Glu Leu Phe 165 170 175 taagctagac aacgagggtt gct <210> 112 <211> 175 <212> PRT <213> Corynebacteriun giutamicum <400> 112 Asp Ala Pro Asp Leu Ala Giu Ala Trp Asp Gin Ile Asn Pro Giu Pro I Ser As n Cys Asp Glu As n Ser Gin Cys 145 Val1 Ser T rp Ile Gly Lys 116 Phe 130 Gly Lys Ala Gly Ile Ala Leu Asn 115 Al a Leu Asp. Tyr Val Lys Ser Trp Gly Glu Ser Pro Pro Giu 100 Ala Val Lys Leu Gly Gly Arg Thr Asp Gly Arg Gly Ala Ile 140 Ala Ile Arg Ile Gi y Val Val1 Asp 125 Ala Trp le Ile Gly Phe Glu [His Val Asp Leu 160 Giu Ser Leu Val Glu 165 Gly Ala Arg Ile Ser Lys Glu Leu <210> 113 <211> 784 <212> DNA <213> Corynebacterium glutamicum WO 01/66573 WO 0166573PCTJ[B00102035 <220> <221>' CDS <222> (784) <223> FRXA02658 <400> 113 atgaataaaa ttccgggtgc agtgaccgta ggtgaggtaa gagtttgata ctttctttcg acttttagat tggattttca acgcggttag agtcgaatga atc- agg Ile Arg gat gca Asp Ala ttc cag Phe Gin gac ctg Asp Leu tcc ggt Ser Gly ctg ggc Leu Gly gca gtg Ala Val cgt cgc Arg Arg ggc atc Gly Ile 135 cct att Pro Ile 150 ctg aag Leu Lys gca cta Ala Leu act gat act Thr atc Ile ctg Leu atc Ile gtt Val1 ctg Leu tcc Ser 105 cgc Arg acc Thr tac Tyr ggc Gly cca Pro 185 gaa cac His aag Lys cag Gin gac Asp ga c Asp acc Thr acc Thr gca Ala ggt Gly att Ile at g Met 170 gga Gly gt c gtt Val Cgt Arg t ct Ser atc Ile ttc Phe 75 atg Met cct Pro ttg Leu cgc Arg ggc Gly 155 aac Asri t ct Ser gt c tt g Leu ggt Gi y 30 gat Asp gag Glu tgg Trp acc Thr atc Ile 110 gaa Giu gtg Val gaa Glu gga Gly cga Arg 190 tgt ccc Pro 15 gag Glu gac Asp ggc Gi y tgg Tirp gac Asp 95 gag Giu gca Ala ggc Gly act Thr gCt Ala 175 ttg Leu gct cgt Arg at t Ile gt g Val gaa Gi u aa c As n 80 cgt Arg ct g Leu tac Tyr aac Asn cag Gin 160 acc Thr a cc Thr gat at g Met 1 acc Thr ggg* Gly at c Ile ta c Tyr tac T yr tgg Trp acc Thr gag Glu cca Pro 145 acg Thr gac Asp a ac Asn gcg agc cag aac cgc Ser Gin Asn Arg cca gag cta ctt Pro Giu Leu Len gag gag gaa ttc Glu Giu Giu Phe aag cgc cag g-tt Lys Arg Gin Vai ggc cac gtc acc Gly His Vai Thr. tcc ttc acc cgc Set Phe Thr Arg gca agc cag gaa Ala Set Gin Glu 100 agc ttc tct gat Set Phe Ser Asp 115 gat cca gta tct Asp Pro Val Set 130 gag ttc acc gga Giu Phe Thr Gly gat gtt gat ctg Asp Val Asp Leu 165 ggc ttc gtt gca Gly Phe Vai Ala 180 aag ttc tac gac Lys Phe Tyr Asp 195 ctt tcc cag gaa 115 163 211 259 3 07 355 403 451 499 5 47 595 643 691 739 WO 01/66573 WO 0166573PCTIIBOO/02035 Thr Asp Glu Glu Val Val Ala Ala Cys Ala Asp Ala Leu Ser Gin Glu 200 205 210 U tac aag atc atc acc gat gca ggt ctg acc gtt cag ctc gac gca 784 Tyr Lys.Ile Ile Thr Asp Ala Gly Leu Thr Val Gin Leu Asp Ala 215 220 225 <210> 114 <211> 228 <212> PRT <213> Corynebacterium giutamicum <400> 114 *Met Ser Gin Asn Arg Ile Arg Thr Thr His Val Gly Ser Leu Pro A 'rg 1 5 10 Thr Pro Giu Leu Leu Asp Ala Asn Ile Lys Arg Ser Asn Gly Glu Ile 25 Gly Glu Glu Giu Phe Phe Gin Ile Leu Gin Ser Ser Val Asp Asp Val 40 Ile Lys Arg Gin Val Asp Leu Gly Ile Asp Ile Leu Asn Glu Gly Giu 55 Tyr Gly His Val Thr Ser Giy Ala Val Asp Phe Gly Ala Trp Trp Asn 70 '75 Tyr Ser Phe Thr Arg Leu Gly Gly Leu Thr Met Thr Asp Thr Asp Arg 90 Trp Ala Ser Gin Glu Ala Val Arg Ser Thr Pro Gly Asn Ile Glu Leu 100 105 110 Thr Ser Phe Ser Asp Arg Arg Asp Arg Ala Leu Phe Ser Glu Ala Tyr 115 120 125 Glu Asp Pro Val Ser Gly Ile Phe Thr Gly Arg Aia Ser Val Gly Asn 130 135 140 Pro Glu Phe Thr Giy Pro Ile Thr Tyr Ile Gly Gin Giu Glu Thr Gin 145 150 155 160 Thr Asp Val Asp Leu Leu Lys Lys Gly Met Asn Ala Ala Gly Ala Thr 165 170 175 Asp Gly Phe Val Ala Ala Leu Ser Pro Gly Ser Ala Ala Arg Leu Thr 180 185 190 Asn Lys Phe Tyr Asp Thr Asp Giu Glu Val Val Ala Ala Cys Ala Asp 195 200 205 Ala Leu Ser Gin Glu Tyr Lys Ile Ile Thr Asp Ala Gly Leu Thr Val 210 215 220 Gin Leu Asp Ala 225 <210> 115 WO 01/66573 WO 0166573PCTJIBOO/02035 <211> 408 <212> DNA <213> Corynebacterium giutamicum <220> <221> CDS <222> (101)..(3B5) <223> RX*C02238 <400> 115 gqcgcttagc caaaacatag agcggtaggg tatgctt ctcttaacac tactgtccat atacttttga aaaggtg atc cgattgagca accttt.cccg rtca gtg acc aac gtg ago Val Thr Asn Val Ser 1 aac gag acc aac gcc acc aag gcc gtc ttc gat ccg cca gtg ggc att. Asn Giu Thr Asn Ala Thr Lys Ala Val Phe Asp Pro Pro Vai Giy Ile 15 acc gct cct ccg atc gat gaa ctg ctg gat aag gtc act tcc aag tac Thr Ala Pro Pro Ile Asp Giu Leu Leu Asp Lys Val Thr Ser Lys Tyr 30 gcc ctc gtg atc ttc gca gcc aag cgt gcg cgc cag atc aac agc ttc Ala Leu Val Ile Phe Ala Ala Lys Arg Ala Arg Gin Ile Asn Ser Phe 45 tac cat cag gca gat gag gga gta ttc gag ttc atc gga cca ttg gtt Tyr His Gin Ala Asp Giu Gly Val Phe Glu Phe Ile Gly Pro Leu Val 60' act ccg cag cca ggc gaa. aag cca ctt tct att. gct ctg cgt gag atc Thr Pro Gin Pro Gly Glu Lys Pro Leu Ser lie Ala Leu Arg Giu Ile 75 80 aat gca ggt. ctg ttg gac cac gag gaa ggt taaaagacct tataacttca Asn Ala Gly Leu Leu Asp His Glu Glu Gly ca c <210> 116 <211> <212> PRT <213> Corynebacterium glutamicuu <400> 116 Val Thr Asn Val Ser Asn Giu Thr Asn Ala Thr Lys Ala Val Phe Asp 1 5 10 Pro Pro Val Gly Ile Thr Ala Pro Pro Ile Asp Giu Leu Leu Asp Lys 25 Val Thr Ser Lys Tyr Ala Leu Val Ile Phe Ala Ala Lys Arg Ala Arg 40 Gin Ile Asn Ser Phe Tyr His Gin Ala Asp Giu Gly Val Phe Glu Phe 55 WO 01/66573 WO 0166573PCT/IBOO/02035 UN Ile Gly Pro Leu Val Thr Pro Gln Pro Gly Giu Lys Pro Leu Ser Ile 65 70 75 Ala Leu Arg Glu Ile Asn Ala Gly Leu Leu Asp His Glu Giu Gly 90 <210> 117 <211> 1827 <212> DNA <213> Corynebacterium glutamicun <220> <221> CDS <222> (1804) <223> RXCO0128 <400> 117 ccattttccg tttggtcttg cctaaagaac cgcatggaaa ttatcgtgaa gcaccgatcc cgttgatcgc tccagagaca ccgtgggaag gggagcagca gtg agt aaa att tcg Val. Ser Lys Ile Ser acg Thr gct Ala t ca Ser aat Asn tat Tyr acg Thr att Ile gcg Ala cag Gin gat aaa Lys ggg Gly ttt Phe caa Gin ccg Pro cgc Arg gat Asp atc Ile ccg Pro 135 ggg gtg ctg Val Leu aac acg Asn' Thr caa gag Gin Giu cgc ggc Arg Gly gog aag Ala Lys gcg tcg Ala Ser tcg acg Ser Thr 110 acg ttg Thr Leo gct gag Ala Glu ttg ccg I1 gtg Val ccg Pro gca Ala ttc Phe tat T yr cgt Arg gcg Ala agc Sex acg Thr 145 ggg acc Thr caa Gin ggg Gly agc S er ctg Lau att Ile gaa Glu ggt Gly 130 atg Met att ctg gtg Leu Val ctg cgc Leu Arg acc ccg Thr Pro ggt grg Gly Ala gaa ggg Glu Giy gat cgc Asp Arg 100 acg att Thr Ile gtg tat Val Tyr cgg gaa Arg Giu tta gag 115 163 211 259 307 355 403 451 499 547 595 WO 01/66573 WO 0166573PCT/IBOO/02035 Asp 150 aga Arg gat Asp gag Giu cct Pro gog Al a 230 gga Gly tgg Trp ga C Asp ct C Leu ttt Phe 310 agt Ser at t Ile gag Giu tt g Leu Gly aac Asn cct Pro tcg Ser t cg Ser 215 t cg Ser aat Asn acg Thr ggc Gly gcc Ala 295 gcg Ala cca Pro tcc Ser gca Al a ag g Arg 375 Glu gat Asp t ct Ser cag Gin 200 ccg Pro tt C Phe ttg Leu ttg Leu gcg Al a 280 gaa Giu ttg Leu ct a Leu t cc Ser gt g Val 360 agt Ser Tip Arg Ile 155 ctg cgg aac Leu Arg Asn 170 ggc cag gtg Gly Gin Val 185 tcg atg tcc Ser Met Ser gca att tct Ala Ile Ser gtg ggg ttc Val Gly Phe 235 gat gat gat Asp Asp Asp 250 qcg cat gct Ala His Ala 265 ccg ttg ctg Pro Leu Leu tac aac cca Tyr Asn Pro cag gat gga Gin Asp Gly 315 cag ggc att Gin Gly Ile 330 tcc gcc aat Ser Ala Asn 345 ctt act gtt Leu Thr Val gaa acg atc Giu Thr Ile Asp Ala Leu Pro Asp Gly Ile Leu Leu Glu 160 165 cat His t tg Leu a cg Thr cct Pro 220 aat Asn gcg Ala gat Asp t cg Ser gag Giu 300 t cg Ser t gg Trp gt g Val1 ggc Gly act Thr 380 tac Tyr gtg Val gtg Val 205 ggt Gly gat Asp cgt Arg gt c Val gag Glu 285 gct Ala ttg Leu agc Ser gtg Val t cc Ser 365 cgt Arg act ccg Thr Pro 175 ggg gat Gly Asp 190 ctg atg Leu Met gtg gtc Val Val ggg gag Gly Giu ttg cgt Leu Arg 255 gca ggc Ala Gly 270 ttc cca Phe Pro tac acc Tyr Thr tcg agg Ser Arg ggt gga Gly Gly 335 gca gcg Ala Ala 350 atg gaa Met Glu ccc acc Pro Thr gag acg Giu Thr ca c His cgg Arg gcc Ala aat Asn tat Tyr 240 ttc Phe ccc Pro a cg Thr aac Asn gtc Vai 320 gat Asp gta Val ggc Gly ttt Phe gat Asp cgt Arg ct t Leu cag Gin 225 ca g Gin gcc Al a tac Tyr ctc Leu acg Thr 305 agt Ser at c I le cgc Arg gtg Val gaa Giu 385 gtg Val tgg Txp ct g Leu 210 ct g Leu tt c Phe gcC Al a act Thr acc Thr 290 gtg Val tcc Ser gat Asp Ca C His act Thr 370 tac Tyr tat Tyr tt g Leu 195 gtt Vai tcc Ser act Thr cag Gin ttg Leu 275 acc Thr tcc Ser ggc Giy t ct Ser gaa Giu 355 t Ca Ser gog Al a ttc Phe 180 ttc Phe aat Asn acg Thr ggt Gly gc Al a 260 gt c Val1 gat Asp acg Thr aat Asn gca Al a 340 ac As n ga t Asp t cg. Ser ttt Phe aat Asn ggt Gly gat Asp ttg Leu 245 gt g Val qct Al1 a gac Asp t.t g L6u* gtg Val 325 gcg Al a aac As n gcg Aila agt Ser 643 691 739 787 835 883 931 979 1027 1075 1123 1171 1219 1267 1315 ggg ttg tgg gct gtg gtg gat ggg Gly Leu Trp Ala Val Val Asp Giy cct gtc cga gtc gca oga Pro Val Arg Val Ala Arg WO 01/66573 WO 0166573PCT/iBOO/02035 8390 395 400 405 tcg gca aca acc ggt gag ctc gtc cag acg gag gcg gag att gtg ctg 1363 U Ser Ala Thr Thr Gly Glu Leu Val Gin Thr Giu Ala Gu Ile Val Leu 410 415 420 cca agg gat gtg acg ggt ccg atc tct gaa ttc caa ctg tca cga act 1411 Pro Arg Asp Val. Thr Gly Pro Ile Ser Glu Phe Gin Leu Ser Arg Thr 425 430 435 ggg gtc cgg gcc gcc atg atc att gaa ggc aag gtg tao gtg ggc gtc 1459 Gly Val Arg Ala Ala Met Ile Ile Glu Giy Lys Val Tyr Val Gly Val 440 445 450 gta acg cgt cct ggt ccg ggc gag cgg cgc gtg aca aat atc acg gag 1507 C1 Val Thr Arg Pro Gly Pro Giy Giu Arg Arg Val Thr Asn Ile Thr Glu ID455 460 465 gtg gcg cog ago ttg ggc gag gog gog ctg tcg ato aac tgg cgc oca 1555 Val Ala Pro Ser Leu Gly Giu Ala Aia Leo Ser Ile Asn Trp Arg Pro 470 475 480 485 gao ggc aft ttg ott gtg ggc acg toa att oca gag acg cog ctg~tgg 1603 Asp Gly Ile Leo Leo Val Gly Thr Ser Ile Pro Gbu Thr Pro Leu Trp 490 495 500 ogo gto gag cag gao gga tog gog att tog tog atg ccg ago ggg aat 1651 Arg Val Gbu Gin Asp Gly Ser Ala Ile Ser Ser Met Pro Ser Gly Asn 505 510 515 oto ago gog cog gtg gtg gcg gtg gca agt too gog acg acg gtc tao 1699 Leo Ser Ala Pro Val Val Ala Val Ala Ser Ser Ala Thr Thr Val Tyr 520 525 530 gto act gat tog oat gog atg ott oag otg cog act goc gat aat gat 1747 Val Thr Asp Ser His Ala Met Leo Gin Leo Pro Thr Ala Asp Asn A~p 535 540 545 att tgg ogo gag gtg coo ggt ttg ctg ggc acg ogt gcg gog cog gtg 1795 Ile Trp Arg Glu Val Pro Gly Leo Leo Gly Thr Arg Ala Ala Pro Val 550 555 560 565 gtt gog tao tgatggagot gttottooog ogo 1827 Val Ala Tyr <210> 118 <211> 568 <212> PRT <213> Corynebaoterixn giotanicun <400> 118 Val Ser Lys Ile Ser Thr Lys Leo Lys Ala Leu Thr Ala Val Leo S r 1 5 10 is Val Thr Thr Leu Val Ala Gly Cys Ser Thr Leo Pro Gin Asn Thr Asp 25 Pro Gin Val Leo Arg Ser Phe Ser Gly Ser Gin Ser Thr Gin Gu Ile 40 WO 01/66573 WO 0166573PCT/LBOO/02035 Ala Gly Pro Thr Pro Asn Gin Asp Pro Asp Leu Leu Ile Arg Gly Phe cN150 55 Phe Ser Ala Gly Ala Tyr Pro Thr Gin Gin Tyr Glu Ala Ala Lys Ala 70 75 Tyr Leu Thr Glu Gly Thr Arg Ser Thr Trp Asn Pro Ala Ala Ser Thr 90 Arg Ile Leu Asp Arg Ile Asp Leu Asn Thr Leu Pro Giy Ser Thr Asn 100 105 110 Ala Giu Arg Thr Ile Ala Ile Arg Gly Thr Gin Val Gly Thr Leu Leu 115 120 125 IND Ser Gly Gly Val Tyr Gin Pro Giu Asn Ala Glu Phe Glu Ala Gl~u Ile 130 135 140 Thr Met Arg Arg Glu Asp Gly Glu Trp Arg Ile Asp Ala Leu Pro Asp 145 150 155 160 Gly Ile Leu Leu Glu Arq Asn Asp Leu Arq Asn His Tyr Thr Pro His 165 170 175 Asp Val Tyr Phe Phe Asp Pro Ser Gly Gin Val Leu Val Gly Asp Arg 180 185 190 Arg Trp Leu Phe Asn Giu Ser Gin Ser Met Ser Thr Val. Leu Met Ala 195 200 205 Leu Leu Val Asn Gly Pro Ser Pro Ala Ile Ser Pro Gly Val Vai Asn 210 215 220 Gin Leu Ser Thr Asp Ala Ser Phe Val Gly Phe Asn Asp Gly Giu Tyr 225 230 235 240 Gin Phe Thr Giy Leu Gly Asn Leu Asp Asp Asp Ala Arg Leu Arg Phe 245 250 255 Ala Ala Gin Ala Val Trp Thr Leu Ala His Ala Asp Val Ala Giy Pro 260 265 270 Tyr Thr Leu Val Ala Asp Gly Ala Pro Leu Leu Ser Giu Phe Pro Thr 275 280 285 Leu Thr Thr Asp Asp Leu Ala Glu Tyr Asn Pro Giu Ala Tyr Thr Asn 290 295 300 Thr Val Ser Thr Leu Phe Aia Leu Gin Asp Gly Ser Leu Ser Arg Vai 305 310 315 320 Ser Ser Gly Asn Val Ser Pro Leu Gin Gly Ile Trp Ser Gly Giy Asp 325 330 335 Ile Asp Ser Ala Ala Ile Ser Ser Ser Ala Asn Val Val Ala Ala Val 340 345 350 Arg His Giu Asn Asn Glu Ala Val Leu Thr Val Gly Ser Met Giu Gly 355 360 365 WO 01/66573 WO 0166573PCTLBOO/02035 U Val Glu 385 Val1 Al a Gin Val1 Thr 465 Ile Glu Met Ala Thr 545 Arg Arg Gly Val Il e Ile 445 Giu Ala Thr AL a Val. 525 Leu Leu Phe Pro 400 Glu Phe Lys Val Ser 480 Pro Ser Ser Pro Thr 560 <210> 119 <211> 1344 <212> DNA <213> Corynebacterium glutamicun <220> <221> CDS <222> (101)..(1321) <223> RXA02240 <400> 119 cagctagacc actgacattg cagttttaga cagcttggtc tatattggtt ttttgtattt aagactattt attctcaact tcttcgaaag aagggtattt gtg gct cag cca acc 115 Val Ala Gin Pro Thr 1 gcc gtc cgt ttg ttc acc agt gaa tct gta act gag gga cat cca gac 163 Ala Val Arg Leu Phe Thr Ser Giu Ser Vai Thr Glu Gly His Pro Asp 15 WO 01/66573 WO 0166573PCTIIBOO/02035 aaa Lys aa Lys atc Ile cct Pro gag Giu gag Giu cgc Arg cag Gin cct Pro 150 gtt Val1 cag Gin acc Thr ttg Leu gca Ala 230 cct Pro acc ata Ile gat Asp gt c Val caa Gin gt t Val cag Gin a ce Thr ggc Giy 135 ctt Leu Cgt Arg gt c Val1 gt t Val gaa Giu 215 ggc Gly tca Set ggc t gt Cys ceg Pro cat His tta Leu gga Gly tcc Ser aac Asn 120 ct g Leu cct Pro aaa Lys acc Thr gt c Val1 200 acc Thr att Ile ggt Giy cge gat Asp cag Gln gtt Val1 gt c Val ttc Phe cag Gin 105 ggc Gly at g Met atc Ile gag Giu ttc Phe 185 ate Ile caa Gin gag Giu tcc Ser a ag att tcc Ile Ser cgc gtc Arg Val ggc gag Gly Giu aac aag Asn Lys 75 gga cgc Gly Arg atc gct Ile Ala gtt gaa Val Giu ggc tac Gly Tyr 140 ttg gcg Leu Ala 155 ate gtt Ile Val tac gat Tyr Asp ace cag Thr Gin cgc gaa Arg Giu 220 etg gca Leu Aia 235 att ctg Ile Leu atc gtg acc Thr 30 gtg Vali cgt Axg atc Ile t gt Cys ggc Gly 110 gac Asp ace Thr cga Arg cac His caa Gin 190 gac Asp gtc Vai ggt Gly 9gc Gly a cc att Ile gaa Giu acc Thr gaa. Giu ggC Giy gtg Val1 gac Asp aac Asn ctg Leu ct g Leu 175 gac Asp cca Pro att Ile gag Giu ccc Pro 255 t ac tt g Leu act Thr agc Ser at c Ie 80 gte Vai gat Asp cqc Arg gaa Glu tea Ser 160 cgt Arg cgc Arg gaa Giu gat Asp atc Ile 240 atg Met ggt ctg Leu a cc Thr gta Val aac Asn tee Ser gac Asp 115 gct Ala gag Giu ctg Leu gga Giy ca e His 195 cgt Arg atc Ile tt g Leu gcg Ala gct etc Leu ace Thr gag Giu tee Ser ate Ile 100 gaa Giu Gly tac Tyr ace Thr aaa Lys 180 ct g Leu gca. Ala aaa Lys ate Ile ggt Gly 260 ege gaa Giu gga Gly ate Ile t ct Ser ggt Gly gee Ala gac Asp atg Met cag Gin 165 ace Thr gat Asp t gg Trp ga e Asp aac Asn 245 etg Leu cat 211 259 307 355 403 451 499 547 595 643 691 739 787 835 883 931 WO 01/66573 WO 0166573PCT/IBOO/02035 Th r ggt Gly gct Al a ct t Leu 310 aag Lys ctg Leu c gt Arg gct Al a cct Gly ggt Gly gca Ala 295 gct Ala cca Pro ago Ser cca Pro ga c Asp 375 tgg Ile Ile Val Asp Thr Tyr Gly Gly Met Ala Arg His 270 275 ggt aag gat cca agc aag gtg gac cgo tct Gly Lys Asp Pro Ser Lys Val Asp Arg Ser 285 290 tgg gta gca aag aao atc gtg gca gca ggc Trp, Val Ala Lys Asn Ile Val Ala Ala Gly 300 305 gtt cag gtt gca tac goc att gga cgc gca Val Gin Val Ala Tyr Ala Ile Gly Arg Ala 320 325 gtt gaa acc ttt gac aco aac aag gaa ggc Val Glu Thr Phe Asp Thr Asn Lys Glu Gly 335 340 cag gct gcc gtg ttg gag gtc ttt gao ctg Gin Ala Ala Val Leu Glu Val Phe Asp Leu 350 355 cgt gag ott gat ctg ctt cgt ccg atc tao Arg Glu Leu Asp Leu Leu Arg Pro Ile Tyr 365 370 ggc cac ttt ggt ogo act gat ttg gao ctt Gly His Phe Gly Arg Thr Asp Leu Asp Leu 380 385 cgc gtt gat gaa ott cgc goa goc otc aag Arg Val Asp Glu Leu Arg Ala Ala Leu Lys 400 405 979 1027 1075 1123 11*71 1219 1267 1315 1344 Pro Trp Glu Ala Ile 390 ttg gc Leu Ala taaaaatctg atgtagtatc ttc <210> 120 <211> 407 <212> PRT <213> Corynebacterium glutamicum <400> 120 Val Ala Gin Pro Thr Ala Val Arg Leu Phe 1 5 10 Glu Gly His Pro Asp Lys Ile Cys Asp Ala 25 Asp Ala Leu Leu Glu Lys Asp Pro Gin Ser 40 Val Val Thr Thr Gly Ile Vai His Val Val 55 Ala Tyr Val Glu Ile Pro Gin Leu Val Arg 70 Thr Ser Glu Ser Val Ile Ser Asp Thr Ile Arg Val Ala Val Glu Gly Glu Val Arg Thr Asn Lys Leu Ile Glu 75 Thr Leu Thr Ser Ile WO 01/66573 WO 0166573PCT[IBOO/02035 Gly Phe Asn Ser Ser Giu Val Gly Phe Asp Gly Arg Thr Cys Gly Val 90 U Ser Val. Ser lie Giy Glii Gin Ser Gin Giu Ile Ala Asp Gly Val. Asp 100 105 110 Asn Ser Asp Giu Ala Arg Thr Asn Gly Asp Vai Glu Glu Asp Asp Arg 115 120 125 Ala Gly Ala Gly Asp Gin Gly Leu Met Phe Gly Tyr Ala Thr Asn Glu __130 135 140 Thr Giu Glu Tyr Met Pro Leu Pro Ile Ala Leu Ala His Arg Leu Ser 145 150 155 160 Arg Arg Leu' Thr Gin Val Arg Lys Glu Gly Ile Vai Pro His Leu Arg ID165 170 175 Pro Asp Gly Lys Thr Gin Val Thr Phe Ala Tyr Asp Ala Gin Asp Arg ri180 185 190 Pro Ser His Leu Asp Thr Val Val Ile Ser Thr Gin His Asp Pro Glu 195 200 205 Val Asp Arg Ala Trp Leu Giu Thr Gin Leu Arg Glu His Val Ile Asp 210 215 220 Trp Val Ile Lys Asp Ala Gly Ile Glu Asp Leu Ala Thr Gly Giu Ile 225 230 235 240 Thr Val Leu Ile Asn Pro Ser Gly Ser Phe Ile Leu Gly Gly Pro Met 245 250 255 Gly Asp Ala Gly Leu Thr Gly Arg Lys Ile Ile Val Asp Thr Tyr Gly 260 265 270 Gly Met Ala Arg His Gly Gly Gly Ala Phe Ser Gly Lys Asp Pro Ser 275 280 285 Lys Vai Asp Arg Ser Ala Ala Tyr Ala Met Arg Trp Val Ala Lys Asn 290 295 300 Ile Val. Ala Ala Giy Leu Ala Asp Arg Ala Glu Val Gin Val Ala Tyr 305 310 315 320 Ala Ile Gly Arg Ala Lys Pro Val Gly Leu Tyr Val Giu Thr Phe Asp 325 330 335 Thr Asn Lys Giu Gly Leu Ser Asp Glu Gin Ile Gin Ala Ala Val Leu 340 345 350 Glu Val The Asp Leu Arg Pro-Ala Ala Ile Ile Arg Giu Leu Asp Leu 355 360 365 Leu Arg Pro Ile Tyr Ala Asp Thr Ala Ala Tyr Gly His Phe Gly Arg 370 375 380 Thr Asp Leu Asp Leu Pro Trp Glu Ala Ile Asp Arg Val Asp Giu Leu 385 390 395 400 Arg Ala Ala Leu Lys Leu Ala WO 01/66573 PCT/IB00/02035 \O 405 0 <210> 121 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 121 tcgggtatcc gcgctacactt aga 23 CK1 <210> 122 \O <211> 23 0 <212> DNA S <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 122 GGAAACCGGG GCATCGAAAC TTA 23 <210> 123 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 123 ggaaacagta tgaccatg 18 <210> 124 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 124 gtaaaacgac ggccagt 18 <210> 125 <211> 4334 <212> DNA <213> Corynebacterium glutamicum <400> 125 aaatcgcttg accattgcag gttggtttat gactgttgag ggagagactg gctcgtggcc gacaatcaat gaagctatgt ctgaatttag cgtgtcacgt cagaccgtga atagagcact 120 WO 01/66573 WO 0166573PCT/IBOO/02035 U taagtctgcg tctcgtaggc cgggctgatt ccaccggctc gcgactccgc ccctatgcca ttcgcaaaaa cgcttggctt gaaagccacg tcatgaacaa attcaacggg tatgggtata tatgggaagc gatgttacag atcaagcatt aaaacagcat ctggcagtgt gatcgcgtat agtgattttg aagcttttgc cttatttttg gaccgatacc cagaaacggc catttgatgc agcattacgc tgaaggatca tcaaaatcac tctggctgga gcagacctca ttgtgcgggt ggcattgaac agaaaacggt gctcttgaag acctcgtaag tt cgcgaagc agcttctttc tcgtcccctg gaccgacttg ttgtgtctca taaaactgtc aaacgtcttg aatgggctcg ccgatgcgcc atgagatggt ttatccgtac tccaggtatt tcctgcgccg ttcgtctcgc atgacgagcg cattctcacc acgaggggaa aggatcttgc tttttcaaaa tcgatgagtt tgacttgacg gatcacgcat caactggtcc tgatggggcg gcgcccccga ggcttgtccc ttccacgagg tccccccgta ctctctaggg cgcacaagga cttgccccgc accctaaatt atcgcccttg atcagcttgc aaatctctga tgcttacata ct cgaggccg cgataatgtc agagttgttt cagactaaac tcctgatgat agaagaatat gttgcattcg tcaggcgcaa taatggctgg ggattcagtc attaataggt cat cct at gg atatggtatt tttctaatca ggacggcggc cttcccgaca acctacaaca attcaggcct attgatcagt tgagggcgct acgccgtaaa ggggtctctc gggctcacac ctgctcccaa ggaaatttcc cgagagattg cgacgttgct atgcctgcag tgttacattg aacagtaata cgattaaatt gggcaatcag ctgaaacatg tggctgacgg gcatggttac cctgattcag attcctgttt tcacgaatga cctgttgaac gtcactcatg tgtattgatg aactgcctcg gataatcctg gaattggtta tttgttgaat acgcagaccq aagctctcat ggtatgagtc actgcggcgt gcgacagata gcttcccagt tcttggcctc cataggcaga agatcttcaa tccaccgagt gattcttacc cgcggcggtg gtcgacggat cacaagataa caaggggtgt ccaacatgga gtgcgacaat gcaaaggtag aatttatgcc tcaccactgc gtgaaaatat gtaattgtcc ataacggttt aagtctggaa gtgatttctc ttggacgagt gtgagttttc atatgaataa attggttgta aaatcgaact ttccqtggca caaccgtggc agcaacacct cgctgatcgc gctaaaaatc aaatgtgcca ctttctaggt taacggttcc agccactgcc tcgtgcacac gtggaaattc ccgctggttg ccccgggtgg aaatatatca tatgagccat tgctgattta ctatcgattg cgttgccaat tcttccgacc gatccccggg tgttgatgcg ttttaacagc ggttgatgcg agaaatgcat acttgataac cggaatcgca tccttcatta attgcagttt acactggcag tttgctgagt aagcaaaagt tccctcactt tcttcacgag cctcgcgacg tgcgtcagga 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 tcgccgtaga gcgcgcgtcg cgtcgattgg aggcttcccc tttggttgac ggtcttcaat 1980 WO 01/66573 WO 0166573PCT/IBOO/02035 U cgctctacgg atcccgaaaa tccagatttt tcggaaaaat tcgtgaaaat atggtgtcat tctctgatgt tcggattttt ccgcgagcga ctcggcagcg tggcctgatt gtgtcgtgcc ggctaggtcg cacagagctg gacaaacatc gccaccacct gaagcgataa agggcgtcgg gattcacgag cccgagctcg cacctgggca aaagacccgg gcccggtgc attgatgtqc gcgattttg ctgagcggga agcagcccga gctgaccagg accgcgtacc gttgctcgca cgatcctgac agtttttgcc ttaaaaacca caagtgcgat ttt cgt gccg gaccttcacg cgcgctggag ccgagctctc cctagaaact ccaggaggac cctccccggc gcagccagcc caaatggcgc gaagcggcag gtaaatgccg gcaccgaatc gctgcacgaa ctaaccccca acattgacac cgctgcgatc gagaaaattt acacgggaga agtatgttgc cgagccacca agcgct gggc aatgccagct atatgcgcct ctttttcaca gctggcatgc tgatctcagg gcttttttgt ttttgtaaaa agccagaaat acaaaatttt cgtgattttc acgaagtacc tccgacgcgc gatacgacgg ctcgtgqcgg gcacagtagt ctgacccgcg gcgagcgcgc tggaagtgcg cgagaattat cgtttcgtgt ggcagcagcg tacctgaaaa gtccaaacca accggcctgg acgtggctgg cc a gggca gc aacacagccg tctgacgcac qgCCggcggg acgcctggaa catctggctc gctggctgca taggctgagc ccagcacaat cacagaaaaa tqcgtaccgt aacttctcgg acgacacacc tagcacccct cgccaaaaac aaaattggcc tcgatgctgc acgcgccagc atcttgagga ggaggatcga aggacggcgc caacaaacqc tcccccgagc ccgcgatcgt ggccgtggcc tcgcgcqtcg atgttgaacg gggagaaagc aaattttccg acgagcgaag aagacccgcg aagttatacc gcgcagcacg aaaatcgagc aaagcgccag attgatccgg acgaccgagg cggtggccac cgcgtggatc cctaaaaaac cgatcgtttt tcgccccgca gtttgcagat gagctgcgca tttaacgaac cgaatcatca cgtcgattta atcacgagac gctggctgac atcagttgcg gcaaaatatt cacgccgagg gaaattttgg ggcgcggtgc gcccaggacg aaaaagcqca ccccgtgagc gctcaaaaat ctgatctgtt accgccgcga acttcgccag gagttggttc cagccgtgct acgtaaaccc cttggatcgg tgtatgccgc aaatgacccg tgcacgtctc gcctagctga gctatgagca atttctgtcq aattttcgat aatct gtct t aagtcccgct gttcgttata gctatggatc aaaacggtga tgggccagtg gaqctgcgtg cctactgcgg gctcagatgc agctggaggc ccatggtcgt ccgcaggcat tgtcagcgcc caggcggcaa ggtaactcac gactctagcg cgacacccat attcctcgct cgcttggatc aaaatcgctt tgtcctggac cgaggtctac cgtgaatcca agcaggcatg cgttttcggc cgacgatccc tcttatggag ggagttttct 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 WO 01/66573 WO 0166573PCT/IBOO/02035 U agcggacggg acgcttgaag cgtgtcctct ttgactgtgg gacgcctacg gatctgccgc aaaggccagc gctctggcca aacagtgagt a ggaa agct a cacgtatcga caagcctgcc ggactgct cc gataccagtt agcgtgccta cgatqcgtga cagtcgtcc ctatgggaag acgcccgagc aagg agcggcaaga gagcgccgct agggcgtgcc aaaagcggct caccgtcgct ccgccagacg tgctcgtcaq acgtggcggt acagcgagaa aaagccactg gaagcgtctg gcccgtgatq ggtgagcgcc caggcggtcg atggcgcgac acagagacgc aaaaaggccg aaactagcta cggaagcaaa gagagctgat agacggcttt taaaagacac gagcagacgg gtgtgcgcgg agagcagccg cagaacgctg agtccagtca agcac ttgcc cgacggcgtc tcgccacgct caagatcatc ccgtgagcct ctacgtcgct agggcgaaaa gaaagaccca acgacaagct 3840 3900 3960 4020 4080 4140 4200 4260 4320 4334 175