WO2026005334A1 - 5'핵산분해효소의 활성을 분석하는 방법 - Google Patents

5'핵산분해효소의 활성을 분석하는 방법

Info

Publication number
WO2026005334A1
WO2026005334A1 PCT/KR2025/007756 KR2025007756W WO2026005334A1 WO 2026005334 A1 WO2026005334 A1 WO 2026005334A1 KR 2025007756 W KR2025007756 W KR 2025007756W WO 2026005334 A1 WO2026005334 A1 WO 2026005334A1
Authority
WO
WIPO (PCT)
Prior art keywords
primer
dimer
forming
probe
self
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/KR2025/007756
Other languages
English (en)
French (fr)
Inventor
이효빈
안병준
김명일
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seegene Inc
Original Assignee
Seegene Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seegene Inc filed Critical Seegene Inc
Publication of WO2026005334A1 publication Critical patent/WO2026005334A1/ko
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/527—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving lyase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates

Definitions

  • the present invention relates to a method for analyzing the activity of 5' nuclease or a composition for assaying the activity of 5' nuclease.
  • Molecular diagnostics is an in vitro diagnostic technique that analyzes nucleic acids such as DNA or RNA, and is used to identify the presence of specific genes or viruses.
  • the polymerase chain reaction (PCR) the most representative method of molecular diagnostics, was invented by Kary B Mullis in 1983 and has continued to evolve, playing a key role in the recent response to the COVID-19 pandemic.
  • PCR requires a series of temperature changes (mainly between 55°C and 95°C), making the use of enzymes that can maintain stability in these reaction environments crucial. For this reason, polymerases derived from hyperthermophiles that are stable at high temperatures are primarily used, with Taq DNA polymerase derived from T. aquaticus being a prime example. These enzymes help to ensure stable reactions even in high-temperature environments, making PCR-based molecular diagnosis more accurate and efficient (Chien A., Edgar DB, Trela JMJ Bacteriol. 1976, 127, 1550-1557).
  • Some DNA polymerases possess an ectohydrolase domain that degrades nucleic acids in addition to the polymerase domain that synthesizes new DNA strands.
  • the ectohydrolase domain is divided into 5'-3' ectohydrolase and 3'-5' ectohydrolase depending on the direction of degradation.
  • the 5' ectohydrolase removes RNA primers present in the lagging strand during DNA replication or removes damaged nucleotides during DNA damage repair (Arthur Kornberg, Tania A. Baker, DNA replication. 1991).
  • this enzyme specifically degrades fluorescent probes, enabling precise and specific target detection in real time (Pamela M. Holland, Proc. Natl. Acad. Sci. USA, Vol. 88, pp. 7276-7280).
  • a method for quantitatively analyzing the activity of an exonuclease enzyme is generally based on the release of nucleotides from the end of DNA in a unit time at a unit temperature, resulting in an acid-soluble degradation product.
  • the rate at which nucleotides become acid-soluble degradation products is defined as Unit, a unique property of the enzyme being measured.
  • T7 Exonuclease from New England Biolabs defines 1 Unit as the release of 1 nmol of nucleotides from target DNA in a state of acid-soluble degradation products at 37°C in 30 minutes.
  • lambda exonuclease and Exonuclease I define 1 Unit as the release of 10 nmol of nucleotides from target DNA in a state of acid-soluble degradation products under the same temperature and time conditions.
  • Unit may vary depending on the company or product, such as temperature, amount of substrate, and type of material containing radioisotopes, they all use a common method of measuring the reaction rate by measuring substrate consumption or calculating the amount of acid-soluble decomposition product released.
  • 5' nucleases could also be confirmed by measuring the rate at which nucleotides at the 5' end of the target DNA were released.
  • radioactive isotopes have been mainly used to confirm the properties or activities of 5' nucleases (Richard S. Murante. J. Biol. Chem, Vol. 269, No. 2, Issue of January 14, pp. 1191-1196, 1994; Matthew J. Longley. Nucleic Acids Research, Vol. 18, No. 24 7317). Although this method boasts high accuracy, it has drawbacks such as experimental complexity, long operation time, environmental impact, and concerns about the health of the experimenter, so research to develop alternative methods has been actively underway.
  • the above-mentioned methods measure the efficiency of degradation of oligonucleotides complementarily hybridized to single-stranded templates such as M13mp2 and M13mp18 by 5'-nucleotide decomposition, and for this purpose, the amount of oligonucleotide 5'-end degradation per unit time is measured at the optimal activity temperature of the 5'-nucleotide decomposition.
  • these methods could not be considered to have replaced the accuracy and quantitation of the existing activity measurement method using radioisotopes, or improved the convenience or efficiency.
  • they had the disadvantage of not accurately reflecting the characteristics of 5'-nucleotide decomposition.
  • 5' nucleases play a role in degrading RNA primers in vivo and degrade fluorescently labeled probes during PCR, enabling the expression of specific signals in real time. Specifically, 5' nucleases degrade the 5' end of oligonucleotides hybridized to double-stranded nucleic acids. In particular, when 5' nucleases exist as part of nucleic acid polymerases, oligonucleotides must be present upstream of the target oligonucleotide, and they recognize specific structures in which the gap between the two nucleotides is approximately 0 nucleotides (Victor lyamichev. Proc. Natl. Acad. Sci. USA, Vol. 96, pp. 6143-6148). Therefore, in order to accurately measure the activity of 5' nucleases performed in vivo or during PCR, it is necessary to reflect these enzymatic characteristics.
  • the inventors of the present invention recognized the need for developing a method for analyzing the activity of 5' nuclease with high accuracy by reflecting these enzymatic characteristics.
  • the present inventors sought to develop a method for analyzing the activity of 5' nuclease, another activity of nucleic acid polymerase used in in vitro diagnostics, particularly molecular diagnostics such as PCR. As a result, they completed the present invention by confirming that the activity of the target 5' nuclease can be easily determined using a combination of dimer-forming primer pairs and probes.
  • the purpose of the present invention is to provide a method for analyzing the activity of 5' nuclease.
  • Another object of the present invention is to provide an activity assay composition for 5' nuclease.
  • the present invention provides a method for analyzing the activity of a 5' nuclease, comprising the following steps:
  • the dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and a dimer-primer is formed through hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and each of the probes is hybridized to the 5'-probe-hybridizing region of each of the first primer
  • the present inventors sought to develop a method for analyzing the activity of 5' nuclease, another nucleic acid polymerase used in in vitro diagnostics, particularly molecular diagnostics such as PCR. As a result, they confirmed that the activity of the target 5' nuclease can be easily determined using a combination of dimer-forming primer pairs and probes.
  • the 5' nuclease is a primer-dependent 5' nuclease. This means that the 5' nuclease exhibits activity in the presence of a primer.
  • the 5' nuclease is an exonuclease or an endonuclease.
  • the 5' nuclease is a DNA polymerase or flap endonuclease (FEN) having 5' nuclease activity. More specifically, it is a thermostable DNA polymerase or flap endonuclease having 5' nuclease activity.
  • FEN DNA polymerase or flap endonuclease
  • the DNA polymerase having the activity of 5' nuclease suitable for the present invention is a thermostable DNA polymerase obtained from various bacterial species, and the DNA polymerase is selected from the group consisting of Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , Thermus antranikianii , Thermus caldophilus , Thermus chliarophilus , Thermus flavus , Thermus igniterrae , Thermus lacteus , Thermus oshimai , Thermus ruber , Thermus rubens , Thermus scotoductus , Thermus silvanus , Thermus species Z05 , Thermus species sps 17 , Thermus thermophilus , Thermotoga maritima , Thermotoga neapolitana , Thermos
  • the flap endonuclease used is a 5'flap-specific nuclease.
  • Flap endonucleases suitable for the present invention include flap endonucleases obtained from various bacterial species, wherein the flap endonucleases are derived from bacteria selected from the group consisting of Sulfolobus solfataricus , Pyrobaculum aerophilum , Thermococcus litoralis , Archaeaglobus veneficus , Archaeaglobus profundus , Acidianus brierlyi , Acidianus ambivalens , Desulfurococcus amylolyticus , Desulfurococcus mobilis , Pyrodictium brockii , Thermococcus gorgonarius , Thermococcus zilligii , Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii , Aeropyrum pernix and Archaeaglobus veneficus .
  • Figure 1 is a flowchart of processes for implementing the method of the present invention according to one embodiment of the present invention. The method of the present invention is described with reference to Figure 1 as follows:
  • the method of the present invention comprises the steps of (a) providing a composition for activity assay comprising (i) a dimer-forming primer pair and (ii) probes.
  • the dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and a dimer-primer is formed through hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and each of the probes is hybridized to the 5'-probe
  • An activity assay composition used in the present invention comprises (i) a dimer-forming primer pair and (ii) probes.
  • the term "primer” refers to an oligonucleotide that can act as an initiation point for synthesis of a primer extension product complementary to a nucleic acid strand (template) under conditions that induce synthesis, i.e., the presence of nucleotides and a polymerizing agent such as DNA polymerase, and conditions of suitable temperature and pH.
  • the primer is a single-stranded deoxyribonucleotide molecule.
  • the primer used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides.
  • a typical primer may include ribonucleotides.
  • the primer must be sufficiently long to prime the synthesis of an extension product in the presence of a polymerization agent.
  • the appropriate primer length depends on several factors, including, for example, temperature, the application, and the source of the primer.
  • annealing or “priming” refer to the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.
  • dimer-forming primer means a primer that can partially hybridize with another dimer-forming primer, other than a template, under certain conditions and be extended in the presence of a nucleic acid polymerase.
  • the present invention analyzes the activity of a 5' nuclease by utilizing the formation of a dimer-forming primer pair and probes into a dimer-primer and probe complex, and the 5' nuclease degrading the 5' ends of the probes of the complex. Therefore, according to the present invention, primer extension is not required.
  • the active assay composition does not contain dNTPs or NTPs.
  • the activity assay composition does not contain dNTPs or NTPs.
  • primer pair means a pair of two primers that partially hybridize to each other, such as a first primer and a second primer.
  • annealing or “hybridization” as used in the context of dimer-forming primers means the apposition of the 3'-dimer forming region of the second primer to the 3'-dimer forming region of the first primer.
  • each of the first primer and the second primer comprises a 5'-probe-hybridizing region and a 3'-dimer-forming region in the 5' to 3' direction;
  • the nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, and the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes.
  • the dimer-forming primer pair used in the present invention comprises two primers, namely a first primer and a second primer.
  • the dimer-forming primer pair is composed of a first primer and a second primer.
  • first primer and “second primer” are intended to specify two distinct primers. It should be understood that these terms do not refer to specific primers and do not impart any particular order, meaning, preference, or the like to the primers. Furthermore, unless otherwise indicated, the terms “first primer” and “second primer” may be used interchangeably with “first dimer-forming primer” and “second dimer-forming primer.”
  • each of the first primer and the second primer includes a 5'-probe-hybridizing region and a 3'-dimer-forming region in the 5' to 3' direction.
  • the term "5'-probe-hybridization region” refers to a region located at the 5' end of a dimer-forming primer, excluding the 3'-dimer-forming region, to which a probe can hybridize under specific hybridization conditions.
  • the 5'-probe-hybridization region of a dimer-forming primer has a nucleotide sequence that is non-complementary to the 3'-dimer-forming region of another dimer-forming primer.
  • non-complementary means that the primer or probe is sufficiently non-complementary that it will not selectively hybridize to a target nucleic acid sequence under given annealing conditions or stringent conditions, and includes both “substantially non-complementary” and “perfectly non-complementary,” and in particular means perfectly non-complementary.
  • non-complementary means that the 5'-probe-hybridized region of the dimer-forming primer is sufficiently non-complementary that it will not selectively hybridize to the entire sequence of another dimer-forming primer under given annealing conditions or stringent conditions, and includes both "substantially non-complementary” and "perfectly non-complementary,” and in particular means perfectly non-complementary.
  • 3'-dimer forming region refers to a region located at the 3' end of a dimer-forming primer, which can form a dimer by hybridizing with the 3'-dimer forming region of another dimer-forming primer under specific hybridization conditions. That is, the 3'-dimer forming region refers to a region at the 3' end of a dimer-forming primer having a nucleotide sequence that can hybridize with the 3'-dimer forming region of another dimer-forming primer.
  • hybridizing refers to the formation of a double-stranded nucleic acid from complementary single-stranded nucleic acids. Hybridization can occur between two nucleic acid strands that are completely identical or substantially identical with some mismatch. The degree of complementarity for hybridization may vary depending on hybridization conditions, particularly temperature.
  • Hybridization between dimer-forming primers or hybridization with a probe in the 5'-probe-hybridization region of a dimer-forming primer can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength can vary depending on various factors, including the length and GC content of the dimer-forming primer or probe. For example, when using a dimer-forming primer pair with a relatively short dimer-forming region, it is preferable to select low stringency conditions.
  • the first primer has a 3'-dimer-forming region at the 3' end
  • the second primer has a 3'-dimer-forming region at the 3' end
  • the nucleotide sequence of the 3'-dimer-forming region of the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region of the second primer.
  • complementary when used in reference to the 3'-dimer-forming region of the first primer and the second primer means that the 3'-dimer-forming region of the first primer is sufficiently complementary to selectively hybridize to the 3'-dimer-forming region of the second primer under certain annealing conditions or stringent conditions, and encompasses the terms “substantially complementary” and "perfectly complementary”, specifically perfectly complementary.
  • the 3'-dimer-forming regions of the first primer and the second primer have nucleotide sequences that are substantially complementary to each other.
  • each of the 3'-dimer-forming regions of the first primer and the second primer has at least one non-complementary nucleotide, as long as the non-complementary nucleotide does not significantly affect hybridization between the 3'-dimer-forming regions.
  • each of the 3'-dimer-forming regions of the first primer and the second primer may have 5, 4, 3, 2, or 1 non-complementary nucleotide, depending on its length.
  • the first primer has a 5'-probe-hybridization region at the 5' end
  • the second primer has a 5'-probe-hybridization region at the 5' end
  • the nucleotide sequence of the 5'-probe-hybridization region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes.
  • complementary when used in reference to the 5'-probe-hybridizing regions of the first primer and the second primer means that the probes are sufficiently complementary to selectively hybridize to the 5'-probe-hybridizing regions of each of the first primer and the second primer under specific annealing conditions or stringent conditions, and encompasses the terms “substantially complementary” and "perfectly complementary”, specifically perfectly complementary.
  • the 5'-probe-hybridizing region of each of the first primer and the second primer and each of the probes have nucleotide sequences that are substantially complementary to each other.
  • the 5'-probe-hybridization region and the probe of each of the first primer and the second primer have at least one non-complementary nucleotide, as long as the non-complementary nucleotide does not significantly affect hybridization between the 5'-probe-hybridization region and the probe.
  • the 5'-probe-hybridization region and the probe of each of the first primer and the second primer may have 5, 4, 3, 2, or 1 non-complementary nucleotide, depending on its length.
  • the 5'-probe-hybridizing region of the first primer may be any sequence, as long as it has a sequence non-complementary to the 3'-dimer-forming region of the second primer.
  • the 5'-probe-hybridizing region of the second primer may be any sequence, as long as it has a sequence non-complementary to the 3'-dimer-forming region of the first primer.
  • each of the first primer and the second primer constituting the dimer-forming primer pair of the present invention do not require any specific length.
  • each of the first primer and the second primer is 7 to 100 nucleotides in length.
  • the length of the first primer and the second primer ranges from at least 7, 10, 15, 20, 30, 50, 60, or 80 nucleotides to at most 100, 80, 70, 60, 50, 40, 35, 30, 25, 20, 15, or 10 nucleotides.
  • each of the first primer and the second primer can be 7-40, 7-60, 7-80, 7-100, 10-40, 10-60, 10-80, 10-100, 15-40, 15-60, 15-80, 15-100, 20-40, 20-60, 20-80, 20-100, 30-40, 30-60, 30-80 or 30-100 nucleotides in length.
  • each of the 5'probe-hybridizing regions of the first primer and the second primer is 3 to 50 nucleotides in length.
  • each of the 3'-dimer-forming regions of the first primer and the second primer is 3 to 50 nucleotides in length.
  • the 5'-probe-hybridizing region or the 3'-dimer-forming region of each of the first primer and the second primer is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50 nucleotides in length.
  • the 5'-probe-hybridizing region or 3'-dimer-forming region of each of the first primer and the second primer may be 3-50, 3-40, 3-35, 3-30, 3-25, 3-20, 3-17, 3-15, 3-12, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-50, 4-40, 4-35, 4-30, 4-25, 4-20, 4-17, 4-15, 4-12, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-17, 5-15, 5-12, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-40, 6-35, 6-30, 6-25, 6-20, 6-17, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-50, 7-40, 7-35, 7-30, 7-25, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-50
  • the 5'-probe-hybridizing region or the 3'-dimer-forming region of each of the first primer and the second primer is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides or 10 nucleotides in length.
  • the length of the 5'-probe-hybridization region of the first primer and the second primer described above refers to the range from the nucleotide at the 5' end (including the nucleotide at the 5' end) to a specific nucleotide in the 3' direction.
  • the 5'-probe-hybridization region ranges from the first nucleotide at the 5' end to the fifth nucleotide (including the first and fifth nucleotides).
  • the length of the 3'-dimer-forming region of the first primer and the second primer described above refers to the range from the nucleotide at the 3' end (including the nucleotide at the 3' end) to a specific nucleotide in the 5' direction. For example, if the 3'-dimer-forming region is 5 nucleotides in length, the 3'-dimer-forming region is the range from the first nucleotide at the 3' end to the fifth nucleotide (including the first and fifth nucleotides).
  • the first primer and the second primer constituting the dimer-forming primer pair may be composed of naturally occurring dNMPs.
  • the first primer and the second primer may comprise modified nucleotides or non-natural nucleotides, such as Peptide Nucleic Acid (PNA, see PCT Application No. WO 92/20702) and Locked Nucleic Acid (LNA, see PCT Application Nos. WO 98/22489, WO 98/39352, and WO 99/14226).
  • the first primer and the second primer may comprise universal bases such as deoxyinosine, inosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole.
  • the term "universal base” means that it can form base pairs with each of the natural DNA/RNA bases almost indiscriminately.
  • the modified nucleotide, non-natural nucleotide, or universal base may be present continuously or non-continuously within the dimer-forming primer.
  • the number of the modified nucleotide, non-natural nucleotide, or universal base may be 1-8, 1-5, 1-3, or 1-2.
  • the modified nucleotide, non-natural nucleotide, or universal base may be present at any position within the dimer-forming primer.
  • the modified nucleotide, non-natural nucleotide, or universal base may be located in the 5'-probe-hybridizing region, the 3'-dimer-forming region, or both.
  • the sequences located on the left and right of the modified nucleotide, non-natural nucleotide, or universal base are complementary to each other and can hybridize with each other to form a stem structure.
  • the first primer and/or the second primer constituting the dimer-forming primer pair used in the present invention may comprise a labeling system suitable for the selected signaling method.
  • step (b) The signaling scheme and labeling system for the first primer and/or the second primer are described in detail in step (b).
  • An activity assay composition used in the present invention comprises probes.
  • probe refers to a single-stranded nucleic acid molecule comprising a portion or portions complementary to a target nucleic acid sequence.
  • the probes included in the active assay composition represent single-stranded nucleic acid molecules that hybridize to the 5'probe-hybridization region of each of the first primer and the second primer.
  • the probe used in the present invention may have a conventional probe structure consisting of a sequence that hybridizes to the 5'probe-hybridization region of each of the first primer and the second primer.
  • the probe used in the present invention may have a unique structure.
  • the probe used in the present invention may have the structure of a molecular beacon probe, a high-beacon probe, a tagging probe, and a PTO probe (see WO 2012/096523).
  • the probe used in the present invention may be a conventional probe or a modified probe such as a degenerate base-containing probe and/or a universal base-containing probe.
  • a conventional probe or a modified probe such as a degenerate base-containing probe and/or a universal base-containing probe.
  • modified probe refers to a general probe that does not introduce a degenerate base or an unnatural base.
  • Degenerate bases that can be introduced into the primer as well as the probe include various degenerate bases known in the art: R: A or G; Y: C or T; S: Gor C; W: A or T; K: G or T; M: A or C; B: C or G or T; D: A or G or T; H: A or C or T; V: A or C or G; N: A or C or G or T.
  • Universal bases that can be introduced into the primer as well as the probe include various universal bases known in the art: deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-Aminobenzimidazole, 4-Aminobenzimidazole, Deoxynebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-
  • the probes are 3 to 50 nucleotides in length. In one embodiment of the present invention, the probes are 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, or 50 nucleotides in length.
  • the probes are 3-50, 3-40, 3-35, 3-30, 3-25, 3-20, 3-17, 3-15, 3-12, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-50, 4-40, 4-35, 4-30, 4-25, 4-20, 4-17, 4-15, 4-12, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-17, 5-15, 5-12, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-40, 6-35, 6-30, 6-25, 6-20, 6-17, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-50, 7-40, 7-35, 7-30, 7-25, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-50, 8-40, 8-35, 7-30
  • Dimer-forming primers and probes can be blocked at their 3'-ends to prevent extension.
  • Blocking can be achieved using conventional methods. For example, blocking can be achieved by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide.
  • blocking can be achieved by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.
  • the first primer and the second primer form a dimer-primer in which a dimer is formed through hybridization between the 3'-dimer forming regions of the first primer and the second primer, and each of the probes hybridizes to the 5'-probe-hybridizing regions of the first primer and the second primer, which are both strands of the dimer-primer, to form a dimer-primer and probe complex.
  • the dimer-primer and probe complex formed from the dimer-forming primer pair and probes included in the active assay composition comprises (i) formation of a dimer-primer by hybridization of the dimer-forming primer pair; and (ii) formation of a dimer-primer and probe complex by hybridization of the dimer-primer and probe (see FIGS. 2 and 3 ).
  • a pair of dimer-forming primers hybridizes with each other. Specifically, the first primer and the second primer hybridize with each other due to complementarity between their 3'-dimer-forming regions to form a dimer-forming primer.
  • Each of the first primer and the second primer comprises (i) a 5'-probe-hybridizing region and (ii) a 3'-dimer-forming region in the 5' to 3' direction, such that in the hybridization process to form a dimer-primer, the 3'-dimer-forming region is involved in hybridization, but the 5'-probe-hybridizing region is not involved in hybridization (see Figures 2 and 3).
  • the dimer-primer formed by hybridization between the 3'-dimer forming regions of the first primer and the second primer is as follows:
  • This dimer form represents a form in which the first primer and the second primer are partially hybridized (partially overlapped) through the 3'-dimer-forming regions of the two primers.
  • This dimer form may be referred to as a partial dimer.
  • a primer-dimer formed by partial hybridization between a first primer and a second primer has a distinct tripartite structure comprising (i) a single-stranded portion comprising the first primer; (ii) a double-stranded portion comprising the first primer and the second primer; and (iii) a single-stranded portion comprising the second primer, wherein the single-stranded portions of the first primer and the second primer include a 5’-probe-hybridization region.
  • Hybridization of the aforementioned dimer-forming primer pair can be performed under conditions that allow hybridization of the first primer and the second primer.
  • Each of the probes hybridizes to the 5'-probe-hybridization region of each of the first primer and the second primer, which are both strands of the above dimer-primer, to form a dimer-primer and probe complex, specifically as follows:
  • Each of the first primer and the second primer comprises (i) a 5'-probe-hybridization region and (ii) a 3'-dimer-forming region in the 5' to 3' direction, such that in the hybridization process to form a dimer-primer and probe complex, the 5'-probe-hybridization region is involved in hybridization (see Figures 2 and 3).
  • Hybridization of the 5’-probe-hybridization region of each of the first primer and the second primer and the probe described above can be performed under conditions that allow hybridization of the probe with the single-stranded region of each of the first primer and the second primer.
  • Fig. 3 illustrates the operating mechanism of a self-dimer primer-probe complex according to one embodiment of the present invention.
  • the interval between the 3' end of the primer and the 5' end of the probe adjacent to the 3' end of the primer is 0 to 15 nucleotides in length.
  • the interval may be 0-13 nucleotides in length, 0-11 nucleotides in length, 0-9 nucleotides in length, 0-7 nucleotides in length, 0-5 nucleotides in length, 0-3 nucleotides in length, 0-1 nucleotide in length, or 0 nucleotide in length.
  • the dimer-forming primer pair is a self-dimer-forming primer pair
  • each of the first primer and the second primer is a self-dimer-forming primer
  • the 3'-dimer-forming region is a 3'-hairpin-forming region
  • the dimer-forming dimer-primer is a self-dimer-forming self-dimer-primer
  • the dimer-primer and probe complex is a self-dimer-primer and probe complex.
  • self-dimer-forming primer means a primer that can partially hybridize two self-dimer-forming primers of identical sequence to each other to form a self-dimer under certain conditions.
  • self-dimer as used herein means a dimer formed by partial hybridization, i.e., inter-strand hybridization, of two self-dimer-forming primers of identical sequence.
  • the active assay composition does not contain dNTPs or NTPs, or the 3'-end of the self-dimer-forming primer is blocked, so the self-dimer-forming primer does not extend.
  • the self-dimer-forming primer comprises (i) a 5'-probe-hybridizing region and (ii) a 3'-hairpin-forming region in the 5' to 3' direction. That is, the 3'-dimer-forming region of the dimer-forming primer is a 3'-hairpin-forming region in the self-dimer-forming primer (see FIG. 2).
  • the 5'-probe-hybridizing region of the self-dimer-forming primer has a nucleotide sequence that is substantially non-complementary to the 5'-probe-hybridizing region and 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence. Therefore, the 5'-probe-hybridizing region of the self-dimer-forming primer does not substantially hybridize to the 5'-probe-hybridizing region or 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence.
  • non-complementary in relation to the 5’-probe-hybridizing region of a self-dimer-forming primer means that the 5’-probe-hybridizing region of the self-dimer-forming primer is sufficiently non-complementary that it will not selectively hybridize to any region of a self-dimer-forming primer of the same sequence under given annealing conditions or stringent conditions, and includes both “substantially non-complementary” and “perfectly non-complementary,” and in particular means perfectly non-complementary.
  • the 5'-probe-hybridizing region of the self-dimer-forming primer does not have a self-complementary sequence. Therefore, the 5'-probe-hybridizing region does not form a hairpin (hairpin dimer).
  • 3’-hairpin-forming region used herein in relation to a self-dimer-forming primer refers to a region located at the 3’ end of the self-dimer-forming primer.
  • the term refers to a region capable of forming a hairpin (hairpin dimer) at a first temperature and forming a self-dimer at a second temperature (see FIG. 2 ).
  • the 3'-hairpin-forming region of the self-dimer-forming primer forms a hairpin dimer at a first temperature.
  • hairpin or "hairpin dimer” as used herein refers to a structure having a double-stranded portion formed through intra-hybridization due to self-complementary sequences in the 3'-hairpin-forming region at a first temperature.
  • the term refers to a structure having a double-stranded portion formed by a single self-dimer-forming primer.
  • the structure of the hairpin dimer is illustrated in FIG. 2.
  • the 3'-hairpin-forming region of the self-dimer-forming primer forms a hairpin dimer having a double-stranded portion through intrastrand hybridization.
  • the first temperature is determined by considering the melting temperature (Tm) of the hairpin dimer. Specifically, the first temperature may be equal to or lower than the Tm of the hairpin dimer. At a temperature equal to or lower than the Tm of the hairpin dimer, the 3'-hairpin-forming region of the self-dimer-forming primer may form a hairpin dimer as in FIG. 2 or may form a self-dimer as in FIG. 2.
  • Tm melting temperature
  • the Tm of the hairpin dimer is lower than that of the self-dimer. Therefore, at temperatures below the Tm of the hairpin dimer, a self-dimer can be formed in addition to the hairpin dimer.
  • the 3'-hairpin-forming region of the self-dimer-forming primer forms a self-dimer at a second temperature.
  • self-dimer refers to a structure having a double-stranded portion formed through hybridization, i.e., inter-hybridization, between the 3’-hairpin-forming regions of two self-dimer-forming primers at a second temperature.
  • hybridization i.e., inter-hybridization
  • FIG. 2 The structure of the self-dimer is illustrated in FIG. 2.
  • the 3'-hairpin-forming region of the self-dimer-forming primer forms a self-dimer having a double-stranded portion through strand hybridization.
  • the second temperature is determined by considering the Tm of the self-dimer. Specifically, the second temperature may be equal to or lower than the Tm of the self-dimer. At a temperature equal to or lower than the Tm of the self-dimer, the 3'-hairpin-forming region of the self-dimer-forming primer can form a self-dimer, as shown in FIG. 2.
  • the second temperature is determined by considering the Tm of the self-dimer and the Tm of the hairpin dimer.
  • the second temperature may be a temperature higher than the Tm of the hairpin dimer and equal to or lower than the Tm of the self-dimer.
  • the 3'-hairpin-forming region of the self-dimer-forming primer does not form a hairpin dimer as in FIG. 2, but at a temperature equal to or lower than the Tm of the self-dimer, the 3'-hairpin-forming region of the self-dimer-forming primer can form a self-dimer as in FIG. 2.
  • the second temperature is higher than the first temperature.
  • the 3'-hairpin-forming region of the self-dimer-forming primer may have a nucleotide sequence that can hybridize with the 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence.
  • the self-dimer-forming primer may be composed of naturally occurring dNMPs.
  • the self-dimer-forming primer may include modified nucleotides or non-natural nucleotides, such as Peptide Nucleic Acid (PNA, see PCT Application No. WO 92/20702) and Locked Nucleic Acid (LNA, see PCT Application Nos. WO 98/22489, WO 98/39352, and WO 99/14226).
  • the self-dimer-forming primer may include universal bases, such as deoxyinosine, inosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole.
  • universal base means one that can form base pairs with each of the natural DNA/RNA bases with almost no distinction.
  • the modified nucleotide, non-natural nucleotide, or universal base may be present consecutively or non-consecutively within the self-dimer-forming primer.
  • the number of the modified nucleotide, non-natural nucleotide, or universal base may be 1-5, 1-3, or 1-2.
  • the modified nucleotide, non-natural nucleotide, or universal base may be present at any position within the self-dimer-forming primer.
  • the modified nucleotide, non-natural nucleotide, or universal base may be located in the 5'-probe-hybridizing region, the 3'-hairpin-forming region, or both.
  • a self-dimer-forming primer may include any additional sequence in addition to the 5'-probe-hybridizing region and the 3'-hairpin-forming region.
  • the additional sequence is located 5' to the 5'-probe-hybridizing region, does not serve as a template, and does not hybridize with another self-dimer-forming primer.
  • the additional sequence may include a blocker to prevent primer extension.
  • a self-dimer-primer is formed by hybridization between the 3'-dimer forming regions of the above self-dimer-forming primer pair.
  • Each probe hybridizes to the 5'-probe-hybridization region of each of the self-dimer-forming primers, which are both strands of the self-dimer-primer, to form a self-dimer-primer and probe complex.
  • the dimer-primer and probe complex is formed by heating the active assay composition to a high temperature and then cooling it.
  • the dimer-forming primer pairs and probes included in the active assay composition used in the present invention can be converted into single-stranded states. Thereafter, the heated resultant can be cooled to a temperature lower than the incubation temperature to induce the formation of dimer-primer and probe complexes.
  • the above high temperature is a temperature that can make the dimer-forming primer pair and probes into a single-stranded state as described above.
  • the above high temperature is a temperature higher than the incubation temperature.
  • the above high temperature is a temperature selected from 90-100°C, and more specifically selected from 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, 97°C, 98°C, 99°C, 100°C, and any value therebetween.
  • the above cooling temperature is a temperature lower than the incubation temperature, and is a temperature selected from 15-70°C, specifically a temperature selected from 15-50°C, and more specifically a temperature selected from 15-30°C.
  • the method of the present invention comprises the step of (b) adding the 5' nuclease to the active assay composition and incubating the resultant.
  • the 5' ends of the probes of the dimer-primer and probe complex are degraded by the 5' nuclease, thereby providing a detectable signal.
  • incubation means placing the provided active assay composition under conditions in which the 5’ nuclease to be assayed for activity can recognize and degrade the structure of the target.
  • the dimer-forming primer pair and probes included in the active assay composition may, depending on the temperature, (i) exist in a single-stranded state, or (ii) exist as a dimer-primer and probe complex formed by hybridization between the 3'-dimer forming regions of the first primer and the second primer, which are the dimer-forming primer pair, as shown in FIGS. 2 and 3, and each of the probes hybridizes to the 5'-probe-hybridization regions of each of the first primer and the second primer, which are both strands of the dimer-primer.
  • the dimer-primer and probe complex exists before the incubation according to the present invention.
  • the 5' ends of the probes of the dimer-primer and probe complex are degraded by the added 5' nuclease, thereby providing a detectable signal.
  • the incubation is performed isothermally, in which a 5' nuclease operates to degrade the 5' ends of the probes of the formed dimer-primer and probe complex.
  • the 5' nuclease operates and the dimer-forming primer hybridizes the probe to the 5'-probe hybridization region under isothermal conditions without forming a hairpin dimer by intra-strand hybridization.
  • the incubation is performed isothermally so that the dimer-forming primer pair and probes do not exist in a single-stranded state.
  • the operation of the 5' nuclease and the maintenance of the structure of the dimer primer and probe complex for the operation of the 5' nuclease can be achieved by controlling the temperature of the incubation.
  • the temperature for incubation to achieve the above purpose can be selected by considering the temperature for the operation of the 5' nuclease and the Tm value of the 3'-dimer-forming region of the dimer-forming primer and the Tm value of the 5'-probe-hybridization region of the primer to maintain the structure of the dimer primer and probe complex.
  • the temperature for incubation may be within the optimal activity temperature of the 5' nuclease to be analyzed for its operation. Therefore, the incubation temperature may vary depending on the optimal activity temperature of the 5' nuclease to be analyzed.
  • the temperature for incubation is higher than the Tm of the hairpin dimer for non-formation of the hairpin dimer.
  • the temperature for incubation is lower than the Tm of the 3'dimer-forming region of the dimer-forming primer for formation of dimers between the 3'dimer-forming regions.
  • the temperature for incubation is lower than the Tm of the 5'-probe-hybridization region of each of the dimer-forming primer pairs, which are both strands of the dimer-primer, such that each of the probes hybridizes to the 5'-probe-hybridization region.
  • the isotherm for incubation is a temperature selected from 65 to 80°C. In a specific embodiment, the isotherm for incubation is about 65°C. In a specific embodiment, the isotherm for incubation is about 72°C.
  • the incubation is performed for 30 to 60 minutes.
  • the incubation time may be adjusted in consideration of the time it takes for the function of time versus signal (or the function of signal versus time) to reach a plateau, or the time it takes for the function of time versus signal to exhibit a linear function. For example, if the time it takes for the function (plot) of time versus signal to reach a plateau for a specific 5' nuclease exceeds 60 minutes, the incubation time may be set to exceed 60 minutes for a 5' nuclease of the same or similar type.
  • the incubation time may be set to within 30 minutes for a 5' nuclease of the same or similar type.
  • the incubation can be performed in various known incubators.
  • the incubator is performed in a variety of amplification devices used in nucleic acid amplification reactions.
  • the amplification devices may include a temperature-controlled thermocycler and a detector capable of detecting a signal.
  • Typical amplification devices are programmed to continuously vary the temperature, for example, to perform PCR, but the amplification devices can be used in the method of the present invention by programming them to maintain the temperature isothermally.
  • Examples of amplification devices that can be used include CFX (Bio-Rad), iCycler (Bio-Rad), LightCycler (Roche), StepOne (ABI), 7500 (ABI), ViiA7 (ABI), QuantStudio (ABI), and AriaMx (Agilent).
  • the 5' end of the probe of the dimer-primer and probe complex is degraded by the 5' nuclease, thereby providing a detectable signal.
  • signal means any signal, particularly a fluorescent signal, that can indicate the occurrence of degradation of the 5’ end of a probe.
  • the signal includes the generation (or disappearance) of a signal from a label, or a change (increase or decrease) in a signal.
  • the detectable signal may be generated by a label(s) or label system.
  • Detectable signals can be generated using a variety of signal-generating means (i.e., labeling systems) well known in the art.
  • the detectable signal is provided by (i) a dual label linked to each of the probes, or (ii) a label linked to the first primer and/or the second primer and a label linked to each of the probes.
  • a labeling system useful in the present invention can be described in detail as follows.
  • the above double label is an intrastrand interactive double label.
  • An interactive labeling system refers to a signal generating system in which energy is non-radioactively transferred between a donor molecule and an acceptor molecule.
  • a representative example of an interactive labeling system is a fluorescence resonance energy transfer (FRET) labeling system, which includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule).
  • FRET fluorescence resonance energy transfer
  • the energy donor is fluorescent, while the energy acceptor can be either fluorescent or non-fluorescent.
  • the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent.
  • the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the energy acceptor is fluorescent.
  • the donor molecule and the acceptor molecule may be the reporter molecule and the quencher molecule, respectively, described above.
  • the signal indicating the occurrence of degradation of the 5' end of the probe is generated by the interactive labeling system, more specifically, by the FRET labeling system (i.e., the interactive dual labeling system).
  • a probe is coupled to an interactive dual label comprising a reporter molecule and a quencher molecule, and when the 5'-ends of the probes of the dimer-primer and probe complex are cleaved by the 5'-nuclease in step (b), a change in a signal from the interactive dual label is caused, thereby providing a detectable signal.
  • the reporter molecule and the quencher molecule on the probe are brought into close proximity to each other, so that the quencher molecule quenches the signal from the reporter molecule, and when the 5'-ends of the probes are cleaved, the reporter molecule and the quencher molecule are separated from each other, so that the quencher molecule unquenches the signal from the reporter molecule, thereby causing a change in the signal from the interactive dual label.
  • the reporter molecule and the quencher molecule on the probe are spaced apart from each other so that the quencher molecule unquenches the signal from the reporter molecule, and the resulting signal is background-corrected, and when the 5' ends of the probes are cleaved, the reporter molecule and the quencher molecule are spaced apart so that the quencher molecule unquenches the signal from the reporter molecule, resulting in a signal change from the interactive dual label.
  • Figure 3 illustrates an embodiment of the present invention using an interactive dual label.
  • a quencher molecule on the probe in close proximity quenches a signal from a reporter molecule, and when the 5' ends of the probes of the dimer-primer and probe complex are cleaved by the 5' nuclease during the incubation step, the reporter molecule and the quencher molecule bound to the probe become separated from each other, causing the quencher molecule to unquench a signal from the reporter molecule, resulting in a change in the signal from the interactive dual label (e.g., an increase in the signal from the reporter molecule).
  • the reporter molecule and the quencher molecule are located at the 5'-end (or 3'-end) and the 3'-end (or 5'-end) of the probe.
  • one of the reporter molecule and the quencher molecule bound to the probe is located at the 5'-end or at a position 1-5 nucleotides apart from the 5'-end, and the other is located at a position that quenches or unquenches the signal of the reporter molecule depending on the conformation of the probe or the distance between the reporter molecule and the quencher molecule on the probe.
  • one of the reporter molecule and the quencher molecule bound to the probe is positioned at the 3'-terminus or at a position 1-5 nucleotides apart from the 3'-terminus, and the other is positioned at a position that quenches or unquenches the signal of the reporter molecule depending on the shape of the probe or the distance between the reporter molecule and the quencher molecule on the probe.
  • the reporter molecule and the quencher molecule are spaced apart from each other by no more than 50 nucleotides, more specifically by no more than 40 nucleotides, even more specifically by no more than 30 nucleotides, and even more specifically by no more than 20 nucleotides. In a more specific embodiment of the present invention, the reporter molecule and the quencher molecule are spaced apart by at least 4 nucleotides, more specifically by at least 6 nucleotides, even more specifically by at least 10 nucleotides, and even more specifically by at least 15 nucleotides.
  • the reporter molecule and quencher molecule used in the present invention may include any molecule known in the art.
  • Specific examples of the fluorescent labels are as follows: Cy2TM (506), YO-PROTM-1 (509), YOYOTM-1 (509), Calcein (517), FITC (518), FluorXTM (519), AlexaTM (520), Rhodamine 110 (520), Oregon GreenTM 500 (522), Oregon GreenTM 488 (524), RiboGreenTM (525), Rhodamine GreenTM (527), Rhodamine 123 (529), Magnesium GreenTM (531), Calcium GreenTM (533), TO-PROTM-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC (572), Magnesium OrangeTM (575), Phycoerythrin R
  • the present invention may utilize non-fluorescent black quencher molecules (or dark quencher molecules) capable of quenching fluorescence over a wide range of wavelengths or specific wavelengths. Examples include BHQ and DABCYL.
  • the reporter contains the FRET donor, and the quencher contains the other partner (acceptor) of FRET.
  • FRET fluorescein dye
  • rhodine dye is used as a quencher.
  • the first primer has one of the interactive dual labels comprising a reporter molecule and a quencher molecule, and a probe adjacent to the 3' end of the first primer has the other of the interactive dual labels.
  • the second primer has one of the interactive dual labels comprising a reporter molecule and a quencher molecule, and a probe adjacent to the 3' end of the second primer has the other of the interactive dual labels.
  • the principle of interactive dual labeling using a primer and a probe is as follows: In the dimer-primer and probe complex, since the first primer and the probe are hybridized in close proximity to the second primer, the reporter molecule and the quencher molecule in the first primer and the probe are adjacent, and the quencher molecule quenches a signal from the reporter molecule, and when the 5' end of the probe is cleaved by the 5' nuclease, the reporter molecule and the quencher molecule in the first primer and the probe are separated from each other, and a signal is generated from the reporter molecule.
  • the reporter molecule and the quencher molecule in the second primer and the probe are adjacent to each other, and the quencher molecule quenches a signal from the reporter molecule, and when the 5' end of the probe is degraded by the 5' nuclease, the reporter molecule and the quencher molecule in the second primer and the probe are separated from each other, and a signal is generated from the reporter molecule.
  • the first primer and the probe may be positioned immediately adjacent to the second primer (or the first primer) or 1-5 nucleotides apart from the second primer (or the first primer), as long as the first primer and the probe (or the second primer and the probe) hybridize to the second primer such that the quencher molecule can quench a signal from the reporter molecule.
  • the reporter molecule and the quencher molecule when the first primer and the probe (or the second primer and the probe) are hybridized adjacent to the second primer (or the first primer), the reporter molecule and the quencher molecule can bind to any position of the first primer and the probe (or the second primer and the probe) as long as the quencher molecule can quench a signal from the reporter molecule.
  • the reporter molecule or the quencher molecule can be bound to the 5'-end or a position 1-5 nucleotides apart from the 5'-end of the probe, and the quencher molecule or the reporter molecule can be bound to the 3'-end or a position 1-5 nucleotides apart from the 3'-end of the first primer that is hybridized adjacent to the probe.
  • the method of the present invention includes the step of (c) measuring the signal provided over time.
  • the change in the signal over time indicates the activity of the 5' nuclease.
  • Measurement of the above signal is performed in real time or at predetermined time intervals during incubation at one temperature, i.e. isothermally.
  • the signal intensity increases steadily during the initial incubation period, i.e., a constant signal change rate over time is observed.
  • the signal change rate gradually decreases, and eventually reaches 0.
  • the activity of 5' nuclease when the activity of 5' nuclease is present, it represents a function of time versus signal intensity (or signal intensity versus time) in which the signal intensity increases over time and then no longer increases, that is, a function of time versus signal change rate (or signal change rate versus time) in which the signal change rate has a constant value exceeding 0 and then gradually decreases to 0 as time passes.
  • the rate of change in the constant signal in the early time interval of incubation may vary depending on the activity of the 5′ nuclease used. For example, a 5′ nuclease with high activity will exhibit a high rate of change in the signal in the early time interval of incubation at the same concentration, whereas a 5′ nuclease with low activity will exhibit a low rate of change in the signal in the early time interval of incubation at the same concentration. Therefore, the level or extent of the constant signal change in the early time interval of incubation may indicate the activity of the nucleic acid polymerase.
  • the results of the measurement of the signal in step (c) are displayed as a plot of signal intensity (fluorescence value) versus incubation time (or signal intensity (fluorescence value) versus incubation time).
  • the change in the signal is measured for an initial time period of incubation.
  • the function of incubation time versus signal intensity exhibits a linear correlation, i.e. a first-order function.
  • the change in the signal is measured over a time period at which the function of the incubation time versus the signal intensity exhibits a linear function.
  • the change in signal over time is obtained by calculating the slope or first derivative (differentiation) of the linear function of signal intensity versus incubation time for the initial time interval of the incubation described above.
  • the activity of the 5' nuclease is provided as a slope measured in a range where the signal intensity increases linearly with respect to the incubation time depending on the concentration or mass of the 5' nuclease. More specifically, the signal intensity is converted into the amount of the digested probe.
  • the activity provided according to the present embodiment can be confirmed in FIGS. 5 and 8.
  • the value of the maximum signal appearing when the 5' ends of the probes in the dimer-primer and probe complex are cleaved is proportional to the total amount of probes contained in the active assay composition, and thus the value of the signal can be converted into the amount of cleaved probe (more specifically, the amount of free fluorescently labeled 5'-end nucleotide). Therefore, the change in signal over time can be converted into the amount of cleaved probe over time.
  • the amount of probe degraded during the unit time of the aforementioned incubation can indicate the activity of the 5' nuclease.
  • the 5' nuclease that degraded a greater amount of probe during the unit time can be said to have greater activity than the 5' nuclease that degraded a lesser amount of probe during the unit time.
  • the fluorescence intensity at the initial time for each concentration of 5' nuclease is calculated from the results of measuring the fluorescence value for each incubation time for each concentration of 5' nuclease, and then a graph is drawn for the change in the fluorescence intensity per unit time for each concentration of 5' nuclease, and then the fluorescence intensity is converted into the amount of probe, and the slope measured in the range where the change in the amount of the digested probe per unit time for each concentration of 5' nuclease increases linearly is provided as the activity (Unit) of 5' nuclease.
  • the activity (Unit) of the 5' nuclease means the amount of probe degraded per unit time at a given temperature (incubation temperature) per unit concentration (mass) of the 5' nuclease.
  • Taq DNA polymerase M0267S, NEB
  • DreamTaq DNA polymerase Thermo Scientific TM
  • Taq DNA polymerase Qiagen
  • TOYOBO rTth DNA polymerase
  • the concentration of the above 5' nuclease can be determined by various methods known in the art. For example, the concentration of the above 5' nuclease can be determined by the Bradford method, the BCA method, or A280 absorbance.
  • the present invention provides an activity assay composition of a 5' nuclease comprising:
  • the dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer being complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, and a dimer-primer formed by hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and
  • probes the nucleotide sequence of the 5'-probe-hybridization region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and each of the probes hybridizes to the 5'-probe-hybridization region of each of the first primer and the second primer, which are both strands of the dimer-primer, to form a dimer-primer and probe complex.
  • composition of the present invention is used to carry out the method of the present invention described above, and any description common between the two is omitted to avoid excessive complexity of the present specification.
  • the composition does not contain dNTPs or NTPs.
  • the dimer-forming primer pair is a self-dimer-forming primer pair
  • each of the first primer and the second primer is a self-dimer-forming primer
  • the 3'-dimer-forming region is a 3'-hairpin-forming region
  • the dimer-formed dimer-primer is a self-dimer-formed self-dimer-primer
  • the dimer-primer and probe complex is a self-dimer-primer and probe complex.
  • the composition further comprises (i) a dual label linked to each of the probes, or (ii) a label linked to the first primer and/or the second primer and a label linked to each of the probes.
  • the present invention utilizes two types of oligonucleotides, a dimer-forming primer pair and probes, thereby facilitating design since fewer factors need to be considered during design compared to conventional methods using primers, templates, and probes.
  • the dimer-primer and probe complex formed by hybridization of the dimer-forming primer pair and probes utilizes an environment in which 5' nucleases are active within PCR, thereby increasing the reliability and applicability of enzyme activity measured using the present invention.
  • the present invention greatly improves user convenience in terms of simplicity, speed, low cost and stability compared to the conventional method of determining a unit using a radioactive isotope.
  • the present invention can be applied to various nucleic acid polymerases including a 5' nuclease domain, and can be applied to analyzing the activity and purity during the production process of the polymerase and monitoring quality control, and can also be used as a basis for improving enzymes applied to PCR through research on the characteristics of 5' nucleases.
  • Figure 1 is a flowchart of processes for implementing the method of the present invention according to one embodiment of the present invention.
  • Figure 2 illustrates the formation of a self-dimer primer-probe complex according to one embodiment of the present invention.
  • Figure 3 shows the operating mechanism of a self-dimer primer-probe complex according to one embodiment of the present invention.
  • FIG. 4 shows a real-time fluorescence measurement graph for measuring the activity of a 5' nuclease of Taq DNA polymerase according to one embodiment of the present invention.
  • FIG. 5 shows a plot of fluorescence signal versus time for Taq DNA polymerase according to one embodiment of the present invention.
  • Figure 6 shows a real-time fluorescence measurement graph according to the presence or absence of a self-dimer primer according to one embodiment of the present invention.
  • Figure 7 shows a real-time fluorescence measurement graph for measuring the activity of various types of decomposition enzymes according to one embodiment of the present invention.
  • Figure 8 shows an activity profile analysis of various types of decomposition enzymes according to one embodiment of the present invention.
  • Self-dimer-forming primers are designed to form dimers with identical sequences, and to allow dual-labeled probes to hybridize to form a specific structure that can be recognized by 5'-nucleotide dehydrogenase. Since the 3'-hairpin-forming region of an oligonucleotide has a palindromic structure, a nucleic acid structure with a primer attached can be formed simply through dimerization without the introduction of an additional primer or template nucleic acid.
  • the 5'-probe hybridization region of the self-dimer-forming primers formed in this way is designed to allow a dual-labeled probe to bind to form a self-dimer-primer and probe complex (Fig. 2).
  • the region where the self-dimer-forming primers hybridize with each other or with the probe is designed to have a melting temperature (Tm) higher than 72°C, which is the activity measurement temperature of 5'-nucleotide dehydrogenase.
  • the gap between the 3' end of the self-dimer-forming primer and the 5' end of the dual-labeled probe can be designed to be 0 nucleotides or longer.
  • the 5' end of the dual-labeled probe may not necessarily hybridize but may form an overhang structure.
  • Example 2 Preparation of a composition for enzyme activity analysis
  • the self-dimer-forming primer #1, dual-labeled probe #1, 10X Ready buffer, and ultrapure water designed in Example 1 above were mixed, heated at 95°C for 3 minutes, and then cooled to room temperature for 20 minutes to prepare a 0.2 pmole/ ⁇ L self-dimer-primer and probe complex reagent.
  • composition for activity analysis including 0.8 pmole of the self-dimer-primer and probe complex reagent, 1X 5'-Exo buffer, and ultrapure water.
  • Example 2 To determine whether the composition for activity analysis prepared in Example 2 can be used to measure the activity of a 5' nuclease, it was analyzed against commercially available Taq DNA polymerase (M0267S, NEB) as a 5' nuclease.
  • the above Taq DNA polymerase (5 U/ ⁇ L) was diluted to concentrations of 1000 mU/ ⁇ L, 125 mU/ ⁇ L, 62.5 mU/ ⁇ L, 31.3 mU/ ⁇ L, 15.6 mU/ ⁇ L, and 7.8 mU/ ⁇ L using 10X ThermoPol reaction buffer and ultrapure water, respectively.
  • composition for activity analysis prepared in Example 2 Taq DNA polymerase at each concentration, and ultrapure water were mixed in a volume ratio of 10:1:9. All processes were performed at low temperature using ice.
  • Fig. 5 shows a plot of the fluorescence signal versus time for different concentrations of Taq DNA polymerase.
  • the fluorescence signal gradually increased over time and eventually reached an equilibrium state (stationary phase). This indicates that at the beginning of the incubation, fluorescence was emitted from the fluorophore that escaped the influence of the quencher as the 5' nuclease degraded the substrate dual-labeled probe, resulting in an increase in the fluorescence signal. However, once the substrate was completely degraded, the fluorescence signal stopped increasing. Therefore, the change in the fluorescence signal over time will indicate the amount of the dual-labeled probe degraded in the reaction.
  • the fluorophore that has escaped the influence of the quencher provides a detectable signal, thereby generating a plot of the fluorescence signal versus time as shown in FIG. 4.
  • the time and the fluorescence signal exhibit a linear correlation, i.e., a first-order function, and the rate of signal change can be calculated by differentiating this.
  • the amount of the degraded probe can be calculated proportionally to the increase rate of each fluorescence signal, and the amount of the degraded probe for a polymerase concentration (polymerase unit) per specific time, for example, 30 minutes, can be obtained.
  • the amount of degraded probe according to the concentration of Taq DNA polymerase is plotted and shown in Fig. 5. As seen in Fig. 5, since the concentration of polymerase and the amount of degraded probe show a linear correlation of a first-order function, the amount of probe degraded for 30 minutes according to the unit concentration of polymerase could be confirmed by the slope of the function.
  • the unit concentration of Taq DNA polymerase used in this example follows the activity unit of the polymerase determined by analysis using a radioisotope (the enzyme unit that consumes 15 nmole of dNTP in 30 minutes at 75°C as measured by a radioisotope). That is, this is a unit unrelated to the activity of the 5' nuclease, and was used as a standard for concentration in this example.
  • the concentration at which the activity of 1 unit of the polymerase is observed can be defined as the unit of the enzyme that degrades 1.36 pmole of probe in 30 minutes at 72°C according to this example.
  • Example 4 Differences in degradation activity depending on the presence or absence of a self-dimer-forming primer
  • a final 10 ⁇ L activity assay composition was prepared in the same manner as in Example 2. Each activity assay composition either contained a self-dimer-forming primer or did not contain one.
  • compositions for activity analysis were mixed with various concentrations of Taq DNA polymerase (NEB, M0267S) prepared in Example 3 and ultrapure water in a volume ratio of 10:1:9. All processes were performed at low temperature using ice.
  • Fig. 6 (a) shows a plot of the time versus fluorescence signal obtained by adding self-dimer-forming primer #1
  • Fig. 6 (b) shows a plot of the time versus fluorescence signal obtained without adding self-dimer-forming primer #1.
  • Bst DNA polymerase, large fragment (NEB, M075S) was diluted to concentrations of 10 mU/ ⁇ L, 5 mU/ ⁇ L, 2.5 mU/ ⁇ L, 1.25 mU/ ⁇ L, 0.63 mU/ ⁇ L, and 0.31 mU/ ⁇ L, and KlenTaq1 (DNA POLYMERASE TECHNOLOGY, 100) and Hemo KlenTaq (NEB, M0332S) were diluted to 1/40, 1/160, 1/320, 1/640, 1/1280, 1/2560, and 1/5120 of the stock solution. All of the above concentrations are the concentrations at which polymerase activity was normally observed in the polymerase activity evaluation using the EvaEZTM Fluorometric Polymerase Activity Assay Kit (Biotium, #29051).
  • composition for activity analysis prepared in Example 2 the DNA polymerase at each concentration, and ultrapure water were mixed in a volume ratio of 10:1:9. All processes were performed at low temperature using ice.
  • Fig. 7 (a) shows a plot of the time versus fluorescence signal obtained using DreamTaq DNA polymerase (Thermo Scientific TM )
  • Fig. 7 (b) shows a plot of the time versus fluorescence signal obtained using Taq DNA polymerase (Qiagen)
  • Fig. 7 (c) shows a plot of the time versus fluorescence signal obtained using rTth DNA polymerase (TOYOBO)
  • Fig. 7 (d) shows a plot of the time versus fluorescence signal obtained using Bst DNA polymerase, large fragment (NEB), Fig.
  • Fig. 7 (e) shows a plot of the time versus fluorescence signal obtained using KlenTaq1 (DNA POLYMERASE TECHNOLOGY), and Fig. 7 (f) shows a plot of the time versus fluorescence signal obtained using Hemo KlenTaq (NEB).
  • the concentration at which the activity of 1 unit of polymerase (consuming 10 nmole of dNTP for 30 minutes at 75°C) was observed through radioisotope measurement of each enzyme was confirmed to correspond to the level at which, according to this example, 1.28 pmole of probe was degraded at 72°C for 30 minutes for DreamTaq DNA polymerase (Thermo Scientific TM ), 0.80 pmole of probe was degraded at 72°C for 30 minutes for Taq DNA polymerase (Qiagen), and 1.77 pmole of probe was degraded at 72°C for 30 minutes for rTth DNA polymerase (TOYOBO).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 다이머-형성 프라이머 쌍 및 프로브들 두 종류의 올리고뉴클레오타이드를 이용하여 5'핵산분해효소의 활성을 분석하는 방법에 관한 것이다. 본 발명은 종래 프라이머, 주형, 프로브를 사용하는 방법에 비해 디자인 시 고려되어야 할 요소가 적어, 디자인이 용이하다. 또한, 다이머-형성 프라이머 쌍과 프로브들의 혼성화로 형성되는 다이머-프라이머 및 프로브 복합체는 PCR 내에서 5'핵산분해효소가 활동하는 환경을 구사하여, 본 발명을 이용해 측정된 효소 활성의 신뢰도 및 응용성이 높다. 본 발명은 종래 방사선 동위원소를 사용하여 유닛을 결정하는 방법에 비해, 간단하고 신속하며, 낮은 비용 및 안정성 측면에서 사용자 편의성을 크게 개선한다.

Description

5′핵산분해효소의 활성을 분석하는 방법
관련출원에 대한 교차참조
본 특허출원은 2024년 06월 25일에 대한민국 특허청에 출원된 대한민국 특허출원 제2024-0083097호에 대하여 우선권을 주장하며, 상기 특허출원들의 개시 사항은 본 명세서에 참조로서 삽입된다.
기술분야
본 발명은 5'핵산분해효소(nuclease)의 활성을 분석하는 방법 또는 5'핵산분해효소의 활성 어세이 조성물에 관한 것이다.
분자 진단은 DNA나 RNA와 같은 핵산을 분석하는 체외진단 기술 중 하나로, 특정 유전자나 바이러스의 존재를 확인하기 위해 사용되고 있다. 분자 진단의 가장 대표적인 방법인 중합효소연쇄반응(PCR)은 1983년 캐리 멀리스(Kary B Mullis)에 의해 고안되었고, 지속적인 발전을 거듭하여 최근 COVID-19 팬데믹 대응에도 핵심적인 역할을 수행하였다. PCR은 일련의 온도 변화(주로 55℃~95℃)를 필요로 하는 과정으로, 이런 반응 환경에서 안정성을 유지할 수 있는 효소의 활용이 매우 중요하다. 이 때문에 고온에 안정적인 초호열균(Hyperthermophile)으로부터 유래한 중합효소가 주로 사용되며, T. aquaticus로부터 유래한 Taq DNA 중합효소가 대표적이다. 이런 효소들은 고온 환경에서도 안정적인 반응을 도와 PCR 기반의 분자진단이 더욱 정확하고 효율적으로 이루어질 수 있도록 한다(Chien A., Edgar D. B., Trela J. M. J. Bacteriol. 1976, 127, 1550-1557).
상기 기술된 Taq DNA 중합효소를 포함하여 몇몇 DNA 중합효소에는 새로운 DNA 가닥을 합성하는 중합효소 도메인과 더불어 핵산을 분해하는 핵산 외부 가수분해효소 도메인을 보유하고 있다. 핵산 외부 가수분해효소 도메인은 분해 방향에 따라 5'-3'핵산 외부 가수분해효소와 3'-5'핵산 외부 가수분해효소로 나뉜다. 이중, 5'핵산 외부 가수분해효소의 경우 DNA 복제 단계에서 지연 가닥에 존재하는 RNA 프라이머를 제거하거나, DNA 손상 복구 단계에서 손상된 뉴클레오타이드를 제거하는 역할을 수행한다(Arthur Kornberg, Tania A. Baker, DNA replication. 1991). 특히 PCR에서는 이 효소가 형광 프로브(Fluorescent Probe)를 특이적으로 분해하여, 실시간으로 정밀하고 특이적인 표적 검출을 가능하게 만든다(Pamela M. Holland, Proc. Natl. Acad. Sci. USA, Vol. 88, pp. 7276-7280).
핵산 외부 가수분해효소의 활성을 정량적으로 분석하는 방법은 일반적으로 단위 온도에서 단위 시간에 DNA의 말단으로부터 뉴클레오타이드를 유리시켜 산 가용성 분해물인 상태가 되는 것으로 한다. 이때, 뉴클레오타이드가 산 가용성 분해물이 되는 속도를 측정 대상 효소의 고유의 성질인 유닛(Unit)으로 정의한다. 예를 들어, 뉴 잉글랜드 바이오랩 사(New England Biolabs)의 T7 엑소뉴클레아제(Exonuclease)는 37℃에서 30분 동안 표적 DNA로부터 1 nmol의 뉴클레오타이드가 유리되어 산 가용성 분해물인 상태가 되는 것을 1 Unit으로 정의한다. 마찬가지로, 람다 엑소뉴클레아제(lambda exonuclease)와 엑소뉴클레아제(Exonuclease) I은 동일한 온도와 시간 조건에서 표적 DNA로부터 10 nmol의 뉴클레오타이드가 유리되어 산 가용성 분해물인 상태가 되는 것을 1 Unit으로 정의한다. 비록 회사나 제품에 따라 Unit의 정의가 온도, 기질의 양, 방사성 동위원소를 포함하는 물질의 종류 등에 따라 달라질 수 있지만, 모두 기질 소모량을 측정하거나 유리된 산 가용성 분해물의 양을 계산하여 반응 속도를 측정하는 공통된 방법을 사용하고 있었다.
마찬가지로, 5'핵산분해효소의 활성 또한 표적 DNA의 5'말단의 뉴클레오타이드가 유리되는 속도를 측정함을 통해 확인할 수 있었다. 역사적으로 5'핵산분해효소의 특성 혹은 활성을 확인하는 데에는 주로 방사성 동위원소가 사용되어왔다(Richard S. Murante. J. Biol. Chem, Vol. 269, No.2, Issue of January 14, pp. 1191-1196, 1994; Matthew J.Longley. Nucleic Acids Research, Vol. 18, No. 24 7317). 이 방법은 높은 정확성을 자랑하지만, 실험의 복잡성, 긴 수행 시간, 환경적 영향, 그리고 실험자의 건강에 대한 우려와 같은 단점을 보유하고 있어, 이에 대한 대안적 방법을 개발하는 연구가 활발히 진행 중에 있었다. 예를 들어, MALDI-TOF MS를 이용하여 형광단과 소광제가 각각 표지된 단일가닥을 혼성화시켜 중합효소와 반응시킨 후, 뉴클레오타이드가 유리되는 속도를 측정하는 방법(Qiuying Huang, Molecular and Cellular Probes, 23, 2009, 188-194)이 연구되었다. 또한 형광을 표지한 기질 DNA가 특정 온도에서 일정 시간 동안 효소에 의해 분해되는 정도를 전기영동을 통해 분석하고, 밴드 면적 정량적 비교를 통해 활성을 측정하려는 시도도 있었다.
상기 예시된 방법들은 M13mp2, M13mp18 등과 같은 단일 가닥 주형에 상보적으로 혼성화 되어있는 올리고뉴클레오타이드가 5'핵산분해효소에 의해 분해되는 효율을 측정하는데, 이를 위해 5'핵산분해효소의 최적 활성 온도에서 단위 시간 동안 올리고뉴클레오타이드의 5'말단 분해량을 측정한다. 하지만, 이러한 방법들이 기존 방사성 동위원소를 이용한 활성 측정법의 정확성 및 정량성을 대체하였다거나, 편리성이나 효율성의 측면을 개선시켰다고 볼 수 없었다. 또한, 5'핵산분해효소가 가진 특성을 정확히 반영하지 못했다는 단점을 가지고 있었다.
상술한 바와 같이, 5'핵산분해효소는 생체 내에서는 RNA 프라이머를 분해하는 역할을 수행하며, PCR 과정에서 형광이 표지된 프로브를 분해하여 실시간으로 특이적인 신호를 발현할 수 있도록 한다. 구체적으로는, 5'핵산분해효소는 이중가닥 핵산에 혼성화 된 올리고뉴클레오타이드의 5'말단을 분해한다. 특히, 5'핵산분해효소가 핵산 중합효소의 일부로 존재할 때에는 표적 올리고뉴클레오타이드의 상류에 올리고뉴클레오타이드가 존재해야 하며, 두 뉴클레오타이드 사이의 간격이 0 뉴클레오타이드 내외로 구성된 특이적 구조를 인지한다 (Victor lyamichev. Proc. Natl. Acad. Sci. USA, Vol. 96, pp. 6143-6148). 그렇기 때문에, 생체 내 혹은 PCR 과정에서 수행되는 5'핵산분해효소의 활성을 정확히 측정하기 위해서는 이러한 효소적 특성을 반영해야 할 필요가 있다.
이에, 본 발명자들은 이러한 효소적 특성을 반영하여 높은 정확도로 5'핵산분해효소의 활성을 분석하는 방법의 개발 필요성을 인식하였다.
본 명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 체외 진단, 특히 PCR과 같은 분자 진단에 사용되는 핵산 중합효소의 또 다른 활성인 5'핵산분해효소의 활성을 분석하는 방법을 개발하고자 노력하였다. 그 결과, 다이머-형성 프라이머 쌍 및 프로브들의 조합을 이용하여, 분석하고자 하는 5'핵산분해효소의 활성을 간편하게 결정할 수 있음을 확인함으로써, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 5'핵산분해효소(nuclease)의 활성을 분석하는 방법을 제공하는 데 있다.
본 발명의 다른 목적은 5'핵산분해효소(nuclease)의 활성 어세이 조성물을 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Ⅰ. 5'핵산분해효소(nuclease)의 활성을 분석하는 방법
본 발명의 일 양태에 따르면, 본 발명은 다음의 단계를 포함하는 5'핵산분해효소(nuclease)의 활성을 분석하는 방법을 제공한다:
(a) (ⅰ) 다이머-형성 프라이머(dimer-forming primer) 쌍 및 (ⅱ) 프로브들(probes)을 포함하는 활성 어세이 조성물(a composition for activity assay)을 제공하는 단계; 상기 다이머-형성 프라이머 쌍은 제 1 프라이머 및 제 2 프라이머를 포함하며, 상기 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함하고, 상기 제 1 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이며, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적이고, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머 형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고, 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)를 형성하며, 및
(b) 상기 5'핵산분해효소를 상기 활성 어세이 조성물에 첨가하고 이 결과물을 인큐베이션(incubation)시키는 단계; 상기 5'핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되어 검출가능한 시그널이 제공되고,
(c) 시간 경과에 따라 제공된 상기 시그널을 측정하는 단계; 상기 시간 경과에 따른 시그널의 변화는 상기 5'핵산분해효소의 활성을 나타낸다.
본 발명자들은 체외 진단, 특히 PCR과 같은 분자 진단에 사용되는 핵산 중합효소의 또 다른 활성인 5'핵산분해효소의 활성을 분석하는 방법을 개발하고자 노력하였다. 그 결과, 다이머-형성 프라이머 쌍 및 프로브들의 조합을 이용하여 분석하고자 하는 5'핵산분해효소의 활성을 간편하게 결정할 수 있음을 확인하였다.
본 발명의 일 구현예에 따르면, 상기 5'핵산분해효소는 프라이머-의존적 5'핵산분해효소이다. 이는 프라이머의 존재 하에 5'핵산분해효소의 활성을 나타냄을 의미한다.
본 발명의 일 구현예에 따르면, 상기 5'핵산분해효소는 엑소뉴클레아제(exonuclease) 또는 엔도뉴클레아제(endonuclease) 이다.
본 발명의 일 구현예에 따르면, 상기 5'핵산분해효소는 5'핵산분해효소의 활성을 갖는 DNA 중합효소 또는 플랩 엔도뉴클레아제(flap endonuclease: FEN)이다. 보다 구체적으로, 5'핵산분해효소의 활성을 갖는 열안정성 DNA 중합효소 또는 플랩 엔도뉴클레아제이다.
본 발명에 적합한 5'핵산분해효소의 활성을 갖는 DNA 중합효소는 다양한 박테리아종으로부터 얻은 열안정성 DNA 중합효소이고, 상기 DNA 중합효소는 Thermus aquaticus(Taq), Thermus thermophilus(Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus 및 Aquifex aeolieus으로 이루어진 군으로부터 선택된 박테리아로부터 유래된다. 가장 구체적으로, 열안정성 DNA 중합효소는 Taq 중합효소이다.
사용되는 플랩 엔도뉴클레아제는 5'플랩-특이적 뉴클레아제(5'flap-specific nuclease)이다.
본 발명에 적합한 플랩 엔도뉴클레아제는 다양한 박테리아 종으로부터 얻은 플랩 엔도뉴클레아제를 포함하며, 상기 플랩 엔도뉴클레아제는 Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix 및 Archaeaglobus veneficus로 구성된 군으로부터 선택되는 박테리아로부터 유래된다.
도 1은 본 발명의 일 구현예에 따라 본 발명의 방법을 실시하는 과정들의 흐름도이다. 본 발명의 방법을 도 1을 참조하여 설명하면 다음과 같다:
단계 (a): 활성 어세이 조성물을 제공( 110 )
우선, 본 발명의 방법은 (a) (ⅰ) 다이머-형성 프라이머(dimer-forming primer) 쌍 및 (ⅱ) 프로브들(probes)을 포함하는 활성 어세이 조성물(a composition for activity assay)을 제공하는 단계를 포함한다. 상기 다이머-형성 프라이머 쌍은 제 1 프라이머 및 제 2 프라이머를 포함하며, 상기 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함하고, 상기 제 1 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이며, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적이고, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머 형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고, 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)를 형성한다.
본 발명에 이용되는 활성 어세이 조성물(a composition for activity assay)은 (ⅰ) 다이머-형성 프라이머(dimer-forming primer) 쌍 및 (ⅱ) 프로브들(probes)을 포함한다.
본 명세서에서 용어 "프라이머"는 핵산 가닥(주형)에 상보적인 프라이머 연장 산물의 합성이 유도되는 조건, 즉, 뉴클레오타이드와 DNA 중합효소와 같은 중합제의 존재, 그리고 적합한 온도와 pH의 조건에서 합성의 개시점으로 작용할 수 있는 올리고뉴클레오타이드를 의미한다. 특히, 프라이머는 단일-가닥 데옥시리보뉴클레오타이드 분자이다. 본 발명에 사용되는 프라이머는 자연(naturally occurring) dNMP(즉, dAMP, dGMP, dCMP 및 dTMP), 변형 뉴클레오타이드 또는 비-자연 뉴클레오타이드를 포함할 수 있다. 또한, 통상적인 프라이머는 리보뉴클레오타이드를 포함할 수 있다.
프라이머는, 중합제의 존재 하에서 연장 산물의 합성을 프라이밍시킬 수 있을 정도로 충분히 길어야 한다. 프라이머의 적합한 길이는 예컨대, 온도, 응용분야 및 프라이머의 소스(source)를 포함한 복수의 요소에 따라 결정된다. 본 명세서에서 사용되는 용어 "어닐링" 또는 "프라이밍"은 주형 핵산에 올리고데옥시뉴클레오타이드 또는 핵산이 병치(apposition)되는 것을 의미하며, 상기 병치는 중합효소가 뉴클레오타이드를 중합시켜 주형 핵산 또는 그의 일부분에 상보적인 핵산 분자를 형성하게 한다.
본 명세서에서 사용되는 용어 "다이머-형성 프라이머"는 특정 조건 하에서 주형이 아닌 또 다른 다이머-형성 프라이머와 부분적으로 혼성화되어 핵산 중합효소의 존재 하에 연장될 수 있는 프라이머를 의미한다.
다만, 본 발명은 다이머-형성 프라이머(dimer-forming primer) 쌍과 프로브들이 다이머-프라이머 및 프로브 복합체를 형성하고, 5'핵산분해효소가 상기 복합체의 프로브들의 5'말단들을 분해하는 것을 이용하여 5'핵산분해효소의 활성을 분석한다. 따라서, 본 발명에 따르면, 프라이머의 연장이 필요하지 않다.
본 발명의 일 구현예에 따르면, 상기 활성 어세이 조성물은 dNTPs 또는 NTPs를 포함하지 않는다.
본 발명은 5'핵산분해효소의 활성을 분석하는데 있어 프라이머의 연장이 필요치 않으므로 활성 어세이 조성물은 dNTPs 또는 NTPs를 포함하지 않는다.
본 명세서에서 사용되는 용어 "다이머-형성 프라이머 쌍"은 서로 부분적으로 혼성화되는 2개의 프라이머의 쌍, 예컨대 제 1 프라이머 및 제 2 프라이머를 의미한다.
다이머-형성 프라이머의 문맥에서 사용되는 용어 "어닐링" 또는 "혼성화"는 제 1 프라이머의 3'-다이머 형성 영역에 제 2 프라이머의 3'-다이머 형성 영역이 병치(apposition)되는 것을 의미한다.
본 발명의 방법에 사용되는 다이머-형성 프라이머 쌍은 하기와 같은 특징을 갖는다:
(a) 제 1 프라이머 및 제 2 프라이머를 포함함;
(b) 상기 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함함; 및
(c) 상기 제 1 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이며, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적임.
본 발명에 이용되는 다이머-형성 프라이머 쌍은 2개의 프라이머, 즉 제 1 프라이머 및 제 2 프라이머를 포함한다. 본 발명의 일 구현예에 따르면, 다이머-형성 프라이머 쌍은 제 1 프라이머 및 제 2 프라이머로 구성된다.
본 명세서에서 "제 1 프라이머" 및 "제 2 프라이머"는 2개의 구별되는 프라이머를 특정하고자 하는 것이다. 상기 용어는 특정 프라이머를 가리키지 않으며 프라이머 간에 특별한 순서, 의미, 선호도 등을 부여하지 않는 것으로 이해되어야 한다. 또한, 달리 나타내지 않는 한, 제 1 프라이머 및 제 2 프라이머는 제 1 다이머-형성 프라이머 및 제 2 다이머-형성 프라이머와 상호교환적으로 사용될 수 있다.
본 발명에 이용되는 다이머-형성 프라이머 쌍에서, 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함한다.
본 명세서에서 용어 "5'-프로브-혼성화 영역"은 3'-다이머-형성 영역을 제외한 다이머-형성 프라이머의 5'말단에 위치하는 영역으로서, 특정 혼성화 조건하에서 프로브가 혼성화될 수 있는 영역을 나타낸다. 다이머-형성 프라이머의 5'-프로브-혼성화 영역은 다른 다이머-형성 프라이머의 3'-다이머-형성 영역과 비상보적인 뉴클레오타이드 서열을 갖는다.
용어 "비상보적"은 프라이머 또는 프로브가 소정의 어닐링 조건 또는 엄격 조건 하에서 타겟 핵산 서열에 선택적으로 혼성화되지 않을 정도로 충분히 비상보적인 것을 의미하며, "실질적으로 비상보적(substantially noncomplementary)" 및 "완전히 비상보적(perfectly non-complementary)"인 것을 모두 포괄하고, 특히 완전히 비상보적인 것을 의미한다. 예를 들어, 다이머-형성 프라이머의 5'-프로브-혼성화 영역과 관련하여 용어 "비상보적"은 다이머-형성 프라이머의 5'-프로브-혼성화 영역이 소정의 어닐링 조건 또는 엄격 조건 하에서 다른 다이머-형성 프라이머의 전체 서열에 선택적으로 혼성화되지 않을 정도로 충분히 비상보적인 것을 의미하며, "실질적으로 비상보적(substantially non-complementary)" 및 "완전히 비상보적(perfectly non-complementary)"인 것을 모두 포괄하고, 특히 완전히 비상보적인 것을 의미한다.
본 명세서에서 용어 "3'-다이머 형성 영역"은 다이머-형성 프라이머의 3'말단에 위치하는 영역으로서, 특정 혼성화 조건하에서 또 다른 다이머-형성 프라이머의 3'-다이머 형성 영역과 혼성화되어 다이머를 형성할 수 있는 영역을 나타낸다. 즉, 3'-다이머 형성 영역은 다른 다이머-형성 프라이머의 3'-다이머 형성 영역과 혼성화될 수 있는 뉴클레오타이드 서열을 갖는 다이머-형성 프라이머의 3'-말단의 영역을 가리킨다.
본 명세서에서 용어 "혼성화(hybridizing)"는 상보적인 단일 가닥 핵산들이 이중 가닥 핵산을 형성하는 것을 의미한다. 혼성화는 완전히 일치되거나 일부 미스매치를 가지는 실질적으로 일치된 2개의 핵산 가닥 사이에서 일어날 수 있다. 혼성화를 위한 상보성은 혼성화 조건, 특히 온도에 따라 달라질 수 있다.
다이머-형성 프라이머 간의 혼성화 또는 다이머-형성 프라이머의 5'-프로브-혼성화 영역에서의 프로브와의 혼성화는 최적화 절차에 의하여 일반적으로 결정되는 적합한 혼성화 조건 하에서 실시될 수 있다. 온도, 구성요소의 농도, 혼성화 및 세척 횟수, 버퍼 성분 및 이들의 pH 및 이온 세기와 같은 조건은 다이머-형성 프라이머 또는 프로브의 길이 및 GC 함량을 포함한 다양한 인자에 따라 달라질 수 있다. 예를 들어, 상대적으로 짧은 다이머-형성 영역을 갖는 다이머-형성 프라이머 쌍을 이용하는 경우, 낮은 엄격조건(stringent condition)을 선택하는 것이 바람직하다. 혼성화를 위한 상세한 조건은 문헌[Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)]에서 확인할 수 있다.
용어 "어닐링"과 "혼성화"는 차이가 없으며, 이들 용어는 상호교환적으로 사용될 것이다.
본 발명에 따르면, 제 1 프라이머는 3'말단에 3'-다이머-형성 영역을 갖고, 제 2 프라이머는 3'말단에 3'-다이머-형성 영역을 가지며, 상기 제 1 프라이머의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이다.
제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역을 언급하면서 사용되는 용어 "상보적(complementary)" 또는 "상보성(complementarity)"은 특정 어닐링 조건 또는 엄격 조건 하에 제 1 프라이머의 3'-다이머-형성 영역이 제 2 프라이머의 3'-다이머-형성 영역에 선택적으로 혼성화할 정도로 충분히 상보적인 것을 의미하며, 용어 "실질적으로 상보적(substantially complementary)" 및 "완전히 상보적(perfectly complementary)"을 포괄하고, 구체적으로는 완전히 상보적이다.
본 발명의 일 구현예에서, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역은 서로 실질적으로 상보적인 뉴클레오타이드 서열을 갖는다.
본 발명의 일 구현예에 따르면, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역 각각은, 비상보적인 뉴클레오타이드가 3'-다이머-형성 영역 간의 혼성화에 유의한 영향을 미치지 않는 한, 1개 이상의 비상보적인 뉴클레오타이드를 갖는다. 예를 들어, 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역 각각은 그의 길이에 따라 5, 4, 3, 2, 또는 1개의 비상보적인 뉴클레오타이드를 가질 수 있다.
본 발명에 따르면, 제 1 프라이머는 5'말단에 5'-프로브-혼성화 영역을 갖고, 제 2 프라이머는 5'말단에 5'-프로브-혼성화 영역을 가지며, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적이다.
제 1 프라이머 및 제 2 프라이머의 5'-프로브-혼성화 영역을 언급하면서 사용되는 용어 "상보적(complementary)" 또는 "상보성(complementarity)"은 특정 어닐링 조건 또는 엄격 조건 하에 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 상기 프로브가 선택적으로 혼성화할 정도로 충분히 상보적인 것을 의미하며, 용어 "실질적으로 상보적(substantially complementary)" 및 "완전히 상보적(perfectly complementary)"을 포괄하고, 구체적으로는 완전히 상보적이다.
본 발명의 일 구현예에서, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역과 프로브들 각각은 서로 실질적으로 상보적인 뉴클레오타이드 서열을 갖는다.
본 발명의 일 구현예에 따르면, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역과 프로브는, 비상보적인 뉴클레오타이드가 5'-프로브-혼성화 영역과 프로브 간의 혼성화에 유의한 영향을 미치지 않는 한, 1개 이상의 비상보적인 뉴클레오타이드를 갖는다. 예를 들어, 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역 및 프로브는 그의 길이에 따라 5, 4, 3, 2, 또는 1개의 비상보적인 뉴클레오타이드를 가질 수 있다.
제 1 프라이머의 5'-프로브-혼성화 영역은, 제 2 프라이머의 3'-다이머-형성 영역에 비상보적인 서열을 갖는 한, 임의의 서열일 수 있다. 마찬가지로, 제 2 프라이머의 5'-프로브-혼성화 영역은, 제 1 프라이머의 3'-다이머-형성 영역에 비상보적인 서열을 갖는 한, 임의의 서열일 수 있다.
본 발명의 다이머-형성 프라이머 쌍을 구성하는 제 1 프라이머 및 제 2 프라이머는 어떤 특정 길이를 요구하지 않는다. 일 구현예에서, 제 1 프라이머 및 제 2 프라이머 각각은 7 내지 100 뉴클레오타이드 길이이다. 특정한 구현예에서, 제 1 프라이머 및 제 2 프라이머의 길이는 최소 7, 10, 15, 20, 30, 50, 60 또는 80 뉴클레오타이드부터 100, 80, 70, 60, 50, 40, 35, 30, 25, 20, 15 또는 10 이하의 뉴클레오타이드 범위이다. 예를 들어, 제 1 프라이머 및 제 2 프라이머 각각은 7-40, 7-60, 7-80, 7-100, 10-40, 10-60, 10-80, 10-100, 15-40, 15-60, 15-80, 15-100, 20-40, 20-60, 20-80, 20-100, 30-40, 30-60, 30-80 또는 30-100 뉴클레오타이드의 길이일 수 있다.
본 발명의 일 구현예에 따르면, 상기 제 1 프라이머 및 제 2 프라이머의 5'프로브-혼성화 영역 각각은 3 내지 50 뉴클레오타이드 길이이다.
본 발명의 일 구현예에 따르면, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역 각각은 3 내지 50 뉴클레오타이드 길이이다.
본 발명의 일 구현예에서, 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역 또는 3'-다이머-형성 영역은 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 또는 50 뉴클레오타이드 길이이다. 예를 들어, 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역 또는 3'-다이머-형성 영역은 3-50, 3-40, 3-35, 3-30, 3-25, 3-20, 3-17, 3-15, 3-12, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-50, 4-40, 4-35, 4-30, 4-25, 4-20, 4-17, 4-15, 4-12, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-17, 5-15, 5-12, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-40, 6-35, 6-30, 6-25, 6-20, 6-17, 6- 15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-50, 7-40, 7-35, 7-30, 7-25, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-50, 8-40, 8-35, 8-30, 8-25, 8-20, 8-17, 8-15, 8-12, 8-10, 8-9, 9-50, 9-40, 9-35, 9-30, 9-25, 9-20, 9-17, 9-15, 9-12, 9-10, 10-50, 10-40, 10-35, 10-30, 10-25, 10-20, 10-17, 10-15, 10-12, 12-50, 12-40, 12-35, 12-30, 12-25, 12-20, 12-17, 12-15, 15-50, 15-40, 15-35, 15-30, 15-25, 15-20, 15-17 또는 17-20 뉴클레오타이드 길이일 수 있다. 특정한 구현예에서, 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역 또는 3'-다이머-형성 영역은 5 뉴클레오타이드, 6 뉴클레오타이드, 7 뉴클레오타이드, 8 뉴클레오타이드, 9 뉴클레오타이드 또는 10 뉴클레오타이드 길이이다.
전술한 제 1 프라이머 및 제 2 프라이머의 5'-프로브-혼성화 영역의 길이는 5'말단의 뉴클레오타이드부터(5'말단의 뉴클레오타이드 포함) 3'방향의 특정 뉴클레오타이드까지의 범위를 가리킨다. 예를 들어, 5'-프로브-혼성화 영역이 5 뉴클레오타이드 길이인 경우, 상기 5'-프로브-혼성화 영역은 5'-말단의 첫 번째 뉴클레오타이드부터 5번째 뉴클레오타이드(첫 번째 및 5번째 뉴클레오타이드 포함)까지의 범위이다.
전술한 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역의 길이는 3'말단의 뉴클레오타이드부터(3'말단의 뉴클레오타이드 포함) 5'방향의 특정 뉴클레오타이드까지의 범위를 가리킨다. 예를 들어, 3'-다이머-형성 영역이 5 뉴클레오타이드 길이인 경우, 상기 3'-다이머-형성 영역은 3'-말단의 첫 번째 뉴클레오타이드부터 5번째 뉴클레오타이드(첫 번째 및 5번째 뉴클레오타이드 포함)까지의 범위이다.
다이머-형성 프라이머 쌍을 구성하는 제 1 프라이머 및 제 2 프라이머는 자연(naturally occurring) dNMPs로 구성될 수 있다. 택일적으로, 제 1 프라이머 및 제 2 프라이머는 변형 뉴클레오타이드 또는 비-자연 뉴클레오타이드, 예컨대, PNA(Peptide Nucleic Acid, 참조 PCT 출원 제WO 92/20702호) 및 LNA(Locked Nucleic Acid, 참조 PCT 출원 제WO 98/22489호, 제WO 98/39352호 및 제WO 99/14226호)를 포함할 수 있다. 제 1 프라이머 및 제 2 프라이머는 데옥시이노신, 이노신, 1-(2'-데옥시-베타-D-리보푸라노실)-3-니트로피롤 및 5-니트로인돌과 같은 유니버설 염기를 포함할 수 있다. 용어 "유니버설 염기"는 자연 DNA/RNA 염기들 각각에 대하여 거의 구별 없이 염기 쌍을 형성할 수 있는 것을 의미한다.
상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기는 다이머-형성 프라이머 내에 연속적으로 또는 비연속적으로 존재할 수 있다. 상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기의 개수는 1-8개, 1-5개, 1-3개 또는 1-2개일 수 있다. 상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기는 다이머-형성 프라이머 내의 임의의 위치에 존재할 수 있다. 본 발명의 일 구현예에서, 상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기는 5'-프로브-혼성화 영역, 3'-다이머-형성 영역, 또는 이 둘 모두에 위치할 수 있다. 상기 변형 뉴클레오타이드 또는 비-자연 뉴클레오타이드 또는 유니버설 염기의 좌측 및 우측에 위치한 서열은 서로 상보적이고 서로 혼성화하여 스템 구조를 형성할 수 있다.
본 발명에 이용되는 다이머-형성 프라이머 쌍을 구성하는 제 1 프라이머 및/또는 제 2 프라이머는 선택된 시그널링 방식에 적합한 표지 시스템을 포함할 수 있다.
제 1 프라이머 및/또는 제 2 프라이머를 위한 시그널링 방식 및 표지 시스템은 단계 (b)에서 상세히 설명하기로 한다.
본 발명에 이용되는 활성 어세이 조성물(a composition for activity assay)은 프로브들(probes)을 포함한다.
본 명세서에서 사용되는 용어"프로브(probe)"는 타겟 핵산서열에 상보적인 부위 또는 부위들을 포함하는 단일-가닥 핵산 분자를 의미한다. 특히 본 발명에 따르면, 활성 어세이 조성물에 포함되는 프로브들은 제 1 프라이머 및 제 2 프라이머 각각의 5'프로브-혼성화 영역에 혼성화되는 단일-가닥 핵산 분자를 나타낸다.
본 발명에 이용되는 프로브는 제 1 프라이머 및 제 2 프라이머 각각의 5'프로브-혼성화 영역에 혼성화 되는 서열로 구성된 통상적인 프로브 구조를 가질 수 있다.
또는, 본 발명에 이용되는 프로브는 독특한 구조를 가질 수 있다. 예를 들어, 본 발명에 이용되는 프로브는 몰리큘러 비이컨 프로브, 하이비이컨 프로브, 태깅 프로브, 및 PTO 프로브(참조: WO 2012/096523)의 구조를 가질 수 있다.
본 발명에 이용되는 프로브는 통상적인(conventional) 프로브이거나 혹은 축퇴성 염기-포함 프로브 및/또는 유니버셜 염기-포함 프로브와 같은 변형 프로브일 수 있다. 본 명세서에서 사용되는 용어 "통상적인 프로브"는 축퇴성 염기 또는 비자연-염기가 도입되지 않은 일반적인 프로브를 의미한다.
프로브 뿐만 아니라 프라이머에도 도입될 수 있는 축퇴성 염기는 당업계에 공지된 다음의 다양한 축퇴성 염기를 포함한다: R: A or G; Y: C or T; S: Gor C; W: A or T; K: G or T; M: A or C; B: C or G or T; D: A or G or T; H: Aor C or T; V: A or C or G; N: A or C or G or T. 프로브 뿐만 아니라 프라이머에도 도입될 수 있는 유니버설 염기는 당업계에 공지된 다음의 다양한 유니버설 염기를 포함한다: 디옥시이노신, 이노신, 7-디아자-2'-디옥시이노신, 2-아자-2'-디옥시이노신, 2'-OMe 이노신, 2'-F 이노신, 디옥시 3-니트로피롤, 3-니트로피롤, 2'-OMe 3-니트로피롤, 2'-F 3-니트로피롤, 1-(2'-디옥시-베타-D-리보푸라노실)-3-니트로피롤, 디옥시 5-니트로피롤, 5-니트로인돌, 2'-OMe 5-니트로인돌, 2'-F 5-니트로인돌, 디옥시 4-니트로벤즈이미다졸, 4-니트로벤즈이미다졸, 디옥시 4-아미노벤즈이미다졸, 4-아미노벤즈이미다졸, 디옥시네불라린, 2'-F 네불라린, 2'-F 4-니트로벤즈이미다졸, PNA-5-인트로인돌, PNA-네불라린, PNA-이노신, PNA-4-니트로벤즈이미다졸, PNA-3-니트로피롤, 모르포리노-5-니트로인돌, 모르포리노-네불라린, 모르포리노-이노신, 모르포리노-4-니트로벤즈이미다졸, 모르포리노-3-니트로피롤, 포스포라미데이트-5-니트로인돌, 포스포라미데이트-네불라린, 포스포라미데이트-이노신, 포스포라미데이트-4-니트로벤즈이미다졸, 포스포라미데이트-3-니트로피롤, 2'-0-메톡시에틸이노신, 2'-0-메톡시에틸 네불라린, 2'-0-메톡시에틸 5-니트로인돌, 2'-0-메톡시에틸 4-니트로-벤즈이미다졸, 2'-0-메톡시에틸 3-니트로피롤 및 상기 염기의 조합. 보다 구체적으로, 상기 유니버설 염기는 디옥시이노신, 이노신, 또는 이들의 조합이다.
본 발명의 일 구현예에 따르면, 상기 프로브들은 3 내지 50 뉴클레오타이드 길이이다. 본 발명의 일 구현예에서, 프로브는 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 또는 50 뉴클레오타이드 길이이다. 예를 들어, 프로브는 3-50, 3-40, 3-35, 3-30, 3-25, 3-20, 3-17, 3-15, 3-12, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-50, 4-40, 4-35, 4-30, 4-25, 4-20, 4-17, 4-15, 4-12, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-17, 5-15, 5-12, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-40, 6-35, 6-30, 6-25, 6-20, 6-17, 6- 15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-50, 7-40, 7-35, 7-30, 7-25, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-50, 8-40, 8-35, 8-30, 8-25, 8-20, 8-17, 8-15, 8- 12, 8-10, 8-9, 9-50, 9-40, 9-35, 9-30, 9-25, 9-20, 9-17, 9-15, 9-12, 9-10, 10-50, 10-40, 10-35, 10-30, 10-25, 10-20, 10-17, 10-15, 10-12, 12-50, 12-40, 12-35, 12-30, 12-25, 12-20, 12-17, 12-15, 15-50, 15-40, 15-35, 15-30, 15-25, 15-20, 15-17 또는 17-20 뉴클레오타이드 길이일 수 있다. 특정한 구현예에서, 프로브는 5 뉴클레오타이드, 6 뉴클레오타이드, 7 뉴클레오타이드, 8 뉴클레오타이드, 9 뉴클레오타이드 또는 10 뉴클레오타이드 길이이다.
다이머-형성 프라이머 및 프로브는 연장이 되지 않도록 그의 3'-말단이 블록킹 될 수 있다. 블록킹은 종래 방법에 따라 달성될 수 있다. 예를 들면, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기에 바이오틴, 표지, 포스페이트기, 알킬기, 비-뉴클레오타이드 링커, 포스포로티오에이트 또는 알칸-디올 잔기와 같은 화학적 모이어티(moiety)를 추가하여 실시할 수 있다. 택일적으로, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기를 제거하거나 또는 다이디옥시뉴클레오타이드와 같이 3'-히드록실기가 없는 뉴클레오타이드를 이용하여 실시할 수 있다.
본 발명에 따르면, 제 1 프라이머 및 제 2 프라이머는 제 1 프라이머 및 제 2 프라이머의 3'-다이머 형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)를 형성한다.
활성 어세이 조성물에 포함되는 다이머-형성 프라이머 쌍 및 프로브들로부터 형성되는 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)는 (i) 다이머-형성 프라이머 쌍의 혼성화에 의한 다이머-프라이머의 형성; 및 (ⅱ) 다이머-프라이머 및 프로브들의 혼성화에 의한 다이머-프라이머 및 프로브 복합체의 형성을 포함한다(참조: 도 2 및 3).
(i) 다이머-프라이머의 형성
다이머-형성 프라이머 쌍은 서로 혼성화된다. 구체적으로, 제 1 프라이머 및 제 2 프라이머는 3'-다이머-형성 영역 간의 상보성에 의해 서로 혼성화되어 다이머가 형성된 다이머-프라이머를 형성한다.
제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 (i) 5'-프로브-혼성화 영역 및 (ii) 3'-다이머-형성 영역을 포함하여, 다이머-프라이머를 형성하기 위한 상기 혼성화 과정에서, 3'-다이머-형성 영역은 혼성화에 관여하지만, 5'-프로브-혼성화 영역은 혼성화에 관여하지 않는다(참조: 도 2 및 3).
제 1 프라이머 및 제 2 프라이머의 3'-다이머 형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머는 다음과 같다:
[규칙 제91조에 의한 정정 28.07.2025]
[삭제]
이러한 다이머 형태는 제 1 프라이머 및 제 2 프라이머가 2개의 프라이머의 3’-다이머-형성 영역을 통해 부분적으로 혼성화된(부분적으로 중첩된) 형태를 나타낸다. 이러한 다이머 형태는 부분적 다이머로서 지칭될 수 있다.
제 1 프라이머 및 제 2 프라이머 간의 부분적 혼성화에 의해 형성된 프라이머-다이머는 (i) 제 1 프라이머로 구성된 단일 가닥 부위; (ii) 제1 프라이머 및 제 2 프라이머로 구성된 이중 가닥 부위; 및 (iii) 제 2 프라이머로 구성된 단일 가닥 부위로 구성된, 구별되는 3부분(tripartite) 구조를 갖으며, 상기 제 1 프라이머 및 제 2 프라이머의 단일 가닥 부위는 5’-프로브-혼성화 영역을 포함한다.
전술한 다이머-형성 프라이머 쌍의 혼성화는 제 1 프라이머 및 제 2 프라이머의 혼성화가 가능한 조건 하에서 수행될 수 있다.
(ii) 다이머-프라이머 및 프로브 복합체의 형성
상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)를 형성하며, 구체적으로 아래와 같다:
[규칙 제91조에 의한 정정 28.07.2025]
[삭제]
제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 (i) 5'-프로브-혼성화 영역 및 (ii) 3'-다이머-형성 영역을 포함하여, 다이머-프라이머 및 프로브 복합체를 형성하기 위한 상기 혼성화 과정에서, 5'-프로브-혼성화 영역이 혼성화에 관여한다(참조: 도 2 및 3).
전술한 제 1 프라이머 및 제 2 프라이머 각각의 5’-프로브-혼성화 영역과 프로브의 혼성화는 제 1 프라이머 및 제 2 프라이머 각각의 단일 가닥 부위와 프로브의 혼성화가 가능한 조건 하에서 수행될 수 있다.
본 발명의 가장 큰 특징은 5’핵산분해효소가 인식할 수 있는 구조인 다이머-프라이머 및 프로브 복합체를 다이머-형성 프라이머 쌍 및 프로브의 혼성화를 통하여 형성함으로써, 상기 복합체의 프로브의 5’말단을 분해하는 기작을 통하여 5’핵산분해효소의 활성을 분석할 수 있다는 점이다. 구체적으로 도 3은 본 발명의 일 구현예에 따른 셀프-다이머 프라이머-프로브 복합체의 작동 기작을 나타낸다.
본 발명의 일 구현예에 따르면, 상기 다이머-프라이머 및 프로브 복합체에서, 상기 프라이머의 3’말단과 상기 프라이머의 3’말단과 인접한 프로브의 5’말단 사이의 간격은 0 내지 15 뉴클레오타이드 길이이다. 구체적으로 상기 간격은 0-13 뉴클레오타이드 길이, 0-11 뉴클레오타이드 길이, 0-9 뉴클레오타이드 길이, 0-7 뉴클레오타이드 길이, 0-5 뉴클레오타이드 길이, 0-3 뉴클레오타이드 길이, 0-1 뉴클레오타이드 길이, 0 뉴클레오타이드 길이일 수 있다.
본 발명의 일 구현예에 따르면, 상기 다이머-형성 프라이머(dimer-forming primer) 쌍은 셀프 다이머-형성 프라이머(self dimer-forming primer) 쌍이고, 상기 제 1 프라이머 및 제 2 프라이머 각각은 셀프 다이머-형성 프라이머이며, 상기 3’-다이머-형성 영역은 3’-헤어핀-형성 영역이고, 상기 다이머가 형성된 다이머-프라이머는 셀프 다이머가 형성된 셀프 다이머-프라이머이며, 상기 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)는 셀프 다이머-프라이머 및 프로브 복합체(self dimer-primer and probe complex)이다.
본 명세서에서 사용되는 용어 “셀프 다이머-형성 프라이머”는 특정 조건 하에서 2개의 동일한 서열의 셀프 다이머-형성 프라이머가 서로 부분적으로 혼성화되어 셀프 다이머를 형성할 수 있는 프라이머를 의미한다.
본 명세서에서 용어 "셀프 다이머"는 2개의 동일한 서열의 셀프 다이머-형성 프라이머의 부분적 혼성화, 즉 가닥간 혼성화(inter-strand hybridization)에 의해 형성되는 다이머를 의미한다.
통상적인 프라이머는 핵산 가닥(주형)에 혼성화된 후 연장을 개시하는 역할을 하는 반면, 셀프 다이머-형성 프라이머는 동일한 서열의 또 다른 셀프 다이머-형성 프라이머에 혼성화된 후 연장을 개시하는 역할을 한다. 다만, 본 발명에 따르면, 활성 어세이 조성물에 dNTPs 또는 NTPs가 포함되지 않거나 셀프 다이머-형성 프라이머의 3'-말단이 블록킹 되어 있어 셀프 다이머-형성 프라이머는 연장되지 않는다.
본 구현예에서, 셀프 다이머-형성 프라이머는 5’에서 3’의 방향으로 (i) 5’-프로브-혼성화 영역 및 (ⅱ) 3’-헤어핀-형성 영역을 포함한다. 즉, 다이머-형성 프라이머의 3’-다이머-형성 영역은 셀프 다이머-형성 프라이머에서는 3’-헤어핀-형성 영역이다(참조: 도 2).
본 발명의 일 구현예에 따르면, 상기 셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역은 동일한 서열의 다른 셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역 및 3’-헤어핀-형성 영역에 실질적으로 비상보적인 뉴클레오타이드 서열을 갖는다. 따라서, 셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역은 동일한 서열의 다른 셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역 또는 3’-헤어핀-형성 영역에 실질적으로 혼성화되지 않는다.
셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역과 관련하여 용어 “비상보적”은 셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역이 소정의 어닐링 조건 또는 엄격 조건 하에서 동일한 서열의 셀프 다이머-형성 프라이머의 어느 영역에도 선택적으로 혼성화되지 않을 정도로 충분히 비상보적인 것을 의미하며, “실질적으로 비상보적(substantially non-complementary)” 및 “완전히 비상보적(perfectly non-complementary)”인 것을 모두 포괄하고, 특히 완전히 비상보적인 것을 의미한다.
셀프 다이머-형성 프라이머의 5’-프로브-혼성화 영역은 자가-상보적인(self-complementary) 서열을 갖지 않는다. 따라서, 상기 5’-프로브-혼성화 영역은 헤어핀(헤어핀 다이머)을 형성하지 않는다.
본 명세서에서 셀프 다이머-형성 프라이머와 관련하여 사용된 용어 “3’-헤어핀-형성 영역”은 셀프 다이머-형성 프라이머의 3’말단에 위치하는 영역을 의미한다. 상기 용어는 제 1 온도에서 헤어핀(헤어핀 다이머)을 형성하고 제 2 온도에서 셀프 다이머를 형성할 수 있는 영역을 나타낸다(참조: 도 2).
일 구현예에서, 상기 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 제 1 온도에서 헤어핀 다이머를 형성한다.
본 명세서에서 사용된 용어 “헤어핀” 또는 “헤어핀 다이머”는 제 1 온도에서 3’-헤어핀-형성 영역에서의 자가-상보적 서열로 인해 가닥내 혼성화(intra-hybridization)를 통해 형성된 이중 가닥 부분을 갖는 구조를 의미한다. 상기 용어는 하나의 셀프 다이머-형성 프라이머에 의해 형성된 이중 가닥 부분을 갖는 구조를 나타낸다. 상기 헤어핀 다이머의 구조가 도 2에 도시되어 있다.
도 2에 나타낸 바와 같이, 제 1 온도에서 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 가닥내 혼성화를 통해 이중 가닥 부분을 갖는 헤어핀 다이머를 형성한다.
상기 제 1 온도는 헤어핀 다이머의 멜팅 온도(Tm)를 고려하여 결정된다. 구체적으로, 제 1 온도는 헤어핀 다이머의 Tm과 동일하거나 이보다 낮은 온도일 수 있다. 헤어핀 다이머의 Tm과 동일하거나 이보다 낮은 온도에서, 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 도 2에서와 같이 헤어핀 다이머를 형성하거나 도 2에서와 같이 셀프 다이머를 형성할 수 있다.
헤어핀 다이머의 이중 가닥 부분의 길이는 셀프 다이머의 이중 가닥 부분의길이의 거의 절반이므로, 헤어핀 다이머의 Tm이 셀프 다이머의 Tm에 비해 낮다. 따라서, 헤어핀 다이머의 Tm 이하의 온도에서는 헤어핀 다이머 외에도 셀프 다이머가 형성될 수 있다.
일 구현예에서, 상기 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 제 2 온도에서 셀프 다이머를 형성한다.
본 명세서에서 사용된 용어 “셀프 다이머”는 제 2 온도에서 2개의 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역 간의 혼성화, 즉 가닥간 혼성화(inter-hybridization)를 통해 형성된 이중 가닥 부분을 갖는 구조를 의미한다. 상기 셀프 다이머의 구조가 도 2에 도시되어 있다.
도 2에 나타낸 바와 같이, 제 2 온도에서 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 가닥 혼성화를 통해 이중 가닥 부분을 갖는 셀프 다이머를 형성한다.
일 구현예에서, 제 2 온도는 셀프 다이머의 Tm을 고려하여 결정된다. 구체적으로, 제 2 온도는 셀프 다이머의 Tm과 동일하거나 이보다 낮은 온도일 수 있다. 셀프 다이머의 Tm과 동일하거나 이보다 낮은 온도에서, 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 도 2에서와 같이 셀프 다이머를 형성할 수 있다.
특정 구현예에서, 제 2 온도는 셀프 다이머의 Tm 및 헤어핀 다이머의 Tm을 고려하여 결정된다. 구체적으로, 제 2 온도는 헤어핀 다이머의 Tm 보다 높고 셀프 다이머의 Tm과 동일하거나 이보다 낮은 온도일 수 있다. 헤어핀 다이머의 Tm보다 높은 온도에서, 셀프 다이머-형성 프라이머의 3'-헤어핀-형성 영역은 도 2에서와 같은 헤어핀 다이머를 형성하지 못하지만, 셀프 다이머의 Tm과 동일하거나 이보다 낮은 온도에서, 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 도 2에서와 같이 셀프 다이머를 형성할 수 있다.
특정 구현예에서, 상기 제 2 온도는 상기 제 1 온도보다 높다.
상술한 바와 같이 헤어핀 다이머 또는 셀프 다이머의 형성을 위해, 상기 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역은 동일한 서열의 다른 셀프 다이머-형성 프라이머의 3’-헤어핀-형성 영역과 혼성화될 수 있는 뉴클레오타이드 서열을 가질 수 있다.
셀프 다이머-형성 프라이머는 자연(naturally occurring) dNMPs로 구성될 수 있다. 택일적으로, 셀프 다이머-형성 프라이머는 변형 뉴클레오타이드 또는 비-자연 뉴클레오타이드, 예컨대, PNA(Peptide Nucleic Acid, 참조 PCT 출원 제WO 92/20702호) 및 LNA(Locked Nucleic Acid, 참조 PCT 출원 제WO 98/22489호, 제WO 98/39352호 및 제WO 99/14226호)를 포함할 수 있다. 또한, 셀프 다이머-형성 프라이머는 데옥시이노신, 이노신, 1-(2'-데옥시-베타-D-리보푸라노실)-3-니트로피롤 및 5-니트로인돌과 같은 유니버설 염기를 포함할 수 있다. 용어 “유니버설 염기”는 자연 DNA/RNA 염기들 각각에 대하여 거의 구별 없이 염기 쌍을 형성할 수 있는 것을 의미한다.
상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기는 셀프 다이머-형성 프라이머 내에 연속적으로 또는 비연속적으로 존재할 수 있다. 상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기의 개수는 1-5개, 1-3개 또는 1-2개일 수 있다. 상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기는 셀프 다이머-형성 프라이머 내의 임의의 위치에 존재할 수 있다. 일 구현예에서, 상기 변형 뉴클레오타이드, 비-자연 뉴클레오타이드 또는 유니버설 염기는 5’-프로브-혼성화 영역, 3’-헤어핀-형성 영역, 또는 이 둘 모두에 위치할 수 있다.
셀프 다이머-형성 프라이머는 5’-프로브-혼성화 영역 및 3’-헤어핀-형성 영역 외에 임의의 부가적인 서열을 포함할 수 있다. 일 구현예에 따르면, 상기 부가적인 서열은 5’-프로브-혼성화 영역의 5’방향에 위치하며, 템플레이트로서 역할을 하지 않으며 또 다른 셀프 다이머-형성 프라이머와 혼성화되지 않는다. 상기 부가적인 서열은 프라이머의 연장을 방지하기 위한 블록커(blocker)를 포함할 수 있다.
(ⅲ) 셀프 다이머-프라이머의 형성
상기 셀프 다이머-형성 프라이머 쌍의 3'-다이머 형성 영역 간의 혼성화를 통해 셀프 다이머가 형성된 셀프 다이머-프라이머를 형성한다.
셀프 다이머-형성 프라이머 및 셀프 다이머-프라이머 대하여 본 출원인에 의해 출원된 대한민국 특허출원 제10-2023-0166983호에 기재된 내용은 본 명세서의 참조로서 삽입된다.
(ⅳ) 셀프 다이머-프라이머 및 프로브 복합체의 형성
상기 셀프 다이머-프라이머의 양 가닥인 셀프 다이머-형성 프라이머들 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 셀프 다이머-프라이머 및 프로브 복합체(self dimer-primer and probe complex)를 형성한다.
본 발명의 일 구현예에 따르면, 상기 다이머-프라이머 및 프로브 복합체는 상기 활성 어세이 조성물을 고온으로 가열한 다음 냉각시켜 형성된다.
활성 어세이 조성물을 고온으로 가열을 함으로써, 본 발명에 이용되는 활성 어세이 조성물에 포함되는 다이머-형성 프라이머 쌍 및 프로브들을 단일 가닥 상태로 만들 수 있다. 이후, 상기 가열된 결과물을 인큐베이션을 위한 온도 보다 낮은 온도로 냉각하여 다이머-프라이머 및 프로브 복합체의 형성을 유도할 수 있다.
상기 고온은 전술한 바와 같이 다이머-형성 프라이머 쌍 및 프로브들을 단일 가닥 상태로 만들 수 있는 온도이다. 상기 고온은 인큐베이션 온도보다 높은 온도이다. 일 구현예에서, 상기 고온은 90-100℃에서 선택된 온도이고, 보다 구체적으로 90℃, 91℃, 92℃, 93℃, 94℃, 95℃, 96℃, 97℃, 98℃, 99℃, 100℃, 및 이들 사이의 임의의 값으로부터 선택된다. 상기 냉각 온도는 인큐베이션 온도 보다 낮은 온도로 15-70℃에서 선택된 온도, 구체적으로 15-50℃에서 선택된 온도, 보다 구체적으로 15-30℃에서 선택된 온도이다.
단계 (b): 5’핵산분해효소를 활성 어세이 조성물에 첨가 및 인큐베이션( 120 )
그 다음, 본 발명의 방법은 (b) 상기 5’핵산분해효소를 상기 활성 어세이 조성물에 첨가하고 이 결과물을 인큐베이션(incubation)시키는 단계를 포함한다. 상기 5’핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5’말단들이 분해되어 검출가능한 시그널이 제공된다.
본 명세서에서 사용되는 용어 “인큐베이션”은 제공된 활성 어세이 조성물에 활성을 분석하고자 하는 5’핵산분해효소가 타겟의 구조를 인지하고 분해하도록 작동할 수 있는 조건 하에 두는 것을 의미한다.
본 발명에 따른 인큐베이션 전에, 활성 어세이 조성물에 포함되는 다이머-형성 프라이머 쌍 및 프로브들은 온도에 따라 (i) 단일 가닥 상태로 존재하거나, 또는 (ⅱ) 도 2 및 3에 도시된 바와 같이 다이머-형성 프라이머 쌍인 제 1 프라이머 및 제 2 프라이머의 3’-다이머 형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5’-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 형성된 다이머-프라이머 및 프로브 복합체(dimer primer and probe complex)로 존재할 수 있다. 구체적으로, 본 발명에 따른 인큐베이션 전에, 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)로 존재한다.
이후, 본 발명에 따른 인큐베이션 동안, 첨가된 상기 5'핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되어 검출가능한 시그널이 제공된다.
본 발명의 일 구현예에 따르면, 상기 인큐베이션은 상기 형성된 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)의 프로브들의 5’말단들을 분해하도록 5’핵산분해효소가 작동하는 등온 하에서 수행된다.
본 발명의 일 구현예에 따르면, 상기 5'핵산분해효소가 작동하고, 상기 다이머-형성 프라이머가 가닥내 혼성화(intra-strand hybridization)에 의해 헤어핀 다이머(hairpin dimer)를 형성하지 않으면서, 5'-프로브 혼성화 영역에 프로브가 혼성화되는 등온 하에서 수행된다.
본 발명의 일 구현예에 따르면, 상기 인큐베이션은 상기 다이머-형성 프라이머 쌍 및 프로브들이 단일 가닥 상태로 존재하지 않게 하는 등온 하에서 수행된다.
상술한 바와 같이, 5'핵산분해효소의 작동, 5'핵산분해효소가 작동하기 위한 다이머-프라이머 및 프로브 복합체(dimer primer and probe complex)의 구조 유지는 인큐베이션의 온도를 조절함으로써 달성될 수 있다.
상기 목적을 달성하기 위한 인큐베이션을 위한 온도는 5'핵산분해효소의 작동을 위한 온도, 그리고 다이머-프라이머 및 프로브 복합체(dimer primer and probe complex)의 구조 유지를 위해 ⅰ) 다이머-형성 프라이머의 3'-다이머-형성 영역의 Tm 값 및 ⅱ) 상기 프라이머의 5'-프로브-혼성화 영역의 Tm 값을 고려하여 선택될 수 있다.
인큐베이션을 위한 온도는 5'핵산분해효소의 작동을 위해 분석하고자 하는 5'핵산분해효소의 최적 활성 온도 내에 있을 수 있다. 따라서, 분석하고자 하는 5'핵산분해효소의 최적 활성 온도에 따라 인큐베이션 온도는 달라질 수 있다.
일 구현예에서, 인큐베이션을 위한 온도는 헤어핀 다이머의 비형성을 위해 헤어핀 다이머의 Tm 보다 높다.
일 구현예에서, 인큐베이션을 위한 온도는 3'다이머-형성 영역 간의 다이머의 형성을 위해 다이머-형성 프라이머의 3'다이머-형성 영역의 Tm보다 낮다.
일 구현예에서, 인큐베이션을 위한 온도는 다이머-프라이머의 양 가닥인 다이머-형성 프라이머 쌍 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화 되도록 상기 5'-프로브-혼성화 영역의 Tm보다 낮다.
본 발명의 일 구현예에 따르면, 상기 인큐베이션을 위한 등온은 65 내지 80℃로부터 선택된 온도이다. 특정 구현예에서, 인큐베이션을 위한 등온은 약 65℃이다. 특정 구현예에서, 인큐베이션을 위한 등온은 약 72℃이다.
본 발명의 일 구현예에 따르면, 상기 인큐베이션은 30분 내지 60분 동안 실시된다.
다만, 상기 인큐베이션 시간은 시간 대 시그널의 함수(또는 시그널 대 시간의 함수)가 정체기(plateau)에 도달하는 데 걸리는 시간, 또는 시간 대 시그널의 함수가 1차 함수를 나타내는 시간을 고려하여 조정될 수 있다. 일 예로서, 특정 5'핵산분해효소에 대해 시간 대 시그널의 함수(플롯)가 정체기에 도달하는 데 걸리는 시간이 60분을 초과하면, 동일 또는 유사한 유형의 5'핵산분해효소에 대해 상기 인큐베이션 시간을 60분 초과로 설정할 수 있다. 반대로, 특정 5'핵산분해효소에 대해 시간 대 시그널의 함수(플롯)가 정체기에 도달하는 데 걸리는 시간이 30분 이내이면, 동일 또는 유사한 유형의 5'핵산분해효소에 대해 상기 인큐베이션 시간을 30분 이내로 설정할 수 있다.
일 구현예에 따르면, 상기 인큐베이션은 공지된 다양한 인큐베이터에서 수행될 수 있다.
다른 구현예에 따르면, 상기 인큐베이터는 핵산 증폭 반응에 사용되는 다양한 증폭 장치에서 수행된다. 상기 증폭 장치는 온도 조절이 가능한 열순환기 및 시그널을 검출할 수 있는 검출기를 포함할 수 있다. 전형적인 증폭 장치는, 예컨대 PCR을 수행하기 위해 온도를 지속적으로 변동시키도록 프로그래밍 되어 있는데, 온도가 등온으로 유지되도록 프로그래밍함으로써 상기 증폭 장치를 본 발명의 방법에 사용할 수 있다. 사용될 수 있는 증폭 장치의 예는, CFX(Bio-Rad), iCycler(Bio-Rad), LightCycler(Roche), StepOne(ABI), 7500(ABI), ViiA7(ABI), QuantStudio(ABI), AriaMx(Agilent)를 포함한다.
본 발명에 따르면, 상기 인큐베이션 단계에서 상기 5’핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브의 5’말단이 분해되어 검출가능한 시그널이 제공된다.
본 명세서에서 용어“시그널”은 프로브의 5’말단의 분해가 발생을 나타낼 수 있는 임의의 시그널, 특히 형광 시그널을 의미한다. 예를 들어, 시그널은 표지로부터의 시그널의 발생(또는 소멸), 또는 시그널의 변화(증가 또는 감소)를 포함한다.
검출가능한 시그널은 표지(들) 또는 표지 시스템에 의해 발생할 수 있다.
검출가능한 시그널은 당업계에 널리 알려진 다양한 시그널-발생 수단(즉, 표지 시스템)을 사용하여 발생할 수 있다.
본 발명의 일 구현예에 따르면, 상기 검출가능한 시그널은 (ⅰ) 프로브들 각각에 연결된 이중표지, 또는 (ⅱ) 제 1 프라이머 및/또는 제 2 프라이머에 연결된 표지와 프로브들 각각에 연결된 표지에 의해 제공된다.
본 발명에 유용한 표지 시스템은 다음과 같이 상세하게 설명될 수 있다.
(ⅰ) 프로브들 각각에 연결된 이중표지
상기 이중표지는 가닥내 상호작용적 이중표지이다.
상호작용적 표지 시스템은 공여자 분자 및 수용자 분자 사이에 에너지가 비-방사능적(non-radioactively) 방식으로 패싱되는 시그널 발생 시스템(signal generating system)을 의미한다. 상호작용적 표지 시스템의 대표적인 예로서, FRET(fluorescence resonance energy transfer) 표지 시스템은 형광 리포터 분자(공여자 분자) 및 퀀처 분자(수용자 분자)를 포함한다. FRET에서, 에너지 공여자는 형광성이지만, 에너지 수용자는 형광성 또는 비-형광성일 수 있다. 상호작용적 표지 시스템의 다른 예에서, 에너지 공여자는 비-형광성, 예컨대, 발색단(chromophore)이고, 에너지 수용자가 형광성이다. 상호작용적 표지 시스템의 또 다른 예에서, 에너지 공여자는 발광성, 예컨대 생물발광(bioluminescent), 화학발광(chemiluminescent), 전기화학발광(electrochemiluminescent)이고, 에너지 수용자가 형광성이다. 본 발명에서 공여자 분자 및 수용자 분자는 각각 상술한 리포터 분자 및 퀀처 분자일 수 있다.
구체적으로, 프로브의 5'말단의 분해(프로브의 5'말단의 절단)의 발생을 나타내는 시그널은 상호작용적 표지 시스템에 의해 발생되며, 보다 구체적으로, FRET 표지 시스템(즉, 상호작용적 이중표지 시스템)에 의해 발생된다.
본 발명의 일 구현예에 따르면, 프로브는 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중표지가 결합되어 있고, 단계 (b)에서 상기 5'핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되는 경우, 상호작용적 이중표지로부터의 시그널의 변화를 초래하여 검출 가능한 시그널을 제공한다. 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되기 전에는 상기 프로브 상의 상기 리포터 분자 및 퀀처 분자는 서로 근접하게 되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭하며, 상기 프로브들의 5'말단들이 분해되면, 상기 리포터 분자 및 퀀처 분자는 서로 이격되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭하여, 상호작용적 이중표지로부터의 시그널 변화를 초래한다.
대안적으로, 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되기 전에, 상기 프로브 상의 상기 리포터 분자 및 퀀처 분자는 서로 이격 되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭하고, 이로 인해 발생하는 시그널은 백그라운드로 보정을 하고, 상기 프로브들의 5'말단들이 분해되면, 상기 리포터 분자 및 퀀처 분자는 이격되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭하여, 상호작용적 이중표지로부터의 시그널 변화를 초래한다.
도 3은 상호작용적 이중표지를 사용한 본 발명의 구현예를 예시한다. 인큐베이션 전에 형성된 다이머-프라이머 및 프로브 복합체에서 서로 근접한 상기 프로브 상의 퀀처 분자가 리포터 분자로부터의 시그널을 퀀칭하며, 상기 인큐베이션 단계에서 상기 5'핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되는 경우, 프로브에 결합되어 있는 리포터 분자 및 퀀처 분자는 서로 이격되게 되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭하며, 상기 상호작용적 이중표지로 부터의 시그널의 변화(예컨대, 리포터 분자로부터의 시그널 증가)를 초래한다.
본 발명의 일 구현예에 따르면, 리포터 분자 및 퀀처 분자는 프로브의 5'-말단(또는 3'-말단) 및 3'-말단(또는 5'-말단)에 위치한다. 본 발명의 보다 구체적인 구현예에 따르면, 프로브에 결합된 리포터 분자 및 퀀처 분자 중 하나는 5'-말단 또는 5'-말단으로부터 1-5 뉴클레오타이드 이격된 위치에 위치하고, 나머지 하나는 프로브의 형태 (conformation) 또는 프로브 상의 리포터 분자 및 퀀처 분자의 거리에 따라 리포터 분자의 시그널을 퀀칭 또는 언퀀칭하는 위치에 위치한다.
본 발명의 보다 구체적인 구현예에 따르면, 프로브에 결합된 리포터 분자 및 퀀처 분자 중 하나는 3'-말단 또는 3'-말단으로부터 1-5 뉴클레오타이드 이격된 위치에 위치하고, 나머지 하나는 프로브의 형태 또는 프로브 상의 리포터 분자 및 퀀처 분자의 거리에 따라 리포터 분자의 시그널을 퀀칭 또는 언퀀칭하는 위치에 위치한다.
본 발명의 보다 구체적인 구현예에 따르면, 리포터 분자 및 퀀처 분자는 서로 50 뉴클레오타이드 이내, 보다 구체적으로 40 뉴클레오타이드 이내, 보다 더 구체적으로 30 뉴클레오타이드 이내, 보다 더욱 더 구체적으로 20 뉴클레오타이드 이내에서 이격되어 위치한다. 본 발명의 보다 구체적인 구현예에 따르면, 리포터 분자 및 퀀처 분자는 최소 4 뉴클레오타이드, 보다 구체적으로 최소 6 뉴클레오타이드, 보다 더 구체적으로 최소 10 뉴클레오타이드, 보다 더욱 더 구체적으로 최소 15 뉴클레오타이드 이격된다.
본 발명에서 이용되는 리포터 분자 및 퀀처 분자는 당업계에 공지되어 있는 어떠한 분자도 포함할 수 있다. 상기 형광 표지의 구체적인 예는 다음과 같다: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™(531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red(615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) 및 Quasar 705 (610). 괄호의 숫자는 나노미터 단위로 표시한 발광 최대 파장이다. 구체적으로, 리포터 분자 및 퀀처 분자는 HEX, JOE, FAM, TAMRA, ROX 또는 플루오르세인-기반 표지 (fluorescein-based label)를 포함한다.
적합한 리포터-퀀처 쌍은 많은 문헌에 개시되어 있다: Pesce et al., editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, R. P., HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; 미국 특허 제3,996,345호 및 제4,351,760호.
본 발명에서 광범위한 파장 또는 특정 파장의 형광을 퀀칭할 수 있는 비형광 블랙 퀀처 분자(또는 다크 퀀처 분자)가 사용될 수 있다는 것도 주목할 만하다. 예를 들어, BHQ 및 DABCYL이 있다.
프로브에 적용된 FRET 표지에서 리포터는 FRET의 공여자를 포함하고, 퀀처는 FRET의 다른 파트너(수용자)를 포함한다. 예를 들어, 플루오세인 색소는 리포터로 사용되고 로다인 색소는 퀀처로 사용된다.
(ⅱ) 제 1 프라이머 및/또는 제 2 프라이머에 연결된 표지와 프로브들 각각에 연결된 표지
일 구현예에 따르면, 상기 다이머-프라이머 및 프로브 복합체에서, 제 1 프라이머는 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중표지 중 하나를 가지며, 상기 제 1 프라이머의 3'말단과 인접한 프로브는 상호작용적 이중표지 중 나머지 하나를 갖는다. 상기 다이머-프라이머 및 프로브 복합체에서, 제 2 프라이머는 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중표지 중 하나를 가지며, 상기 제 2 프라이머의 3'말단과 인접한 프로브는 상호작용적 이중표지 중 나머지 하나를 갖는다.
프라이머 및 프로브를 이용한 상호작용적 이중표지의 원리는 다음과 같다: 상기 다이머-프라이머 및 프로브 복합체에서, 제 2 프라이머에 제 1 프라이머 및 프로브는 근접하여 혼성화 되기 때문에, 상기 제 1 프라이머 및 프로브에 있는 리포터 분자 및 퀀처 분자는 인접하여 상기 퀀처 분자가 상기 리포터 분자로부터 나오는 시그널을 퀀칭(quenching)하고, 상기 5'핵산분해효소에 의해 프로브의 5'말단이 분해되면 상기 제 1 프라이머 및 프로브에 있는 리포터 분자 및 퀀처 분자는 서로 이격되어 리포터 분자로부터 시그널을 발생시킨다.
또한, 상기 다이머-프라이머 및 프로브 복합체에서, 제 1 프라이머에 제 2 프라이머 및 프로브는 근접하여 혼성화 되기 때문에, 상기 제 2 프라이머 및 프로브에 있는 리포터 분자 및 퀀처 분자는 인접하여 상기 퀀처 분자가 상기 리포터 분자로부터 나오는 시그널을 퀀칭(quenching)하고, 상기 5'핵산분해효소에 의해 프로브의 5'말단이 분해되면 상기 제 2 프라이머 및 프로브에 있는 리포터 분자 및 퀀처 분자는 서로 이격되어 리포터 분자로부터 시그널을 발생시킨다.
본 발명의 일 구현예에 따르면, 제 2 프라이머에 제 1 프라이머 및 프로브(또는 제 1 프라이머에 제 2 프라이머 및 프로브)가 혼성화 되어 퀀처 분자가 리포터 분자로부터 시그널을 퀀칭할 수 있도록 하는 한, 제 1 프라이머 및 프로브(또는 제 2 프라이머 및 프로브)는 제 2 프라이머(또는 제 1 프라이머)에 바로 인접하거나, 1-5 뉴클레오타이드 이격되어 위치할 수 있다.
본 발명의 구체적인 구현예에 따르면, 제 1 프라이머 및 프로브(또는 제 2 프라이머 및 프로브)가 제 2 프라이머(또는 제 1 프라이머)에 인접하여 혼성화 되는 경우, 퀀처 분자가 리포터 분자로부터 시그널을 퀀칭할 수 있도록 하는 한, 리포터 분자 및 퀀처 분자는 제 1 프라이머 및 프로브(또는 제 2 프라이머 및 프로브)의 어떠한 위치에도 결합할 수 있다. 예를 들어, 프로브의 5'-말단 또는 5'-말단으로부터 1-5 뉴클레오타이드 이격된 위치에 리포터 분자 또는 퀀처 분자가 결합되고, 상기 프로브에 인접하게 혼성화되는 제 1 프라이머의 3'-말단 또는 3'-말단으로부터 1-5 뉴클레오타이드 이격된 위치에 퀀처 분자 또는 리포터 분자가 결합될 수 있다.
단계 (c): 시간 경과에 따라 제공된 시그널을 측정( 130 )
마지막으로 본 발명의 방법은 (c) 시간 경과에 따라 제공된 상기 시그널을 측정하는 단계를 포함한다. 상기 시간 경과에 따른 시그널의 변화는 상기 5’핵산분해효소의 활성을 나타낸다.
상기 시그널의 측정은 하나의 온도, 즉 등온에서 인큐베이션 동안 실시간 방식 또는 미리 결정된 시간 간격(interval) 방식으로 실시된다.
본 발명의 방법에 따라 5'핵산분해효소의 활성을 분석하는 경우, 인큐베이션 초기 구간에서는 시그널 강도(형광값)가 일정하게 증가하며, 즉 시간 경과에 따른 일정한 시그널 변화율(rate of signal change)을 나타낸다. 하지만, 인큐베이션 시간이 더 경과하면 시그널 변화율이 점차적으로 감소하게 되고, 결국 시그널 변화율이 0이 된다.
즉, 본 발명에 따르면 5'핵산분해효소의 활성을 갖는 경우, 시간이 경과함에 따라 시그널 강도가 증가하다가 더 이상 증가하지 않는 시간 대 시그널 강도 (또는 시그널 강도 대 시간)의 함수, 즉 시간이 경과함에 따라 시그널 변화율이 0을 초과하는 일정한 값을 갖다가 점점 감소하여 0이 되는 시간 대 시그널 변화율(또는 시그널 변화율 대 시간)의 함수를 나타낸다.
이는 인큐베이션의 초기 시간 구간에서는 5'핵산분해효소가 인큐베이션 동안 다이머-프라이머 및 프로브 복합체에서 프로브들의 5'말단들을 분해하면서 지속적인 시그널 강도의 증가, 즉 일정한 시그널 변화율이 초래되지만, 시간이 어느 정도 경과하면 분해할 프로브가 점차 소모(고갈)되므로 감소된 시그널 변화율이 초래되기 때문이다.
인큐베이션의 초기 시간 구간에서의 일정한 시그널 변화율은 사용된 5'핵산분해효소의 활성에 따라 달라질 수 있다. 예를 들어, 높은 활성을 갖는 5'핵산분해효소는 동일한 농도에서 인큐베이션의 초기 시간 구간에서 높은 시그널 변화율을 나타내는 반면, 낮은 활성을 갖는 5'핵산분해효소는 동일한 농도에서 인큐베이션의 초기 시간 구간에서 낮은 시그널 변화율을 나타낸다. 따라서, 인큐베이션의 초기 시간 구간에서의 일정한 시그널 변화율의 수준 또는 정도는 핵산 중합효소의 활성을 나타낼 수 있다.
일 구현예에서, 상기 단계 (c)에서의 시그널의 측정에 대한 결과는 인큐베이션 시간 대 시그널 강도(형광값)(또는 시그널 강도(형광값) 대 인큐베이션 시간)의 플롯(plot)으로 표시된다.
상기 플롯의 예가 도 4, 6, 및 7에 도시되어 있다. 상기 각 도면에서 보는 바와 같이, 인큐베이션의 초기 시간 구간에서는 시그널 강도가 계속 증가하지만 인큐베이션의 말기 시간 구간에 가까워질수록 시그널 강도의 증가가 정체된다.
본 발명의 일 구현예에 따르면, 상기 시그널의 변화는 인큐베이션의 초기 시간 구간에 대해 측정된다.
전술한 바와 같이, 인큐베이션의 초기 시간 구간에서 인큐베이션 시간 대 시그널 세기(또는 시그널 세기 대 인큐베이션 시간)의 함수는 선형 상관관계, 즉 1차 함수를 나타낸다.
따라서, 본 발명의 일 구현에에 따르면, 상기 시그널의 변화는 인큐베이션 시간 대 시그널 세기의 함수가 1차 함수를 나타내는 시간에 대해 측정된다.
일 구현예에서, 시간 경과에 따른 시그널의 변화는 전술한 인큐베이션의 초기 시간 구간에 대해 인큐베이션 시간 대 시그널 세기의 1차 함수로부터 기울기 또는 1차 도함수(미분)를 계산함으로써 수득된다.
본 발명의 보다 구체적인 구현예에 따르면, 상기 5'핵산분해효소의 활성은 상기 5'핵산분해효소의 농도 또는 질량에 따라 인큐베이션 시간 대 시그널의 세기가 1차 함수로 증가하는 범위에서 측정한 기울기로 제공된다. 보다 더 구체적으로, 상기 시그널의 세기는 분해된 프로브의 양으로 변환된다. 본 구현예에 따라 제공된 활성은 도 5 및 도 8에서 확인할 수 있다.
활성 어세이 조성물에 포함된 프로브의 총 양을 알고 있으므로, 다이머-프라이머 및 프로브 복합체에서 프로브들의 5'말단들이 분해되어 나타나는 최대 시그널의 값은 활성 어세이 조성물에 포함된 프로브의 총 양과 비례하므로, 시그널의 값은 분해된 프로브의 양(보다 구체적으로, 유리된 형광 표지-5'말단 뉴클레오타이드의 양)으로 변환될 수 있다. 따라서, 시간 대 시그널의 변화는 시간 대 분해된 프로브의 양으로 변환될 수 있다.
전술한 인큐베이션의 단위 시간 동안 분해된 프로브의 양은 5'핵산분해효소의 활성을 나타낼 수 있다. 예를 들어, 동일한 농도의 2종의 5'핵산분해효소가 본 발명의 방법에 의해 활성이 분석되는 경우, 단위 시간 동안 분해된 프로브의 양이 많은 5'핵산분해효소는 단위 시간 동안 분해된 프로브의 양이 적은 5'핵산분해효소에 비해 더 큰 활성을 갖는다고 할 수 있다.
구체적으로, 도 4 및 도 5를 참조하여 설명하면, 우선 5'핵산분해효소의 농도 별 인큐베이션 시간에 대한 형광값을 측정한 결과로부터 5'핵산분해효소의 농도 별 초기 시간에서의 형광의 세기를 계산하고, 5'핵산분해효소의 농도에 대하여 단위 시간 당 형광의 세기의 변화에 대한 그래프를 그린 다음, 상기 형광의 세기를 프로브의 양으로 변환하여 5'핵산분해효소의 농도에 대하여 단위 시간 당 분해된 프로브의 양의 변화가 1차 함수로 증가하는 범위에서 측정한 기울기를 5'핵산분해효소의 활성(Unit)으로 제공한다.
이 경우, 5'핵산분해효소의 활성(Unit)은 5'핵산분해효소의 단위 농도(질량)당 주어진 온도(인큐베이션 온도)에서 단위 시간 동안 분해된 프로브의 양을 의미한다.
본 발명의 방법에 따라, Taq DNA 중합효소(M0267S, NEB)는 72℃에서 30분 동안 1.36 pmole의 프로브를 분해하는 5'핵산분해효소의 활성을 가지며, DreamTaq DNA 중합효소(Thermo ScientificTM)의 경우 1.28 pmole, Taq DNA 중합효소(Qiagen)의 경우 0.80 pmole, rTth DNA 중합효소(TOYOBO)의 경우 1.77 pmole의 프로브를 72℃에서 30분 동안 분해하는 5'핵산분해효소의 활성을 가짐을 후술하는 실시예를 통하여 확인하였다.
상기 5'핵산분해효소의 농도는 당업계에 공지된 다양한 방법에 의해 결정될 수 있다. 일 예로서, 상기 5'핵산분해효소의 농도는 브래드포드(Bradford) 방법, BCA 방법 또는 A280 흡광에 의해 결정될 수 있다.
Ⅱ. 5'핵산분해효소(nuclease)의 활성 어세이 조성물
본 발명의 다른 양태에 따르면, 본 발명은 다음을 포함하는 5'핵산분해효소(nuclease)의 활성 어세이 조성물을 제공한다:
(a) 다이머-형성 프라이머(dimer-forming primer) 쌍; 상기 다이머-형성 프라이머 쌍은 제 1 프라이머 및 제 2 프라이머를 포함하며, 상기 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함하고, 상기 제 1 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이며, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고, 및
(b) 프로브들(probes); 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적이고, 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 상기 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)를 형성한다.
본 발명의 조성물은 상술한 본 발명의 방법을 실시하기 위하여 이용하는 것으로서, 이 둘 사이에 공통된 설명은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
본 발명의 일 구현예에 따르면, 상기 조성물은 dNTPs 또는 NTPs를 포함하지 않는다.
본 발명의 일 구현예에 따르면, 상기 다이머-형성 프라이머(dimer-forming primer) 쌍은 셀프 다이머-형성 프라이머(self dimer-forming primer) 쌍이고, 상기 제 1 프라이머 및 제 2 프라이머 각각은 셀프 다이머-형성 프라이머이며, 상기 3'-다이머-형성 영역은 3'-헤어핀-형성 영역이고, 상기 다이머가 형성된 다이머-프라이머는 셀프 다이머가 형성된 셀프 다이머-프라이머이며, 상기 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)는 셀프 다이머-프라이머 및 프로브 복합체(self dimer-primer and probe complex)이다.
본 발명의 일 구현예에 따르면, 상기 조성물은 (ⅰ) 프로브들 각각에 연결되는 이중표지, 또는 (ⅱ) 제 1 프라이머 및/또는 제 2 프라이머에 연결되는 표지와 프로브들 각각에 연결되는 표지를 추가적으로 포함한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 다이머-형성 프라이머 쌍 및 프로브들 두 종류의 올리고뉴클레오타이드를 이용하여 종래 프라이머, 주형, 프로브를 사용하는 방법에 비해 디자인 시 고려되어야 할 요소가 적어, 디자인이 용이하다. 또한, 다이머-형성 프라이머 쌍과 프로브들의 혼성화로 형성되는 다이머-프라이머 및 프로브 복합체는 PCR 내에서 5'핵산분해효소가 활동하는 환경을 구사하여, 본 발명을 이용해 측정된 효소 활성의 신뢰도 및 응용성이 높다.
(b) 본 발명은 종래 방사성 동위원소를 사용하여 유닛을 결정하는 방법에 비해, 간단하고 신속하며, 낮은 비용 및 안정성 측면에서 사용자 편의성을 크게 개선한다.
(c) 본 발명은 5'핵산분해효소 도메인을 포함하는 다양한 핵산 중합효소에 적용될 수 있으며, 중합효소의 생산 과정에서의 활성 및 순도를 분석하고 품질관리를 모니터링하는 데 적용될 수 있을 뿐만 아니라, 5'핵산분해효소의 특성 연구를 통해 PCR에 적용되는 효소 개량의 근거로 사용할 수 있다.
도 1은 본 발명의 일 구현예에 따라 본 발명의 방법을 실시하는 과정들의 흐름도이다.
도 2는 본 발명의 일 구현예에 따른 셀프-다이머 프라이머-프로브 복합체 형성을 나타낸다.
도 3은 본 발명의 일 구현예에 따른 셀프-다이머 프라이머-프로브 복합체의 작동 기작을 나타낸다.
도 4는 본 발명의 일 구현예에 따라 Taq DNA 중합효소의 5'핵산분해효소의 활성 측정을 위한 실시간 형광 측정 그래프를 나타낸다.
도 5는 본 발명의 일 구현예에 따라 Taq DNA 중합효소에 대한 시간 대 형광 시그널의 플롯을 보여준다.
도 6은 본 발명의 일 구현예에 따라 셀프-다이머 프라이머의 유무에 따른 실시간 형광 측정 그래프를 나타낸다.
도 7은 본 발명의 일 구현예에 따라 다양한 종류의 분해효소의 활성 측정을 위한 실시간 형광 측정 그래프를 나타낸다.
도 8은 본 발명의 일 구현예에 따라 다양한 종류의 분해효소의 활성 프로필 분석을 나타낸다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1: 셀프 다이머-형성 프라이머 및 이중표지 프로브의 설계
셀프 다이머-형성 프라이머는 같은 서열끼리 다이머를 형성하고, 이중표지 프로브가 혼성화되어 5'핵산분해효소가 인지할 수 있는 특이적 구조를 이룰 수 있도록 설계되었다. 하나의 올리고뉴클레오타이드의 3'-헤어핀-형성 영역은 회문 구조를 가지기 때문에, 추가적인 프라이머나 주형 핵산의 도입 없이 간단하게 프라이머가 부착된 핵산 구조를 다이머를 통해 형성할 수 있다. 이렇게 형성된 셀프 다이머-형성 프라이머의 5'-프로브 혼성화 영역에는 이중표지 프로브가 결합하여 셀프 다이머-프라이머 및 프로브 복합체가 형성될 수 있도록 설계하였다(도 2). 셀프 다이머-형성 프라이머끼리 혼성화되거나 혹은 프로브가 혼성화되는 부위는 5'핵산분해효소의 활성 측정 온도인 72℃보다 높은 멜팅 온도(Tm)를 가지도록 설계하였다.
셀프 다이머-형성 프라이머의 3'말단과 이중표지 프로브의 5'말단 사이의 간격은 0 뉴클레오타이드 길이 이상으로 설계될 수 있다. 또한, 이중표지 프로브의 5'말단은 반드시 혼성화되지 않고 오버행(Overhang) 구조를 이루어도 된다. 다만, 이러한 경우 프로브의 5'말단 오버행을 제외한 나머지 혼성화되는 부위는 5'핵산분해효소의 활성 측정 온도인 72℃보다 높은 멜팅 온도(Tm)를 가지도록 하는 게 좋다.
상기 셀프 다이머-형성 프라이머의 구조 및 Tm 분석은 IDT사의 OligoAnalyzer에 의해 수행하였다.
실험에 사용된 서열 정보는 아래 표 1에 나타낸 바와 같다:
서열번호 이름 서열(5' to 3') 길이(nt) *Tm1 (℃) **Tm2 (℃)
1 셀프 다이머 -형성 프라이머 #1 GGCGTTACCCAACTTAATCGCCTTGCAGCA
GTACACGACGGCCAGCTGGCCGTCGTGTAC 		60 75.8 73.8
2 이중표지 프로브 #1 HEX-TGCTGCAAGGCGATTAAGTTGGGTAA
CGCC-BHQ1		 30 - 73.8
밑줄: 3'-헤어핀-형성 영역
기울임꼴: 5'-프로브-혼성화 영역
*Tm1: 셀프 다이머의 멜팅 온도
**Tm2: 5'-프로브-혼성화 영역의 멜팅 온도
실시예 2: 효소 활성 분석용 조성물의 제조
상기 실시예 1에서 설계된 셀프 다이머-형성 프라이머 #1, 이중표지 프로브 #1, 10X Ready 버퍼 및 초순수를 혼합하고, 95℃에서 3분 가열한 후, 상온으로 20분간 식혀 0.2 pmole/μL의 셀프 다이머-프라이머 및 프로브 복합체 시약을 제조하였다.
이후, 상기 셀프 다이머-프라이머 및 프로브 복합체 시약 0.8 pmole, 1X 5'-Exo 버퍼, 초순수를 포함하여 최종 10 μL의 활성 분석용 조성물을 제조하였다.
실시예 3: Taq DNA polymerase의 5'핵산분해효소 활성 측정
실시예 2에서 제조된 활성 분석용 조성물이 5'핵산분해효소의 활성을 측정하는 데 사용될 수 있는지 확인하기 위하여, 5'핵산분해효소로서 상업적으로 이용가능한 Taq DNA 중합효소(M0267S, NEB)에 대해 분석하였다.
상기 Taq DNA 중합효소 5 U/μL를 10X ThermoPol 반응 버퍼와 초순수를 이용하여 1000 mU/μL, 125 mU/μL, 62.5 mU/μL, 31.3 mU/μL, 15.6 mU/μL, 및 7.8 mU/μL의 농도로 각각 희석하였다.
이후, 실시예 2에서 제조된 활성 분석용 조성물, 상기 각 농도의 Taq DNA 중합효소, 및 초순수를 10:1:9의 부피 비율로 혼합하였다. 모든 과정은 얼음을 이용하여 저온에서 수행하였다.
상기 각각의 혼합물 20 μL를 8-strip PCR 튜브에 넣은 다음, 실시간으로 형광 측정이 가능하고 온도가 조절되는 기기인 CFX96(Bio-Rad)에서 72℃에서 인큐베이션하였다. 상기 인큐베이션 동안 30초 간격으로 형광 시그널을 측정하였다.
상기 측정 결과를 도 4에 나타내었다. 도 5는 상이한 농도의 Taq DNA 중합효소에 대한 시간 대 형광 시그널의 플롯을 보여준다.
도 4에서 보는 바와 같이, 시간 경과에 따라 형광 시그널이 점차 증가하다가 최종적으로는 평형 상태(정체기)에 도달하였다. 이는 인큐베이션 초기에는 5'핵산분해효소가 기질인 이중표지 프로브를 분해하면서 소광제의 영향권을 벗어난 형광단으로부터 형광이 발현되어 형광 시그널의 증가를 초래하다가 기질이 완전히 분해되면 형광 시그널이 더 이상 증가하지 않는다는 것을 나타낸다. 따라서, 상기 시간 경과에 따른 형광 시그널의 변화는 반응에서 분해된 이중표지 프로브의 양을 나타낼 것이다.
본 실시예에 따르면, 셀프 다이머-프라이머 및 프로브 복합체가 5'핵산분해효소의 표적이 되어 프로브의 5'말단이 분해되면서, 소광제의 영향권에서 벗어난 형광단이 검출가능한 시그널을 제공하여 도 4에 도시된 바와 같은 시간 대 형광 시그널의 플롯을 생성한다. 상기 플롯에서 기질의 고갈이 일어나지 않는 인큐베이션의 초기 시간 구간의 경우, 시간과 형광 시그널이 선형 상관관계, 즉 1차 함수를 나타내며, 이를 미분하여 시그널 변화율을 계산할 수 있다. 반응에 첨가한 기질이 소진되면 최대 형광 시그널이 나타나게 되므로 이에 비례해서 각 형광 시그널의 증가 속도별로 분해된 프로브의 양을 산출할 수 있고, 특정 시간, 예를 들어 30분당 중합효소 농도(중합효소 유닛)에 대한 분해된 프로브의 양을 구할 수 있다.
상기와 같이 결정된 Taq DNA 중합효소 농도당 30분 동안의 분해된 프로브의 양을 하기 표 2에 나타내었다.
효소 농도 (mU) 프로브 분해량 (pmole)
125.00 1.72
62.50 0.84
31.25 0.40
15.63 0.20
7.81 0.11
0.00 0.00
상기 표 2에서 계산된 결과를 기반으로, Taq DNA 중합효소의 농도에 따른 분해된 프로브의 양을 도식화하여 도 5에 나타내었다. 도 5에서 보는 바와 같이, 중합효소의 농도와 분해된 프로브의 양은 1차 함수의 선형 상관관계를 나타내기 때문에, 상기 함수의 기울기에 의해 중합효소의 단위 농도에 따른 30분 동안의 프로브의 분해량을 확인할 수 있었다.
본 실시예에서 사용된 Taq DNA 중합효소의 유닛(unit) 농도는 방사성 동위원소를 이용한 분석에 의해 결정된 중합효소의 활성 단위(방사성 동위원소로 측정하여 75℃에서 30분 동안 15 nmole의 dNTP를 소모하는 효소 단위)를 따른다. 즉, 이는 5'핵산분해효소의 활성과는 무관한 단위이며, 본 실시예에서는 농도의 기준으로 사용되었다. 상기 도 5에서, 중합효소 1 유닛의 활성이 관측되는 농도는 본 실시예에 따라 72℃에서 30분 동안 1.36 pmole의 프로브를 분해하는 효소의 단위로 정의될 수 있다.
상기 결과는 상업적으로 이용가능한 Taq DNA 중합효소가 본 실시예에 따라 72℃에서 30분 동안 1.36 pmole의 프로브를 분해하는 5'핵산분해효소의 활성을 가짐을 보여준다.
실시예 4: 셀프 다이머-형성 프라이머 유무에 따른 분해 활성의 차이
셀프 다이머-형성 프라이머가 5'핵산분해효소의 활성 확인에 꼭 필요한 요소인지 확인하기 위해 실시예 2와 같은 방법으로 최종 10 μL의 활성 분석용 조성물을 제조하였다. 각 활성 분석용 조성물은 셀프 다이머-형성 프라이머를 포함하거나, 혹은 포함하고 있지 않다.
상기 제조된 활성 분석용 조성물 각각을 실시예 3에서 제조된 다양한 농도의 Taq DNA 중합효소(NEB, M0267S) 및 초순수와 10:1:9의 부피 비율로 혼합하였다. 모든 과정은 얼음을 이용하여 저온에서 수행하였다.
상기 각각의 혼합물 20 μL를 8-strip PCR 튜브에 넣은 다음, CFX96에서 72℃에서 인큐베이션하였다. 상기 인큐베이션 동안 30초 간격으로 형광 시그널을 측정하였다.
상기 측정 결과를 도 6에 나타내었다. 도 6의 (a)는 셀프 다이머-형성 프라이머 #1를 첨가하여 얻은 시간 대 형광 시그널의 플롯을 나타내고, 도 6의 (b)는 셀프 다이머-형성 프라이머 #1을 첨가하지 않은 상태로 얻은 시간 대 형광 시그널의 플롯을 나타낸다.
도 6에서 볼 수 있는 바와 같이, 셀프 다이머-형성 프라이머가 5'핵산분해효소의 활성 확인에 꼭 필요한 요소임을 확인하였다.
실시예 5: 다양한 종류의 진단용 효소 활성 측정
실시예 3에서 실험한 Taq DNA 중합효소 외에 진단 분야에서 사용되는 다양한 유형의 5'핵산분해효소의 활성을 측정하였다.
상업적으로 이용가능한 DreamTaq DNA 중합효소(Thermo ScientificTM, EP0705), Taq DNA 중합효소(Qiagen, 201203), rTth DNA 중합효소(TOYOBO, TTH-301)를 각각 1000 mU/μL, 125 mU/μL, 62.5 mU/μL, 31.3 mU/μL, 15.6 mU/μL, 및 7.8 mU/μL의 농도로 희석하였다. 마찬가지로, 상업적으로 이용가능한 Bst DNA 중합효소, 큰 단편(NEB, M075S)을 10 mU/μL, 5 mU/μL, 2.5 mU/μL, 1.25 mU/μL, 0.63 mU/μL, 0.31 mU/μL의 농도로 희석하였고, KlenTaq1(DNA POLYMERASE TECHNOLOGY, 100), Hemo KlenTaq(NEB, M0332S)을 원액의 1/40, 1/160, 1/320, 1/640, 1/1280, 1/2560 및 1/5120만큼 희석하였다. 상기 농도는 모두 EvaEZ™ Fluorometric Polymerase Activity Assay Kit(Biotium, #29051)을 이용한 중합효소 활성 평가에서 활성이 정상적으로 관측된 농도이다.
이후, 실시예 2에서 제조된 활성 분석용 조성물, 상기 각 농도의 DNA 중합효소, 및 초순수를 10:1:9의 부피 비율로 혼합하였다. 모든 과정은 얼음을 이용하여 저온에서 수행하였다.
그리고 나서, 상기 각각의 혼합물 20 μL를 8-strip PCR 튜브에 넣은 다음, CFX96(Bio-Rad)에서 72℃(단, Bst DNA 중합효소의 경우, 65℃)에서 인큐베이션하였다. 상기 인큐베이션 동안 30초 간격으로 형광 시그널을 측정하였다.
상기 측정 결과를 도 7에 나타내었다. 도 7의 (a)는 DreamTaq DNA 중합효소(Thermo ScientificTM)를 사용하여 얻은 시간 대 형광 시그널의 플롯을 나타내고, 도 7의 (b)는 Taq DNA 중합효소(Qiagen)를 사용하여 얻은 시간 대 형광 시그널의 플롯을 나타내며, 도 7의 (c)는 rTth DNA 중합효소(TOYOBO)를 사용하여 얻은 시간 대 형광 시그널의 플롯을 나타내고, 도 7의 (d)는 Bst DNA 중합효소, 큰 단편(NEB)을 사용하여 얻은 시간 대 형광 시그널의 플롯을 나타내고, 도 7의 (e)는 KlenTaq1(DNA POLYMERASE TECHNOLOGY)을 사용하여 얻은 시간 대 형광 시그널의 플롯을 나타내며, 도 7의 (f)는 Hemo KlenTaq(NEB)을 사용하여 얻은 시간 대 형광 시그널의 플롯을 나타낸다.
이후, 실시예 3에 기재된 바와 같이, 중합효소 농도에 대한 30분 동안의 프로브 분해량을 계산하였다.
상기 결과를 하기 표 3에 나타내었다.
DreamTag DNA 중합효소
(Thermo ScientificTM)		 Taq DNA 중합효소
(Qiagen)
효소 농도 (mU) 프로브 분해량(pmole) 효소 농도 (mU) 프로브 분해량(pmole)
125.00 1.61 125.00 1.02
62.50 0.79 62.50 0.48
31.25 0.38 31.25 0.24
15.63 0.18 15.63 0.13
7.81 0.09 7.81 0.07
0.00 0.00 0.00 0
rTth DNA 중합효소
(TOYOBO)		 Bst DNA 중합효소, 큰 단편
(NEB)
효소 농도 (mU) 프로브 분해량(pmole) 효소 농도 (mU) 프로브 분해량(pmole)
125.00 2.23 100.00 -
62.50 1.07 50.00 -
31.25 0.51 25.00 -
15.63 0.28 12.50 -
7.81 0.14 6.25 -
0.00 0 0.00 -
KlenTaq1
(DNA POLYMERASE TECH.)		 Hemo KlenTaq
(NEB)
효소 농도
(희석비율)		 프로브 분해량(pmole) 효소 농도 (mU) 프로브 분해량(pmole)
1/40 - 1/40 -
1/160 - 1/160 -
1/320 - 1/320 -
1/640 - 1/640 -
1/1280 - 1/1280 -
1/2560 - 1/2560 -
1/5120 - 1/5120 -
효소 미첨가 - 효소 미첨가 -
이때, Bst DNA 중합효소, 큰 단편(NEB)과 KlenTaq1(DNA POLYMERASE TECHNOLOGY)과 Hemo KlenTaq(NEB)는 어떠한 형광의 발현도 관측되지 않아 프로브 분해량을 계산할 수 없었다(도 7의 (d)-(f)). 이는 상기 효소가 N 말단에 위치한 5'핵산분해효소가 제거되어 있어, 프로브가 분해되지 않음을 유추할 수 있었다.또한, 상기 표 3에서 계산된 결과를 기반으로, 중합효소의 농도에 따른 프로브 분해량을 도식화하여 도 8에 나타내었다.
도 8에서 보는 바와 같이, 각 효소의 방사성 동위원소 측정을 통한 중합효소 1 유닛(75℃에서 30분 동안 10 nmole의 dNTP를 소모)의 활성이 관측되는 농도는 본 실시예에 따라 72℃에서 30분 동안 DreamTaq DNA 중합효소(Thermo ScientificTM)의 경우 1.28 pmole, Taq DNA 중합효소(Qiagen)의 경우 0.80 pmole, rTth DNA 중합효소(TOYOBO)의 경우 1.77 pmole의 프로브를 72℃에서 30분 동안 분해하는 수준에 해당한다는 것을 확인할 수 있었다.
상기 결과는 본 실시예의 방법을 사용하여 중합효소 간의 활성을 비교할 수 있음을 보여준다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (26)

  1. 다음의 단계를 포함하는 5'핵산분해효소(nuclease)의 활성을 분석하는 방법:
    (a) (ⅰ) 다이머-형성 프라이머(dimer-forming primer) 쌍 및 (ⅱ) 프로브들(probes)을 포함하는 활성 어세이 조성물(a composition for activity assay)을 제공하는 단계; 상기 다이머-형성 프라이머 쌍은 제 1 프라이머 및 제 2 프라이머를 포함하며, 상기 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함하고, 상기 제 1 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이며, 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적이고, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머 형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고, 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer primer and probe complex)를 형성하며, 및
    (b) 상기 5'핵산분해효소를 상기 활성 어세이 조성물에 첨가하고 이 결과물을 인큐베이션(incubation)시키는 단계; 상기 5'핵산분해효소에 의해 상기 다이머-프라이머 및 프로브 복합체의 프로브들의 5'말단들이 분해되어 검출가능한 시그널이 제공되고,
    (c) 시간 경과에 따라 제공된 상기 시그널을 측정하는 단계; 상기 시간 경과에 따른 시그널의 변화는 상기 5'핵산분해효소의 활성을 나타낸다.
  2. 제 1 항에 있어서, 상기 5'핵산분해효소는 엑소뉴클레아제(exonuclease) 또는 엔도뉴클레아제(endonuclease)인 것을 특징으로 하는 방법.
  3. 제 1 항에 있어서, 상기 5'핵산분해효소는 5'핵산분해효소의 활성을 갖는 DNA 중합효소 또는 플랩 엔도뉴클레아제(flap endonuclease: FEN)인 것을 특징으로 하는 방법.
  4. 제 1 항에 있어서, 상기 활성 어세이 조성물은 dNTPs 또는 NTPs를 포함하지 않은 것을 특징으로 하는 방법.
  5. 제 1 항에 있어서, 상기 제 1 프라이머 및 제 2 프라이머 각각은 7 내지 100 뉴클레오타이드 길이인 것을 특징으로 하는 방법.
  6. 제 1 항에 있어서, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머 형성 영역 각각은 3 내지 50 뉴클레오타이드 길이인 것을 특징으로 하는 방법.
  7. 제 1 항에 있어서, 상기 제 1 프라이머 및 제 2 프라이머의 5'-프로브-혼성화 영역 각각은 3 내지 50 뉴클레오타이드 길이인 것을 특징으로 하는 방법.
  8. 제 1 항에 있어서, 상기 다이머-형성 프라이머(dimer-forming primer) 쌍은 셀프 다이머-형성 프라이머(self dimer-forming primer) 쌍이고, 상기 제 1 프라이머 및 제 2 프라이머 각각은 셀프 다이머-형성 프라이머이며, 상기 3'-다이머-형성 영역은 3'-헤어핀-형성 영역이고, 상기 다이머가 형성된 다이머-프라이머는 셀프 다이머가 형성된 셀프 다이머-프라이머이며, 상기 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)는 셀프 다이머-프라이머 및 프로브 복합체(self dimer-primer and probe complex)인 것을 특징으로 하는 방법.
  9. 제 8 항에 있어서, 상기 셀프 다이머-형성 프라이머의 5'-프로브-혼성화 영역은 동일한 서열의 다른 셀프 다이머-형성 프라이머의 5'-프로브-혼성화 영역 및 3'-헤어핀-형성 영역에 실질적으로 비상보적인 뉴클레오타이드 서열을 갖는 것을 특징으로 하는 방법.
  10. 제 8 항에 있어서, 상기 셀프 다이머-형성 프라이머의 3'-헤어핀-형성 영역은 동일한 서열의 다른 셀프 다이머-형성 프라이머의 3'-헤어핀-형성 영역에 실질적으로 상보적인 뉴클레오타이드 서열을 갖는 것을 특징으로 하는 방법.
  11. 제 8 항에 있어서, 상기 셀프 다이머-형성 프라이머의 3'-헤어핀-형성 영역은 실질적으로 회문 서열(palindromic sequence)을 갖는 것을 특징으로 하는 방법.
  12. 제 1 항에 있어서, 상기 셀프 다이머-형성 프라이머의 3'-헤어핀-형성 영역이 n 뉴클레오타이드 길이인 경우, 3'-말단으로부터 m번째 뉴클레오타이드 염기는 n-m+1번째 뉴클레오타이드 염기와 상보적(여기서, n은 5 내지 50의 정수이고, m은 1 이상의 정수임)인 것을 특징으로 하는 방법.
  13. 제 1 항에 있어서, 상기 셀프 다이머-형성 프라이머의 5'-프로브-혼성화 영역의 길이와 상기 셀프 다이머-형성 프라이머의 3'-헤어핀-형성 영역의 길이는 약 1:1의 비율인 것을 특징으로 하는 방법.
  14. 제 1 항에 있어서, 상기 프로브들은 5 내지 50 뉴클레오타이드 길이인 것을 특징으로 하는 방법.
  15. 제 1 항에 있어서, 상기 다이머-프라이머 및 프로브 복합체에서, 상기 프라이머의 3'말단과 상기 프라이머의 3'말단과 인접한 프로브의 5'말단 사이의 간격은 0 내지 15 뉴클레오타이드 길이인 것을 특징으로 하는 방법.
  16. 제 1 항에 있어서, 상기 인큐베이션은 상기 형성된 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)의 프로브의 5'말단을 분해하도록 5'핵산분해효소가 작동하는 등온 하에서 수행되는 것을 특징으로 하는 방법.
  17. 제 1 항에 있어서, 상기 등온은 65 내지 80℃로부터 선택된 온도인 것을 특징으로 하는 방법.
  18. 제 1 항에 있어서, 상기 검출가능한 시그널은 (ⅰ) 프로브들 각각에 연결된 이중표지, 또는 (ⅱ) 제 1 프라이머 및/또는 제 2 프라이머에 연결된 표지와 프로브들 각각에 연결된 표지에 의해 제공되는 것을 특징으로 하는 방법.
  19. 제 1 항에 있어서, 상기 활성 어세이 조성물은 다이머-형성 프라이머 쌍 및 프로브들 외에 추가적인 올리고뉴클레오타이드를 포함하지 않는 것을 특징으로 하는 방법.
  20. 제 1 항에 있어서, 상기 시그널의 변화는 인큐베이션 시간 대 시그널 세기의 함수가 1차 함수를 나타내는 시간에 대해 측정되는 것을 특징으로 하는 방법.
  21. 제 20 항에 있어서, 상기 5'핵산분해효소의 활성은 상기 5'핵산분해효소의 농도 또는 질량에 따라 인큐베이션 시간 대 시그널의 세기가 1차 함수로 증가하는 범위에서 측정한 기울기로 제공되는 것을 특징으로 하는 방법.
  22. 제 21 항에 있어서, 상기 시그널의 세기는 분해된 프로브의 양으로 변환되는 것을 특징으로 하는 방법.
  23. 다음을 포함하는 5'핵산분해효소(nuclease)의 활성 어세이 조성물:
    (a) 다이머-형성 프라이머(dimer-forming primer) 쌍; 상기 다이머-형성 프라이머 쌍은 제 1 프라이머 및 제 2 프라이머를 포함하며, 상기 제 1 프라이머 및 제 2 프라이머 각각은 5'에서 3'의 방향으로 5'-프로브-혼성화 영역 및 3'-다이머-형성 영역을 포함하고, 상기 제 1 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열은 상기 제 2 프라이머 내의 3'-다이머-형성 영역의 뉴클레오타이드 서열에 상보적이며, 상기 제 1 프라이머 및 제 2 프라이머의 3'-다이머-형성 영역 간의 혼성화를 통해 다이머가 형성된 다이머-프라이머를 형성하고, 및
    (b) 프로브들(probes); 상기 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역의 뉴클레오타이드 서열은 상기 프로브들 각각의 뉴클레오타이드 서열에 상보적이고, 상기 다이머-프라이머의 양 가닥인 제 1 프라이머 및 제 2 프라이머 각각의 5'-프로브-혼성화 영역에 상기 프로브들 각각이 혼성화되어 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)를 형성한다.
  24. 제 23 항에 있어서, 상기 조성물은 dNTPs 또는 NTPs를 포함하지 않은 것을 특징으로 하는 조성물.
  25. 제 23 항에 있어서, 상기 다이머-형성 프라이머(dimer-forming primer) 쌍은 셀프 다이머-형성 프라이머(self dimer-forming primer) 쌍이고, 상기 제 1 프라이머 및 제 2 프라이머 각각은 셀프 다이머-형성 프라이머이며, 상기 3'-다이머-형성 영역은 3'-헤어핀-형성 영역이고, 상기 다이머가 형성된 다이머-프라이머는 셀프 다이머가 형성된 셀프 다이머-프라이머이며, 상기 다이머-프라이머 및 프로브 복합체(dimer-primer and probe complex)는 셀프 다이머-프라이머 및 프로브 복합체(self dimer-primer and probe complex)인 것을 특징으로 하는 조성물.
  26. 제 23 항에 있어서, 상기 조성물은 (ⅰ) 프로브들 각각에 연결되는 이중표지, 또는 (ⅱ) 제 1 프라이머 및/또는 제 2 프라이머에 연결되는 표지와 프로브들 각각에 연결되는 표지를 추가적으로 포함하는 것을 특징으로 하는 조성물.
PCT/KR2025/007756 2024-06-25 2025-06-05 5'핵산분해효소의 활성을 분석하는 방법 Pending WO2026005334A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2024-0083097 2024-06-25
KR20240083097 2024-06-25

Publications (1)

Publication Number Publication Date
WO2026005334A1 true WO2026005334A1 (ko) 2026-01-02

Family

ID=98222367

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2025/007756 Pending WO2026005334A1 (ko) 2024-06-25 2025-06-05 5'핵산분해효소의 활성을 분석하는 방법

Country Status (1)

Country Link
WO (1) WO2026005334A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104293928A (zh) * 2014-09-28 2015-01-21 南京诺唯赞生物科技有限公司 一种定量核酸外切酶i活性测定方法
US20210108251A1 (en) * 2018-04-04 2021-04-15 Aarhus Universitet Detection of endonuclease activity
KR102380264B1 (ko) * 2017-08-31 2022-03-29 주식회사 씨젠 다이머-형성 프라이머 쌍을 이용한 구성요소의 성능 평가
WO2023076857A1 (en) * 2021-10-26 2023-05-04 Caribou Biosciences, Inc. Exonuclease-coupled real-time endonuclease activity assay

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104293928A (zh) * 2014-09-28 2015-01-21 南京诺唯赞生物科技有限公司 一种定量核酸外切酶i活性测定方法
KR102380264B1 (ko) * 2017-08-31 2022-03-29 주식회사 씨젠 다이머-형성 프라이머 쌍을 이용한 구성요소의 성능 평가
US20210108251A1 (en) * 2018-04-04 2021-04-15 Aarhus Universitet Detection of endonuclease activity
WO2023076857A1 (en) * 2021-10-26 2023-05-04 Caribou Biosciences, Inc. Exonuclease-coupled real-time endonuclease activity assay

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MA, C. ; TANG, Z. ; HUO, X. ; YANG, X. ; LI, W. ; TAN, W.: "Real-time monitoring of double-stranded DNA cleavage using molecular beacons", TALANTA, ELSEVIER, AMSTERDAM, NL, vol. 76, no. 2, 15 July 2008 (2008-07-15), NL , pages 458 - 461, XP022686083, ISSN: 0039-9140, DOI: 10.1016/j.talanta.2008.03.038 *

Similar Documents

Publication Publication Date Title
JP4972541B2 (ja) 標識されたプローブおよび３’→５’エキソヌクレアーゼ活性を用いた定量的増幅方法
WO2011149255A2 (en) Modified rnase h and detection of nucleic acid amplification
EP2625290A2 (en) Real time pcr detection of single nucleotide polymorphisms
WO2013133680A1 (ko) 핫스타트 역전사반응 또는 핫스타트 역전사 중합효소 연쇄반응용 조성물
WO2013168924A1 (en) Nucleic acid detection by oligonucleotide probes cleaved by both exonuclease and endonuclease
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
WO2012030136A2 (en) Oligonucleotides for detecting listeria spp. and use thereof
WO2022265463A1 (en) Detection of multiple target nucleic acid using multiple detection temperatures
WO2025009802A1 (ko) 단일 신호로 2가지 이상의 다중 표적핵산을 검출하기 위한 pcr 방법
WO2020145711A1 (ko) Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2015105336A1 (ko) 5'-플랩 엔도뉴클레이즈 활성이 억제된 dna 폴리머레이즈를 이용하여 실시간 중합효소 연쇄반응으로 돌연변이 유전자를 검사하는 방법
WO2026005334A1 (ko) 5'핵산분해효소의 활성을 분석하는 방법
WO2020145715A1 (ko) Tert 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2021172653A1 (ko) 단일 표적 유전자의 유전적 변이 실시간 검출용 단일핵산 및 이를 이용한 검출 방법
WO2024181774A1 (en) Detection of target nucleic acid by lpho-assisted pto cleavage and extension assay
WO2023106866A1 (ko) 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법
WO2025005717A1 (ko) Hto 절단 및 자기-연장 어세이에 의해 샘플 내의 타겟 핵산을 검출하는 방법
EP2971115B1 (en) Quantification of target nucleic acid using melting peak analysis
WO2024106890A1 (ko) 퀀칭-pto 절단 및 연장(quenching-pto cleavage and extension; q-ptoce) 어세이에 의한 타겟 핵산의 검출
WO2026071688A1 (ko) 경쟁적 혼성화물 기반 시그널링 어세이에 의한 타겟 핵산의 검출
WO2024186140A1 (ko) 인공핵산을 이용한 표적핵산의 검출 방법
WO2020145734A1 (ko) Braf 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2023043280A1 (ko) 합성 비자연 염기를 포함하는 태그 올리고뉴클레오타이드를 이용한 타겟 핵산 서열의 검출
WO2020145762A1 (ko) Jak2 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2024005458A1 (ko) 베타-하이드록시산을 이용한 타겟 핵산의 증폭 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25827300

Country of ref document: EP

Kind code of ref document: A1