WO2025143751A1 - 난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도 - Google Patents

난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도 Download PDF

Info

Publication number
WO2025143751A1
WO2025143751A1 PCT/KR2024/021029 KR2024021029W WO2025143751A1 WO 2025143751 A1 WO2025143751 A1 WO 2025143751A1 KR 2024021029 W KR2024021029 W KR 2024021029W WO 2025143751 A1 WO2025143751 A1 WO 2025143751A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
muscle
food
indigestible maltodextrin
maltodextrin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/KR2024/021029
Other languages
English (en)
French (fr)
Inventor
황환주
박세영
박지원
사순옥
한정숙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Samyang Corp
Original Assignee
Samyang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Samyang Corp filed Critical Samyang Corp
Publication of WO2025143751A1 publication Critical patent/WO2025143751A1/ko
Anticipated expiration legal-status Critical
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/125—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives containing carbohydrate syrups; containing sugars; containing sugar alcohols; containing starch hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/716—Glucans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system

Definitions

  • Skeletal muscle is the largest organ in the human body, accounting for 40-50% of the human body. Skeletal muscle tends to decrease by about 1% per year after the age of 30, and then rapidly decreases after the age of 65. As aging progresses, the functional ability of muscles (muscle strength, power) also gradually decreases. This decrease in muscle mass due to aging, as well as muscle strength or performance, is called sarcopenia.
  • Sarcopenia is caused by various factors, but research on each factor is still insufficient. It is induced by a decrease in growth hormone, neurological changes, changes in physical activity, changes in metabolism, the amount of sex hormones, or increases in fat or catabolic cytokines, and changes in the balance of protein synthesis and differentiation.
  • a food composition for improving muscle function such as increasing exercise capacity, muscle strength, or muscle mass, using natural substances that are safe for consumption by patients with sarcopenia or the elderly and can be taken for a long period of time
  • a food composition for improving or preventing sarcopenia or a pharmaceutical composition for treating or preventing sarcopenia.
  • One example of the present invention relates to a composition for improving muscle strength comprising indigestible maltodextrin.
  • a further example of the present invention relates to a composition for preventing, improving or treating sarcopenia comprising indigestible maltodextrin, wherein the composition may be a food composition or a pharmaceutical composition.
  • One example of the present invention relates to a method for improving muscle strength, or a method for preventing, improving or treating sarcopenia, comprising a step of administering indigestible maltodextrin or a starch hydrolyzate containing the same to a subject in need thereof.
  • One example of the present invention relates to the use of indigestible maltodextrin or a starch hydrolyzate containing the same for improving muscle strength or preventing, improving or treating sarcopenia.
  • One example of the present invention relates to a composition for improving muscle strength and/or a composition for preventing, improving or treating diseases related to muscle loss, comprising indigestible maltodextrin. Since the composition according to the present invention exhibits effects of increasing muscle mass, increasing muscle protein and generating muscle mass without side effects, it is very useful as a preventive, improving or treating agent for diseases related to muscle loss such as sarcopenia.
  • improvement in muscle strength may include improving the phenomenon of muscle strength decline due to a decrease in muscle mass, a decrease in muscle quality, etc., or increasing muscle strength, promoting muscle recovery, preventing muscle loss, preventing muscle degeneration, preserving muscles, etc.
  • Specific examples include the results showing an increase in the limb muscle strength of indigestible mice using a limb hanging test in animals fed indigestible maltodextrin in the present invention (see FIGS. 2 and 3), and changes in the muscle endurance of mice administered indigestible maltodextrin can be confirmed through an exercise stress test (treadmill test) (see FIGS. 4 and 5).
  • the composition according to the present invention can exhibit muscle strengthening effects through muscle differentiation, muscle regeneration, and muscle mass increase, and thus can be used to promote muscle production or improve muscle function.
  • indigestible maltodextrin can increase muscle mass or prevent muscle loss.
  • the composition can have at least one characteristic selected from the group consisting of the following characteristics (1) to (3):
  • the factor related to the induction of growth and differentiation of the muscle cells may be at least one selected from the group consisting of PI3K, Akt, mTOR, and S6K1
  • the myogenic regulatory factor may be at least one selected from the group consisting of Myf5, MyoD, MEF2, and Myogenin
  • the myokine factor may be at least one selected from the group consisting of FNDC5, LIF, and Metrn1.
  • sarcopenia refers to a disease in which muscle volume and strength are progressively reduced. Said sarcopenia is muscular atrophy, muscular dystrophy, muscular rigidity, hypotonia, muscular weakness, muscular dystrophy, amyotrophic lateral sclerosis, or myasthenia gravis.
  • Sarcopenia syndrome is a progressive, age-related syndrome characterized by a generalized, diffuse decrease in the volume, quantity, and quality of skeletal muscle fibers, and a decline in muscle strength and/or function; it is often accompanied by an increase in connective tissue and adipose tissue, and the main clinical symptoms of patients include decreased muscle strength, muscle laxity, decreased energy, increased skin wrinkles, decreased body mass, and decreased grip strength.
  • muscle strength loss or sarcopenia may be caused by various causes, for example, may be caused by aging or obesity, or may be caused by both aging and obesity.
  • Sarcopenic obesity which occurs together with obesity and sarcopenia, inhibits protein metabolism in muscles, resulting in a decrease in muscle mass, which in turn leads to a decrease in physical activity and basal metabolic rate, resulting in a vicious cycle of increased body fat.
  • Sarcopenic obesity not only causes problems such as osteoarthritis, falls, decreased exercise capacity, decreased quality of life, and increased mortality due to decreased muscle mass and muscle dysfunction, but also increases the risk of metabolic syndrome, diabetes, dyslipidemia, and cardiovascular disease caused by obesity.
  • sarcopenia due to aging refers to a decrease in skeletal muscle mass, muscle strength, muscle function, and muscle density due to aging.
  • skeletal muscle mass decreases by about 1% per year after the age of 30, and rapidly decreases after the age of 65.
  • the muscle-related diseases due to aging may be, but are not limited to, age-related sarcopenia, motor neuron disease, metabolic muscle disease, inflammatory myopathy, neuromuscular junction disease, and endocrine myopathy.
  • muscle weakness or sarcopenia or diseases related thereto include muscle diseases caused by muscle function decline, muscle degeneration, and muscle loss, and are preferably selected from the group consisting of muscular atrophy, disuse atrophy, spinal muscular amyotrophy, muscular dystrophy, dystrophy, myotonia, muscular hypotonia, muscular weakness, amyotrophic lateral sclerosis, spinal bulbar muscular atrophy, myasthenia, and myasthenia gravis, but are not limited thereto.
  • One example of the present invention relates to a food for preventing or improving sarcopenia, containing indigestible maltodextrin as an effective ingredient.
  • improved means reducing a parameter related to a condition being treated, for example, the degree of symptoms.
  • the food may increase muscle mass or prevent muscle loss, and preferably may increase muscle mass.
  • the health functional food of the present invention may include all foods in the conventional sense, and may be used interchangeably with terms known in the art, such as functional food.
  • the term "functional food” of the present invention means a food manufactured and processed using raw materials or ingredients having functionality useful to the human body according to Act No. 6727 on Health Functional Foods, and "functionality” means consumption for the purpose of obtaining a useful effect for health purposes, such as regulating nutrients for the structure and function of the human body or physiological effects.
  • health functional food means a food manufactured and processed using a specific ingredient as a raw material or a specific ingredient contained in a food raw material by methods such as extraction, concentration, purification, and mixing for the purpose of health supplementation, and means a food designed and processed so that the above-mentioned ingredients can sufficiently exert bioregulatory functions, such as biodefense, biorhythm regulation, disease prevention and recovery, on the body, and the above-mentioned health food composition can perform functions related to disease prevention and disease recovery.
  • bioregulatory functions such as biodefense, biorhythm regulation, disease prevention and recovery
  • the composition of the present invention When used as a food additive, the composition may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method.
  • resistant maltodextrin means maltodextrin that is not decomposed or is decomposed very slowly by human digestive enzymes, and may also mean an enzymatic hydrolyzate of roasted dextrin or a hydrolyzate of starch containing the resistant maltodextrin.
  • the resistant maltodextrin can be purchased and used as a commercially available product or manufactured and used directly.
  • resistant maltodextrin refers to corn starch that is obtained by heating it, enzymatically decomposing it with ⁇ -amylase (from Bacillus subtilis or Bacillus licheniformis) and amyloglucosidase (from Aspergillus niger), refining it, and fractionating the indigestible components to make it suitable for consumption.
  • ⁇ -amylase from Bacillus subtilis or Bacillus licheniformis
  • amyloglucosidase from Aspergillus niger
  • a composition for improving muscle strength, or preventing, improving, or treating sarcopenia can be manufactured as a health functional food composition.
  • the composition of the present invention includes ingredients that are usually added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, and seasonings.
  • Figure 1 is an overall experimental plan for constructing an animal model and administering a diet according to an example of the present invention.
  • Figures 2 and 3 are results showing an increase in limb muscle strength in mice by administration of indigestible maltodextrin using a limb hanging test method according to an example of the present invention.
  • Figures 6 and 7 are results showing changes in skeletal muscle mass of experimental animals due to administration of indigestible maltodextrin according to an example of the present invention.
  • Figures 8 and 9 are results showing changes in the hind limb muscle mass of experimental animals due to administration of indigestible maltodextrin according to an example of the present invention.
  • Figure 10 is a result showing the change in the mRNA expression level of the PI3K/Akt/mTOR pathway due to administration of indigestible maltodextrin according to an example of the present invention.
  • Figure 11 is a result showing changes in the mRNA expression levels of Myf5, MyoD, MEF2, and Myogenin due to administration of indigestible maltodextrin according to an example of the present invention.
  • Figure 12 is a result showing changes in the mRNA expression levels of FNDC5, LIF, and Metrnl due to administration of indigestible maltodextrin according to an example of the present invention.
  • mice were divided into five groups for each experimental group and were allowed to adapt to the experimental environment for one week. Afterwards, the experiment was conducted for 12 weeks to induce sarcopenia due to aging, and additional aging was induced and used as an experimental animal model in the following example. At the end of the experiment, muscle tissue was obtained through dissection and used for muscle-related biomarker analysis.
  • Example 1 Regular diet intake and administration of resistant maltodextrin (SCD + NMD)
  • the test animals of Preparation Example 1 were fed a standard chow diet for 12 weeks, and indigestible maltodextrin (5.83 mg/35 g of body weight) dissolved in distilled water was orally administered daily. Water was freely available during the experimental period. The effect of indigestible maltodextrin on sarcopenia worsening due to aging was confirmed through this example.
  • the indigestible maltodextrin (Samyang Corporation product) used was a product having a dietary fiber content of 85 wt% or more, 43% of ⁇ -1,4 linkages, 25% of ⁇ -1,6 linkages, 16% of ⁇ -1,3 linkages, and 16% of ⁇ -1,2 linkages.
  • Example 2 High-fat diet and administration of resistant maltodextrin (HFD + NMD)
  • the test animals of Preparation Example 1 were fed a high-fat diet (60% high-fat diet) in which 60% of the total energy source was fat for 12 weeks, and indigestible maltodextrin (5.83 mg/35 g of body weight) dissolved in distilled water was orally administered daily.
  • high-fat diet 60% high-fat diet
  • indigestible maltodextrin 5.83 mg/35 g of body weight
  • the animal model of Preparation Example 1 was fed the standard chow diet of Example 1 for 12 weeks, and the same amount of distilled water as in Experimental Example 1 was orally administered every day.
  • the animal model of Preparation Example 1 was fed the high-fat diet (60% high-fat diet) of Example 2 for 12 weeks, and the same amount of distilled water as in Experimental Example 2 was orally administered every day.
  • the mouse was placed on a 30 x 30 cm wire mesh plate (diameter ⁇ 0.5 cm) and turned over, and the time that the mouse hung upside down using its limbs was measured. A rest period of 30 minutes or more was given between measurements, and a total of three measurements were taken. The experiment was conducted in weeks 1, 2, 4, 6, 8, 10, 11, and 12 of a total 12-week test period. Using the limb hanging test method, the results of the limb muscle strength test of mice administered with indigestible maltodextrin were obtained as the average values of the experimental animals included in each group, and are shown in Figs. 2 and 3, and Table 1 below.
  • the total distance (m) run by the experimental animals until exhaustion was measured and compared on a 6-lane treadmill.
  • a weak current was applied to the grid to account for rail deviation, and the mice were trained to run under conditions of a 0-degree slope and a speed of 10 m/min.
  • running was started under conditions of a 0-degree slope and a speed of 8 m/min, and the slope was increased by 2 degrees and the speed by 2 m/min every 5 minutes.
  • the muscular endurance results were derived by converting the running distance until the mice stopped running and stayed on the grid with the current flowing for 15 seconds.
  • the experiments were conducted in weeks 1, 2, 4, 6, 8, 10, 11, and 12 of a total 12-week test period.
  • the changes in muscle endurance of mice administered indigestible maltodextrin through the treadmill test are shown in Figures 4 and 5 and Table 2.
  • the muscle mass of the hind-limb muscles was analyzed.
  • the test animals were sacrificed, dissected, and hind-limb muscle tissue was obtained, and the weight of the muscle tissue was measured.
  • the types of hind-limb muscles measured in the relevant test examples are the gastrocnemius (GAS), a type of white muscle that affects maximum muscle force generation, and the soleus (SOL), a type of red muscle that affects muscle endurance.
  • GAS gastrocnemius
  • SOL soleus
  • Table 4 shows the average value of the weight % of the hind limb muscles of experimental animals in each group compared to their body weight.
  • GAS gastrocnemius
  • Fig. 10 and Table 6 it was confirmed that the mRNA expression level of PI3K/Akt/mTOR signaling factors in the mice of Example 1 or 2, which were orally administered resistant maltodextrin together with a normal diet or a high-fat diet, significantly increased compared to the mRNA expression level in the mice of Comparative Example 1 or 2, which were not administered resistant maltodextrin. This shows that oral administration of resistant maltodextrin increases the expression of signaling factors that affect the induction of muscle cell growth and differentiation.
  • Muscle production is affected by myogenic regulatory factors such as Myf5, MyoD, MEF2, and Myogenin during the process in which muscle cells differentiate into muscle fibers.
  • myogenic regulatory factors such as Myf5, MyoD, MEF2, and Myogenin
  • the changes in the mRNA expression levels of Myf5, MyoD, MEF2, and Myogenin due to the administration of the indigestible maltodextrin are shown in Table 6 and Fig. 11.
  • myokine factors were confirmed for the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2.
  • Myokines are hormones that are released from skeletal muscle cells and act not only on muscle tissue but also on other organs.
  • FNDC5 is a precursor of Irisin, and its expression level increases during exercise, causing muscle hypertrophy.
  • LIF increases the size of gastrocnemius (GAS) and promotes muscle regeneration.
  • Metrnl also promotes muscle regeneration and plays a role in transferring the results obtained through mitochondrial biogenesis to other tissues.
  • the changes in the mRNA expression levels of FNDC5, LIF, and Metrnl due to the administration of the indigestible maltodextrin are shown in Table 6 and Fig. 12.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Nutrition Science (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 난소화성 말토덱스트린을 포함하는 근육 감소 관련 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.

Description

난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도
본 발명은 난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.
골격근(skeletal muscle)은 인체를 구성하는 가장 큰 기관으로서 인체의 40-50%을 차지한다. 골격근은 30세 이후가 되면 우리 몸에서 매년 약 1%씩 감소하는 경향을 보이다가 65세 이후부터는 급격하게 감소한다. 노화가 진행됨에 따라 근육의 기능적 능력(근력, 파워)도 점진적으로 감소하는데, 이처럼 노화에 따른 근육량의 감소뿐만 아니라 근력 또는 수행력의 감소를 근감소증(sarcopenia)이라고 한다.
근감소증은 다양한 요인에 의해 유발되나, 각각의 요인들에 대한 연구는 아직 미진하다. 성장 호르몬의 감소 또는 신경학적 변화 (neurological change), 생리활성(physical activity)의 변화, 대사의 변화, 성호르몬의 양 또는 지방이나 카타볼릭 싸이토카인(catabolic cytokines)의 증가와 단백질의 합성과 분화의 균형 변화에 의해 유도된다.
현재 근감소증에는 운동, 단백질 및 칼로리보충이 도움이 된다고 알려져 있으나, 근감소증 환자의 대부분을 차지하는 노인들에서는 크게 도움이 되지 않아 근감소증 치료제가 절실히 필요하다. 그러나, 현재 근감소증에 사용되는 치료제들은 근육감소 개선 및 근육량 증진에 직접적인 효과를 나타내는 약물은 아직까지 임상실험 수준의 단계이며, 현재 최종적으로 FDA 승인을 받은 약제는 없는 상황이다.
따라서 근감소증 환자 또는 노인에게 섭취하기에 안전하고 장기 복용할 수 있는 천연물질을 이용한 운동능력 증가, 근력 증가 또는 근육량 증가와 같은 근기능 개선용 식품 조성물, 근감소증의 개선 또는 예방용 식품 조성물 또는 근감소증의 치료 또는 예방용 약학 조성물이 요구되고 있다.
본 발명의 일 예는, 난소화성 말토덱스트린을 포함하는 근력 개선용 조성물에 관한 것이다.
본 발명의 추가 일 예는, 난소화성 말토덱스트린을 포함하는 근감소증의 예방, 개선 또는 치료용 조성물에 관한 것으로서, 상기 조성물은 식품 조성물 또는 약제학적 조성물일 수 있다.
본 발명의 일 예는, 난소화성 말토덱스트린 또는 이를 포함하는 전분 분해물을 이를 필요로 하는 대상에 투여하는 단계를 포함하는 근력의 개선 방법, 또는 근감소증의 예방, 개선 또는 치료 방법에 관한 것이다.
본 발명의 일 예는, 난소화성 말토덱스트린 또는 이를 포함하는 전분 분해물의 근력 개선 또는 근감소증의 예방, 개선 또는 치료용도에 관한 것이다.
본 발명의 일 예는, 난소화성 말토덱스트린을 포함하는 근력 개선용 조성물 및/또는 근육 감소 관련 질환의 예방, 개선 또는 치료용 조성물에 관한 것으로서, 본 발명에 따른 조성물은 부작용 없이 근육량 증가, 근육 단백질 증가 및 근생성 효과를 나타내므로, 근감소증 등의 근육 감소 관련 질환의 예방, 개선 또는 치료제로 매우 유용하다.
본 명세서에서 근력 개선은, 근육 양(muscle mass)의 감소, 근질의 저하 등에 의한 근력 저하 현상을 개선하는 것, 또는 근력의 증강, 근육 회복 촉진, 근육 손실 방지, 근육 퇴화 방지, 근육 보존 등을 포함하는 것일 수 있다. 구체적인 일예는, 본 발명에서는 난소화성 말토덱스트린 섭취 동물에서 사지 매달리기 시험법을 이용하여 난소화 마우스의 사지 근력 증가를 보여주는 결과 (도 2 및 도 3 참조), 및 운동부하검사(Treadmill test)를 통한 난소화성 말토덱스트린 투여에 의한 마우스의 근지구력 변화를 확인할 수 있다(도 4 및 도 5 참조).
본 발명에 따른 조성물은 근육 분화, 근육 재생, 근육량 증가를 통해 근력 강화 효과를 나타낼 수 있는 바 근육 생성 촉진 또는 근 기능 개선에 이용될 수 있다.　또한 난소화성 말토덱스트린은 근육량의 증가, 또는 근육손실의 방지하는 것일 수 있다. 상기 조성물은 하기 (1) 내지 (3)의 특성으로 이루어지는 군에서 선택된 1종 이상의 특성을 갖는 것일 수 있다:
(1) 근육 세포의 성장 및 분화의 유도,
(2) 근원성 조절 인자의 발현 증가, 및
(3) Myokine 인자의 발현 증가.
더욱 자세하게는, 상기 근육 세포의 성장 및 분화의 유도와 관련된 인자는, PI3K, Akt, mTOR 및 S6K1으로 이루어지는 군에서 선택된 1종 이상, 상기 근원성 조절 인자는 Myf5, MyoD, MEF2 및 Myogenin으로 이루어지는 군에서 선택된 1종 이상, 또는 상기 Myokine 인자는 FNDC5, LIF, 및 Metrn1으로 이루어지는 군에서 선택된 1종 이상일 수 있다.
본 명세서에서, 용어 “근감소증”은 근육의 부피 및 근력이 점진적으로 쇠퇴하는 질환을 의미한다. 상기 근감소증은 근위축증, 근무력증, 근이영양증, 근경직증, 근긴장저하, 근력약화, 근육퇴행위축, 근위축성 측삭경화증 또는 중증 근무력증이다.
근감소 증후군은 연령증가와 관련된 진행성, 전신적 광범위 골격 근섬유의 부피, 양 및 질이 감소하고 근력 및/또는 근기능이 저하되는 증후군이다; 결합 조직과 지방 조직의 증가를 동반하는 경우가 많으며, 환자의 주요 임상 증상은 근력 저하, 근육 이완, 활력 저하, 피부 주름 증가, 체질량 감소, 악력의 감소 등을 포함한다.
본 발명에서 근력 감소 또는 근감소증은 다양한 원인에 의해 초래될 수 있으며, 예를 들면 노화 또는 비만에 의한 것일 수 있으며, 노화 및 비만 모두에 의한 것일 수도 있다.
비만과 근감소증(sarcopenia)이 같이 나타나는 근감소성 비만 (sarcopenic obesity)은 근육에서의 단백질 대사를 저해하여 근육량이 감소하고, 이로 인해 신체 활동 및 기초대사량의 감소로 이어지게 되어 체지방량이 증가하는 악순환이 발생한다. 근감소성 비만은 근육량의 감소 및 근기능 장애로 인해 골관절염, 낙상, 운동능력감소, 삶의질 저하, 사망률의 증가와 같은 문제를 유발할 뿐 아니라, 비만으로 인한 대사증후군, 당뇨병, 이상지질혈증, 심혈관질환 등의 위험을 증가시킨다.
본 발명의 용어 "노화에 의한 근감소"는 노화에 따른 골격 근육량, 근력, 근기능, 근육의 밀도가 감소하는 것을 의미하는 것으로서, 이 중 골격근량은 30세 이후가 되면 매년 약 1%씩 감소하며, 65세 이후부터는 급격하게 감소하게 된다. 즉, 노화가 진행됨에 따라 직접적으로 골격근량의 감소 및 근력의 저하를 유발하며 그 결과 각종 신체기능의 감소 및 장애를 일으킬 수 있는 상태를 의미한다. 상기 노화로 인한 근육 관련 질환은, 노화성 근감소증(age related sarcopenia), 동작 뉴런 질병, 대사성 근육 질병, 염증성 근병증, 신경근 접합부 질병, 내분비성 근병증일 수 있으나, 이에 제한되지 않는다.
상기 근력 감소 또는 근감소증 또는 이와 관련된 질환은 근기능 저하, 근육 퇴화, 근육 손실에 의해 발생하는 근육 질환을 포함하며, 예를 들면 근위축증 (muscular atrophy), 무용성 근위축(disuse atrophy), 척수성 근위축(spinal muscular amyotrophy), 근이영양증, 근육퇴행위축 (dystrophy), 근육긴장증 (myotonia), 근긴장저하 (muscular hypotonia), 근육 위약 (muscular weakness), 근위축성 축삭 경화증(amyotrophic lateral sclerosis), 척수구근 근위축(sphinobulbar muscular atrophy), 근무력증 (myasthenia) 및 중증근무력증 (myasthenia gravis)으로 구성된 군에서 선택되는 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명의 용어 "개체" 또는 “대상”이란 근력 감소 및/또는 근감소증이 이미 발병하였거나 발병할 가능성이 있는 인간을 포함한 모든 동물을 의미하고, 본 발명의 조성물을 개체에게 투여함으로써, 상기 증상 및/또는 질환을 효과적으로 예방, 개선 또는 치료할 수 있다.
본 발명의 일 예는, 난소화성 말토덱스트린을 유효성분으로 함유하는 근감소증의 예방 또는 개선용 식품에 관한 것이다. 본 발명의 용어 “개선”이란 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 것을 의미한다. 본 발명에 있어서, 상기 식품은 근육량을 증가시키거나, 근육손실을 방지하는 것일 수 있으며, 바람직하게는 근육량 증가일 수 있다.
본 발명의 건강기능식품은 통상적인 의미의 식품을 모두 포함할 수 있으며, 기능성 식품 등 당업계에 알려진 용어와 혼용 가능하다. 본 발명의 용어, "기능성 식품"은 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, "기능성"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다. 본 발명의 용어, "건강기능식품"은 건강보조의 목적으로 특정성분을 원료로 하거나 식품 원료에 들어있는 특정성분을 추출, 농축, 정제, 혼합 등의 방법으로 제조, 가공한 식품을 말하며, 상기 성분에 의해 생체방어, 생체리듬의 조절, 질병의 방지와 회복 등 생체조절기능을 생체에 대하여 충분히 발휘할 수 있도록 설계되고 가공된 식품을 말하는 것으로서, 상기 건강식품용 조성물은 질병의 예방 및 질병의 회복 등과 관련된 기능을 수행할 수 있다.
본 발명의 식품 조성물을 식품 첨가물로 사용할 경우, 상기 조성물을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다.
본 발명의 식품은, 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives) 등의 모든 형태로 제조할 수 있다.
본 발명의 조성물이 사용될 수 있는 식품의 종류에는 제한이 없다. 아울러, 본 발명의 조성물은 당업자의 선택에 따라 식품에 포함될 수 있는 적절한 기타 보조 성분과 공지의 첨가제를 혼합하여 제조할 수 있다.
난소화성 말토덱스트린은 indigestible maltodextrin, digestion-resistant maltodextrin, resistant maltodextrin, NMD)은 전분을 가수분해하여 얻은 수용성 식이섬유로 식후 혈당상승 억제, 혈중 중성지질 개선, 포만감 증가, 공복감 증가, 체중 감소, 혈당 상승 감소, 인슐린 저항성 감소 등의 효과가 있다고 보고되고 있는 바, 당뇨병 예방 및 식이 요법에 대응하는 기대되는 기능성 식품 소재이다.
본 발명의 일 예에서, 상기 난소화성 말토덱스트린은, 난소화성 말토덱스트린을 함유하는 전분의 가수분해물 또는 배소 덱스트린의 효소 분해물일 수 있다.
본 발명에 따른 용어 “난소화성 말토덱스트린”은 인간 소화효소에 의해 분해가 되지 않거나 분해가 매우 느린 말토덱스트린을 의미하며, 상기 난소화성 말토덱스트린을 포함하는 배소 덱스트린의 효소 분해물 또는 전분의 가수분해물을 의미할 수도 있다. 본 발명에서, 난소화성 말토덱스트린은 상업적으로 판매되는 것을 구입하여 사용하거나 직접 제조하여 사용할 수 있다.
본 발명에서 난소화성 말토덱스트린 또는 이를 포함하는 배소 덱스트린의 효소 분해물 또는 전분의 분해물의 일 예는, 인간 체내의 소화 효소로 소화되지는 않는 알파-1,6 글리코시드 결합, 알파-1,2 글리코시드 결합 및/또는 알파-1,3 글리코시드 결합을 포함하고 있으며, 또한 알파-1,4 글리코시드 결합에 비해 소화가 어려운 알파-1,6 글리코시드 결합을 포함하는 것이 바람직하다.
구체적으로, 본 발명에서 난소화성 말토덱스트린은, 전체 글리코시드 결합 (glycosidic bond)중에서 α-1,6 글리코시드 결합 비율이 20 내지 40%, 또는 20 내지 35%일 수 있다. 자세하게는 상기 난소화성 말토덱스트린은 α-1,6 글리코시드 결합 비율이 20 내지 40% 또는 20% 내지 35%일 수 있으며, α-1,2 결합 및/또는 α-1,3 결합을 추가로 포함할 수 있으며, 예를 들면 α-1,6 글리코시드 결합 비율이 20 내지 40% 또는 20% 내지 35%일 수 있으며, α-1,2 글리코시드 결합 비율이 5 내지 25%, 5% 내지 20%, 또는 10 내지 25%일 수 있으며, α-1,3 글리코시드 결합 비율이 10% 내지 30% 또는 10 내지 25%일 수 있다. 상기 난소화성 말토덱스트린은 α-1,6 글리코시드 결합, α-1,2 결합 및/또는 α-1,3 결합을 포함할 수 있으며, 또한 α-1,4 글리코시드 결합을 더 포함할 수 있으며, α-1,4 글리코시드 결합은 30 내지 50%, 또는 35 내지 47%일 수 있다.
더욱 자세하게는, 본 발명에서 난소화성 말토덱스트린은, 전체 글리코시드 결합 (glycosidic bond)중에서 α-1,2 글리코시드 결합 비율이 5% 내지 25%, 5 내지 23%, 5 내지 20%, 또는 5 내지 18%일 수 있다. 본 발명에서 난소화성 말토덱스트린은, 전체 글리코시드 결합 (glycosidic bond)중에서 α-1,3 글리코시드 결합 비율이 10% 내지 30%, 10 내지 25%, 10 내지 20%, 또는 10 내지 18%, 12% 내지 30%, 12 내지 25%, 12 내지 20%, 또는 12 내지 18%일 수 있다.
또한 난소화성 말토덱스트린 또는 이를 포함하는 배소 덱스트린의 효소 분해물 또는 전분의 분해물의 일 예는, DE 값이 1 내지 20, 자세하게는 8 내지 20 또는 8 내지 18이며, 평균 분자량이 2,000 내지 3,000일 수 있으며, 또는 DP1 당류 및 DP2 당류를 포함하는 합계 함량이, 조성물의 전체 당류 고형분 함량 100 중량%를 기준으로 10 중량% 미만, 9 중량% 미만, 8 중량% 미만, 7 중량% 미만, 6 중량% 미만 또는 5 중량% 미만일 수 있다. 본 발명에서 난소화성 말토덱스트린 또는 이를 포함하는 배소 덱스트린의 효소 분해물 또는 전분의 분해물의 일 예는 식이섬유 함량이 50 중량% 이상, 60 중량% 이상, 70 중량% 이상, 80 중량% 이상, 85 중량% 이상 또는 90 중량% 이상일 수 있다.
난소화성 말토덱스트린을 제조하는 방법은 다양한 알려진 방법이 있으며, 예를 들면 전분에 미량의 염산을 첨가하여 가열함으로써 조제되는 배소 덱스트린에, 가수분해 효소인 α－아밀라제 및 글루코아밀라제를 작용시킨 후, 정제 공정을 거쳐 제조하거나, 전분에 산을 처리하여 얻어진 배소 덱스트린에 효소반응을 수행한 후에 난소화성 성분을 분획하여 제조하는 방법일 수 있으나, 이에 한정되지 않는다. 상기 효소반응은 알파 아밀레이즈(α-amylase), 베타 아밀레이즈(β-amylase) 및 말토제닉 아밀레이즈(maltogenic amylase)로 이루어지는 군에서 선택된 1종 이상의 효소를 사용하여 수행될 수 있다.
난소화성 말토덱스트린은 덱스트린과는 전혀 상이한 물성을 갖는 것이다. 덱스트린은 녹말보다 분자량이 작은 다당류를 총칭하며, 점성이 높고, 이미 및 이취가 심해서 식품에 다량 사용하기 어렵다. 따라서, 본 발명의 조성물은 덱스트린을 포함하지 않아 덱스트린에 의한 이취 문제가 발생되지 않는다. 난소화성 말토덱스트린은 사이클로덱스트린과는 전혀 상이한 물성을 갖는 것이다. 사이클로덱스트린은 효소 처리로 생성된, 6 내지 12개 포도당이 각각 α-1,4 글리코시드결합을 한 고리모양의 올리고당이다. 이러한 사이클로덱스트린은 액체 용해 시 낮은 온도에서 결정이 잘 석출되며 뿌옇게 흐려지는 문제점이 있어 식품에 다량 사용하기 어렵다. 또한, 난소화성 말토덱스트린은 통상 DE가 1 내지 20 정도를 가지는 것으로서, 전분을 말토스 단위로 분해후 말토스에 포도당을 알파-1,6 결합으로 전이시킨 이소말토올리고당과는 상이하다. 이소말토올리고당은 DE 값이 20 초과 내지 55 정도를 가지며, 평균 분자량이 약 1,000 이하 값을 가지며, DP1 당류 (단당류) 및 DP2 당류(이당류)의 합계 함량이 전체 당류 고형분 함량 100 중량%를 기준으로 10%를 초과하여 60 중량%을 가지는 올리고당으로서, 점도가 낮고, 식이섬유 함량이 낮아 (대략 5 중량% 미만 정도), 건강기능식품과 기능성 표시식품의 기능성 원료로 사용할 수 없다.
한국 건강기능식품의 기준 및 규격에 기재된 난소화성 말토덱스트린 제조기준에 따르면, 난소화성 말토덱스트린은 옥수수전분을 가열하여 얻은 배소덱스트린을 α-아밀라아제(α-amylase, Bacillus subtilis 또는 Bacillus licheniformis 유래) 및 아밀로글루코시다아제(amyloglucosidase, Aspergillus niger 유래)로 효소분해하고 정제한 것 중 난소화성 성분을 분획하여 식용에 적합하도록 한 것을 말한다. 또한, 난소화성 말토덱스트린의 경우 건강기능식품 기능성 원료로서 액상이 아닌 경우에는 식이섬유를 85% 이상 함유하고 있어야 하며, 액상인 경우에는 58% 이상 함유하고 있어야 한다.
본 명세서에서, 난소화성 말토덱스트린은 식이섬유 함량이 일정수준 이상이면 제한 없이 사용될 수 있으며, 예를 들면 난소화성 덱스트린은, 배소 덱스트린을 효소 분해하고 정제한 것 중 난소화성 성분을 분획한 것으로, 식이섬유를 55 %(w/w) 내지 99 %(w/w)로 함유하는 덱스트린을 의미한다. 바람직하게는 분말의 경우 식이섬유 함량이 850 mg/g 이상, 액상인 경우는 580 mg/g 이상인 것일 수 있다. 상기 식이섬유 함량은, 식품공전 상 식이섬유 분석법 중 액체크로마토그래프(HPLC)를 이용한 수용성 식이섬유 정량법으로 분석할 수 있다.
본 발명에 따른 조성물은 일일 섭취량이 난소화성 말토덱스트린 식이섬유로서 2g 내지 50g 또는 4 내지 30g 일 수 있다.
근력 개선, 또는 근감소증의 예방, 개선 또는 치료용 조성물은 건강기능식품 조성물로 제조될 수 있다. 본 발명의 조성물이 건강기능식품 조성물로 제조되는 경우, 식품 제조 시 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함한다.
본 발명에 따른 난소화성 말토덱스트린을 포함하는 근력 개선, 또는 근감소증의 예방, 개선 또는 치료용 조성물은, 난 근감소증 환자 또는 노인에게 섭취하기에 안전하고 장기 복용할 수 있는 천연물질을 이용한 운동능력 증가, 근력 증가 또는 근육량 증가와 같은 근기능 개선용 식품 조성물, 근감소증의 개선 또는 예방용 식품 조성물 또는 근감소증의 치료 또는 예방용 약학 조성물을 제공한다.
도 1은 본 발명의 일 예에 따라 동물모델 구축 및 식이 투여 실험의 전반적인 실험계획이다.
도 2 및 도 3는 본 발명의 일 예에 따라 사지 매달리기 시험법을 이용하여 난소화성 말토덱스트린 투여에 의한 마우스의 사지 근력 증가를 보여주는 결과이다.
도 4 및 도 5는 본 발명의 일 예에 따라 운동부하검사(Treadmill test)를 통한 난소화성 말토덱스트린 투여에 의한 마우스의 근지구력 변화를 보여주는 결과이다.
도 6 및 도 7는 본 발명의 일 예에 따라 난소화성 말토덱스트린 투여에 의한 실험동물의 골격근량 변화를 보여주는 결과이다.
도 8 및 9는 본 발명의 일 예에 따라 난소화성 말토덱스트린 투여에 의한 실험동물의 뒷다리 근육량의 변화를 보여주는 결과이다.
도 10은 본 발명의 일 예에 따라 난소화성 말토덱스트린 투여에 의한 PI3K/Akt/mTOR 경로의 mRNA 발현량의 변화를 보여주는 결과이다.
도 11은 본 발명의 일 예에 따라 난소화성 말토덱스트린 투여에 의한 Myf5, MyoD, MEF2, Myogenin의 mRNA 발현량 변화를 보여주는 결과이다.
도 12는 본 발명의 일 예에 따라 난소화성 말토덱스트린 투여에 의한 FNDC5, LIF 및 Metrnl의 mRNA 발현량 변화를 보여주는 결과이다.
본 발명을 하기 실시예를 들어 더욱 자세히 설명할 것이나, 본 발명의 범위가 하기 실시예로 한정되는 의도는 아니다.
준비예 1: 노화마우스 활용한 근감소증 동물 모델 구축
본 실험에서 동물모델 구축 및 식이 투여 실험의 전반적인 스케줄을 도 1에 표시하였다.
구체적으로, 노화된 18개월령 수컷 C57BL/6 마우스를 각 실험 그룹별로 5마리씩 분류하여, 1주일간 실험 환경에 적응시켰다. 이후 노화로 인한 근감소증(Sarcopenia)을 유발하기 위해, 12주간 실험을 진행하며, 하기 실시예에서 추가적인 노화를 유도하여 실험군 동물모델로 사용하였다. 실험 종료 시 해부를 통해 근육조직을 획득하여 근육 관련 바이오마커 분석에 이용하였다.
실시예 1: 일반식이 섭취 및 난소화성 말토덱스트린의 투여 (SCD + NMD)
준비예 1의 시험 동물에게 12주간 일반식이 (standard chow diet) 사료를 섭취하게 하였으며, 난소화성 말토덱스트린 (5.83mg/35g of body weight)을 증류수에 녹여 매일 경구투여 하였다. 실험 기간 동안 물을 자유롭게 섭취할 수 있도록 하였다. 해당 실시예를 통해 노화로 인해 악화되는 근감소증에 대한 난소화성 말토덱스트린의 효과를 확인하였다. 난소화성말토덱스트린 (삼양사 제품)은 식이섬유 함량이 85중량% 이상이며, α-1,4 결합이 43%, α-1,6 결합이 25%, α-1,3 결합이 16%, 및 α-1,2 결합이 16%인 제품을 사용하였다.
실시예 2: 고지방식이 섭취 및 난소화성 말토덱스트린의 투여 (HFD + NMD)
준비예 1의 시험 동물에게 12주간, 전체 에너지원의 60%이 지방으로 이루어진 고지방식이 (60% high-fat diet) 사료를 섭취하게 하였으며, 난소화성 말토덱스트린 (5.83mg/35g of body weight)을 증류수에 녹여 매일 경구투여 하였다. 해당 실시예를 통해 고지방식이로 인한 비만에 의해 가속화된 근감소증에 대한 난소화성 말토덱스트린의 효과를 확인하였다.
비교예 1: 일반식이 (SCD) 섭취
준비예 1의 동물모델에게 상기 실시예 1의 일반식이 (standard chow diet) 사료를 12주간 섭취하게 하였으며, 실험예 1과 동량의 증류수를 매일 경구투여 하였다.
비교예 2: 고지방식이(HFD) 섭취
준비예 1의 동물모델에게 상기 실시예 2의 고지방식이 (60% high-fat diet) 사료를 12주간 섭취하게 하였으며, 실험예 2와 동량의 증류수를 매일 경구투여 하였다.
시험예 1: 운동수행능력 평가
(1) 매달리기를 통한 사지근력 분석 (four-limb hanging test)
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 사지근력의 변화를 측정하기 위하여 four-limb hanging test를 실시하였다.
자세하게는, 30 x 30 cm 크기의 철망 (지름 < 0.5 cm)으로 된 판 위에 마우스를 올려놓고 뒤집은 뒤 마우스가 사지를 이용하여 거꾸로 매달려 있는 시간을 측정하였다. 측정 사이에 30분 이상의 휴식시간을 주어 총 3회를 측정하였다. 총 12주의 시험기간 중 1주차, 2주차, 4주차, 6주차, 8주차, 10주차, 11주차, 12주차에 실험을 실시하였다. 상기 사지 매달리기 시험법을 이용하여 난소화성 말토덱스트린 투여에 의한 마우스의 사지 근력 시험결과를 각 그룹에 포함된 실험동물의 평균값으로 얻었으며, 이를 도 2 및 도 3, 및 하기 표 1에 나타냈다.
실험주차 비교예 1
(SCD)		 실시예 1
(SCD + NMD)		 비교예 2
(HFD)		 실시예 2
(HFD + NMD)
1 20.8 26.5 20.9 29.4
2 57.2 45.8 26.3 39.7
4 78.7 83.2 39.6 46.9
6 98.9 121.1 43.1 67.7
8 102.3 158.6 45.0 71.4
10 114.6 194.7 25.6 81.0
11 104.2 209.4 25.3 62.8
12 93.7 207.8 11.8 60.9
도 2 및 도 3에서 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2와 비교하여, 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구투여한 실시예 1 또는 2의 마우스의 매달리는 시간이 유의적으로 증가하였다. 따라서 이는 난소화성 말토덱스트린의 경구투여로 인한 마우스의 사지근력의 증가를 보여주는 결과이다.
(2)오래달리기를 통한 근지구력 분석 (treadmill test)
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 근지구력의 변화를 측정하기 위하여 운동부하검사(treadmill test)를 실시하였다.
자세하게는, 6-lane treadmill에 실험동물을 올린 뒤 마우스가 탈진할 때까지의 달린 총 거리 (m)로 측정하여 비교하였다. 초기 적응기간동안 레일 이탈을 고려하여 그리드(grid)에 전류가 미약하게 흐르도록 하고, 0도 경사, 10 m/min 속도 조건에서 달릴 수 있도록 훈련하였다. 측정 시에는 0도 경사, 8 m/min 속도 조건으로 달리기 시작하여 5분마다 경사 2도 및 속도 2 m/min씩 증가시켰다. 근지구력 결과는 달리기를 멈추고 전류가 흐르는 그리드(grid)에서 15초간 머무를 때까지의 달린 거리를 환산하여 도출하였다. 총 12주의 시험기간 중 1주차, 2주차, 4주차, 6주차, 8주차, 10주차, 11주차, 12주차에 실험을 실시하였다. 상기 운동부하검사(Treadmill test)를 통한 난소화성 말토덱스트린 투여에 의한 마우스의 근지구력 변화를 도 4 및 도 5, 표 2에 나타낸다.
실험주차 비교예 1
(SCD)		 실시예 1
(SCD + NMD)		 비교예 2
(HFD)		 실시예 2
(HFD + NMD)
1 327.7 321.9 329.4 343.8
2 279.4 291.0 235.8 248.5
4 232.8 227.9 188.0 191.7
6 199.6 264.8 161.0 148.4
8 153.8 390.0 133.6 150.2
10 156.3 387.1 75.5 174.0
11 125.7 348.4 48.4 183.2
12 86.1 313.8 20.7 128.0
도 4 및 도 5에서 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구투여한 실시예 1 또는 2의 마우스에서 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2와 비교하여 총 달린 거리가 유의적으로 증가하였다. 이는 난소화성 말토덱스트린의 경구투여로 인한 마우스의 근지구력의 증가를 보여주는 결과이다.
시험예 2: 골격근량 평가
(1)Dual Energy X-ray Absorptiometry 분석
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 골격근량의 변화를 측정하기 위해 마우스를 희생시키기 전 Inalyzer (Medikors, USA)를 이용하여 이중 에너지 X-선 흡수법 (Dual energy X-ray absorptiometry)분석을 실시하였다.
상기 난소화성 말토덱스트린 투여에 의한 실험동물의 골격근량 변화의 분석결과를 도 6 및 도 7, 표 3에 나타낸다. 하기 표 3에서 골격근량은 총질량 대비 골격근 질량의 비율로 계산하여 %로 표시한 것이다.
항목 비교예 1
(SCD)		 실시예 1
(SCD + NMD)		 비교예 2
(HFD)		 실시예 2
(HFD + NMD)
골격근량(%) 65.5 70.2 44.7 52.1
도 6 및 도 7에서 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2의 마우스에서의 골격근량 대비하여, 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구 투여한 실시예 1 또는 2의 마우스에서의 골격근량은 유의적으로 증가함을 확인하였다. 이는 난소화성 말토덱스트린의 경구투여가 골격근량을 증가시키는 결과를 보여주는 것이다.
(2) 뒷다리 근육 조직 무게 측정
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 뒷다리 근육 (hind-limb muscle)의 근육량을 분석하였다. 보다 상세한 실험 방법으로는, 12주간의 난소화성 말토덱스트린 섭취 실험 종료 후 희생시킨 시험동물의 해부를 통해 뒷다리 근육 조직을 획득하여 근육 조직의 무게를 측정하였다. 해당 시험예에서 측정한 뒷다리 근육의 종류로는 최대근력발생에 영향을 주는 백색근의 일종인 비복근 (속근, Gastrocnemius; GAS)과 근지구력에 영향을 주는 적색근의 일종인 비장근 (지근, Soleus; SOL)이다.
상기 난소화성 말토덱스트린 투여에 의한 실험동물의 뒷다리 근육의 분석 결과를 표 4, 도 8 및 도 9에 나타낸다. 하기 표 4에서 실험동물의 뒷다리 근육의 체중 대비 중량%를 각 그룹에서 평균한 값이다.
항목 비교예 1
(SCD)		 실시예 1
(SCD + NMD)		 비교예 2
(HFD)		 실시예 2
(HFD + NMD)
비복근 (Gastrocnemius; GAS) 중량% 0.455 0.535 0.358 0.434
비장근 (Soleus; SOL) 중량% 0.019 0.029 0.016 0.024
도 8 및 도 9에서 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구투여한 실시예 1 또는 2의 마우스에서의 뒷다리 근육의 체중 대비 무게는 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2의 마우스에서의 뒷다리 근육 무게와 비교하여 유의적으로 증가함을 확인하였다. 이는 난소화성 말토덱스트린의 경구투여가 뒷다리 근육량을 증가시킨다는 결과를 보여주는 것이다.
시험예 3: 근육과 관련된 인자의 발현량 확인
실시예 1 및 2와 비교예 1 및 2의 실험동물에서의 근육과 관련된 인자의 발현 정도를 비교측정하기 위해 비복근 조직에서의 mRNA의 발현량을 측정하였다. 이를 위해 근육조직으로부터 RNA를 분리해 낸 뒤, 역전사 효소를 이용해 cDNA를 합성하여 실시간 PCR 정량분석 (Real-Time Quantitative PCR)을 진행하였다.
자세하게는, 노화 마우스의 비복근 (속근·백색근, Gastrocnemius; GAS) 조직을 확보하여 RNeasy mini kit (Qiagen, Germany)의 사용자 프로토콜에 따라 조직 RNA를 추출하였으며, 추출된 RNA는 cDNA synthesis kit(Takara, Japan)를 사용해 cDNA로 합성하여 실시간 PCR 정량 분석 (Real-time PCR)을 실시하였다. 실시간 PCR 정량분석은 QuantStudioTM 3 Real-time PCR Instrument (Applied Biosystems, USA)로 수행하였다. 분석에서 활용한 유전인자의 primer sequence는 하기 표 5에 나타낸 것과 같다.
Target gene 설명 Nucleotide sequence SEQ ID NO
Pi3K Forward (5′-3′) CTGGGGGACATACTGACTGT 1
Pi3K Reverse (5′-3′) GTTCCTGGAAAGTCTCCCCTC 2
Akt Forward (5′-3′) ACTCATTCCAGACCCACGAC 3
Akt Reverse (5′-3′) CCGGTACACCACGTTCTTCT 4
mTOR Forward (5′-3′) ATTCAATCCATAGCCCCGTC 5
mTOR Reverse (5′-3′) TGCATCACTCGTTCATCCTG 6
S6K1 Forward (5′-3′) TGAGTCAAGCCTTGGTCGAG 7
S6K1 Reverse (5′-3′) AAGAGTCGAGAGAGACGCCC 8
Myf5 Forward (5′-3′) AACCAGAGACTCCCCAAGGT 9
Myf5 Reverse (5′-3′) AGCTGGACACGGAGCTTTTA 10
MyoD Forward (5′-3′) TGGGATATGGAGCTTCTATCGC 11
MyoD Reverse (5′-3′) GGTGAGTCGAAACACGGATCAT 12
MEF2 Forward (5′-3′) CAGGCGCTATGGGTCATCTG 13
MEF2 Reverse (5′-3′) GCTACTTGGATTGCTGAACTGC 14
Myogenin Forward (5′-3′) AGCATCACGGTGGAGGATATG 15
Myogenin Reverse (5′-3′) CAGTTGGGCATGGTTTCGT 16
FNDC5 Forward (5′-3′) GAGGTGCTGATCATCGTCGT 17
FNDC5 Reverse (5′-3′) GAGCAAGCACTGAAAGGGTTT 18
LIF Forward (5′-3′) CAAGAATCAACTGGCACAGC 19
LIF Reverse (5′-3′) AGTGGGGTTCAGGACCTTCT 20
Metrnl Forward (5′-3′) CTGGAGCAGGGAGGCTTATTT 21
Metrnl Reverse (5′-3′) GGACAACAAAGTCACTGGTACAG 22
(1) 근육세포의 성장 및 분화를 유도하는 인자 발현
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 근육세포의 성장 및 분화에 관여하는 신호전달경로 인자의 발현량을 확인하였다. PI3K/Akt/mTOR 경로는 근육세포의 성장과 분화를 유도하며, S6K1 인자는 이러한 경로에 의해 단백질 합성을 자극하는 인자로 알려져 있다. 상기 난소화성 말토덱스트린 투여에 의한 PI3K/Akt/mTOR 경로의 mRNA 발현량의 변화를 표 6 및 도 10에 나타낸다.
항목 비교예 1
(SCD)		 실시예 1
(SCD + NMD)		 비교예 2
(HFD)		 실시예 2
(HFD + NMD)
PI3K 1.00 4.49 0.84 3.63
Akt 1.00 2.55 0.33 1.31
mTOR 1.00 2.57 0.35 1.29
S6K1 1.00 2.07 0.75 1.56
Myf5 1.00 5.21 0.42 3.53
MyoD 1.00 2.09 0.64 1.89
MEF2 1.00 2.86 0.51 1.62
Myogenin 1.00 6.13 0.44 1.50
FNDC5 1.00 1.75 0.68 2.21
LIF 1.00 2.65 0.57 2.59
Metrnl 1.00 3.68 0.31 2.60
도 10 및 표 6에서 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2의 마우스에서의 mRNA 발현량 대비하여, 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구투여한 실시예 1 또는 2의 마우스에서의 PI3K/Akt/mTOR 신호전달인자의 mRNA 발현량은 유의적으로 증가함을 확인하였다. 이는 난소화성 말토덱스트린의 경구투여가 근육세포의 성장 및 분화를 유도하는데 영향을 주는 신호전달인자의 발현을 증가시키는 결과를 보여주는 것이다.
(2) 근육생성 인자의 발현
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 근육 생성에 영향을 미치는 인자의 발현량을 확인하였다. 근육의 생성은 근육모세포가 근섬유로 분화되는 과정에서 Myf5, MyoD, MEF2, Myogenin 등의 근원성 조절 인자 (Myogenic regulatory factor)가 영향을 미친다. 상기 난소화성 말토덱스트린 투여에 의한 Myf5, MyoD, MEF2, Myogenin의 mRNA 발현량 변화를 표 6 및 도 11에 나타낸다.
도 11에서 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구투여한 실시예 1 또는 2의 마우스에서의 Myf5, MyoD, MEF2, Myogenin의 mRNA 발현량은 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2의 마우스에서의 mRNA 발현량 대비하여 유의적으로 증가함을 확인하였다. 이는 난소화성 말토덱스트린의 경구투여가 근섬유의 생성에 영향을 주는 근원성 조절 인자의 발현을 증가시키는 결과를 보여주는 것이다.
(3) 마이오카인 (myokine) 인자의 발현
실시예 1 및 2와 비교예 1 및 2의 실험동물에 대해, 마이오카인 (myokine) 인자의 발현량을 확인하였다. 마이오카인은 골격근 세포에서 방출되어 근육 조직뿐만 아니라 다른 기관에도 작용하는 호르몬이다. 그 중 FNDC5는 Irisin의 전구체로서 운동시 발현량이 증가하여 근육 비대를 유발한다. 한편 LIF는 gastrocnemius(GAS)의 크기를 증가시키고, 근육 재생을 촉진한다. Metrnl 또한 근육 재생을 촉진하고, 미토콘드리아 생합성으로 얻어진 결과를 다른 조직으로 전달하는 역할을 한다. 상기 난소화성 말토덱스트린 투여에 의한 FNDC5, LIF, Metrnl의 mRNA 발현량 변화를 표 6 및 도 12에 나타낸다.
도 12에서 일반식이 또는 고지방식이 섭취와 함께 난소화성 말토덱스트린을 경구투여한 실시예 1 또는 2의 마우스에서의 FNDC5, LIF, Metrnl의 mRNA 발현량은 난소화성 말토덱스트린을 투여하지 않은 비교예 1 또는 2의 마우스에서의 mRNA 발현량 대비하여 유의적으로 증가함을 확인하였다. 이는 난소화성 말토덱스트린의 경구투여로 인해 마이오카인의 증가함을 보여주는 결과이다.

Claims (14)

  1. 난소화성 말토덱스트린을 포함하는, 근력 개선 또는 근감소증의 예방, 개선 또는 치료용 조성물.
  2. 제1항에 있어서, 상기 근감소증은 근위축증, 근무력증, 근이영양증, 근경직증, 근긴장저하, 근력약화, 근육퇴행위축, 근위축성 측삭경화증 및 중증 근무력증으로 이루어진 군에서 선택되는 1종 이상인 조성물.
  3. 제1항에 있어서, 상기 근감소증은 노화, 비만, 또는 노화 및 비만에 의한 근감소증인 조성물.
  4. 제1항에 있어서, 상기 조성물은 근육량의 증가, 또는 근육손실의 방지하는 것인 조성물.
  5. 제1항에 있어서, 상기 조성물은 하기 (1) 내지 (3)의 특성으로 이루어지는 군에서 선택된 1종 이상의 특성을 갖는 것인 조성물:
    (1) 근육 세포의 성장 및 분화의 유도,
    (2) 근원성 조절 인자의 발현 증가, 및
    (3) Myokine 인자의 발현 증가.
  6. 제5항에 있어서, 상기 근육 세포의 성장 및 분화의 유도와 관련된 인자는, PI3K, Akt, mTOR 및 S6K1으로 이루어지는 군에서 선택된 1종 이상,
    상기 근원성 조절 인자는 Myf5, MyoD, MEF2 및 Myogenin으로 이루어지는 군에서 선택된 1종 이상, 또는
    상기 Myokine 인자는 FNDC5, LIF, 및 Metrn1으로 이루어지는 군에서 선택된 1종 이상인, 조성물.
  7. 제1항에 있어서, 상기 조성물은 식품학적으로 허용 가능한 식품보조 첨가제를 추가로 포함하는 것을 특징으로 하는 조성물.
  8. 제1항에 있어서, 상기 조성물은 음료, 유제품, 식용 과립, 페이스트, 조미료, 레토르트식품, 발효식품, 보존식, 수산가공품, 식육가공품, 곡물가공품, 식품첨가물, 건강기능식품, 환자용 식품 등의 특수의료용도식품, 또는 동물사료의 식품인 조성물.
  9. 제1항에 있어서, 상기 조성물은, 일일 섭취량으로서 난소화성 말토덱스트린 식이섬유로서 2g 내지 50g를 포함하는 것인 조성물.
  10. 제1항에 있어서, 상기 난소화성 말토덱스트린은, 난소화성 말토덱스트린을 포함하는 전분 가수분해물로 제공되는 것인 조성물
  11. 제1항에 있어서, 상기 난소화성 말토덱스트린은, 하기 (a) 내지 (c)로 이루어지는 군에서 선택된 1종 이상의 특성을 가지는 것인, 조성물:
    (a) DE(dextrose equivalent)값이 1 내지 20,
    (b) 단당류 및 이당류의 함량이 10 중량% 미만, 및
    (c) 전체 글리코시드 결합(glycoside bond) 중에서 α-1,6 글리코시드 결합 비율이 20 내지 40%임.
  12. 제1항에 있어서, 상기 난소화성 말토덱스트린은, 전체 글리코시드 결합(glycosidic bond) 중에서 α-1,6 글리코시드 결합 비율이 20 내지 40%인, 조성물.
  13. 제1항에 있어서, 상기 난소화성 말토덱스트린은, 전체 글리코시드 결합(glycosidic bond) 중에서 α-1,2 글리코시드 결합 비율이 5 내지 25%이며, α-1,3 글리코시드 결합 비율이 10 내지 30%인, 조성물.
  14. 제1항에 있어서, 상기 난소화성 말토덱스트린은, 전체 글리코시드 결합(glycosidic bond) 중에서 α-1,6 글리코시드 결합 비율이 20 내지 40%, α-1,2 결합 비율이 5 내지 25%이고, α-1,3 결합 비율이 10 내지 30% 이며, α-1,4 글리코시드 결합 비율이 30 내지 50%인, 조성물.
PCT/KR2024/021029 2023-12-27 2024-12-24 난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도 Pending WO2025143751A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020230192874A KR20250102209A (ko) 2023-12-27 2023-12-27 난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도
KR10-2023-0192874 2023-12-27

Publications (1)

Publication Number Publication Date
WO2025143751A1 true WO2025143751A1 (ko) 2025-07-03

Family

ID=96219478

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/021029 Pending WO2025143751A1 (ko) 2023-12-27 2024-12-24 난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도

Country Status (3)

Country Link
KR (1) KR20250102209A (ko)
TW (1) TW202535434A (ko)
WO (1) WO2025143751A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140130370A (ko) * 2013-04-30 2014-11-10 씨제이제일제당 (주) 난소화성 말토덱스트린 함유 혈당상승 억제용 즉석밥의 제조 방법
WO2016044167A1 (en) * 2014-09-15 2016-03-24 Abbott Laboratories Methods for increasing muscle strength and mobility in subjects experiencing significant physical inactivity using gamma linolenic acid
KR20230080919A (ko) * 2021-11-30 2023-06-07 주식회사 유티인프라 스파우트 파우치 타입의 영양보조식품

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140130370A (ko) * 2013-04-30 2014-11-10 씨제이제일제당 (주) 난소화성 말토덱스트린 함유 혈당상승 억제용 즉석밥의 제조 방법
WO2016044167A1 (en) * 2014-09-15 2016-03-24 Abbott Laboratories Methods for increasing muscle strength and mobility in subjects experiencing significant physical inactivity using gamma linolenic acid
KR20230080919A (ko) * 2021-11-30 2023-06-07 주식회사 유티인프라 스파우트 파우치 타입의 영양보조식품

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HASHIZUME CHIEKO, KISHIMOTO YUKA, KANAHORI SUMIKO, YAMAMOTO TAKUSHI, OKUMA KAZUHIRO, YAMAMOTO KUNIO: "Improvement Effect of Resistant Maltodextrin in Humans with Metabolic Syndrome by Continuous Administration", JOURNAL OF NUTRITIONAL SCIENCE AND VITAMINOLOGY, vol. 58, 1 January 2012 (2012-01-01), JP, pages 423 - 430, XP093329430, ISSN: 0301-4800, DOI: 10.3177/jnsv.58.423 *
MIYAZATO SHOKO, TSUDA MASATO, KISHIMOTO YUKA, HOSONO AKIRA: "Suppressive effect of dietary resistant maltodextrin on systemic immunity in a mouse model of food allergy", BIOSCIENCE OF MICROBIOTA, FOOD AND HEALTH, vol. 38, no. 3, 6 March 2019 (2019-03-06), pages 89 - 95, XP093329422, ISSN: 2186-3342, DOI: 10.12938/bmfh.18-025 *
MYEONG-OK NA: "Indigestible maltodextrin composition: "Effective in improving sarcopenia caused by aging and obesity."", HTTPS://WWW.FOODNEWS.CO.KR, FOOD JOURNAL FOODNEWS, KR, 10 July 2024 (2024-07-10), KR, pages 1 - 4, XP093329427, Retrieved from the Internet <URL:https://www.foodnews.co.kr/news/articleView.html?idxno=108893&utm_source=chatgpt.com> *

Also Published As

Publication number Publication date
KR20250102209A (ko) 2025-07-07
TW202535434A (zh) 2025-09-16

Similar Documents

Publication Publication Date Title
US11696921B2 (en) Synthetic composition for microbiota modulation
EP2323669B1 (en) Arabinoxylan for modulating the barrier function of the intestinal surface
Loh et al. Inulin alters the intestinal microbiota and short-chain fatty acid concentrations in growing pigs regardless of their basal diet
JP2013515051A (ja) 穀物ベースフラクション及びプロバイオティックを含む非発酵組成物、並びにそれらの使用
JP2004504332A (ja) 栄養組成物
CN101087621A (zh) 具有身体脂肪减少功能的组合物以及含该组合物的食物和饮料
EP2879713B1 (en) Compounds and their effects on appetite control and insulin sensitivity
Li et al. The role of probiotics and prebiotics in osteolastogenesis and immune relevance
WO2025143751A1 (ko) 난소화성 말토덱스트린을 포함하는 근력 개선 또는 근육 감소 관련 질환의 예방, 개선, 또는 치료 용도
JPWO2005056022A1 (ja) 腸疾患改善用組成物
CN100496536C (zh) α-葡萄糖苷酶活性抑制剂
EP4151222A1 (en) Composition for optimizing urolithin production in a human subject
WO2017191856A1 (ko) 지페노사이드 75의 항당뇨 효과
JP2004194635A (ja) ダイエット用の食品
KR100620477B1 (ko) 프리바이오틱 식품 성분으로서 ｄ-타가토스의 용도
JP3999894B2 (ja) 腸内酪酸菌生育促進剤
JP5394644B2 (ja) アスペルロシドまたはその類縁体を含む筋肉増強剤
JP2024088889A (ja) 腸内細菌叢におけるＲｏｍｂｏｕｔｓｉａ属菌低減用組成物
KR20030087383A (ko) 효모벽 추출물의 베타-글루칸을 이용한 건강증진 방법
US7202219B1 (en) Use of D-tagatose as a prebiotic food component
TW202535421A (zh) 用於提高生物能量代謝之含有蔗果三糖的組成物
WO2025068343A1 (en) Composition for use in increasing spermidine production by microbiota
WO2017222302A1 (ko) 비환원성 말단의 불포화형 만뉴론산 올리고당을 포함하는 운동 수행 능력 개선 및 골다공증 치료용 조성물
JP2024152695A (ja) ビフィズス菌の増殖用組成物および増殖方法ならびに乳酸および／またはピルビン酸の増加用組成物および増加方法
EP1520486A1 (en) Composition for suppressing ghrelin and method for same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24913542

Country of ref document: EP

Kind code of ref document: A1