WO2025005691A1 - 피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물 - Google Patents

피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2025005691A1
WO2025005691A1 PCT/KR2024/009001 KR2024009001W WO2025005691A1 WO 2025005691 A1 WO2025005691 A1 WO 2025005691A1 KR 2024009001 W KR2024009001 W KR 2024009001W WO 2025005691 A1 WO2025005691 A1 WO 2025005691A1
Authority
WO
WIPO (PCT)
Prior art keywords
macular degeneration
pyruvate dehydrogenase
inhibitor
dehydrogenase kinase
pdk4
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2024/009001
Other languages
English (en)
French (fr)
Inventor
박동호
이인규
안진희
시바지 파기레하우스하바우
하우스하바우 파기레수바나
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gwangju Institute of Science and Technology
Industry Academic Cooperation Foundation of KNU
Original Assignee
Gwangju Institute of Science and Technology
Industry Academic Cooperation Foundation of KNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gwangju Institute of Science and Technology, Industry Academic Cooperation Foundation of KNU filed Critical Gwangju Institute of Science and Technology
Publication of WO2025005691A1 publication Critical patent/WO2025005691A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/401Proline; Derivatives thereof, e.g. captopril
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00Food ingredients
    • A23V2250/30Other Organic compounds

Definitions

  • the present invention was made with the support of the Ministry of Science and ICT, under the research number RS-2024-00334982.
  • the research management organization of the said project is the National Research Foundation of Korea, the research project name is "Individual Basic Research", the research project name is "Study on a novel treatment mechanism of retinal degeneration through control of metabolic decoupling between retinal epithelial cells and photoreceptor cells", the main organization is Kyungpook National University Industry-Academic Cooperation Foundation, and the research period is 2024.05.01 ⁇ 2029.04.30.
  • the present invention was made with the support of the Ministry of Science and ICT by the research number 2019R1A2C1084371, the research management specialized institution of the said project is the National Research Foundation of Korea, the research project name is "Individual Basic Research", the research project name is "Study on Novel Treatment Mechanism of Neovascular Age-Related Macular Degeneration through Mitochondrial Energy Metabolism Reprogramming and Inflammatory Activation Control of Immune Cells", the main institution is Kyungpook National University, and the research period is 2019.09.01 ⁇ 2024.02.29.
  • the present invention was made with the support of the Ministry of Science and ICT under the project number 2020-0-01808-002, and the research management specialized institution of the project is the Information and Communications Technology Planning and Evaluation Institute, the research project name is "Training of Information and Communications Broadcasting Innovation Talents”, the research project name is "Research on Complex Information-based Predictive Intelligence Innovation Technology", the main institution is Kyungpook National University Industry-Academic Cooperation Foundation, and the research period is 2024.01.01 ⁇ 2024.12.31.
  • the present invention was made with the support of the Ministry of Science and ICT, the Ministry of Health and Welfare, and the Ministry of Trade, Industry and Energy, under the project number HN21C0923000021.
  • the research management specialized institution of the project is the National Drug Development Foundation, the research project name is "New Drug Base Expansion Research”, the research project name is "Discovery of Effective/Lead Substances for Oral Treatment of Age-Related Macular Degeneration", the main institution is Kyungpook National University, and the research period is 2021.11.01 ⁇ 2024.10.31.
  • the present invention was made under the support of the Ministry of Health and Welfare under the project number HR22C1832010023, the research management specialized institution of the project is the Korea Health Industry Development Institute, the research project name is "Research-oriented hospital promotion R&D”, the research project name is "Establishment of the world's first medical technology commercialization platform based on K-Leading Tech to secure global competitiveness", the main institution is Kyungpook National University Hospital, and the research period is 2024.01.01 ⁇ 2024.12.31.
  • the present invention relates to a composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase inhibitor, and more specifically, the present invention relates to a composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.
  • PDK pyruvate dehydrogenase kinase
  • Macular degeneration is an eye disease that causes vision impairment due to degeneration of the macula, and the causes are known to be related to aging, family history, race, and smoking. In the early stages of the disease, vision becomes blurred and near vision becomes distorted, and later leads to blindness.
  • Age-related macular degeneration causes severe, irreversible vision loss and is known as the leading cause of blindness in people over 50 years of age.
  • Epidemiological studies have reported that the prevalence is 1.2% of the population aged 52–64 in the United States, and the rate is even higher at 20–37% in people aged 75 years and older, so the prevalence is expected to increase as the average age increases.
  • AMD There are two types of AMD. The first is non-neovascular AMD, which is the most common and accounts for 85% of all AMD cases. This dry type is characterized by oily deposits and atrophic changes in the retinal pigment epithelium. The second is neovascular AMD, which is characterized by choroidal neovascularization. Choroidal neovascularization is a newly formed blood vessel that tends to leak blood and fluid. This leads to the formation of lesions in which fibrous tissue proliferates in the retinal tissue and photoreceptors are lost, and it progresses over time, causing severe and irreversible vision loss.
  • neovascular age-related macular degeneration treatments for neovascular age-related macular degeneration include photodynamic therapy and intraocular injection of drugs to block vascular endothelial growth factor.
  • vascular endothelial growth factor drugs to block vascular endothelial growth factor.
  • anti-VEGF anti-vascular endothelial growth factor
  • ranibizumab (Lucentis®)
  • Ranibizumab has been reported to be an effective and safe treatment for patients with neovascular age-related macular degeneration through various clinical studies, and is widely used worldwide.
  • lesions frequently recur the number of injections increases, which puts a considerable burden on patients. In some patients, lesions do not improve despite injections.
  • vascular endothelial growth factor acts as a powerful vasodilator, which helps maintain the relaxation of coronary arteries and blood circulation in the heart. Since patients with age-related macular degeneration are elderly and at high risk for cardiovascular disease, anti-vascular endothelial growth factor injections also carry the risk of serious side effects.
  • the present invention proposes a novel therapeutic composition that reduces the risk of side effects and has an effective therapeutic effect on macular degeneration.
  • the inventors of the present invention have made extensive research efforts to develop a treatment for macular degeneration with a reduced risk of side effects. As a result, the inventors of the present invention have completed the present invention by confirming that a pyruvate dehydrogenase kinase (PDK) inhibitor reduces neovascularization caused by macular degeneration and suppresses vascular leakage.
  • PDK pyruvate dehydrogenase kinase
  • the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating macular degeneration.
  • Another object of the present invention is to provide a food composition for preventing or improving macular degeneration.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neovascular ocular disease.
  • Another object of the present invention is to provide a food composition for preventing or improving neovascular eye disease.
  • Another object of the present invention is to provide a method for treating macular degeneration.
  • Another object of the present invention is to provide a method for treating neovascular eye disease.
  • Another object of the present invention is to provide novel uses of PDK inhibitors.
  • the present invention relates to a composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.
  • PDK pyruvate dehydrogenase kinase
  • the composition according to the present invention can effectively treat and prevent macular degeneration and neovascular eye diseases while minimizing the risk of side effects by reducing neovascularization caused by macular degeneration and inhibiting vascular leakage.
  • One aspect of the present invention is a pharmaceutical composition for alleviating, inhibiting, preventing or treating macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.
  • PDK pyruvate dehydrogenase kinase
  • pyruvate dehydrogenase kinase in this specification, also named PDK, refers to a protein that inhibits the activity of pyruvate dehydrogenase by phosphorylating pyruvate dehydrogenase.
  • pyruvate dehydrogenase kinase inhibitor refers to a substance that inhibits the expression or activity of PDK, and may include any substance that inhibits expression by directly acting on a PDK gene or protein or indirectly acting on its ligand, thereby reducing the expression of PDK at the transcriptional level or promoting its post-translational degradation into a protein, or any substance that reduces the activity of PDK by interfering with its activity.
  • a pyruvate dehydrogenase kinase inhibitor can be a compound, nucleic acid, peptide, virus or vector comprising a nucleic acid that can target PDK and inhibit the expression or activity of PDK.
  • the pyruvate dehydrogenase kinase inhibitor can include, but is not limited to, an oligonucleotide that inhibits the expression of PDK mRNA, an antibody, aptamer or compound that inhibits the activity of PDK protein, etc.
  • oligonucleotide as used herein means DNA or RNA, or a derivative thereof, containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence in the mRNA and inhibits the translation of the mRNA into protein.
  • the PDK inhibitor according to the present invention may be an oligonucleotide, and the PDK inhibitor is DNA or RNA having a sequence complementary to PDK mRNA, or a derivative thereof, which binds to mRNA and interferes with translation, translocation into the cytoplasm, maturation, etc. of the mRNA, or inhibits any other biological function or activity of the mRNA.
  • aptamer in this specification refers to a single-stranded oligonucleotide, and means a nucleic acid molecule having binding activity for a given target molecule.
  • the aptamer may have various three-dimensional structures depending on its base sequence, and may have high affinity for a specific substance, such as an antigen-antibody reaction.
  • the aptamer according to the present invention can inhibit the expression or activity of PDK by targeting the mRNA of PDK and binding to the mRNA, thereby inhibiting the biological function or activity of the mRNA.
  • siRNA in this specification refers to a small RNA fragment of 21 to 25 nucleotides in size, which is a nucleic acid molecule capable of mediating RNA interference or gene silencing. Since siRNA can inhibit the expression of a target gene, it can be used as an efficient gene knockdown method or gene therapy method.
  • the siRNA which can be generated by cleavage of double-stranded RNA by dicer, can specifically bind to mRNA having a complementary sequence and inhibit the expression of the corresponding mRNA.
  • the pyruvate dehydrogenase kinase inhibitor according to the present invention may be siRNA, and the siRNA can specifically bind to the mRNA of PDK and inhibit the expression of the corresponding mRNA, thereby inhibiting the expression or activity of PDK.
  • antibody in this specification refers to a protein molecule that can specifically bind to an antigenic site of a protein or peptide molecule.
  • An antibody can be produced by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by a marker gene, and then producing the obtained protein by a conventional method.
  • the form of the antibody is not particularly limited, and a part of it, such as a polyclonal antibody, a monoclonal antibody, an antibody fragment, or a recombinant antibody, is also included in the antibody of the present invention as long as it has antigen binding property.
  • the antibody may include not only all immunoglobulin antibodies, but also special antibodies such as humanized antibodies.
  • the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also a functional fragment of an antibody molecule.
  • a functional fragment of an antibody molecule means a fragment that has at least an antigen binding function, and may be Fab, F(ab'), F(ab') 2, and Fv.
  • the pyruvate dehydrogenase kinase inhibitor according to the present invention may be a compound.
  • the compound may be dichloroacetate (DCA), or GM10395 represented by the following chemical formula 1, or a salt thereof.
  • the salt may be, but is not limited to, an acid addition salt formed by a free acid.
  • the acid may be an organic acid and/or an inorganic acid.
  • Organic acids may include, but are not limited to, citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, metasulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, glutamic acid, and aspartic acid.
  • Inorganic acids include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid.
  • the pyruvate dehydrogenase kinase inhibitor may be a pyruvate dehydrogenase kinase 4 inhibitor.
  • pyruvate dehydrogenase kinase 4 in this specification is also named PDK4, and is a protein that encodes a mitochondrial protein having a histidine kinase domain, one of the PDK/BCKDK protein kinase family.
  • PDK4 is located in the matrix of mitochondria and is known to phosphorylate one of the subunits of pyruvate dehydrogenase to inhibit the pyruvate dehydrogenase complex and reduce the conversion of pyruvate generated from the oxidation of glucose and amino acids into acetyl-CoA, thereby contributing to the regulation of glucose metabolism.
  • Macular degeneration in this specification refers to a disease in which degeneration occurs in the macular area due to causes such as aging, family history, race, and smoking, and occurs mainly due to aging. Macular degeneration refers to an eye disease in which, when it occurs, yellow deposits called drusen (accumulation of extracellular proteins and lipids) gradually accumulate in the macula (part of the retina) between the retinal pigment epithelium and the choroid.
  • drusen accumulation of extracellular proteins and lipids
  • the macular degeneration may be age-related macular degeneration (AMD).
  • AMD age-related macular degeneration
  • age-related macular degeneration in this specification refers to a macular degeneration disease that occurs due to aging, progresses in three stages of early, intermediate, and late, based in part on the degree (size and number) of drusen, and can cause vision loss.
  • the age-related macular degeneration may be early age-related macular degeneration (early AMD), intermediate age-related macular degeneration (intermediate AMD), or late age-related macular degeneration (late AMD).
  • the age-related macular degeneration may be late age-related macular degeneration.
  • late age-related macular degeneration in this specification refers to a macular degeneration disease characterized by vision loss due to macular damage. Late age-related macular degeneration is divided into dry AMD and wet AMD depending on the type of damage. Dry AMD is non-neovascular age-related macular degeneration characterized by geographic atrophy, and wet age-related macular degeneration is neovascular age-related macular degeneration in which choroidal neovascularization appears.
  • the age-related macular degeneration may be neovascular age-related macular degeneration (Neovascular AMD) or non-neovascular age-related macular degeneration (Non-neovascular AMD).
  • Neovascular AMD neovascular age-related macular degeneration
  • Non-neovascular AMD non-neovascular age-related macular degeneration
  • the age-related macular degeneration may be neovascular age-related macular degeneration.
  • the pharmaceutical composition may contain pyruvate dehydrogenase kinase in an effective amount of 0.0001 to 10,000 mg/kg, 0.001 to 1,000 mg/kg, 0.05 to 500 mg/kg, 0.01 to 300 mg/kg, 0.05 to 200 mg/kg, 0.1 to 100 mg/kg, 1 to 100 mg/kg, for example, but is not limited thereto.
  • the composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, ointments, suspensions, emulsions, syrups, aerosols, etc., or parenteral formulations such as transdermal agents, suppositories, and sterile injectable solutions, respectively, according to conventional methods.
  • oral formulations such as powders, granules, tablets, capsules, ointments, suspensions, emulsions, syrups, aerosols, etc.
  • parenteral formulations such as transdermal agents, suppositories, and sterile injectable solutions, respectively, according to conventional methods.
  • the composition may additionally contain, in addition to the mixed extract, auxiliary agents such as pharmaceutically suitable and physiologically acceptable carriers, excipients, and diluents.
  • auxiliary agents such as pharmaceutically suitable and physiologically acceptable carriers, excipients, and diluents.
  • carriers, excipients and diluents may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration can include tablets, pills, powders, granules, capsules, etc., and such solid preparations can be prepared by mixing the extract with at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • excipients for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc can also be used, but are not limited thereto.
  • Oral preparations include suspensions, solutions, emulsions, syrups, and ointments, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included, but are not limited thereto.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories, transdermal preparations, etc.
  • Non-aqueous solutions and suspensions may include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • Suppository formulations that can be used include, but are not limited to, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerogelatin.
  • the pharmaceutical composition may be administered orally or parenterally, and in the case of parenteral administration, may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, ocular administration, or ocular topical administration.
  • ocular topical administration may be intraocular, periocular, retroocular, subretinal, central retinal, extrafoveal, subconjunctival, intravitreal, intracameral, or suprachoroidal.
  • Another aspect of the present invention is a food composition for alleviating, suppressing or improving macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.
  • PDK pyruvate dehydrogenase kinase
  • the food composition for alleviating, suppressing or improving macular degeneration of the present invention contains a pyruvate dehydrogenase kinase inhibitor in the same manner as the pharmaceutical composition for alleviating, suppressing, preventing or treating macular degeneration of the present invention described above, and therefore, description of common contents between the two is omitted to avoid excessive complexity of the specification due to repeated description.
  • the food composition according to the present invention may include ingredients commonly added during food manufacturing, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents, but is not limited thereto.
  • Carbohydrates that may be included in the food composition according to the present invention include, but are not limited to, monosaccharides such as glucose and fructose, disaccharides such as maltose, sucrose, and oligosaccharides, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • Flavoring agents that may be included in the food composition according to the present invention may include, but are not limited to, natural flavoring agents such as thaumatin and stevia extract, and synthetic flavoring agents such as saccharin and aspartame.
  • Another aspect of the present invention is a pharmaceutical composition for alleviating, inhibiting, preventing or treating neovascular eye disease, comprising a pyruvate dehydrogenase kinase inhibitor.
  • Another aspect of the present invention is a food composition for alleviating, suppressing or improving neovascular eye disease, comprising a pyruvate dehydrogenase kinase inhibitor.
  • the pharmaceutical composition for alleviating, suppressing, preventing or treating neovascular eye disease of the present invention and the food composition for alleviating, suppressing or improving neovascular eye disease contain a pyruvate dehydrogenase kinase inhibitor, which is the same effective ingredient as the pharmaceutical composition for alleviating, suppressing, preventing or treating macular degeneration of the present invention described above, and therefore, the description of the common contents between the two is omitted in order to avoid excessive complexity of the specification due to repeated description.
  • neovascular eye disease refers to a pathological angiogenesis-related disease occurring in the eye.
  • the neovascular eye disease may include corneal neovascularization, retinal neovascularization, choroidal neovascularization, intraocular neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, neovascular macular degeneration, and retinopathy of prematurity.
  • Another aspect of the present invention relates to a method for treating or alleviating macular degeneration, comprising administering to a subject a pharmaceutical composition comprising a pyruvate dehydrogenase kinase inhibitor.
  • Another aspect of the present invention relates to a method for treating or alleviating a neovascular eye disease, comprising administering to a subject a pharmaceutical composition comprising a pyruvate dehydrogenase kinase inhibitor.
  • administration means providing a given substance to a patient by any suitable method, and the route of administration of the pharmaceutical composition of the present invention may be oral or parenteral administration through any common route as long as it can reach the target tissue.
  • the composition of the present invention may be administered using any device capable of delivering the active ingredient to the target cell.
  • subject includes, but is not limited to, a human, a monkey, a cow, a horse, a sheep, a pig, a chicken, a turkey, a quail, a cat, a dog, a mouse, a rat, a rabbit or a guinea pig, for example, but not limited to a human.
  • the pharmaceutical composition of the present invention may be administered alone, but may generally be administered mixed with a pharmaceutical carrier selected in consideration of the mode of administration and standard pharmaceutical practice.
  • the dosage of the pharmaceutical composition of the present invention may vary depending on the patient's age, weight, sex, dosage form, health condition, and disease severity, and may be administered once or several times a day at regular intervals at the discretion of a doctor or pharmacist.
  • the daily dosage may be 1 to 1000 ug/mL based on the active ingredient content, but this is an average case and the dosage may be higher or lower depending on individual differences.
  • the pyruvate dehydrogenase kinase inhibitor may be a pyruvate dehydrogenase kinase 4 inhibitor.
  • the pyruvate dehydrogenase kinase 4 inhibitor may comprise GM10395 or a salt thereof.
  • Another aspect of the present invention is the use of a pyruvate dehydrogenase kinase inhibitor for alleviating, inhibiting, treating or preventing macular degeneration.
  • Another aspect of the present invention is the use of a pyruvate dehydrogenase kinase inhibitor for alleviating, inhibiting, treating or preventing neovascular eye diseases.
  • the present invention relates to a composition for alleviating, inhibiting, treating or preventing macular degeneration.
  • the composition according to the present invention has an excellent effect of reducing neovascularization caused by macular degeneration and inhibiting vascular leakage, and thus can be utilized as a therapeutic agent for alleviating or treating macular degeneration, particularly, age-related macular degeneration (AMD).
  • AMD age-related macular degeneration
  • Figure 1 is a graph comparing the expression levels of PDK isoforms (PDK1 to PDK4) in the retinal pigment epithelium (RPE) and choroid of choroidal neovascularization (CNV) mice and control mice.
  • RPE retinal pigment epithelium
  • CNV choroidal neovascularization
  • Figure 2 is a graph comparing the expression levels of phosphorylated PDHE1 ⁇ (p-PDHE1 ⁇ ) protein in the RPE and choroid of CNV mice and control mice.
  • Figure 3 is a photograph comparing the expression levels of PDK4 protein in the ocular tissues of CNV mice and control mice.
  • the size of the scale bar in Figure 3 is 100 ⁇ m.
  • Figure 4 is a photograph comparing the expression levels of p-PDHE1 ⁇ protein in the ocular tissues of CNV mice and control mice.
  • the size of the scale bar in Figure 4 is 100 ⁇ m.
  • Figure 5 is a graph comparing the expression levels of PDK isoforms (PDK1 to PDK4) in the retinas of CNV mice and control mice.
  • Figure 6 is a diagram showing the results of evaluating the CNV lesion grade (0 to 2B) of CNV mice in which the Pdk4 gene is wild type or knocked out.
  • Figure 7 is a diagram showing the results of comparing the CNV lesion areas of CNV mice in which the Pdk4 gene is wild type or knocked out.
  • the size of the scale bar in Figure 7 is 100 ⁇ m.
  • Figure 8 is a graph showing the results of comparing the basal OCR, maximal OCR, and reserve OCR of each group after knocking down each gene by transfecting siRNA against Pdk isoforms ( Pdk1 to Pdk4 ) into primary human RPE in which oxygen consumption rate (OCR) was down-regulated by an inflammatory cytokine mixture (ICM).
  • OCR oxygen consumption rate
  • Figure 9 is a graph showing the results of measuring the level of Pdk4 mRNA in primary human RPE cells when siRNA against Pdk4 was transfected into primary human RPE cells treated with ICM.
  • Figure 10 is a graph showing the results of measuring the mRNA levels of Il-1 ⁇ , Il-6 , Il-8 , and Mcp-1 in primary human RPE cells in which Pdk4 was knocked down by transfecting siRNA against Pdk4 into primary human RPE cells treated with ICM.
  • Figure 11 is a graph comparing the mRNA levels of Il-1 ⁇ and Il-6 in primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.
  • Figure 12 is a drawing showing the results of confirming the level of p-PDHE1 ⁇ protein expression when DCA was treated at various concentrations in primary human RPE cells treated with ICM.
  • Figure 13 is a drawing showing the results of confirming the level of p-PDHE1 ⁇ protein expression when GM10395 was treated at various concentrations in primary human RPE cells treated with ICM.
  • Figure 14 is a graph comparing the OCR of primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.
  • Figure 15 is a graph comparing mitochondrial superoxide in primary human RPE cells when DCA (10 uM) or GM10395 (1 uM) was treated in ICM-treated primary human RPE cells.
  • the size of the scale bar in Figure 15 is 50 um.
  • Figure 16 is a graph comparing the mitochondrial area in primary human RPE cells when DCA (10 uM) or GM10395 (1 uM) was treated in ICM-treated primary human RPE cells.
  • the size of the scale bar in Figure 16 is 20 ⁇ m.
  • Figure 17 is a graph comparing the mRNA levels of Il-1 ⁇ , Il-6 , Il-8 , and Mcp-1 in primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.
  • Figure 18 is a graph comparing the expression levels of proinflammatory cytokines IL-6, IL-8, and MCP-1 in primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.
  • Figure 19 is a diagram showing the results of evaluating the CNV lesion grade (0 to 2B) of CNV mice orally administered DCA (250 mpk) or GM10395 (1 mpk).
  • Figure 20 is a drawing showing the results comparing the CNV lesion area of CNV mice orally administered DCA (250 mpk) or GM10395 (1 mpk).
  • the size of the scale bar in Figure 20 is 100 ⁇ m.
  • Figure 21 is a drawing showing the results of comparing the expression levels of p-PDHE1 ⁇ protein in RPE/choroid tissues obtained from CNV mice orally administered control drug (saline) and GM10395 (1 mpk).
  • Figure 22 is a graph comparing the mRNA levels of Il-1 ⁇ , Il-6 , and Mcp-1 in RPE/choroid tissues obtained from CNV mice orally administered control drug (saline) and GM10395 (1 mpk).
  • a pharmaceutical composition for alleviating, inhibiting, preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.
  • PDK pyruvate dehydrogenase kinase
  • % when used to indicate the concentration of a particular substance, unless otherwise noted, is (wt/wt)% for solid/solid, (wt/vol)% for solid/liquid, and (vol/vol)% for liquid/liquid.
  • PDK4 is overexpressed in retinal pigment epithelial cells (RPE) in a laser-induced choroidal neovascularization (CNV) model
  • PDK a key regulatory enzyme of mitochondrial metabolism in neovascular AMD
  • the expression levels of PDK and p-PDHE1 ⁇ in laser-induced CNV mice were evaluated.
  • the expression levels of PDK4 and p-PDHE1 ⁇ were significantly increased in CNV mice compared with the control group (Fig. 1, Table 1 and Fig. 2, Table 2).
  • PDK1, PDK2 and PDK3 were not increased in the RPE/choroid.
  • PDK4 and p-PDHE1 ⁇ were overexpressed in CNV mice compared with the control group, especially in the RPE (Fig. 3 and Fig. 4).
  • no PDK isoform was increased in the retinal tissue (Fig. 5 and Table 3).
  • the specific numerical values of the graphs in Fig. 1, Fig. 2 and Fig. 5 are shown in Tables 1 to 3, respectively.
  • Control group CNV P value average ⁇ standard error of mean average ⁇ standard error of mean pPDHE1 ⁇ (S293)/HSP90 1.000 0.127 2.510 0.265 0.0002
  • OCR oxygen consumption
  • hRPE primary human RPE
  • siRNA siRNA
  • PBS control drug
  • ICM inflammatory cytokine mixture
  • Inflammatory cytokines including IL-1 ⁇ and MCP-1
  • RPE is a metabolically demanding tissue that is fueled by abundant mitochondria and requires high oxygen consumption. Impaired energy metabolism and RPE dysfunction under inflammatory conditions may contribute to the development and progression of AMD. Therefore, mRNA levels of Pdk4 , Il -1 ⁇ , Il-6 , Il-8 , and Mcp-1 were measured after transient knockdown of Pdk4 using siRNA (si Pdk4 ) in ICM-derived primary hRPE cells.
  • si Pdk4 inhibited ICM-induced upregulation of Pdk4 , Il-1 ⁇ , Il-6 , Il-8 , and Mcp-1 compared to si Control (Fig. 9, Table 7 and Fig. 10, Table 8). Specific figures for the graphs of Figures 9 and 10 are shown in Tables 7 and 8, respectively.
  • GM10395 a small molecule targeting PDK4, reversed the metabolic shift toward OXPHOS in ICM-induced primary hRPE
  • DCA DCA in metabolic processes
  • relatively high dose ranges 0.5 to 10 mM
  • DCA DCA in various cell lines including HepG2, C2C12, HEK293, primary hepatocytes and primary macrophages.
  • the effective dose of DCA in the range of 1 to 50 uM was confirmed in ICM-induced primary hRPE cells in the present invention.
  • the data were similar to a previous study using TGF ⁇ -induced ARPE cells.
  • the effective dose of GM10395 in primary hRPE cells was lower than DCA at 0.5 to 5 uM, and these results were similar in other cells including CD4+ T cells (Fig. 11 and Table 9).
  • IL-1 ⁇ IL-6 average ⁇ standard error of mean average ⁇ standard error of mean Control group 1.0 0.3 1.0 0.1 ICM 5 ng/mL 888.9 61.0 454.6 31.7 ICM + DCA 1 uM 626.6 57.3 369.9 4.9 ICM + DCA 10 uM 589.5 12.9 291.1 9.2 ICM + DCA 50 uM 607.5 29.8 304.1 18.1 ICM + DCA 1,000 uM 892.3 41.0 439.7 15.8 ICM + GM10395 0.5 uM 586.4 24.2 272.8 7.0 ICM + GM10395 1 uM 619.6 54.2 248.8 22.2 ICM + GM10395 5 uM 524.8 24.7 246.2 5.0
  • pPDHE1 ⁇ /HSP90 average ⁇ standard error of mean Control group 1.000 0.251 ICM 5 ng/mL 2.336 0.182 ICM + GM103950.5 uM 0.244 0.026 ICM + GM103951 uM 0.111 0.003
  • GM10395 The neovascular phenotype in CNV lesions appears to be governed by mitochondrial metabolism of RPE via PDK4 when activated by inflammatory stimuli. Therefore, to evaluate the effect of GM10395 on metabolic reprogramming under inflammatory conditions, OCR of ICM-derived primary hRPE cells was measured. Both DCA and GM10395 increased maximal respiration. Interestingly, GM10395 significantly increased spare respiratory capacity in a dose-dependent manner, while DCA did not increase spare respiratory capacity (Fig. 14 and Table 12). The specific numerical values of the graph in Fig. 14 are presented in Table 12.
  • GM10395 the mRNA and protein levels of proinflammatory cytokines were measured after DCA and GM10395 treatment in ICM-induced primary hRPE cells.
  • DCA inhibited the ICM-induced up-regulation of Il-1 ⁇ , Il-6 , Il-8 , and Mcp-1 (Fig. 17 and Table 15).
  • GM10395 inhibited the ICM-induced up-regulation of Il-1 ⁇ , Il-6 , Il-8, and Mcp-1 .
  • DCA and GM10395 inhibited the ICM-induced up-regulation of IL-6, IL-8, and MCP-1 protein levels (Fig. 18 and Table 16).
  • the specific numerical values of the graphs in Fig. 17 and Fig. 18 are shown in Table 15 and Table 16, respectively.
  • GM10395 a PDK4 inhibitor, alleviated CNV in a laser-induced CNV model
  • p-PDHE1 ⁇ after oral administration of GM10395 were evaluated by immunoblotting of RPE/choroid tissues obtained from CNV mice.
  • the expression of p-PDHE1 ⁇ was decreased by GM10395 treatment (Fig. 21 and Table 19), which was similar to the results of dephosphorylation of p-PDHE1 ⁇ by GM10395 in ICM-derived primary hRPE cells in Fig. 13.
  • the specific values of Fig. 21 are shown in Table 19.
  • pPDHE1 ⁇ /HSP90 average ⁇ standard error of mean Control drug administration group 1.00 0.15 GM10395 administration group 0.32 0.04
  • GM10395 mRNA levels of Il-1 ⁇ , Il-6 , and Mcp-1 were measured in laser-induced CNV mice.
  • the GM10395 treatment group attenuated the CNV-induced upregulation of Il-1 ⁇ , Il-6 , and Mcp-1 3 days after CNV induction (Fig. 22 and Table 20). The specific values of Fig. 22 are shown in Table 20.
  • the RPE relies almost exclusively on mitochondrial OXPHOS (oxidative phosphorylation), which allows photoreceptors to utilize glucose transported from the choroid through the RPE.
  • OXPHOS oxidative phosphorylation
  • This process is highly regulated in the RPE through the inhibition of glycolysis, thus preserving glucose as an energy source for photoreceptors.
  • AMD disrupts this metabolic ecosystem, causing the RPE to rely on glycolysis to sustain its energy needs, a process referred to as metabolic reprogramming.
  • This metabolic switch in mitochondria creates a proinflammatory environment in the RPE that further exacerbates the neovascular phenotype of AMD.
  • PDK-mediated glycolytic switch in dorsal root ganglia leads to overexpression of proinflammatory cytokines that induce painful diabetic neuropathy. Furthermore, pharmacological inhibition with DCA and Pdk2/4 deficiency attenuated proinflammatory cytokine expression, thereby reducing spinal neuroinflammation.
  • metabolic reprogramming of RPE mitochondria creates a proinflammatory environment that exacerbates the neovascular phenotype of AMD.
  • the link between metabolic reprogramming in human RPE and the neovascular phenotype of CNV has not yet been studied. Therefore, we evaluated the link using genetic deletion and small molecules and identified PDK4 inhibitors as therapeutic targets in mitochondrial dynamics regulation.
  • DCA a structural analogue of pyruvate and a PDK inhibitor
  • DCA has shown protective effects against various neurological diseases including neurodegenerative diseases as well as glioma and ischemic encephalopathy.
  • DCA is known to have serious systemic side effects of peripheral neuropathy, which calls for the discovery of alternative PDK inhibitors, especially those targeting primarily PDK4. Therefore, in the present invention, the effect of a novel small molecule GM10395 was evaluated, which acts at much lower concentrations in terms of mitochondrial dynamics regulation.
  • GM10395 targeting PDK4 increased maximal respiration and reserve respiration.
  • reserve respiration capacity was significantly increased dose-dependently by GM10395, whereas DCA did not show such effects.
  • GM10395 attenuated oxidative stress as evidenced by MitoSOX staining and also attenuated mitochondrial fragmentation induced by inflammatory conditions.
  • enhanced mitochondrial activity enabled RPE to better recover from oxidative damage, supporting the important role of RPE mitochondria.
  • GM10395 reduced the expression of genes associated with immunomodulatory RPE phenotype and neovascular phenotype. Therefore, modulation of RPE phenotype through metabolic reprogramming may be used to improve clinical outcomes of CNV by reducing the direct neurotoxic potential of reactive RPE.
  • mice Male C57BL/6J mice were used in all experiments.
  • a population of Pdk4 knockout mice ( Pdk4 -/- ) was established in an in-house animal facility. All mice were housed on a pathogen-free platform with constant temperature (22 °C), a 12-h light/dark cycle, and unrestricted access to chow diet and water. Seven-week-old mice were administered orally dichloroacetate (DCA 250 mg/kg; Sigma-Aldrich, 347795) or GM10395 (1 mg/kg; diluted to a concentration of 10 mg/mL in 1% DMSO/saline solution), or saline once daily from day ⁇ 7 prior to CNV induction (day 0) to day +7 after CNV induction.
  • DCA 250 mg/kg Sigma-Aldrich, 347795
  • GM10395 diluted to a concentration of 10 mg/mL in 1% DMSO/saline solution
  • a Micron IV Retinal Imaging Microscope (Phoenix Technology Group, Pleasanton, CA, USA) was used for fluorescein imaging. After anesthesia and pupil dilation, 0.1 mL of 2% sodium fluorescein (Akorn, Lake Forest, IL, USA) was injected intraperitoneally, and images were acquired 3 to 5 and 7 to 10 minutes later using StreamPix software. A previously described scheme was used to grade the lesions: faint or patchy fluorescence without leakage was scored as 0; hyperfluorescence without increase in size or intensity was scored as 1 (mild leakage); hyperfluorescence of constant size but increasing intensity was scored as 2A (moderate leakage); and hyperfluorescence with increase in both size and intensity was scored as 2B (clinically significant leakage).
  • enucleated mouse eyes were fixed with 4% paraformaldehyde for 1 h at room temperature, cryoprotected in 30% sucrose solution overnight at 4 °C, and embedded in OCT compound. Eyes were cryosectioned at 15 ⁇ m thickness. For immunofluorescence techniques, sections were blocked with blocking buffer (0.5% Triton, 0.2% BSA, and 5% donkey serum in PBS) for 1 h at room temperature and then incubated with primary antibodies overnight at 4 °C. After washing, samples were incubated with secondary antibodies for 1 h at room temperature.
  • blocking buffer (0.5% Triton, 0.2% BSA, and 5% donkey serum in PBS
  • Rabbit anti-p-PDHE11 ⁇ (1:100; MilliporeSigma, Burlington, MA, USA, AP1062), rabbit anti-PDK4 (1:200; Sigma-Aldrich, St. Louis, MO, USA, HPA056731) were used as primary antibodies, and Alexa Fluor 488-conjugated donkey anti-rabbit antibody (1:500; Thermo Fisher Scientific, Waltham, MA, USA, A21206) was used as secondary antibody.
  • hRPE Primary human RPE cells (Lonza, Walkersville, MD, USA) at passages 5 to 6 were used in the present invention.
  • Primary hRPE cells were cultured in basal medium containing supplements (RtEGM Bulletkit; Lonza).
  • ReagentPackTM Subculture Reagents (Lonza, CC-5034) containing Trypsin/EDTA (CC-5012), Trypsin Neutralizing Solution (CC-5002), and HEPES Buffered Saline Solution (CC5022) were used according to the manufacturer's instructions.
  • Primary hRPE cells were cultured in basal medium containing supplements (RtEGM BulletKit; Lonza, 00195409) at 37°C in a 5% CO2 humidified incubator.
  • hRPE cells Primary hRPE cells were seeded onto each culture plate with 2% FBS/RtEGM medium, and the medium was replaced with serum-free RtEGM medium after 24 h. Confluent primary hRPE cells were washed and treated with inflammatory cytokine mixture (ICM) containing IL-1 ⁇ (5 ng/mL), TNF- ⁇ (5 ng/mL), and IFN- ⁇ (5 ng/mL) diluted in serum-free RtEGM medium for 24 h.
  • ICM inflammatory cytokine mixture
  • Human recombinant IL-1 ⁇ 201-LB-010/CF
  • TNF- ⁇ 210-TA-100/CF
  • siRNAs targeting human Pdk1 5163-1
  • Pdk2 5164-1
  • Pdk3 5165-1
  • Pdk4 5166-2
  • si Control SN-1003
  • Sequence number designation Sequence List (5'-> 3') 1 Human siPDK1_Sense GUGUAGAUUAGAGGGAUGU 2 Human siPDK1_Antisense ACAUCCCUCUAAUCUACAC 3 Human siPDK2_Sense GGAAAGGAGUUACACCCGU 4 Human siPDK2_Antisense ACGGGUGUAACUCCUUUCC 5 Human siPDK3_Sense CUAAACACAUAGGAAGUAU 6 Human siPDK3_Antisense AUACUUCCUAUGUGUUUAG 7 Human siPDK4_Sense CUCUUCAGUGCAAUUGGU 8 Human siPDK4_Antisense AACCAAUUGCACUGAAGAG
  • siRNA transfections were performed using Lipofectamine RNAiMax and Opti-MEM (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. Briefly, primary human RPE (hRPE) cells were cultured in 12-well plates and transfected with human PDK isoforms (si Pdk1-4 ) and negative control (si Control ) at 60–70% confluency. The following day, siRNA-transfected primary hRPE cells were treated with ICM for 24 h and then harvested for qPCR and optical coagulation rate (OCR) analyses.
  • hRPE primary human RPE
  • OCR optical coagulation rate
  • PVDF membranes were immunoblotted with the following primary antibodies: anti-PDK1 (Enzo Life Sciences, Farmingdale, NY, USA, ADI-KAP-PK112), anti-PDK2 (Abcam, Cambridge, MA, USA, ab68164), anti-PDK3 (Abnova, Taipei, Taiwan, PAB4563), anti-PDK4 (Abcam, Cambridge, MA, USA, ab110336), anti-p-PDHE1 ⁇ (MilliporeSigma, Burlington, MA, USA, AP1062), anti-pyruvate dehydrogenase (Cell Signaling Technology, Danvers, MA, USA, 2784), anti-heat shock protein 90 (Cell Signaling Technology, Danvers, MA, USA, 4874), and anti- ⁇ -actin (Sigma-Aldrich, St. Louis, MO, USA, A5441). Anti-heat shock protein 90 was used as a loading control.
  • anti-PDK1 Enzo Life Sciences, Farmingdale, NY, USA, ADI-KAP-
  • Human IL-6, IL-8, and MCP-1 in cell culture media were measured using ELISA kits according to the manufacturer's instructions.
  • Human IL-6 (88-7066-76) and MCP-1 (88-7399-76) uncoated ELISA kits were purchased from Thermo Scientific (Waltham, MA, USA).
  • Human IL-8 coated ELISA kit (D8000C) was purchased from R&D Systeem (Minneapolis, MN, USA). Results were expressed as pg/mL of sample.
  • OCR was measured using an XFe96 Extracellular Flux Analyzer (Seahorse Biosciences, Billerica, MA, USA).
  • Primary hRPE cells were seeded in cell culture plates (6-well) at a density of 1.4 ⁇ 10 5 cells/well. On day 3, cells were treated with ICM diluted in fresh serum-free medium with or without DCA and GM10395 for 24 h. Afterwards, cells were transferred to XFe96 cell culture plates (96-well) containing assay medium, and the assay plates were incubated at 37 °C in 5% CO 2 for 5 h.
  • the assay medium consisted of XF DMEM medium pH 7.4 (Agilent TECHNOLOGIES, Santa Clara, CA, USA) supplemented with Seahorse XF 1.0 M Glucose Solution (25 mM), Seahorse XF 100 mM Pyruvate Solution (1 mM), and Seahorse XF 200 mM Glutamine Solution (2 mM).
  • Inhibitors and uncouplers were used at the following concentrations: oligomycin A (1 uM, Sigma-Aldrich), FCCP (carbonyl cyanide 4-(trifluoro-methoxy) phenylhydrazone, 1 uM, Sigma-Aldrich), and rotenone (1 uM, Signa-Aldrich).
  • DAPI-stained cells were automatically counted with ImageXpress Micro Confocal Microscopy (Molecular Devices, San Jose, CA, USA) to normalize to cell number.
  • MitoSOX TM Red Mitochondrial Superoxide Indicator (Thermo Scientific, Waltham, MA, USA, M36008) was used to detect mitochondrial superoxide formation in primary hRPE cells treated with ICM containing or not DCA (10 uM) or GM10395 (1 uM) for 24 h.
  • Primary hRPE cells were seeded at a density of 2 X 10 4 cells/well in black wall/clear bottom 96-well plates (Greiner Bio-One, Kremsmünster, Austria).
  • hRPE cells were seeded at a density of 6 ⁇ 10 3 cells/well in black wall/clear bottom 96-well plates (Greiner Bio-One, Kremsmünster, Austria). At the end of the experiment, primary hRPE cells were fixed with 4% paraformaldehyde and then permeabilized in PBS containing 0.1% Triton X-100 and 0.1 M glycine. After washing with PBS, cells were incubated with primary antibody against translocase of outer mitochondrial membrane 20 (TOM20) (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc-11415) overnight at 4 °C.
  • TOM20 translocase of outer mitochondrial membrane 20
  • Alexa Fluor 594-conjugated donkey anti-rabbit antibody (1:100; Thermo Fisher Scientific, Waltham, MA, USA, A21207) was used as the secondary antibody and incubated for 2 h at room temperature. Nuclei were stained with DAPI solution (Thermo Fisher, Waltham, MA, USA, 62248). Images of primary hRPE cells were acquired using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) in confocal mode (60 ⁇ m pinhole spinning) with a 60X Plan Fluor objective. A 2.4 mm z-stack with 0.4 mm between image planes was acquired using DAPI and Texas Red.
  • a 2-dimensional projection was generated to show maximum intensity and processed using the “Flatten Background” function to provide clear mitochondrial structure using MetaXpress (Molecular Devices).
  • the mitochondrial area of each cell was quantified using the Fiji plugin (NIH) in ImageJ software.
  • the total mitochondrial area contour was determined by thresholding the low-pass filtered image.
  • image processing software was used to apply a region of interest (ROI) to individual cells to quantify the fluorescent pixels.
  • ROI region of interest
  • the sum of the total fluorescence intensities obtained from each image was divided by the number of cells in that image to obtain the mean cellular fluorescence intensity.
  • the fluorescence intensity values per cell were replicated according to the number of cells analyzed in each image, and the mean and standard error of the mean (SEM) were calculated based on these values.
  • the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating macular degeneration.
  • Another object of the present invention is to provide a food composition for preventing or improving macular degeneration.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neovascular ocular disease.
  • Another object of the present invention is to provide a food composition for preventing or improving neovascular eye disease.
  • Another object of the present invention is to provide a method for treating macular degeneration.
  • Another object of the present invention is to provide a method for treating neovascular eye disease.
  • Another object of the present invention is to provide novel uses of PDK inhibitors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Ophthalmology & Optometry (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 황반변성의 완화, 억제, 치료 또는 예방용 조성물에 관한 것으로, 본 발명에 따른 조성물은 황반변성으로 인한 신생혈관을 감소시키고, 혈관 누출을 억제하는 효과가 우수한 바, 황반변성, 특히, 나이관련 황반변성 (age-related macular degeneration, AMD)을 완화 또는 치료하는 치료제로 활용될 수 있다.

Description

피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물
본 발명은 과학기술정보통신부의 지원 하에서 과제번호 RS-2024-00334982에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국연구재단, 연구사업명은 "개인기초연구", 연구과제명은 "망막상피세포와 시세포간의 메타볼릭 디커플링 제어를 통한 망막변성의 신규 치료기전 연구", 주관기관은 경북대학교산학협력단, 연구기간은 2024.05.01 ~ 2029.04.30 이다.
또한 본 발명은 과학기술정보통신부의 지원 하에서 과제번호 2019R1A2C1084371에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국연구재단, 연구사업명은 "개인기초연구", 연구과제명은 "면역세포의 미토콘드리아 에너지 대사 리프로그래밍 및 염증 활성화 제어를 통한 신생혈관성 연령관련 황반변성 신규 치료기전 연구", 주관기관은 경북대학, 연구기간은 2019.09.01 ~ 2024.02.29 이다.
또한 본 발명은 과학기술정보통신부의 지원 하에서 과제번호 2020-0-01808-002에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 정보통신기획평가원, 연구사업명은 "정보통신방송혁신인재양성", 연구과제명은 "복합정보 기반 예측지능 혁신 기술 연구", 주관기관은 경북대학교산학협력단, 연구기간은 2024.01.01 ~ 2024.12.31 이다.
또한 본 발명은 과학기술정보통신부, 보건복지부, 산업통상자원부의 지원 하에서 과제번호 HN21C0923000021에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 국가신약개발재단, 연구사업명은 "신약기반 확충연구", 연구과제명은 "연령관련 황반변성 경구용 치료제 유효/선도물질 발굴", 주관기관은 경북대학, 연구기간은 2021.11.01 ~ 2024.10.31 이다.
또한 본 발명은 보건복지부의 지원 하에서 과제번호 HR22C1832010023에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국보건산업진흥원, 연구사업명은 "연구중심병원 육성 R&D", 연구과제명은 "글로벌 경쟁력 확보를 위한 K-Leading Tech 기반 세계 최초 의료기술 사업화 플랫폼 구축", 주관기관은 경북대학교병원, 연구기간은 2024.01.01 ~ 2024.12.31 이다.
본 특허출원은 2023년 06월 30일에 대한민국 특허청에 제출된 대한민국 특허출원 제 10-2023-0085045호에 대하여 우선권을 주장하며, 상기 특허출원의 개시사항은 본 명세서에 참조로서 삽입된다.
본 발명은 피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 본 발명은 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는 황반변성 예방 또는 치료용 조성물에 관한 것이다.
황반변성 (macular degeneration)은 황반 부분에 변성이 일어나 시력장애를 일으키는 안구 질환으로, 발병원인은 연령증가, 가족력, 인종, 흡연과 관련이 있다고 알려져 있다. 발병 초기에는 시야가 흐려지고 가까운 곳의 시력이 뒤틀려서 보이다가 나중에는 실명에 이르게 된다.
나이관련 황반변성 (age-related macular degeneration, AMD)은 중증의 비가역적인 시력상실을 야기하며 50세 이상 인구에서 실명의 주요 원인으로 알려져 있다. 역학 연구에서 유병률은 미국 내 52~64세 인구의 1.2%인 것으로 보고되었으며, 75세 이상에서는 그 비율이 20-37%로서 더욱 높은 것으로 보고되어, 평균연령이 증가될수록 유병률은 점차 증가될 것으로 생각된다.
나이관련 황반변성에는 두 가지 유형이 있다. 첫 번째는 비-신생혈관성 나이관련 황반변성으로, 가장 흔하며 전체 나이관련 황반변성 사례의 85%를 차지한다. 이러한 건성 유형은 망막 색소 상피의 기름찌꺼기와 위축성 변화를 특징으로 한다. 두 번째는 신생혈관성 나이관련 황반변성으로, 맥락막 신생혈관을 특징으로 한다. 맥락막 신생혈관은 새롭게 형성된 혈관으로 혈액과 체액을 유출시키는 경향이 있다. 이는, 망막조직에 섬유조직이 증식하고 광수용체가 소실된 병변의 형성을 유도하며, 지속적으로 진행하여 중증이며 비가역적인 시력상실을 야기한다.
특히, 2010년 발표된 국내 나이관련 황반변성에 대한 기초역학조사에 따르면, 나이관련 황반변성의 유병률은 초기변성이 2.92%, 후기변성이 0.19%이지만, 후기 황반변성 중 비-신생혈관성 황반변성은 3.9% 이며, 나머지는 모두 신생혈관성으로 관찰되어, 신생혈관성 황반변성의 빈도가 외국의 경우에 비해 매우 높음을 알 수 있다.
신생혈관성 나이관련 황반변성 치료법에는 광역학요법과 혈관내피성장인자를 차단하기 위한 약물을 안구 안으로 주사하는 방법이 있다. 그러나, 여러 대규모 다기관 임상연구들을 통해 광역학요법보다 유리체강내 항혈관내피성장인자 (anti-vascular endothelial growth factor, anti-VEGF) 주사술을 시행하는 것이 더 나은 결과를 보여주었다.
이에 따라 신생혈관성 나이관련 황반변성의 치료로 다양한 항혈관내피성장인자 약물들이 개발되었는데, 그 중 대표적인 약제가 라니비주맙 (Ranibizumab, Lucentis®)으로, 세포 밖의 혈관내피성장인자와 결합하여 활성을 억제시킨다. 라니비주맙은 다양한 임상연구를 통해 신생혈관성 나이관련 황반변성 환자에서 효과적이고 안전한 치료임이 보고되어 전세계적으로 널리 사용되고 있으나, 병변이 자주 재발함에 따라 주사횟수가 많아져 환자에게 상당한 부담을 준다. 일부환자에서 주사술에도 불구하고 병변이 호전되지 않는 경우도 있다.
한편, 혈관내피성장인자 (VEGF)는 강력한 혈관확장제 역할을 하기 때문에 심장의 관상동맥의 이완과 혈액 순환을 유지시키는 역할을 한다. 나이관련 황반변성 환자들이 고령이고 심혈관 질환의 위험이 높은 군들이므로, 항혈관내피성장인자 주사술은 심각한 부작용의 위험성도 있다.
이에 본 발명에서는 부작용의 위험성을 줄이고 황반변성에 대해 효율적 치료효과를 가져오는 새로운 치료조성물을 제안하고자 한다.
본 발명자들은 부작용의 위험성이 감소된 황반변성 치료제를 개발하고자 예의 연구 노력하였다. 그 결과, 본 발명자들은 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제가 황반변성으로 인한 신생혈관을 감소시키고, 혈관 누출을 억제함을 확인함으로써 본 발명을 완성하게 되었다.
이에, 본 발명의 목적은 황반변성 (macular degeneration)의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 황반변성의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 신생혈관성 안질환 (neovascular ocular disease)의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 신생혈관성 안질환 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 황반변성 치료방법을 제공하는 것이다.
본 발명의 또 다른 목적은 신생혈관성 안질환 치료방법을 제공하는 것이다.
본 발명의 또 다른 목적은 PDK 저해제의 신규한 용도를 제공하는 것이다.
본 발명은 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는 황반변성 예방 또는 치료용 조성물에 관한 것으로, 본 발명에 따른 조성물은 황반변성으로 인한 신생혈관을 감소시키고, 혈관 누출을 억제함으로써, 황반변성 및 신생혈관성 안질환을 부작용의 위험성을 최소화하면서 효율적으로 치료 및 예방할 수 있다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는, 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 황반변성 (macular degeneration)의 완화, 억제, 예방 또는 치료용 약제학적 조성물이다.
본 명세서 상의 용어 "피루브산 탈수소효소 키나아제"는 PDK로도 명명되며, 피루브산 탈수소효소를 인산화함으로써 피루브산 탈수소효소의 활성을 억제하는 단백질을 의미한다.
본 명세서 상의 용어 "피루브산 탈수소효소 키나아제 저해제"는 PDK의 발현 또는 활성을 저해하는 물질로, PDK 유전자 또는 단백질에 직접적으로 작용하거나 그의 리간드에 간접적으로 작용하는 등의 방식을 통해 PDK의 발현을 전사 수준에서 감소시키거나 단백질로 번역 후 분해를 촉진시키는 방식으로 발현을 저해하는 물질, 또는 그 활성을 방해함으로써 PDK의 활성을 감소시키는 모든 물질을 포함할 수 있다.
피루브산 탈수소효소 키나아제 저해제는 PDK를 표적으로 하여 PDK의 발현 또는 활성을 억제할 수 있는 화합물, 핵산, 펩타이드, 바이러스 또는 핵산을 포함하는 벡터일 수 있다. 예를 들어, 피루브산 탈수소효소 키나아제 저해제는 PDK의 mRNA의 발현을 저해하는 올리고 뉴클레오티드, PDK 단백질의 활성을 억제하는 항체, 앱타머 또는 화합물 등을 들 수 있으나, 이에 제한되지 않는다.
본 명세서 상의 용어 "올리고 뉴클레오티드"는 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA, 또는 이들의 유도체를 의미하는 것으로서 mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다.
본 발명에 따른 PDK 저해제는 올리고 뉴클레오티드일 수 있고, PDK 저해제는 PDK mRNA에 상보적인 서열을 갖는 DNA 또는 RNA, 또는 이들의 유도체로서, mRNA에 결합하여 mRNA의 번역, 세포질 내로의 전위 (translocation), 성숙 (maturation) 등을 방해하거나 또는 mRNA의 그 밖의 다른 모든 생물학적 기능 또는 활성을 저해할 수 있다.
본 명세서 상의 용어 "앱타머"란, 단일 가닥 올리고 뉴클레오티드를 의미하는 것으로, 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 의미한다. 앱타머는 그 염기 서열에 따라 다양한 3차원 구조를 가질 수 있으며, 항원-항체 반응과 같이 특정 물질에 대하여 높은 친화력을 가질 수 있다. 본 발명에 따른 앱타머는 PDK의 mRNA를 표적으로 하여 상기 mRNA에 결합함으로써 해당 mRNA의 생물학적 기능 또는 활성을 저해하여 PDK의 발현 또는 활성을 억제할 수 있다.
본 명세서 상의 용어 "siRNA"는 RNA 간섭 (interference) 또는 유전자 사일런싱 (silencing)을 매개할 수 있는 핵산 분자로서, 21 내지 25 뉴클레오티드 크기의 작은 RNA 조각을 의미한다. siRNA는 표적 유전자의 발현을 저해할 수 있기 때문에 효율적인 유전자 녹다운 (knockdown) 방법 또는 유전자 치료 방법으로 사용될 수 있다. 이중 가닥의 RNA가 다이서 (dicer)에 의해 절단되어 생성될 수 있는 상기 siRNA는 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 해당 mRNA의 발현을 억제할 수 있다.
본 발명에 따른 피루브산 탈수소효소 키나아제 저해제는 siRNA일 수 있고, 상기 siRNA는 PDK의 mRNA에 특이적으로 결합하여 해당 mRNA의 발현을 억제함으로써, PDK의 발현 또는 활성을 억제할 수 있다.
본 명세서 상의 용어 "항체"는, 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질성 분자를 의미한다. 항체는 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다. 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체, 항체의 단편 또는 재조합 항체 등 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함된다. 본 발명에 있어서 항체에는 모든 면역 글로불린 항체가 포함될 수 있을 뿐만 아니라, 인간화 항체 등의 특수 항체를 포함될 수 있다. 아울러, 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2 및 Fv 등이 될 수 있다.
본 발명에 따른 피루브산 탈수소효소 키나아제 저해제는 화합물일 수 있다. 예를 들어, 화합물은 디클로로아세테이트 (Dichloroacetate; DCA), 또는 하기 화학식 1로 표현되는 GM10395 또는 이의 염 (salts)일 수 있다.
[화학식 1]
Figure PCTKR2024009001-appb-img-000001
염은 유리산 (free acid)에 의하여 형성된 산 부가염일 수 있으나, 이에 한정되는 것은 아니다.
유리산은 유기산 및/또는 무기산인 것일 수 있다.
유기산은 구연산, 초산, 젖산, 주석산, 말레인산, 푸마르산, 포름산, 프로피온산, 옥살산, 트리플로오로아세트산, 벤조산, 글루콘산, 메타술폰산, 글리콜산, 숙신산, 4-톨루엔술폰산, 글루탄산 및 아스파르트산 등인 것일 수 있으나, 이에 한정되는 것은 아니다.
무기산은 염산, 브롬산, 황산 및 인산 등인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에서 피루브산 탈수소효소 키나아제 저해제는 피루브산 탈수소효소 키나아제 4 저해제인 것일 수 있다.
본 명세서 상의 용어 "피루브산 탈수소효소 키나아제 4 (pyruvate dehydrogenase kinase 4; PDK4)"는 PDK4로도 명명되며, PDK/BCKDK 단백질 키나아제 패밀리의 하나로, 히스티딘 키나아제 도메인을 가진 미토콘드리아 단백질을 코딩하는 단백질이다. PDK4는 미토콘드리아의 기질에 위치하고 피루브산 탈수소효소의 서브유닛 (subunit) 중 하나를 인산화하여 피루브산 탈수소효소 복합체를 억제하고, 포도당과 아미노산의 산화에서 생성되는 피루브산의 아세틸-CoA의 전환을 감소시켜 포도당 대사의 조절에 기여하는 것으로 알려져 있다.
본 명세서 상의 용어 "황반변성"은 연령증가, 가족력, 인종, 흡연 등의 발병원인으로 황반부에 변성이 발생하는 질환으로, 주로 연령증가에 의해 발생한다. 황반변성은 발생 시, 망막 색소 상피와 맥락막 사이의 황반 (망막의 일부)에 드루젠 (drusen, 세포 외 단백질과 지질의 축적)이라는 황색 침전물이 점진적으로 축적되는 안구 질환을 의미한다.
본 발명의 일 구현예에서, 황반 변성은 나이관련 황반변성 (age-related macular degeneration; AMD)일 수 있다.
본 명세서 상의 용어 "나이관련 황반변성"은 연령증가를 원인으로 발생하는 황반변성 질환으로, 드루젠의 정도 (크기 및 수)에 부분적으로 기초하여 초기 (early), 중기 (intermediate), 및 후기 (late)의 3 단계로 진행되며, 시력 상실의 원인이 될 수 있는 질환을 의미한다.
본 발명의 일 구현예에서, 나이관련 황반변성은 초기 나이관련 황반변성 (early age-related macular degeneration; early AMD), 중기 나이관련 황반변성 (intermediate age-related macular degeneration; Intermediate AMD) 또는 후기 나이관련 황반변성 (late age-related macular degeneration; late AMD)일 수 있다.
본 발명의 일 구현예에서, 나이관련 황반변성은 후기 나이관련 황반변성일 수 있다.
본 명세서 상의 용어 "후기 나이관련 황반변성"은 황반 손상으로 인한 시력 손실을 특징으로 하는 황반변성 질환을 의미한다. 후기 나이관련 황반변성은 손상 유형에 따라 건식 AMD 와 습식 AMD 로 구분된다. 건식 AMD는 지도상 위축증 (Geographic atrophy)을 특징으로 하는 비-신생혈관성 나이관련 황반변성이며, 습식 나이관련 황반변성은 맥락막 신생혈관이 나타나는 신생혈관성 나이관련 황반변성이다.
본 발명의 일 구현예에서, 나이관련 황반변성은 신생혈관성 나이관련 황반변성 (Neovascular age-related macular degeneration; Neovascular AMD) 또는 비-신생혈관성 나이관련 황반변성 (Non-neovascular age-related macular degeneration; Non-neovascular AMD)일 수 있다.
본 발명의 일 구현예에서, 나이관련 황반변성은 신생혈관성 나이관련 황반변성일 수 있다.
본 발명에 있어서 약제학적 조성물은 피루브산 탈수소효소 키나아제를 유효량으로 0.0001 내지 10,000 mg/kg, 0.001 내지 1,000 mg/kg, 0.05 내지 500 mg/kg, 0.01 내지 300 mg/kg, 0.05 내지 200 mg/kg, 0.1 내지 100 mg/kg, 1 내지 100 mg/kg을 포함할 수 있고, 예를 들어, 0.1 내지 100 mg/kg 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 연고제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 또는 경피제, 좌제 및 멸균 주사용액의 형태의 비경구 제형 등으로 제형화하여 사용될 수 있다.
본 발명의 일 구현예에서, 조성물은 혼합 추출물 이외에 약제학적으로 적합하고 생리학적으로 허용되는 담체, 부형제 및 희석제 등의 보조제를 추가로 함유하는 것일 수 있다.
본 발명에 있어서 담체, 부형제 및 희석제로는, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유일 수 있으나, 이에 한정되는 것은 아니다.
제제화할 경우에는 당업계에서 일반적으로 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용할 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함될 수 있으며, 이러한 고형 제제는 상기 추출물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트 (calcium carbonate), 수크로스 (sucrose) 또는 락토오스 (lactose), 젤라틴 등을 섞어 조제될 수 있고, 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용될 수 있으나, 이에 한정되는 것은 아니다.
경구를 위한 제제로는 현탁제, 내용액제, 유제, 시럽제, 연고제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있으나, 이에 한정되는 것은 아니다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제, 경피제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌 글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
좌제의 제제로는 위텝솔 (witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 약제학적 조성물은 경구 또는 비경구로 투여될 수 있고, 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여, 안구 투여 또는 안구 국소 투여 등으로 투여될 수 있다.
본 발명의 일 구현예에서, 안구 국소 투여는 안구내, 안구주위, 안구뒤, 망막하 (subretinal), 망막중심 (central retinal), 중심와 (fovea) 외부, 결막하 (subconjunctival), 유리체내 (intravitreal), 전방내 (intracameral) 또는 맥락막위 (suprachoroidal)에 투여되는 것일 수 있다.
본 발명의 다른 양태는, 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 황반변성 (macular degeneration) 완화, 억제 또는 개선용 식품 조성물이다.
본 발명의 황반변성의 완화, 억제 또는 개선용 식품 조성물은 상술한 본 발명의 황반변성 완화, 억제, 예방 또는 치료용 약제학적 조성물과 동일하게 피루브산 탈수소효소 키나아제 저해제를 포함하므로, 이 둘 사이에 공통된 내용은 반복 기재에 따른 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
본 발명에 따른 식품 조성물은 식품 제조 시에 통상적으로 첨가되는 성분을 포함할 수 있으며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 따른 식품 조성물에 포함될 수 있는 탄수화물로는 포도당 과당 등의 모노사카라이드, 말토스, 슈크로스, 올리고당 등의 디사카라이드, 덱스트린, 사이클로덱스트린 등과 같은 폴리사카라이드 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이 포함될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 따른 식품 조성물에 포함될 수 있는 향미제는 타우마틴, 스테비아 추출물 등의 천연 향미제 및 사카린, 아스파탐 등의 합성 향미제를 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는, 피루브산 탈수소효소 키나아제 저해제를 포함하는, 신생혈관성 안질환의 완화, 억제, 예방 또는 치료용 약제학적 조성물이다.
본 발명의 또 다른 양태는, 피루브산 탈수소효소 키나아제 저해제를 포함하는, 신생혈관성 안질환의 완화, 억제 또는 개선용 식품 조성물이다.
본 발명의 신생혈관성 안질환의 완화, 억제, 예방 또는 치료용 약제학적 조성물 및 신생혈관성 안질환의 완화, 억제 또는 개선용 식품 조성물은 상술한 본 발명의 황반변성 완화, 억제, 예방 또는 치료용 약제학적 조성물과 동일한 유효성분인 피루브산 탈수소효소 키나아제 저해제를 포함하므로, 이 둘 사이에 공통된 내용은 반복 기재에 따른 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
본 명세서에서 용어 "신생혈관성 안질환"은 안구에서 발생하는 병리학적 혈관신생관련 질환을 의미한다.
본 발명의 일 구현예에서, 신생혈관성 안질환은 각막혈관신생 (corneal neovascularization), 망막 혈관신생 (retinal neovascularization), 맥락막 혈관신생 (choroidal neovascularization), 안구내 혈관신생 (intraocular neovascularization), 신생혈관성 녹내장 (neovascular glaucoma), 증식성 당뇨병성 망막증 (proliferative diabetic retinopathy), 신생혈관성 황반변성 (neovascular macular degeneration), 및 미숙아 망막병증 (retinopathy of prematurity)을 포함할 수 있다.
본 발명의 또 다른 양태는, 피루브산 탈수소효소 키나아제 저해제를 포함하는 약제학적 조성물을, 대상 (subject)에게 투여하는 단계를 포함하는, 황반변성 치료 또는 완화방법에 관한 것이다.
본 발명의 또 다른 양태는 피루브산 탈수소효소 키나아제 저해제를 포함하는 약제학적 조성물을 대상에게 투여하는 단계를 포함하는, 신생혈관성 안질환 치료 또는 완화 방법에 관한 것이다.
본 명세서에서 용어 "투여"는 임의의 적절한 방법으로 환자에게 소정의 물질을 제공하는 것을 의미하며, 본 발명의 약제학적 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 일반적인 모든 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 본 발명의 조성물은 유효성분을 표적 세포로 전달할 수 있는 임의의 장치를 이용해 투여될 수도 있다.
본 명세서에서 용어 "대상"은, 특별히 한정되는 것은 아니지만, 예를 들어, 인간, 원숭이, 소, 말, 양, 돼지, 닭, 칠면조, 메추라기, 고양이, 개, 마우스, 쥐, 토끼 또는 기니아 피그를 포함하고, 예를 들어, 인간일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 본 발명의 약제학적 조성물은 단독으로 투여될 수 있으나, 일반적으로 투여방식과 표준 약제학적 관행 (standard phamaceutical practice)을 고려하여 선택된 약제학적 담체와 혼합되어 투여될 수 있다.
본 발명의 약제학적 조성물의 투여 용량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 의사 또는 약사의 판단에 따라 일정 시간간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.
예를 들어, 유효성분 함량을 기준으로 1일 투여량이 1 내지 1000 ug/mL 일 수 있으나, 이는 평균적인 경우를 예시한 것으로서 개인적인 차이에 따라 그 투여량이 높거나 낮을 수 있다.
본 발명의 일 구현예에서, 피루브산 탈수소효소 키나아제 저해제는 피루브산 탈수소효소 키나아제 4 저해제인 것일 수 있다.
본 발명의 일 구현예에서, 피루브산 탈수소효소 키나아제 4 저해제는 GM10395 또는 이의 염 (salts)을 포함하는 것일 수 있다.
본 발명의 또 다른 양태는 피루브산 탈수소효소 키나아제 저해제의 황반변성의 완화, 억제, 치료 또는 예방을 위한 용도이다.
본 발명의 또 다른 양태는 피루브산 탈수소효소 키나아제 저해제의 신생혈관성 안질환의 완화, 억제, 치료 또는 예방을 위한 용도이다.
본 발명은 황반변성의 완화, 억제, 치료 또는 예방용 조성물에 관한 것으로, 본 발명에 따른 조성물은 황반변성으로 인한 신생혈관을 감소시키고, 혈관 누출을 억제하는 효과가 우수한 바, 황반변성, 특히, 나이관련 황반변성 (age-related macular degeneration, AMD)을 완화 또는 치료하는 치료제로 활용될 수 있다.
도 1은 맥락막 혈관신생 (CNV; choroidal neovascularization) 마우스와 대조군 마우스의 망막색소상피 (RPE; retinal pigment epithelium) 및 맥락막에서의 PDK 동형 단백질들 (PDK1 내지 PDK4)의 발현량을 비교한 그래프이다.
도 2는 CNV 마우스와 대조군 마우스의 RPE 및 맥락막에서의 인산화된 PDHE1α (p-PDHE1α) 단백질의 발현량을 비교한 그래프이다.
도 3은 CNV 마우스와 대조군 마우스의 안구 조직에서의 PDK4 단백질의 발현량을 비교한 사진이다. 도 3의 스케일 바의 크기는 100 um이다.
도 4는 CNV 마우스와 대조군 마우스의 안구 조직에서의 p-PDHE1α 단백질의 발현량을 비교한 사진이다. 도 4의 스케일 바의 크기는 100 um이다.
도 5는 CNV 마우스와 대조군 마우스의 망막에서의 PDK 동형 단백질들 (PDK1 내지 PDK4)의 발현량을 비교한 그래프이다.
도 6은 Pdk4 유전자가 야생형이거나 녹아웃된 CNV 마우스의 CNV 병변 등급 (0 내지 2B)을 평가한 결과를 나타낸 도면이다.
도 7은 Pdk4 유전자가 야생형이거나 녹아웃된 CNV 마우스의 CNV 병변 면적을 비교한 결과를 나타낸 도면이다. 도 7의 스케일 바의 크기는 100 um이다.
도 8은 염증성 사이토카인 혼합물 (ICM; inflammatory cytokine mixture)에 의해 산소소비량 (OCR; oxygen consumption rate)이 하향 조절된 1차 인간 RPE에 Pdk 동형 유전자들 (Pdk1 내지 Pdk4)에 대한 siRNA를 형질주입함으로써 각 유전자를 녹다운시킨 후, 각 그룹의 기초 OCR, 최대 OCR 및 예비 OCR을 비교한 결과를 나타낸 그래프이다.
도 9는 ICM이 처리된 1차 인간 RPE 세포에 Pdk4에 대한 siRNA를 형질주입 하였을 때의 1차 인간 RPE 세포 내 Pdk4 mRNA 수준을 측정한 결과를 나타낸 그래프이다.
도 10은 ICM이 처리된 1차 인간 RPE 세포에 Pdk4에 대한 siRNA를 형질주입 하여 Pdk4가 녹다운 된 1차 인간 RPE 세포 내 Il-1β, Il-6, Il-8Mcp-1의 mRNA 수준을 측정한 결과를 나타낸 그래프이다.
도 11은 ICM이 처리된 1차 인간 RPE 세포에 DCA 또는 GM10395를 농도별로 처리하였을 때의 1차 인간 RPE 세포 내 Il-1βIl-6의 mRNA 수준을 비교한 결과를 나타낸 그래프이다.
도 12는 ICM이 처리된 1차 인간 RPE 세포에 DCA를 농도별로 처리하였을 때의 p-PDHE1α 단백질 발현량을 확인한 결과를 나타낸 도면이다.
도 13은 ICM이 처리된 1차 인간 RPE 세포에 GM10395를 농도별로 처리하였을 때의 p-PDHE1α 단백질 발현량을 확인한 결과를 나타낸 도면이다.
도 14는 ICM이 처리된 1차 인간 RPE 세포에 DCA 또는 GM10395를 농도별로 처리하였을 때의 1차 인간 RPE 세포의 OCR을 비교한 결과를 나타낸 그래프이다.
도 15는 ICM이 처리된 1차 인간 RPE 세포에 DCA (10 uM) 또는 GM10395 (1 uM)를 처리하였을 때의 1차 인간 RPE 세포 내 미토콘드리아 과산화물을 비교한 결과를 나타낸 그래프이다. 도 15의 스케일 바의 크기는 50 um이다.
도 16은 ICM이 처리된 1차 인간 RPE 세포에 DCA (10 uM) 또는 GM10395 (1 uM)를 처리하였을 때의 1차 인간 RPE 세포 내 미토콘드리아 면적을 비교한 결과를 나타낸 그래프이다. 도 16의 스케일 바의 크기는 20 um이다.
도 17은 ICM이 처리된 1차 인간 RPE 세포에 DCA 또는 GM10395를 농도별로 처리하였을 때의 1차 인간 RPE 세포 내 Il-1β, Il-6, Il-8Mcp-1의 mRNA 수준을 비교한 결과를 나타낸 그래프이다.
도 18은 ICM이 처리된 1차 인간 RPE 세포에 DCA 또는 GM10395를 농도별로 처리하였을 때 1차 인간 RPE 세포 내 전염증성 사이토카인 IL-6, IL-8 및 MCP-1의 발현량을 비교한 결과를 나타낸 그래프이다.
도 19는 DCA (250 mpk) 또는 GM10395 (1 mpk)가 경구투여된 CNV 마우스의 CNV 병변 등급 (0 내지 2B)을 평가한 결과를 나타낸 도면이다.
도 20은 DCA (250 mpk) 또는 GM10395 (1 mpk)가 경구투여된 CNV 마우스의 CNV 병변 면적을 비교한 결과를 나타낸 도면이다. 도 20의 스케일 바의 크기는 100 um이다.
도 21은 대조약물 (생리식염수)과 GM10395 (1 mpk)가 경구투여된 CNV 마우스로부터 수득된 RPE/맥락막 조직의 p-PDHE1α 단백질 발현량을 비교한 결과를 나타낸 도면이다.
도 22는 대조약물 (생리식염수)과 GM10395 (1 mpk)가 경구투여된 CNV 마우스로부터 수득된 RPE/맥락막 조직의 Il-1β, Il-6Mcp-1의 mRNA 수준을 비교한 결과를 나타낸 그래프이다.
피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 황반변성 (macular degeneration)의 완화, 억제, 예방 또는 치료용 약제학적 조성물.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량)%, 고체/액체는 (중량/부피)%, 그리고 액체/액체는 (부피/부피)%이다.
달리 명시되지 않는 한, 본 명세서에서 사용된 성분, 반응 조건, 성분의 함량을 표현하는 모든 숫자, 값 및/또는 표현은, 이러한 숫자들이 본질적으로 다른 것들 중에서 이러한 값을 얻는 데 발생하는 측정의 다양한 불확실성이 반영된 근사치들이므로, 모든 경우 "약"이라는 용어에 의해 수식되는 것으로 이해되어야 한다.
또한, 본 명세서에서 수치범위가 개시되는 경우, 이러한 범위는 연속적이며, 달리 명시되지 않는 한 이러한 범위의 최소값으로부터 최대값이 포함된 최대값까지의 모든 값을 포함한다.
그리고, 본 명세서 상의 용어 "또는"은 배타적 "또는"이 아니라 내포적 "또는"을 의미하는 것으로 의도된다. 즉, 구성 간의 결합 또는 이용이 달리 특정되지 않거나 문맥상 명확하지 않은 경우, 즉, X가 A를 포함하거나; X가 B를 포함하거나; 또는 X가 A 및 B 모두를 포함하는 경우, "X는 A 또는 B를 포함한다"가 이들 경우들 어느 것으로도 적용될 수 있다.
실시예 1. 결과
레이저-유도 맥락막 혈관신생 (CNV) 모델에서 망막색소상피세포 (RPE) 내 PDK4가 과발현되었다
신생혈관성 AMD에서, 미토콘드리아 대사의 핵심 조절 효소인 PDK를 평가하기 위해, 레이저-유도 CNV 마우스에서의 PDK 및 p-PDHE1α 발현량 변화를 평가하였다. CNV 유도로부터 1일 후, PDK4 및 p-PDHE1α의 발현량은 대조군에 비해 CNV 마우스에서 현저히 증가하였다 (도 1, 표 1 및 도 2, 표 2). 반면, PDK1, PDK2 및 PDK3는 RPE/맥락막에서 증가하지 않았다. 나아가, 면역형광 기법 평가에서, 특히 RPE에서, PDK4 및 p-PDHE1α는 대조군 마우스에 비해 CNV 마우스에서 과발현되었다 (도 3 및 도 4). 대조적으로, 망막 조직에서는 어떠한 PDK 동형 (PDK isoform)도 증가하지 않았다 (도 5 및 표 3). 도 1, 도 2 및 도 5의 그래프의 구체적인 수치를 표 1 내지 표 3에 각각 나타내었다.
상대적 단백질 발현량 대조군 CNV P 값
(P value)
평균 ±평균표준오차 평균 ±평균표준오차
PDK1 1.000 0.03 0.959 0.022 0.3035
PDK2 1.000 0.079 0.747 0.053 0.0289
PDK3 1.000 0.031 0.815 0.043 0.0084
PDK4 1.000 0.057 9.727 0.703 < 0.0001
상대적 발현량 대조군 CNV P 값
(P value)
평균 ±평균표준오차 평균 ±평균표준오차
pPDHE1α (S293)/HSP90 1.000 0.127 2.510 0.265 0.0002
상대적 단백질 발현량 대조군 CNV P 값
(P value)
평균 ±평균표준오차 평균 ±평균표준오차
PDK1 1.000 0.121 1.141 0.062 0.331
PDK2 1.000 0.058 1.002 0.055 0.983
PDK3 1.000 0.143 0.86 0.068 0.402
PDK4 1.000 0.017 1.1 0.079 0.253
이러한 데이터는 RPE의 미토콘드리아 대사가 CNV 유도에 대응하여 변화한다는 것을 나타낸다. 나아가, 동형들 중 PDK4만이 대사 전환에 관여하였다. 망막에서의 PDK4 단백질 수준이 변화하지 않았다는 점이 흥미로웠으며, 이는 신경망막의 에너지 대사가 원래 당분해 (glycolysis)에 의존한다는 종래 연구와 일치하였다.
Pdk4 결핍은 CNV로부터 보호효과를 나타내었다.
신생혈관성 AMD에서 Pdk4의 역할을 평가하기 위해, 야생형 (Pdk4 +/+) 및 Pdk4 녹아웃 (Pdk4 -/-) 마우스의 신생혈관성 표현형을 비교하였다. CNV 유도로부터 7일 후, 임상적으로 심각한 혈관 누출을 보이는 것으로 정의되는 2B 등급 병변의 비율은 야생형 마우스에 비해 Pdk4 녹아웃 마우스에서 현저히 감소하였다 (도 6 및 표 4). 또한, 맥락막 플랫 마운트 기법 평가에서, 야생형에 비해 Pdk4 녹아웃 마우스에서 CNV 병변 크기가 감소하였다 (도 7 및 표 5). 도 6 및 도 7의 그래프의 구체적인 수치를 표 4 및 표 5에 각각 나타내었다.
병변 등급 0 1 2A 2B
대조군 0 24 30 46
PDK4 녹아웃 그룹 24 49 22 5
CNV 병변 면적 야생형 마우스 Pdk4 녹아웃 마우스 P 값
(P value)
평균 ±평균표준오차 평균 ±평균표준오차
21.88 3.338 11.32 1.221 0.0041
이러한 결과는 RPE 내 Pdk4의 유전적 결실이 CNV 마우스에서 신생혈관 작용을 완화하였음을 나타낸다.
동형들 중 Pdk4만이 ICM-유도 OCR 하향조절에 영향을 미쳤다
미토콘드리아 호흡에서의 PDK4의 역할을 뒷받침하기 위해, 일시적으로 48시간동안 siRNA (siPdk1, siPdk2, siPdk3 및 siPdk4)로 형질주입되고 대조약물 (PBS) 또는 염증성 사이토카인 혼합물 (ICM)로 후속 처리된 1차 인간 RPE (primary hRPE)에서의 산소소비량 (OCR)을 비교하였다. 흥미롭게도, Pdk 동형들 중에서, Pdk4 녹다운 그룹만이 기초 (basal), 최대 (maximal) 및 예비 (spare) 산소소비량의 ICM-유도 하향조절에 의해 영향받지 않았다. 나아가, Pdk4 녹다운 그룹만이 다른 Pdk 동형과 비교하여 기초, 최대 및 예비 산소소비량의 현저한 상향조절을 보였다 (도 8 및 표 6). 도 8의 그래프의 구체적인 수치를 표 6에 나타내었다.
기초 OCR 최대 OCR 예비 용량
평균 ±평균표준오차 평균 ±평균표준오차 평균 ±평균표준오차
대조군 56.38 1.573 111.7 4.891 55.34 3.738
ICM 47.41 0.841 62.45 1.627 15.04 1.778
siPDK1 + ICM 46.6 2.243 49.67 3.397 3.072 1.904
siPDK2 + ICM 42.34 3.157 66.08 4.716 23.74 2.534
siPDK3 + ICM 45.13 1.863 71.32 2.712 26.19 2.481
siPDK4 + ICM 61.23 0.438 121.7 3.022 60.51 2.905
이러한 결과는 Pdk 동형들 중 Pdk4만이 세포호흡에 영향을 미치는 미토콘드리아 역학 조절에 중요한 역할을 한다는 것을 나타낸다.
IL-1β 및 MCP-1을 포함하는 염증성 사이토카인은 인간 CNV 조직 및 레이저-유도 CNV 마우스 모델에서 과발현된다. RPE는 풍부한 미토콘드리아에 의해 에너지를 공급받으며 높은 산소 소모가 요구되는, 대사적으로 요구량이 높은 조직이다. 손상된 에너지 대사 및 염증성 조건의 RPE 기능 장애는 AMD의 발달과 진행에 일조할 수 있다. 따라서, ICM-유도 1차 hRPE 세포에서 siRNA (siPdk4)를 이용한 Pdk4의 일시적 녹다운 이후 Pdk4, Il-1β, Il-6, Il-8Mcp-1의 mRNA 수준을 측정하였다. siPdk4는 siControl에 비해 Pdk4, Il-1β, Il-6, Il-8Mcp-1의 ICM-유도 상향조절을 억제하였다 (도 9, 표 7 및 도 10, 표 8). 도 9 및 도 10의 그래프의 구체적인 수치를 각각 표 7 및 표 8에 나타내었다.
Pdk4 평균 ±평균표준오차
siControl 1.000 0.111
siControl + ICM 0.574 0.062
siPDK4 12.682 0.794
siPDK4 + ICM 3.570 0.324
siControl siPDK4 siControl+ICM siPDK4+ICM
Il-1β 평균 1.00 1.17 256.5 133.5
±평균표준오차 0.26 0.05 7.62 7.25
Il-6 평균 1.00 1.8 283.6 247.0
±평균표준오차 0.04 0.12 12.56 3.5
Il-8 평균 1.00 1.02 2761 2162
±평균표준오차 0.02 0.11 76.21 55.81
Mcp-1 평균 1.000 0.6013 9.723 7.658
±평균표준오차 0.025 0.024 0.080 0.101
PDK4를 타겟팅하는 소분자인 GM10395는 ICM-유도 1차 hRPE에서 OXPHOS를 향한 대사 전환을 역전시켰다
디클로로아세테이트 (dichloroacetate, DCA)나 KPLH130과 같은, 범-PDK (pan-PDK) 타겟팅 ATP 결합 포켓의 약리학적 억제는 미토콘드리아 기능장애와 연관된 당뇨병 및 동맥경화증과 같은 다수의 대사 질환에서 조사되었다. 기술적 발달을 기반으로, 히트 안트라퀴논 (hit anthraquinone)의 구조적 변형은 리포아미드 결합 부위에 최적화된 새로운 일련의 알로스테릭 PDK4 억제제의 식별이 가능하도록 하였다. 나아가, 본 발명에서는 잠재적 알로스테릭 PDK4 억제제로서 하기 화학식 1의 구조를 가지는 GM10395를 개발했다.
[화학식 1]
Figure PCTKR2024009001-appb-img-000002
대사 과정에서 DCA의 역할을 살펴보기 위해, 상대적으로 고용량 범위 (0.5 내지 10 mM)의 DCA가 HepG2, C2C12, HEK293, 1차 간세포 (primary hepatocyte) 및 1차 대식세포 (primary macrophage)를 비롯한 다양한 세포주에 사용되었다. 반면, 본 발명에서는 ICM-유도 1차 hRPE 세포에서 1 내지 50 uM 범위의 DCA 유효량을 확인하였다. 상기 데이터는 TGFβ-유도 ARPE 세포를 이용한 종래의 연구와 유사했다. 흥미롭게도, 1차 hRPE 세포에서의 0.5 내지 5 uM의 GM10395 유효량은 DCA보다 낮았으며, 이러한 결과는 CD4+ T세포를 비롯한 다른 세포에서도 유사했다 (도 11 및 표 9).
다음으로, hRPE 세포의 ICM-유도 염증 조건에서 p-PDHE1α가 DCA 또는 GM10395에 의해 용량 의존적인 방식으로 감소하였는지 확인하였다. 흥미롭게도, 특이적인 PDK4 억제제로서의 0.5 uM의 GM10395의 억제적 효과는 범-PDK 억제제로서의 10 uM의 DCA (20배 높음)와 비슷할 수 있었다 (도 12, 표 10 및 도 13, 표 11).
도 11 내지 도 13의 그래프의 구체적인 수치를 각각 표 9 내지 표 11에 나타내었다.
Il-1β Il-6
평균 ±평균표준오차 평균 ±평균표준오차
대조군 1.0 0.3 1.0 0.1
ICM 5 ng/mL 888.9 61.0 454.6 31.7
ICM + DCA
1 uM
626.6 57.3 369.9 4.9
ICM + DCA
10 uM
589.5 12.9 291.1 9.2
ICM + DCA
50 uM
607.5 29.8 304.1 18.1
ICM + DCA
1,000 uM
892.3 41.0 439.7 15.8
ICM + GM10395
0.5 uM
586.4 24.2 272.8 7.0
ICM + GM10395
1 uM
619.6 54.2 248.8 22.2
ICM + GM10395
5 uM
524.8 24.7 246.2 5.0
pPDHE1α/HSP90 평균 ±평균표준오차
대조군 1.000 0.269
ICM 5 ng/mL 3.017 0.618
ICM + DCA 1 uM 2.278 0.385
ICM + DCA 10 uM 0.403 0.064
pPDHE1α/HSP90 평균 ±평균표준오차
대조군 1.000 0.251
ICM 5 ng/mL 2.336 0.182
ICM + GM103950.5 uM 0.244 0.026
ICM + GM103951 uM 0.111 0.003
CNV 병변에서의 신생혈관 표현형은 염증 자극에 의해 활성화되었을 때 PDK4를 통한 RPE의 미토콘드리아 대사에 의해 지배되는 것으로 보인다. 따라서, 염증 조건 하의 대사 재프로그래밍에서의 GM10395의 효과를 평가하기 위해, ICM-유도 1차 hRPE 세포의 OCR이 측정되었다. DCA와 GM10395는 모두 최대 호흡을 증가시켰다. 흥미롭게도, DCA에서 예비 호흡 용량이 증가하지 않은 것에 비해 GM10395에서 용량 의존적으로 예비 호흡 용량이 현저히 증가하였다 (도 14 및 표 12). 도 14의 그래프의 구체적인 수치를 표 12에 나타내었다.
기초 OCR 최대 OCR 예비 용량
평균 ±평균표준오차 평균 ±평균표준오차 평균 ±평균표준오차
대조군 12.540 1.349 15.230 0.661 2.692 1.126
ICM 10.260 0.507 9.690 0.113 -0.573 0.607
ICM + DCA
1 uM
15.710 0.776 14.930 1.098 -0.778 0.966
ICM + DCA
10 uM
20.640 1.618 20.050 0.236 -0.592 1.496
ICM + GM10395 0.5 uM 15.270 1.294 16.100 0.865 0.840 0.730
ICM + GM10395
1 uM
14.900 1.112 19.790 0.141 4.896 1.097
다음으로, 미토콘드리아 산화 스트레스에 대한 약물의 효과를 측정하기 위해, ICM-유도 1차 hRPE 세포에서의 미토콘드리아 과산화물이 평가되었다. 앞선 데이터와 일치하게, ICM에 의한 염증 조건은 미토콘드리아 과산화물을 증가시켰으며, 이는 DCA 및 GM10395에 의해 완화되었다 (도 15 및 표 13). 도 15의 구체적인 수치를 표 13에 나타내었다.
평균 형광 강도 평균 ±평균표준오차
대조군 337.8 1.38
ICM 5 ng/mL 403.6 2.41
ICM + DCA 10 uM 383.4 2.21
ICM + GM10395 1 uM 384.5 1.94
추가적으로, 미토콘드리아 외막 마커인 TOM20을 이용한 염색을 통해 형태학적 미토콘드리아 변화가 평가되었다. 앞선 데이터와 일치하게, ICM에 의한 염증 조건은 1차 hRPE 세포에서 미토콘드리아 질량을 감소시켰으며, 이는 DCA 및 GM10395에 의해 완화되었다 (도 16 및 표 14). 도 16의 구체적인 수치를 표 14에 나타내었다.
세포당 미토콘드리아 면적 (um2) 평균 ±평균표준오차
대조군 332.1 8.741
ICM 5 ng/mL 159.0 5.320
ICM + DCA 10 uM 237.6 9.198
ICM + GM10395 1 uM 272.9 10.750
그리고, GM10395의 항염증 효과를 평가하기 위해, ICM-유도 1차 hRPE 세포에서 DCA 및 GM10395 처리 후의 전염증성 사이토카인의 mRNA 및 단백질 수준을 측정하였다. DCA는 Il-1β, Il-6, Il-8Mcp-1의 ICM-유도 상향조절을 억제하였다 (도 17 및 표 15). 나아가, GM10395는 Il-1β, Il-6, Il-8Mcp-1의 ICM-유도 상향조절을 억제하였다. 추가적으로, DCA 및 GM10395는 IL-6, IL-8 및 MCP-1 단백질 수준의 ICM-유도 상향조절을 억제하였다 (도 18 및 표 16). 도 17 및 도 18의 그래프의 구체적인 수치를 각각 표 15 및 표 16에 나타내었다.
대조군 ICM
5 ng/mL
ICM + DCA 1 uM 1CM + DCA 10 uM 1CM + GM10395 0.5 uM ICM + GM10395 1 uM
Il-1β 평균 1.00 930.9 813.9 613.9 631.9 595.5
±평균표준오차 0.12 32.99 30.09 71.62 18.21 60.10
Il-6 평균 1.00 454.6 369.9 291.1 272.8 248.8
±평균표준오차 0.07 31.66 4.88 9.16 7.01 22.24
Il-8 평균 1.00 6293 5653 4491 4967 4347
±평균표준오차 0.07 375.8 439.1 307.2 102.9 51.22
Mcp-1 평균 1.00 19.35 17.87 13.85 14.84 13.09
±평균표준오차 0.04 0.27 0.43 0.87 0.42 0.45
대조군 ICM
5 ng/mL
ICM + DCA 1 uM 1CM + DCA 10 uM 1CM + GM10395 0.5 uM ICM + GM10395 1 uM
IL-6 평균 149 36600 32990 32038 26637 25830
±평균표준오차 1.753 362.1 329.8 370.8 471.9 505.6
IL-8 평균 27.83 65139 56166 53800 53478 51547
±평균표준오차 3.983 1439 1483 561.3 554.8 640.6
MCP-1 평균 4177 66791 48817 49874 36939 29811
±평균표준오차 67.66 927.7 2458 2239 3227 689.9
PDK4 억제제인 GM10395는 레이저-유도 CNV 모델에서 CNV를 완화하였다
다음으로, PDK 억제제가 RPE에서의 대사 재프로그래밍에 의해 유발되는 염증성 변화를 감소시킴으로써 CNV를 완화하는지 평가하였다. CNV에서의 항-혈관신생 효과를 평가하기 위해, 대조약물, DCA (250 mpk) 및 GM10395 (1 mpk)가 경구투여된 CNV 마우스의 신생혈관 표현형을 비교하였다. CNV 유도로부터 7일 후, 대조약물에 그룹에 비해 DCA 및 GM10395 그룹에서 2B 등급 병변의 비율이 현저히 감소하였다 (도 19 및 표 17). 또한, 맥락막 플랫 마운트 기법 평가에서, 대조 그룹에 비해 DCA 및 GM10395 투여 마우스의 CNV 병변 크기가 감소하였다 (도 20 및 표 18). 도 19 및 도 20의 그래프의 구체적인 수치를 각각 표 17 및 표 18에 나타내었다.
병변 등급 0 1 2A 2B
대조약물 투여 그룹 0 2.4 26.2 71.4
DCA 투여 그룹 1.9 48.1 40.7 9.3
GM10395 투여 그룹 0 59 35.9 5.1
CNV 병변 면적 평균 ±평균표준오차
대조약물 투여 그룹 27.92 4.33
DCA 투여 그룹 16.50 1.87
GM10395 투여 그룹 18.03 2.13
DCA 및 GM10395가 유사한 항-혈관신생 효과를 보일 때, GM10395의 양은 DCA의 250분의 1이었으며, 이는 GM10395의 더 높은 효능을 나타낸다.
그 후, GM10395의 경구투여 이후 p-PDHE1α의 변화를 평가하였으며, 이는 CNV 마우스로부터 수득된 RPE/맥락막 조직의 면역 블로팅 기법으로 평가되었다. p-PDHE1α의 발현은 GM10395 처리에 의해 감소하였고 (도 21 및 표 19), 이는 도 13의 ICM-유도 1차 hRPE 세포에서 GM10395에 의해 p-PDHE1α를 탈인산화시킨 결과와 유사하다. 도 21의 구체적인 수치를 표 19에 나타내었다.
pPDHE1α/HSP90 평균 ±평균표준오차
대조약물 투여 그룹 1.00 0.15
GM10395 투여 그룹 0.32 0.04
추가적으로, RPE/맥락막 조직에서 GM10395 처리 후의 항염증 변화를 평가하기 위해, 레이저-유도 CNV 마우스에서 Il-1β, Il-6Mcp-1의 mRNA 수준을 측정하였다. GM10395 처리 그룹은 CNV 유도로부터 3일 후에 Il-1β, Il-6Mcp-1의 CNV-유도 상향조절을 감소시켰다 (도 22 및 표 20). 도 22의 구체적인 수치를 표 20에 나타내었다.
Il-1β Il-6 Mcp-1
평균 ±평균표준오차 평균 ±평균표준오차 평균 ±평균표준오차
대조약물 투여 그룹 1.000 0.015 1.000 0.228 1.000 0.113
DCA 투여 그룹 3.000 0.303 11.250 0.818 6.858 0.125
GM10395 투여 그룹 1.729 0.141 8.635 0.376 4.816 0.150
실시예 2. 논의
에너지원으로, RPE는 미토콘드리아 OXPHOS (oxidative phosphorylation)에 거의 전적으로 의존하며, 이는 광수용체가 RPE를 통해 맥락막으로부터 운반된 포도당을 사용할 수 있도록 한다. 이 과정은 RPE에서 당분해의 억제를 통해 고도로 조절되며, 이에 따라 포도당을 광수용체를 위한 에너지원으로서 보존한다. 그러나, AMD는 이러한 대사 생태계를 파괴하며, RPE가 에너지 요구량을 유지하기 위해 당분해에 의존하도록 하고, 이는 대사 재프로그래밍으로 지칭된다. 미토콘드리아의 이러한 대사 전환은 AMD의 신생혈관 표현형을 더욱 악화시키는 RPE의 전염증성 환경을 유발한다.
후근신경절에서의 PDK-매개 당분해 대사 전환은 고통스러운 당뇨성 신경병증을 유발하는 전염증성 사이토카인의 과발현으로 이어진다. 나아가, DCA를 통한 약리학적 억제 및 Pdk2/4 결핍은 전염증성 사이토카인 발현을 완화하여 척수의 신경염증을 감소시켰다.
유사하게, RPE 미토콘드리아의 대사 전환은 AMD의 신생혈관 표현형을 악화시키는 전염증성 환경을 야기한다. 그러나, 인간 RPE에서의 대사 재프로그래밍과 CNV의 신생혈관 표현형 사이의 연관성은 아직 연구되지 않았다. 따라서, 본 발명에서는 유전적 제거 및 소분자를 이용하여 연관성을 평가하였고 PDK4 억제제가 미토콘드리아 역학 조절에서의 치료적 타겟임을 확인하였다.
PDK 동형들 중, 면역 블로팅 기법에서 오직 PDK4만이 RPE에서 과발현된 반면 다른 PDK 동형들이 증가되지 않은 것으로 나타났다. 1차 hRPE 세포를 이용한 in vitro 실험은 오직 Pdk4 녹다운만이 OCR 및 전염증성 사이토카인의 ICM-유도 하향조절에 영향을 미치는 반면 다른 Pdk 동형들은 영향을 미치지 않았다는 점을 보여주었다.
피루브산의 구조적 유사체이며 PDK 억제제인 DCA는 신경퇴행성 질환뿐만 아니라 신경교종, 허혈성 뇌질환을 포함하는 다양한 신경질환에 대한 보호 효과를 나타내었다. 그러나, DCA는 말초신경병증의 심각한 전신 부작용을 가지는 것으로 알려져 있으며, 이는 특히 주로 PDK4를 타겟팅하는 대안적인 PDK 억제제의 발견을 요구한다. 따라서, 본 발명에서는 새로운 소분자 GM10395의 효과를 평가하였으며, 이는 미토콘드리아 역학 조절의 측면에서 훨씬 작은 농도로 작용한다.
PDK4를 타겟팅하는 소분자 GM10395는 최대 호흡 및 예비 호흡을 증가시켰다. 흥미롭게, 예비 호흡 용량은 용량 의존적으로 GM10395에 의해 현저히 증가한 반면, DCA에서는 그러한 효과가 나타나지 않았다. 게다가, GM10395는 MitoSOX 염색을 통해 확인된 것과 같이 산화 스트레스를 완화하였고 또한 염증성 조건에 의해 유도되는 미토콘드리아 분열을 완화하였다. 나아가, 미토콘드리아 활성의 강화는 RPE가 산화 손상에 대해 더 잘 회복하도록 하였으며, 이는 RPE 미토콘드리아의 중요한 역할을 뒷받침한다. 종합하면, 본 발명의 데이터는 GM10395가 OXPHOS에서 호기성 당분해로의 대사 재프로그래밍으로부터 RPE를 보호한다는 것을 시사한다.
RPE의 염증성 활성화는 미토콘드리아 역학 및 수반되는 전염증성 사이토카인의 과발현을 변화시킨다. Palsson-McDermott 등은 LPS-유도 대사 재프로그래밍의 억제가 염증성 사이토카인 분비를 완화하였음을 보고하였다. 유사하게, 본 발명에서 GM10395는 용량 의존적으로 전염증성 사이토카인 생산을 억제하였다. 앞선 데이터들은 GM10395가 PDK4를 통한 미토콘드리아 대사를 역전시킴으로써 RPE에서의 염증반응을 완화하였음을 나타내었다.
다음으로, 본 발명에서는 신경염증의 in vivo 패러다임에서의 GM10395의 효과를 살펴보았으며 GM10395가 면역 조절성 RPE 표현형 및 신생혈관 표현형과 관련된 유전자의 발현을 감소시켰음을 확인하였다. 따라서 대사 재프로그래밍을 통한 RPE 표현형의 조절은 반응성 RPE의 직접적인 신경독성 잠재력을 감소시킴으로써 CNV의 임상적 결과를 개선하기 위해 사용될 수 있다.
결론적으로, 본 발명에서는 CNV가 PDK4 및 인산화-PDH (p-PDH)의 발현을 증가시키며, CNV 병변에서의 염증과 함께 당분해 대사 전환을 유발한다는 것을 확인하였다. PDK4의 유전적 제거 및 PDK4 억제제 소분자는 CNV-유도 신경염증을 완화하였다. 종합하면, 이러한 발견들로부터 PDK4 조절을 통한 RPE 대사 조절이 신생혈관성 AMD를 위한 신규 치료 방법으로 활용될 수 있다는 점을 유추할 수 있다.
실시예 3. 방법
동물 실험
모든 실험에서 수컷 C57BL/6J 마우스가 사용되었다. Pdk4 녹아웃 마우스 (Pdk4 -/-) 개체군은 in-house 동물 시설에서 확립되었다. 모든 마우스는 일정한 온도 (22 ℃), 12시간 명암 주기 및 식이 (chow diet)와 식수에 대한 비제한적 접근의 무균 플랫폼에 보관되었다. 7주령의 마우스는 CNV 유도 (0일차) 이전의 -7일차부터 CNV 유도 이후의 +7일차까지 하루에 한 번 경구투여로 디클로로아세테이트 (DCA 250 mg/kg; Sigma-Aldrich, 347795) 또는 GM10395 (1 mg/kg; 1% DMSO/생리식염수 용액에 10 mg/mL의 농도로 희석), 또는 생리식염수가 투여되었다.
레이저-유도 CNV 모델
모든 실험에서 8주령의 수컷 C57BL/6J 마우스가 사용되었다. 슬릿 램프에 부착된 532-nm OcuLight GLx Laser System (IRIDEX Corporation)이 CNV 병변을 생성하기 위해 사용되었다. 종래 연구에 기술된 방법에 따라, 다음의 레이저 파라미터를 이용하여 4 내지 10개의 병변이 생성되었다: 100 mW 출력, 100 um 스팟 크기 및 0.1초의 펄스 지속시간. 광응고 부위의 기포 출현이 브루크막 (Bruch's membrane)의 성공적인 파괴를 의미하였다. RNA 분리 또는 맥락막 플랫 마운트 기법을 위해 망막 및 맥락막 조직이 다양한 시점에서 수집되었다. 마우스는 CNV 유도 (0일차) 이전의 -7일차부터 CNV 유도 이후의 +7일차까지 하루에 한 번 경구투여로 생리식염수, DCA (250 mg/kg), GM10395 (1 mg/kg) 또는 생리식염수가 투여되었다.
플루오레세인 혈관조영술
Micron IV Retinal Imaging Microscope (Phoenix Technology Group, Pleasanton, CA, USA)가 플루오레세인 이미지 촬영에 사용되었다. 마취 및 동공 확장 이후, 0.1 mL 용량의 2% 플루오레세인 나트륨 (Akorn, Lake Forest, IL, USA)을 복강내 주사하고, 3 내지 5분 및 7 내지 10분 후에 StreamPix 소프트웨어를 사용하여 이미지가 획득되었다. 병변의 등급화를 위해 종래에 기술되었던 스킴 (scheme)이 사용되었다: 누출 없이 희미하거나 얼룩덜룩한 형광은 0으로 평가되었고; 크기 또는 강도의 증가가 없는 과형광 (hyperfluorescence)은 1로 평가되었고 (약한 누출); 일정한 크기를 지니지만 강도가 증가하는 과형광은 2A로 평가되었고 (중간 누출); 및 크기와 강도가 모두 증가하는 과형광은 2B로 평가되었다 (임상적으로 심각한 누출).
맥락막 플랫 마운트 기법
CNV 유도 이후 7일차에 (+7일차), 안구가 적출되었고 4% 파라포름알데히드로 30분동안 고정되었다. 맥락막 플랫 마운트를 생성하기 위해 하부 맥락막 및 공막으로부터 망막이 제거되었다. 4 ℃에서 밤새 아이컵 (eyecup)을 염색하기 위해 Alexa Fluor 488-conjugated to isolectin B4 (1:100, Invitrogen, Carlsbad, CA, USA, I21411)가 사용되었다. 그후 PermaFluor aqueous mount (Thermo Scientific, Waltham, MA, USA)가 맥락막이 위를 향하고 공막이 아래를 향하는 아이컵을 플랫 마운트하기 위해 사용되었다. 플랫 마운트 이미지는 LSM 800 with Airyscan detector (Carl Zeiss, Oberkochen, Germany)를 사용하여 촬영되었다. CNV 병변 크기 측정에 ImageJ 소프트웨어가 사용되었고 종래 연구에 기술된 방법에 따라 분석이 이루어졌다.
면역조직학 염색
CNV 유도 이후 1일차에, 적출된 마우스 안구가 실온에서 1시간동안 4% 파라포름알데히드로 고정되었고, 밤새 4 ℃에 30% 수크로스 용액으로 동결보호되었고, OCT 컴파운드에 포매되었다. 안구는 15 um 두께로 동결절편되었다. 면역형광 기법을 위해, 절편들은 블로킹 버퍼 (PBS 내 0.5% 트리톤, 0.2% BSA 및 5% 당나귀 혈청)로 실온에서 1시간동안 블로킹되었고 그후 4 ℃에서 밤새 1차 항체로 인큐베이션되었다. 세척 후, 시료는 실온에서 1시간동안 2차 항체로 인큐베이션되었다. 토끼 항-p-PDHE11α (1:100; MilliporeSigma, Burlington, MA, USA, AP1062), 토끼 항-PDK4 (1:200; Sigma-Aldrich, St. Louis, MO, USA, HPA056731)가 1차 항체로 사용되었고, Alexa Fluor 488-conjugated donkey anti-rabbit antibody (1:500; Thermo Fisher Scientific, Waltham, MA, USA, A21206)가 2차 항체로 사용되었다.
세포 배양
본 발명에서는 5 내지 6계대의 1차 인간 RPE (hRPE) 세포 (Lonza, Walkersville, MD, USA)가 사용되었다. 1차 hRPE 세포는 보충물 (RtEGM Bulletkit; Lonza)을 함유하는 기초 배지에서 배양되었다. 계대배양을 위해 Trypsin/EDTA(CC-5012), Trypsin Neutralizing Solution(CC-5002) 및 HEPES Buffered Saline Solution(CC5022)을 포함한 ReagentPack™ Subculture Reagents(Lonza, CC-5034)를 제조업체의 지침에 따라 사용하였다. 1차 hRPE 세포는 보충제(RtEGM BulletKit; Lonza, 00195409)가 포함된 기본 배지에서 37 ℃ 5% CO2 가습 배양기에서 배양되었다. 1차 hRPE 세포를 각 배양 플레이트에 2% FBS/RtEGM 배지로 접종하고 배지를 24시간 후에 무혈청 RtEGM 배지로 교체하였다. 컨플루언트 1차 hRPE 세포를 세척하고 IL-1β (5 ng/mL), TNF-α (5 ng/mL) 및 IFN-γ (5 ng/mL)를 함유하는 염증성 사이토카인 혼합물 (ICM)을 무혈청 RtEGM 배지에 희석하여 24시간 동안 처리하였다. 인간 재조합 IL-1β (201-LB-010/CF), TNF-α (210-TA-100/CF) 및 IFN-γ (285-IF-100/CF)는 R&D Systems (Minneapolis, MN, USA)에서 구매하였다.
siRNA 형질주입
인간 Pdk1 (5163-1), Pdk2 (5164-1), Pdk3 (5165-1), Pdk4 (5166-2)를 타겟팅하는 사전설계된 siRNA와 siControl (SN-1003)은 바이오니어 (대전, 대한민국)에서 구매되었다. siRNA 형질주입을 위해 사용된 특이적 siRNA의 서열을 표 21에 나타내었다.
서열번호 명칭 서열목록 (5'-> 3')
1 Human siPDK1_Sense GUGUAGAUUAGAGGGAUGU
2 Human siPDK1_Antisense ACAUCCCUCUAAUCUACAC
3 Human siPDK2_Sense GGAAAGGAGUUACACCCGU
4 Human siPDK2_Antisense ACGGGUGUAACUCCUUUCC
5 Human siPDK3_Sense CUAAACACAUAGGAAGUAU
6 Human siPDK3_Antisense AUACUUCCUAUGUGUUUAG
7 Human siPDK4_Sense CUCUUCAGUGCAAUUGGU
8 Human siPDK4_Antisense AACCAAUUGCACUGAAGAG
siRNA 형질주입은 Lipofectamine RNAiMax 및 Opti-MEM (Thermo Fisher Scientific, Waltham, MA, USA)를 이용하여 제조사의 지침에 따라 수행되었다. 간략하게, 1차 인간 RPE (hRPE) 세포가 12-웰 플레이트에서 배양되었고 60 내지 70% 컨플루언시에서 인간 PDK 동형 (siPdk1-4) 및 음성 대조군 (siControl)을 이용하여 형질주입되었다. 이튿날, siRNA-형질주입 1차 hRPE 세포는 24시간동안 ICM으로 처리되었고 그 후 qPCR 및 산소소비량 (OCR) 분석을 위해 수확되었다.
정량적 실시간 중합 연쇄 반응 (qPCR)
제조사의 지침에 따라, QIAzol lysis reagent (Qiagen, Waltham, MA, USA)를 이용하여 총 RNA가 마우스 조직 또는 1차 hRPE 세포로부터 추출되었다. 총 RNA는 cDNA synthesis kit (Thermo Scientific, Waltham, MA, USA)를 사용한 cDNA 합성에 사용되었다. qPCR 분석은 Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA)를 사용하여 ViiA7 real-time PCR system (Applied Biosystems, Hammonton, NJ, USA)로 수행되었다. 실시간 PCR을 위해 사용된 특이적 프라이머의 서열을 표 22에 나타내었다.
서열번호 명칭 서열목록 (5'-> 3')
9 Mouse IL-1β_Forward Primer AGTTGACGGACCCCAAAAGAT
10 Mouse IL-1β_Reverse Primer GTTGATGTGCTGCTGCGAGA
11 Mouse IL-6_Forward Primer AAGTCGGAGGCTTAATTACACATGT
12 Mouse IL-6_Reverse Primer CCATTGCACAACTCTTTTCTCATT
13 Mouse MCP-1_Forward Primer GCATCCACGTGTTGGCTCA
14 Mouse MCP-1_Reverse Primer CTCCAGCCTACTCATTGGGATCA
15 Mouse 36B4_Forward Primer ACCTCCTTCTTCCAGGCTTT
16 Mouse 36B4_Reverse Primer CTCCAGTCTTTATCAGCTGC
17 Human IL-1β_Forward Primer ATGCACCTGTACGATCACTG
18 Human IL-1β_Reverse Primer ACAAAGGACATGGAGAACACC
19 Human IL-6_Forward Primer AGTGAGGAACAAGCCAGAGC
20 Human IL-6_Reverse Primer CAGGGGTGGTTATTGCATCT
21 Human IL-8_Forward Primer GACATACTCCAAACCTTTCCACCC
22 Human IL-8_Reverse Primer CCAGACAGAGCTCTCTTCCATCAG
23 Human MCP-1_Forward Primer CTCATAGCAGCCACCTTCATTC
24 Human MCP-1_Reverse Primer TCACAGCTTCTTTGGGACACTT
25 Human PDK4_Forward Primer GTATGTTCCTCCTCACCTCCATCA
26 Human PDK4_Reverse Primer TGTTGCCCGCATTGCAT
27 Human 36B4_Forward Primer CAACCCAGCTCTGGAGAAAC
28 Human 36B4_Reverse Primer GTGAGGTCCTCCTTGGTGAA
웨스턴 블롯 분석
마우스 조직 또는 1차 hRPE 세포는 phosphatase inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA)를 함유하는 RIPA Buffer (Thermo Scientific, Waltham, MA, USA)로 용해되었다. 단백질 농도는 BCA protein assay (Thermo Scientific, Waltham, MA, USA)를 통해 측정되었다. 용해물은 Nupage 4-12% Bis-Tris Mini Protein Gel (Thermo Scientific, Waltham, MA, USA)을 통해 분리되었고, 용해된 단백질은 PVDF 막 (polyvinylidene difluoride membrane; EMD Millipore, Billerica, MA, USA)으로 옮겨졌다. PVDF 막은 다음의 1차 항체로 면역 블로팅되었다: 항-PDK1 (Enzo Life Sciences, Farmingdale, NY, USA, ADI-KAP-PK112), 항-PDK2 (Abcam, Cambridge, MA, USA, ab68164), 항-PDK3 (Abnova, Taipei, Taiwan, PAB4563), 항-PDK4 (Abcam, Cambridge, MA, USA, ab110336), 항-p-PDHE1α (MilliporeSigma, Burlington, MA, USA, AP1062), 항-피루브산 탈수소효소 (Cell Signaling Technology, Danvers, MA, USA, 2784), 항-열충격단백질 90 (Cell Signaling Technology, Danvers, MA, USA, 4874) 및 항-β-액틴 (Sigma-Aldrich, St. Louis, MO, USA, A5441). 항-열충격단백질 90은 로딩 컨트롤로 사용되었다.
사이토카인 효소면역분석법 (ELISA)
제조사의 지침에 따라, ELISA 키트를 사용하여 세포 배양 배지 내의 인간 IL-6, IL-8 및 MCP-1의 분비 수준이 측정되었다. 인간 IL-6 (88-7066-76) 및 MCP-1 (88-7399-76) 비코팅 ELISA 키트는 Thermo Scientific (Waltham, MA, USA)에서 구매되었다. 인간 IL-8 코팅 ELISA 키트 (D8000C)는 R&D Systeem (Minneapolis, MN, USA)에서 구매되었다. 결과는 시료의 pg/mL로 표현되었다.
산소소비량 측정
OCR은 XFe96 Extracellular Flux Analyzer (Seahorse Biosciences, Billerica, MA, USA)를 이용하여 측정되었다. 1차 hRPE 세포는 세포 배양 플레이트 (6-웰)에 1.4 X 105 세포/웰의 밀도로 시딩되었다. 3일차에, 세포는 DCA 및 GM10395를 포함하거나 포함하지 않는 새로운 무혈청 배지에 희석된 ICM으로 24시간동안 처리되었다 이후, 세포는 분석 배지가 담긴 XFe96 세포 배양 플레이트 (96-웰)로 옮겨졌고, 분석 플레이트는 37 ℃ 5% CO2에서 5시간동안 인큐베이션되었다. 분석 배지는 Seahorse XF 1.0 M Glucose Solution (25 mM), Seahorse XF 100 mM Pyruvate Solution (1 mM) 및 Seahorse XF 200 mM Glutamine Solution (2 mM)으로 보충된 XF DMEM medium pH 7.4 (Agilent TECHNOLOGIES, Santa Clara, CA, USA)로 구성되었다. 억제제 및 짝풀림제는 다음의 농도로 사용되었다: 올리고마이신 A (1 uM, Sigma-Aldrich), FCCP (carbonyl cyanide 4-(trifluoro-methoxy) phenylhydrazone, 1uM, Sigma-Aldrich) 및 로테논 (1 uM, Signa-Aldrich). DAPI 염색된 세포는 세포 수로 정규화하기 위해 ImageXpress Micro Confocal Microscopy (Molecular Devices, San Jose, CA, USA)로 자동 계수되었다.
세포 과산화물 검출
DCA (10 uM) 또는 GM10395 (1 uM)를 포함하거나 포함하지 않는 ICM을 24시간 동안 처리한 1차 hRPE 세포에서의 미토콘드리아 과산화물 형성을 감지하기 위해 MitoSOXTM Red Mitochondrial Superoxide Indicator (Thermo Scientific, Waltham, MA, USA, M36008)가 사용되었다. 1차 hRPE 세포는 black wall/clear bottom 96-well plate (Greiner Bio-One, Kremsmunster, Austria)에 2 X 104 세포/웰의 밀도로 시딩되었다. 실험 말미에, 1차 hRPE 세포는 MitoSOX (5 uM) 및 NucBlueTM Live ReadyProbesTM Reagent (Hoechst 33342) 용액 (Thermo Scientific, Waltham, MA, USA, R376505)을 함유하는 PBS에서 37 ℃에서 10분간 인큐베이션되었다. 미토콘드리아 과산화물 이미지는 공초점 모드 (60 um 핀홀 스피닝)에서 ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) 및 10X Plan Fluor objective를 사용하여 획득되었다. 이미지 평면은 DAPI 및 TRITC를 이용하여 수득되었다. 평균형광강도는 ImageXpress Micro Confocal Microscopy (Molecular Devices, San Jose, CA, USA)를 통해 자동 정량화되었다.
미토콘드리아 형태의 면역형광 기법
1차 hRPE 세포는 black wall/clear bottom 96-well plate (Greiner Bio-One, Kremsmunster, Austria)에 6 X 103 세포/웰의 밀도로 시딩되었다. 실험 말미에, 1차 hRPE 세포는 4% 파라포름알데히드로 고정되었고 이후 0.1% Triton X-100 및 0.1 M 글리신을 포함하는 PBS에서 투과화 (permeabilization)되었다. PBS로 세척 후, 세포는 4 ℃에서 밤새 TOM20 (translocase of outer mitochondrial membrane 20)에 대한 1차 항체 (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc-11415)로 인큐베이션되었다. Alexa Fluor 594-conjugated donkey anti-rabbit antibody (1:100; Thermo Fisher Scientific, Waltham, MA, USA, A21207)가 2차 항체로 사용되었고 실온에서 2시간동안 인큐베이션되었다. 핵은 DAPI 용액 (Thermo Fisher, Waltham, MA, USA, 62248)으로 염색되었다. 1차 hRPE 세포의 이미지는 공초점 모드 (60 um 핀홀 스피닝)에서 ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) 및 60X Plan Fluor objective를 사용하여 획득되었다. DAPI 및 Texas Red를 이용하여 이미지 평면간 0.4 mm인 2.4 mm z-스택이 획득되었다. 최대 강도를 나타내기 위해 2차원 투영 (2-dimensional projection)이 생성되었고 MetaXpress (Molecular Devices)를 사용하여 명확한 미토콘드리아 구조를 제공하기 위해 "Flatten Background" 기능을 사용하여 처리되었다. 각 세포의 미토콘드리아 면적은 ImageJ 소프트웨어에 Fiji plugin (NIH)을 사용하여 정량화되었다. 총 미토콘드리아 면적 윤곽은 로우패스 필터링된 이미지 (low-pass filtered image)의 임계값을 지정 (thresholding)함으로써 결정되었다. 세포 수준에서 형광 강도를 분석하기 위해 이미지 처리 소프트웨어를 사용하여 개별 세포에 ROI (관심 영역)를 적용하여 형광 픽셀을 정량화하였다. 각 이미지에서 얻은 전체 형광 강도의 합계를 해당 이미지의 세포 수로 나누어 평균 세포 형광 강도를 얻었다. 통계 분석을 위해, 각 이미지에서 분석된 세포 수에 따라 세포당 형광 강도 값이 복제되고 이러한 값들을 기반으로 평균과 평균 표준 오차(SEM)를 계산하였다.
통계
데이터는 Prism v. 6.0 (GraphPad Software, San Diego, CA, USA)를 사용하여 제시되었고, 통계적 분석은 IBM SPSS Statistics v. 21.0 (SPSS Inc., Chicago, IL, USA)을 사용하여 수행되었다. 결과들은 평균 ± 평균의 표준오차 (mean ± SEM)로 표현된다. 두 그룹을 비교하기 위해 2-표본 t-검정이 사용되었다. 다중그룹 비교는 터키 다중 비교 (Tukey's multiple comparison)가 수반되는 일원 분산 분석 (one-way ANOVA) 또는 이원 분산 분석 (two-way ANOVA)을 통해 수행되었다. 통계적 유의성은 P<0.05로 정의되었다.
연구 승인
모든 마우스 실험은 미국안과학회 (the Association for Research in Vision and Ophthalmology)의 눈과 시력연구에서의 동물사용에 관한 원칙 (Statement for the Use of Animals in Ophthalmic and Vision Research)의 가이드라인을 준수하였으며 경북대학교 동물실험윤리위원회로부터 승인되었다 (승인번호 2019-0104-1).
이상에서 대표적인 실시예를 통하여 본 발명을 상세하게 설명하였으나, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 상술한 실시예에 대하여 본 발명의 범주에서 벗어나지 않는 한도 내에서 다양한 변형이 가능함을 이해할 것이다. 그러므로 본 발명의 권리 범위는 설명한 실시예에 국한되어 정해져서는 안 되며, 후술하는 특허청구범위뿐만 아니라 특허청구범위와 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태에 의하여 정해져야 한다.
본 발명의 목적은 황반변성 (macular degeneration)의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 황반변성의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 신생혈관성 안질환 (neovascular ocular disease)의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 신생혈관성 안질환 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 황반변성 치료방법을 제공하는 것이다.
본 발명의 또 다른 목적은 신생혈관성 안질환 치료방법을 제공하는 것이다.
본 발명의 또 다른 목적은 PDK 저해제의 신규한 용도를 제공하는 것이다.

Claims (13)

  1. 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 황반변성 (macular degeneration)의 완화, 억제, 예방 또는 치료용 약제학적 조성물.
  2. 제1항에 있어서, 상기 피루브산 탈수소효소 키나아제 저해제는 피루브산 탈수소효소 키나아제 4 (PDK4) 저해제인 것인, 조성물.
  3. 제2항에 있어서, 상기 피루브산 탈수소효소 키나아제 4 저해제는 하기 화학식 1로 표현되는 GM10395 또는 이의 염 (salts)을 포함하는 것인, 조성물:
    [화학식 1]
    Figure PCTKR2024009001-appb-img-000003
    .
  4. 제1항에 있어서, 상기 황반변성은 나이관련 황반변성 (age-related macular degeneration; AMD)인 것인, 조성물.
  5. 제4항에 있어서, 상기 나이관련 황반변성은 후기 나이관련 황반변성 (late age-related macular degeneration; late AMD)인 것인, 조성물.
  6. 제4항에 있어서, 상기 나이관련 황반변성은 신생혈관성 나이관련 황반변성 (Neovascular age-related macular degeneration; Neovascular AMD)인 것인, 약제학적 조성물.
  7. 제1항에 있어서, 상기 약제학적 조성물은 안구내, 안구주위, 안구뒤, 망막하 (subretinal), 망막중심 (central retinal), 중심와 (fovea) 외부, 결막하 (subconjunctival), 유리체내 (intravitreal), 전방내 (intracameral) 또는 맥락막위 (suprachoroidal)에 투여되는 것인, 약제학적 조성물.
  8. 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 황반변성 (macular degeneration)의 완화, 억제 또는 개선용 식품 조성물.
  9. 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 신생혈관성 안질환 (neovascular ocular disease)의 완화, 억제, 예방 또는 치료용 약제학적 조성물.
  10. 제9항에 있어서, 상기 피루브산 탈수소효소 키나아제 저해제는 피루브산 탈수소효소 키나아제 4 (PDK4) 저해제인 것인, 조성물.
  11. 제10항에 있어서, 상기 피루브산 탈수소효소 키나아제 4 저해제는 하기 화학식 1로 표현되는 GM10395 또는 이의 염 (salts)을 포함하는 것인, 조성물:
    [화학식 1]
    Figure PCTKR2024009001-appb-img-000004
    .
  12. 제9항에 있어서, 상기 신생혈관성 안질환은 각막혈관신생 (corneal neovascularization), 망막 혈관신생 (retinal neovascularization), 맥락막 혈관신생 (choroidal neovascularization), 안구내 혈관신생 (intraocular neovascularization), 신생혈관성 녹내장 (neovascular glaucoma), 증식성 당뇨병성 망막증 (proliferative diabetic retinopathy), 신생혈관성 황반변성 (neovascular macular degeneration) 또는 미숙아 망막병증 (retinopathy of prematurity)인 것인, 조성물.
  13. 피루브산 탈수소효소 키나아제 (pyruvate dehydrogenase kinase; PDK) 저해제를 포함하는, 신생혈관성 안질환 (neovascular ocular disease)의 완화, 억제 또는 개선용 식품 조성물.
PCT/KR2024/009001 2023-06-30 2024-06-27 피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물 Ceased WO2025005691A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020230085045A KR20250004472A (ko) 2023-06-30 2023-06-30 피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물
KR10-2023-0085045 2023-06-30

Publications (1)

Publication Number Publication Date
WO2025005691A1 true WO2025005691A1 (ko) 2025-01-02

Family

ID=93939338

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/009001 Ceased WO2025005691A1 (ko) 2023-06-30 2024-06-27 피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20250004472A (ko)
WO (1) WO2025005691A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010041748A1 (ja) * 2008-10-10 2010-04-15 日本たばこ産業株式会社 フルオレン化合物及びその医薬用途
WO2014142291A1 (ja) * 2013-03-15 2014-09-18 日本たばこ産業株式会社 フルオレン化合物の水和物、およびその結晶
KR101711732B1 (ko) * 2014-04-30 2017-03-02 경북대학교 산학협력단 3-아릴-1,2,4-트라이아졸 유도체 및 이의 용도
KR101749380B1 (ko) * 2014-06-13 2017-06-21 경북대학교 산학협력단 Pdk 억제제의 스크리닝 방법 및 pdk 억제제의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010041748A1 (ja) * 2008-10-10 2010-04-15 日本たばこ産業株式会社 フルオレン化合物及びその医薬用途
WO2014142291A1 (ja) * 2013-03-15 2014-09-18 日本たばこ産業株式会社 フルオレン化合物の水和物、およびその結晶
KR101711732B1 (ko) * 2014-04-30 2017-03-02 경북대학교 산학협력단 3-아릴-1,2,4-트라이아졸 유도체 및 이의 용도
KR101749380B1 (ko) * 2014-06-13 2017-06-21 경북대학교 산학협력단 Pdk 억제제의 스크리닝 방법 및 pdk 억제제의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LAMBERT, V. ET AL.: "Pyruvate dehydrogenase kinase/lactate axis: A therapeutic target for neovascular age- related macular degeneration identified by metabolomics.", JOURNAL OF MOLECULAR MEDICINE, vol. 98, 2020, pages 1737 - 1751, XP037300038, DOI: 10.1007/s00109-020-01994-9 *

Also Published As

Publication number Publication date
KR20250004472A (ko) 2025-01-08

Similar Documents

Publication Publication Date Title
WO2018101708A1 (ko) 미토콘드리아를 포함하는 약학 조성물
Hernandez et al. Crosstalk between transforming growth factor beta-2 and toll-like receptor 4 in the trabecular meshwork
WO2021010621A1 (ko) 자가면역질환 및 염증성질환 펩타이드 치료제
WO2018097628A2 (ko) 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
WO2020235954A1 (en) Administration method and dosage regimen for treatment of neurodegenerative diseases using trametinib and markers
WO2025005691A1 (ko) 피루브산 탈수소효소 키나아제 저해제를 포함하는 황반변성 예방 또는 치료용 조성물
WO2009151304A2 (ko) 에이케이에이피일이를 함유하는 조성물 및 동물 모델로서 에이케이에이피일이 돌연변이 제브라피쉬의 용도
Sinha-Hikim et al. Involvement of c-Jun NH2-terminal kinase and nitric oxide-mediated mitochondria-dependent intrinsic pathway signaling in cardiotoxin-induced muscle cell death: role of testosterone
WO2013051767A1 (ko) 안지오제닌의 신규 용도
WO2025080080A1 (ko) Pdk 억제제를 유효성분으로 포함하는, 파킨슨병의 예방 또는 치료용 약학적 조성물
AU2017267166B2 (en) Pharmaceutical composition containing keratin 8 phosphorylation inhibitor for preventing or treating macular degeneration, and method for screening macular degeneration medicine
Aoshima et al. ALK5 inhibitor acts on trabecular meshwork cell and reduces intraocular pressure
WO2017099424A1 (en) Novel dihydropyranopyrimidinone derivatives, and use thereof
WO2024215162A1 (ko) 단일 융합 단백질 및 이를 포함하는 약학적 조성물
WO2022080849A1 (ko) Acta2 억제제를 유효성분으로 포함하는 망막 또는 맥락막 질환 치료용 조성물
WO2025263978A1 (ko) 낭성콩팥병 개선 또는 치료용 조성물 및 이의 용도
WO2022124795A1 (ko) 트라메티닙 및 선택적으로 파르네소이드 x 수용체 작용제를 포함하는 대사성 또는 담즙정체성 간질환의 예방 또는 치료용 약학적 조성물
WO2018026150A1 (en) Pharmaceutical composition for prevention or treatment of neurodegenerative diseases
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2025053611A1 (ko) Pdk3 저해제를 포함하는 말초신경종양 예방 또는 치료용 약학 조성물 및 이의 용도
WO2025188077A1 (ko) Dusp22 억제제를 포함하는 근감소증의 치료 또는 예방용 약학 조성물
WO2024096629A1 (ko) Cftr 조절제 화합물을 포함하는 점안용 조성물
WO2025053613A1 (ko) Ilk 저해제를 포함하는 말초신경종양 예방 또는 치료용 약학 조성물 및 이의 용도
WO2025249993A1 (ko) 암 질환 치료용 조성물 및 이의 스크리닝 방법
WO2024225727A1 (ko) Prdx3를 유효성분으로 포함하는 미토콘드리아 관련 질환 예방 또는 치료용 조성물 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24832468

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE