WO2024248367A1 - 단백질 고효율 발현용 mRNA 구조체 플랫폼 - Google Patents

단백질 고효율 발현용 mRNA 구조체 플랫폼 Download PDF

Info

Publication number
WO2024248367A1
WO2024248367A1 PCT/KR2024/006580 KR2024006580W WO2024248367A1 WO 2024248367 A1 WO2024248367 A1 WO 2024248367A1 KR 2024006580 W KR2024006580 W KR 2024006580W WO 2024248367 A1 WO2024248367 A1 WO 2024248367A1
Authority
WO
WIPO (PCT)
Prior art keywords
base sequence
mrna
utr
cells
globin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2024/006580
Other languages
English (en)
French (fr)
Inventor
조성찬
조민주
김세영
정민선
함영욱
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority to EP24815745.5A priority Critical patent/EP4722367A1/en
Publication of WO2024248367A1 publication Critical patent/WO2024248367A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/60—Vector systems having a special element relevant for transcription from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/60—Vectors comprising a special translation-regulating system from viruses

Definitions

  • the present invention relates to an mRNA structure platform capable of expressing a protein with high efficiency.
  • mRNA vaccines which are classified as a relatively new strategy, have been approved for use in the shortest period of time and are still being administered.
  • the mRNA vaccine is a nucleic acid-based vaccine that strengthens adaptive immunity by using artificially synthesized mRNA (messenger RNA, a blueprint containing antigen protein information).
  • mRNA containing the viral antigen gene is synthesized in vitro, purified to a high purity, and wrapped in LNP (lipid nanoparticle) and administered to the human body.
  • LNP lipid nanoparticle
  • SARS-CoV-2 is an RNA virus, many mutations occur naturally during the replication process. If a mutation occurs in the area where neutralizing antibodies act, the neutralizing antibodies will not work, which can reduce or eliminate the effectiveness of the vaccine.
  • the mRNA is currently being actively applied to develop vaccines for not only infectious diseases but also cancer, and it is expected that its scope of application will expand in the future to develop treatments for various rare genetic diseases and incurable diseases.
  • This method delivers disease-causing genes to cells and living organisms in the form of mRNA to supplement the amount or activity of proteins, thereby producing a therapeutic effect. It is the most suitable method for monogenic diseases, which are hereditary diseases caused by defects in a single gene, among which a correlation with the disease has been clearly verified, is caused by a decrease in the amount or activity of a gene.
  • AAV adeno-associated virus
  • Representative examples include Zolgensma for spinal muscular atrophy, Zynteglo for anemia, and Hemgenix for hemophilia, all of which are astronomical in price, at 2.5-4.5 billion won per dose.
  • the packaging capacity of AAV vectors is limited, which limits the size of the gene, and it is still recognized as a limitation, such as an unrealistically high drug price, a significant immune response, and the inability to produce efficacy in patients exposed to the AAV virus due to the formation of neutralizing antibodies.
  • mRNA-based therapeutics have the advantage of theoretically having no restrictions on the size of the applicable gene, high safety, relatively low drug prices due to economical pharmaceutical production, and no restrictions on patient groups, which can complement the weaknesses of AAV-based therapeutics.
  • mRNA-based therapeutics in order for mRNA to be successful as a therapeutic, it is essential to express the disease gene at a high level and continuously express it for a long period of time. This is because, unlike vaccines that express sufficient antigens with a single administration and form immune memory through an immune response in the body, in the case of therapeutics, it is important to continuously express the disease protein at a high level to achieve a therapeutic effect.
  • One object of the present invention is to provide a novel mRNA structure that can be applied as a platform capable of expressing a target protein with high efficiency.
  • Another object of the present invention is to provide a pharmaceutical composition comprising the novel mRNA structure.
  • one aspect of the present invention provides an mRNA structure including: a base sequence encoding a target protein; a base sequence of a 3'-UTR of ⁇ -globin arranged downstream of the base sequence encoding the target protein; and a base sequence including a repeating unit of (A 60 G)n arranged downstream of the base sequence of the 3'-UTR of ⁇ -globin (wherein, n is an integer from 1 to 3).
  • the above mRNA structure may further include a base sequence derived from black beetle virus (BBV) or peste destrade ruminants virus (PPRV) located upstream of the base sequence encoding the target protein.
  • BBV black beetle virus
  • PPRV destrade despoorinants virus
  • the above mRNA structure may further include a base sequence of an IRES (internal ribosome entry site) of EMCV (encephalomyocaditis virus) between the downstream of the base sequence encoding the target protein and the upstream of the base sequence of the 3’-UTR of ⁇ -globin.
  • IRES internal ribosome entry site
  • EMCV encephalomyocaditis virus
  • another aspect of the present invention provides a pharmaceutical composition comprising the mRNA structure.
  • the above pharmaceutical composition may be a vaccine or a gene therapy agent.
  • the mRNA structure newly designed and derived in the present invention has a much superior expression efficiency in cells compared to the mRNA structures commercialized previously by Moderna or Pfizer-BioNTech, and thus has the advantage of being usefully applied as a platform technology that can be widely utilized in the development of mRNA-based vaccines or therapeutics.
  • Figure 1 shows the design of mRNA constructs by applying the base sequences of various cellular genes to 3'-UTRs to derive optimal 3'-UTRs (A), the results of measuring nanoluciferase activity over time after transfecting these mRNA constructs into 293T cells (B), and the results of analyzing the change in relative activity by correcting the nanoluciferase activity to the 12-hour result (C).
  • Figure 2 shows the results of designing mRNA structures by applying various viral-derived base sequences to 3'-UTRs to derive the optimal 3'-UTR (A), measuring the activity of nanoluciferase over time after transfecting 293T cells with these mRNA structures (B), and analyzing the change in relative activity by correcting the activity of the nanoluciferase to the 12-hour result (C).
  • Figure 3 shows the design of mRNA structures by applying a base sequence in which guanines are inserted in various numbers and intervals into the poly (A) tail to derive the optimal poly (A) tail (A), the results of measuring the activity of nanoluciferase over time after transfecting these mRNA structures into 293T cells (B), and the results of analyzing the change in relative activity by correcting the activity of the nanoluciferase to the 12-hour result (C).
  • Figure 4 shows the results of designing mRNA constructs by applying the base sequence of the 3'-UTR of ⁇ -globin or the base sequence of the IRES of EMCV alone or in combination to the 3'-UTR and applying A 60 G 2 as a poly(A) tail (A), measuring the activity of nanoluciferase over time after transfecting these mRNA constructs into 293T cells (B), and analyzing the change in relative activity by correcting the activity of the nanoluciferase to the 12-hour result (C).
  • Figure 5 shows the design of mRNA constructs by applying a combination of the base sequence of the 3'-UTR of ⁇ -globin or the base sequence of the IRES of EMCV and the base sequence of the 3'-UTR of ⁇ -globin to the 3'-UTR to derive the optimal 5'-UTR, applying A 60 G 2 as a poly (A) tail, and applying various base sequences to the 5'-UTR (A), and the results of measuring the activity of nanoluciferase over time after transfecting these mRNA constructs into 293T cells (B) and analyzing the change in relative activity by correcting the activity of the nanoluciferase to the 12-hour result (C).
  • Figure 6 shows the results of measuring the activity of nanoluciferase over time after selecting three mRNA structures (CJ-1, BBV+ ⁇ G+A 60 G 2; CJ-2, PPRV+ ⁇ G+A 60 G 2; CJ-3, BBV+EMCV+ ⁇ G+A 60 G 2 ) showing the highest expression efficiency in Figure 5, additionally producing mRNA structures used by Moderna and Pfizer-BioNTech in the development of a coronavirus mRNA vaccine (A), and transfecting these mRNA structures into THP-1 cells, which are monocytic immune cells (B), mouse DC2.4 cells, which are dendritic cell lines (C), and cells activated with LPS (Activated DC2.4 Cells) (D).
  • B monocytic immune cells
  • C dendritic cell lines
  • LPS Activated DC2.4 Cells
  • Figure 7 shows the results of measuring nanoluciferase activity over time after transfection of three types of mRNA constructs (CJ-1, CJ-2, and CJ-3) into representative mouse muscle cells, C2C12 cells (A), representative hepatocytes, Huh-7 cells (B), representative lung cells, A549 cells (C), representative retinal cells, AREP-19 cells (D), representative neural cells, SH-SY5Y cells (ATCC) and Neuro-2a cells (ATCC), and 293T cells.
  • CJ-1, CJ-2, and CJ-3 representative mouse muscle cells
  • C2C12 cells A
  • representative hepatocytes Huh-7 cells
  • B representative lung cells
  • A549 cells C
  • representative retinal cells representative retinal cells
  • AREP-19 cells D
  • representative neural cells SH-SY5Y cells (ATCC) and Neuro-2a cells (ATCC), and 293T cells.
  • Figure 8 shows the results of measuring nanoluciferase activity over time (C) after transfection of three types of mRNA constructs (CJ-1, CJ-2, CJ-3) into 293T cells (A), HepG2 cells (B), which are another representative hepatocyte, and SH-SY5Y cells (C) and Neuro-2a cells (D), which are representative neural cells.
  • One aspect of the present invention provides a novel mRNA construct.
  • the mRNA structure of the present invention comprises a base sequence encoding a target protein; a base sequence of a 3'-UTR (3'-untranslated region) of ⁇ -globin; and a base sequence including a repeating unit of (A 60 G) n .
  • the above target protein refers to a target protein to be expressed through the mRNA structure of the present invention.
  • the above target protein may refer to a protein that is directly translated and expressed from the mRNA structure of the present invention by the cell's own translation system after the mRNA structure of the present invention is introduced into the cell.
  • the 'base sequence encoding the target protein' included in the mRNA structure of the present invention may refer to a CDS (coding sequence) that is composed of only exons with introns removed and can be directly translated and produced as a target protein.
  • the above ⁇ -globin is a human HBZ gene, one of five genes belonging to the human ⁇ -globin gene cluster.
  • the base sequence of the 3'-UTR of the above ⁇ -globin refers to the base sequence of the 3'-UTR included in the mRNA produced in the process of expressing the human HBZ gene.
  • the base sequence of the 3'-UTR of the above ⁇ -globin may include the base sequence of SEQ ID NO: 6 or a variant thereof, and specifically, the base sequence of the 3'-UTR of the above ⁇ -globin may be composed of the base sequence of SEQ ID NO: 6 or a variant thereof.
  • the variant of the base sequence of the above sequence number 6 means, but is not limited to, those having a sequence homology of 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more to the base sequence of the above sequence number 6, and means all base sequences that have the function of improving the stability and expression efficiency of mRNA, like the base sequence of the above sequence number 6.
  • the base sequence of the 3’-UTR of the above ⁇ -globin can be positioned downstream of the base sequence encoding the target protein, and in particular, can be operably linked to the base sequence encoding the target protein.
  • the base sequence including the repeating unit of (A 60 G) n is a variant of the poly (A) tail, and the base sequence including the repeating unit of (A 60 G) n may have a length of 115 nt to 125 nt, for example, may have a length of 117 nt to 123 nt, and in particular, the base sequence including the repeating unit of (A 60 G) n may have a length of 121 nt. Accordingly, n may be an integer of 1 to 3, for example, may be an integer of 1 to 2, and in particular, n may be 1. Specifically, the base sequence including the repeating unit of (A 60 G) n may be a base sequence of SEQ ID NO: 21 (A 57 GA 60 GAA).
  • the base sequence including the repeating unit of (A 60 G) n can be positioned downstream of the base sequence of the 3'-UTR of the ⁇ -globin, and in particular can be operably linked to the base sequence encoding the target protein and the base sequence of the 3'-UTR of the ⁇ -globin.
  • the mRNA structure of the present invention may further include a base sequence of a 5'-UTR of BBV (black beetle virus) or a base sequence of a 5'-UTR of PPRV (peste des detrimental ruminants virus).
  • the base sequence of the 5'-UTR of BBV is a sequence derived from a virus that infects black beetles and is present upstream of a coding sequence, thereby improving protein translation efficiency.
  • the base sequence of the 5'-UTR of BBV is much shorter than the IRES base sequence known as a Cap-independent translation mechanism, but exhibits high protein translation efficiency.
  • the PPRV belongs to the Morbillivirus genus of the Paramyxoviridae family, and is a pseudoruddy ruddy disease virus that mainly infects goats and sheep. It is estimated that the base sequence of the 5'-UTR of the above PPRV is present upstream of the F gene of PPRV and binds complementarily to 18S rRNA, thereby enhancing protein translation efficiency.
  • the base sequence of the 5’-UTR of the above BBV may include the base sequence of SEQ ID NO: 24 or a variant thereof, and specifically, the base sequence of the 5’-UTR of the BBV may be composed of the base sequence of SEQ ID NO: 24 or a variant thereof.
  • the base sequence of the 5’-UTR of the PPRV may include the base sequence of SEQ ID NO: 25 or the base sequence of SEQ ID NO: 26 or a variant thereof, and specifically, the base sequence of the 5’-UTR of the PPRV may be composed of the base sequence of SEQ ID NO: 25 or the base sequence of SEQ ID NO: 26 or a variant thereof.
  • the variant of the base sequence of the above sequence number 24, 25 or 26 means, but is not limited to, those having a sequence homology of 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more to the base sequence of the above sequence number 24, 25 or 26, and means all base sequences that have the function of improving the stability and expression efficiency of mRNA, like the base sequence of the above sequence number 24, 25 or 26.
  • the base sequence of the 5’-UTR of the above BBV or the base sequence of the 5’-UTR of the PPRV can be positioned upstream of the base sequence encoding the target protein, and in particular, can be operably linked to the base sequence encoding the target protein.
  • the mRNA structure of the present invention may further include a base sequence of an IRES (internal ribosome entry site) of EMCV (encephalomyocaditis virus).
  • the base sequence of the IRES of EMCV may be composed of a base sequence of SEQ ID NO: 13 or a mutant thereof.
  • the mutant of the base sequence of SEQ ID NO: 13 means those having a sequence homology of 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more with the base sequence of SEQ ID NO: 13, but is not limited thereto, and means all base sequences that have the function of improving the stability and expression efficiency of mRNA, like the base sequence of SEQ ID NO: 13.
  • the base sequence of the IRES of the EMCV can be positioned between the downstream of the base sequence encoding the target protein and the upstream of the base sequence of the 3'-UTR of the ⁇ -globin, and in particular, can be operably linked to the base sequence encoding the target protein and the base sequence of the 3'-UTR of the ⁇ -globin.
  • the mRNA construct of the present invention configured as described above has excellent stability and expression efficiency within cells, and thus has the effect of maintaining a high expression state within cells for a long period of time even after transfection.
  • novel mRNA construct of the present invention exhibits high expression efficiency in cells and thus can be transfected into cells for expression of a target protein.
  • novel mRNA construct of the present invention which can be transfected into cells as described above, can be used as an effective ingredient of a pharmaceutical composition depending on the target protein.
  • the pharmaceutical composition containing the mRNA structure of the present invention may be a vaccine.
  • the target protein derived from a virus or bacteria is expressed with high efficiency by the novel mRNA structure in the subject into which the pharmaceutical composition of the present invention is injected, and the virus or bacteria derived protein thus expressed is recognized as an antigen in the subject and induces an immune response, thereby acting as a vaccine.
  • the pharmaceutical composition containing the mRNA construct of the present invention may be a gene therapy agent.
  • the causal protein deficient in the specific disease, which is the target protein is expressed with high efficiency by the novel mRNA construct in the subject into which the pharmaceutical composition of the present invention has been injected, and the specific disease can be treated by complementing the deficiency of the causal protein through the high-efficiency expression of the causal protein. Therefore, any disease that can be treated by complementing the deficient gene can be treated by the pharmaceutical composition of the present invention without any particular limitation.
  • the diseases most suitable for application as the above gene therapy include monogenic genetic diseases caused by a single gene defect, such as spinal muscular atrophy (SMA), a rare neuromuscular disease, and cystic fibrosis (CF), Duchenne muscular dystrophy (DMD), Friedreich's ataxia (FA), hemophilia, Rett Syndrome, Fabry disease, sickle cell disease, etc.
  • SMA spinal muscular atrophy
  • CF cystic fibrosis
  • DMD Duchenne muscular dystrophy
  • FA Friedreich's ataxia
  • hemophilia Fabry disease
  • Fabry disease Fabry disease
  • sickle cell disease etc.
  • the mRNA construct of the present invention consistently exhibits high expression efficiency regardless of various cell types such as muscle cells, liver cells, lung cells, ocular cells, and nerve cells, it can be applied to various cells that may induce various diseases. Therefore, when the mRNA construct of the present invention is used as an effective ingredient of the gene therapy agent as described above, it has the advantage of ensuring a much better therapeutic effect compared to when using the existing mRNA constructs of Moderna or Pfizer-BioNTech.
  • the pharmaceutical composition may further include a delivery means for delivering the mRNA structure of the present invention.
  • Representative examples of the above delivery means include nanoparticles such as liposomes or LNPs (lipid nanoparticles), and the liposomes or LNPs include cationic lipids, non-cationic lipids, or neutral lipids, and may additionally include other lipids such as PEG (polyethylene glycol) or cholesterol.
  • nanoparticles such as liposomes or LNPs (lipid nanoparticles)
  • the liposomes or LNPs include cationic lipids, non-cationic lipids, or neutral lipids, and may additionally include other lipids such as PEG (polyethylene glycol) or cholesterol.
  • exosomes may also be used as the nanoparticles that serve as the above delivery means, and as another delivery means, cationic biocompatible polymers or cationic peptides (e.g., protamine, cell penetrating peptides (CPPs), etc.) that can provide improved stability by electrostatically interacting with the mRNA structure of the present invention may be used, but the present invention is not limited thereto, and any and all means known in the technical field to which the present invention pertains that can deliver the mRNA structure may be used.
  • cationic biocompatible polymers or cationic peptides e.g., protamine, cell penetrating peptides (CPPs), etc.
  • CPPs cell penetrating peptides
  • the pharmaceutical composition may further comprise one or more pharmaceutically acceptable carriers.
  • the pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention, and may be used as a mixture of saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components, and may further comprise other conventional additives such as antioxidants, buffers, and bacteriostatic agents, as needed.
  • a diluent, a dispersant, a surfactant, a binder, and a lubricant may be additionally added to formulate the composition into an injectable formulation such as an aqueous solution, a suspension, or an emulsion.
  • an injectable formulation such as an aqueous solution, a suspension, or an emulsion.
  • a method commonly known in the art to which the present invention pertains can be used to prepare a lyophilized formulation, and a stabilizer for lyophilization may be added.
  • it can be preferably formulated according to each disease or ingredient using an appropriate method in the field or a method disclosed in Remington's pharmaceutical Science (Mack Publishing company, Easton PA).
  • the content and administration method of the active ingredients, etc. included in the above pharmaceutical composition can be determined by a general expert in the art based on the symptoms and severity of the disease of a typical patient.
  • it can be formulated in various forms such as powder, tablet, capsule, liquid, injection, ointment, syrup, etc., and can also be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.
  • the pharmaceutical composition can be administered orally or parenterally.
  • the route of administration of the composition according to the present invention is not limited to these, but for example, bronchial, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual or topical administration is possible.
  • the dosage of the composition according to the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate or disease severity, and can be easily determined by a person skilled in the art.
  • the pharmaceutical composition can be formulated into a suitable dosage form using a known technique for clinical administration.
  • nanoluciferase which has the highest luminescence and the smallest protein size among reporter proteins
  • nanoluciferase-PEST fusion protein in which PEST amino acid is fused to the C-terminus of the nanoluciferase
  • the structure of the novel mRNA structure was specified in such a way that the base sequence of SEQ ID NO: 1 encoding the nanoluciferase-PEST fusion protein was arranged upstream thereof, CleanCap (TriLink) in the form of Cap1 was arranged at the 5'-terminus of the base sequence of the 5'-UTR, and the base sequence of the 3'-UTR and the base sequence of the poly (A) tail were arranged sequentially downstream thereof.
  • CleanCap TriLink
  • the base sequence of the 5'-UTR was fixed to the base sequence of the 5'-UTR of human ⁇ -globin (base sequence of SEQ ID NO: 2) and the base sequence of the poly (A) tail was fixed to a 117 nt poly (A) sequence, while applying various types of 3'-UTR base sequences disclosed in Table 1 below as the base sequence of the 3'-UTR, thereby designing six types of mRNA structures of Production Examples 1-1 to 1-6 as illustrated in A of FIG. 1.
  • the mRNA constructs of Manufacturing Examples 1-1 to 1-6 designed as described above were linked to the downstream of the T7 promoter of a DNA vector (pcDNA3.1 hygro Vector), and a type II restriction enzyme recognition sequence was inserted so as to be placed immediately behind the poly (A) tail of the mRNA construct. Therefore, the mRNA construct expressed from the DNA vector as described above has the 5'-terminal capped with CleanCap and the 3'-terminal purely has an adenine sequence of 117 nt in length. 5 ug of the DNA vector manufactured as described above was treated with the type IIS restriction enzyme BspQI (NEB) and reacted overnight to linearize the DNA vector.
  • NEB type IIS restriction enzyme BspQI
  • the mRNA isolated and purified as described above was denatured at 70 degrees Celsius for 10 minutes and electrophoresis was performed using an agarose gel to confirm that the corresponding mRNAs were uniformly produced in the expected size.
  • the purity and concentration of the produced mRNA were measured using a nanodrop device (spectrophotometer, ND-2000, ThermoScientific).
  • the mRNA isolated and purified as described above was transfected into 293T cells (ATCC) seeded in a 96-well plate at a density of 1x104 cells/well using the reverse-transfection method using Lipofectamine 2000 (Lipofectamine2000 TM Transfection Reagent, ThermoFisher).
  • Nano-Glo reagent Na-Glo (R) Luciferase Assay System, Promega
  • Nanoluciferase activity was measured after 48, 72, and 96 hours.
  • Example 1 the base sequences of ENE, an RNA stabilizing sequence of Kaposi's herpesvirus (KSHV) and IRES (internal ribosome entry site) of various RNA viruses, as disclosed in Table 2 below as the base sequence of 3'-UTR, were applied to design seven mRNA structures of Production Examples 1-7 to 1-13 as shown in A of FIG. 2.
  • KSHV Kaposi's herpesvirus
  • IRES internal ribosome entry site
  • the mRNA constructs of Manufacturing Examples 2-1 to 2-6 designed as described above were inserted into a DNA vector in the same manner as in the above Example [2-1], then transcribed in vitro, and the produced mRNA was transfected into 293T cells to measure nanoluciferase activity.
  • FIGS. 3 B and C among various sequences, it was confirmed that the expression of nanoluciferase was the highest and lasted the longest in the mRNA construct of Manufacturing Example 2-6 applying a modified poly (A) tail (A60-G2) in which two guanosines (G) were inserted at intervals of 60 nt.
  • the modified poly (A) tail (A60-G2) selected in Example 2-2 was applied as the base sequence of the poly (A) tail, while the base sequence of the 3'-UTR of ⁇ -globin (base sequence of SEQ ID NO: 6) and the base sequence of the IRES of EMCV (base sequence of SEQ ID NO: 13) selected in Example 2-1 were applied in combination as in FIG. 4A, thereby designing six mRNA structures of Preparation Examples 3-1 to 3-6 as shown in FIG. 4A.
  • the mRNA constructs of Manufacturing Examples 3-1 to 3-6 designed as described above were inserted into a DNA vector in the same manner as in Example [2-1], then transcribed in vitro and the produced mRNA was transfected into 293T cells to measure nanoluciferase activity.
  • the 3'-UTR was fixed to the base sequence of the 3'-UTR of ⁇ -globin (mRNA structures of Preparation Examples 4-1 to 4-5) or a combination of the base sequence of the IRES of EMCV and the 3'-UTR of ⁇ -globin (mRNA structures of Preparation Examples 4-6 to 4-10), and the poly (A) tail was fixed to the modified poly (A) tail of A60-G2, while applying various types of 5'-UTR base sequences disclosed in Table 4 below as the base sequence of the 5'-UTR, thereby designing 10 kinds of mRNA structures of Preparation Examples 4-1 to 4-10 as illustrated in FIG. 5A.
  • Example [2-1] three kinds of mRNA produced in the same manner as in the above Example [2-1], and mRNA of Moderna and Pfizer-BioNTech produced through in vitro transcription after linearizing DNA using BsmBI (NEB) as a type IIS restriction enzyme similar to Example [2-1], were transfected into THP-1 cells (ATCC), which are representative antigen-presenting cells and monocyte-derived cells, or mouse DC2.4 cells (Merck), which are antigen-presenting immune cells and a dendritic cell lineage that plays an important role in muscle tissue, or cells activated by treating the DC2.4 cells with LPS (Activated DC2.4 Cells), and the activity of nanoluciferase was compared over time.
  • THP-1 cells which are representative antigen-presenting cells and monocyte-derived cells
  • mouse DC2.4 cells Merck
  • LPS Activated DC2.4 Cells
  • mRNA produced in the same manner as in the above Example [2-1] was transfected into C2C12 cells (ATCC) as representative muscle cells, Huh-7 cells (ATCC) and HepG2 cells (ATCC) as representative hepatic cells, A549 (ATCC) as representative lung cells, AREP-19 (ATCC) as representative retinal cells, SH-SY5Y cells (ATCC) and Neuro-2a cells (ATCC) as representative neural cells, and 293T cells, and the activity of nanoluciferase was compared over time. As a result, as shown in FIGS.
  • the mRNA construct of the present invention exhibited high expression efficiency in all cells.
  • the mRNA constructs of Moderna and Pfizer-BioNTech showed different expression patterns depending on the cells used, but the three mRNA constructs of the present invention were confirmed to consistently exhibit high expression efficiency regardless of the cell type.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 단백질을 고효율로 발현시킬 수 있는 mRNA 구조체 플랫폼에 관한 것이다.

Description

단백질 고효율 발현용 mRNA 구조체 플랫폼
관련 출원과의 상호 인용
본 출원은 2023년 05월 26일자 한국 특허출원 제2023-0068278호에 기초한 우선권의 이익을 주장하며, 상기 한국 특허출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
기술분야
본 발명은 단백질을 고효율로 발현시킬 수 있는 mRNA 구조체 플랫폼에 관한 것이다.
2019년 창궐한 신종 코로나바이러스인 SARS-CoV-2의 감염증인 COVID-19가 전 세계적으로 빠르게 확산됨에 따라, 추가적인 확산 예방과 사망 피해 감소를 위해 국가적인 차원에서 백신 개발이 경쟁적으로 이루어졌다. 다양한 백신 개발 전략 중 비교적 새로운 전략으로 분류되는 mRNA 백신이 가장 단기간에 사용승인되어 현재까지 투여되고 있다. 상기 mRNA 백신은 인공적으로 합성한 mRNA(messenger RNA, 항원 단백질 정보를 포함한 설계도)를 이용하여 후천면역을 강화하는 핵산-기반 백신으로, 바이러스 항원 유전자를 포함하는 mRNA를 생체 외에서 합성하고 고순도로 정제하여 LNP(lipid nanoparticle)에 감싼 형태로 인체에 투여되는데, 면역세포에 의해서 발현된 항원은 세포밖으로 제시되어 다양한 항원 특이적 후천면역을 유도하게 된다.
2020년 12월 모더나社(mRNA-1273)와 화이자-바이오엔텍社(BNT162b2)의 mRNA 백신이 미국을 비롯한 주요국에서 긴급사용 승인을 받았고, 30,000명 이상의 대규모 임상에서 95% 이상의 놀라운 효능이 확인되었는데, 이는 전통적인 백신들이 50-70% 수준에 머무는 것과 매우 대조적이다. 이렇듯 mRNA 백신의 전례없는 성공에도 불구하고, 백신의 효력이 오래 지속되지 않아 추가접종이 필수적인 현실이다. 또한, 백신접종 이후 시간이 지남에 따라 중화항체가 및 백신 효력이 감소하게 되는데, 모더나社와 화이자-바이오엔텍社의 mRNA 백신 모두 2차 접종 6~8개월 이후 중화항체가 6배 이상 감소하는 것으로 보고되었다.
더불어, 코로나 팬더믹의 장기화로 인한 지속적인 변이 바이러스의 출현이 mRNA 백신의 효력을 저하시키는 또 다른 원인이 되고 있다. SARS-CoV-2는 RNA 바이러스이어서 복제 과정에서 자연적으로 다수의 변이가 발생하게 되는데 이들 중 중화항체가 작용하는 부위에 변이가 생기게 되면 중화항체가 작용하지 못하게 되어 백신 효력이 저하 또는 상실하게 되는 문제가 있다.
이에, mRNA 백신의 효력 지속성을 높이기 위해서는 항원제시 면역세포에서 항원 발현을 1세대 mRNA 백신 보다 더 높이고 오랫동안 지속될 수 있도록 고도화된 mRNA 구조체 개발이 필요하다. 특히 비활성 항원제시 면역세포 뿐 아니라 활성화된 항원제시 면역세포가 림프절로 이동한 이후에도 지속적 고발현을 하는 것이 후천 면역의 활성화에 중요할 것으로 사료된다.
한편, 상기 mRNA는 현재 감염병의 백신뿐 아니라 암 백신 개발을 위해서도 활발하게 적용연구가 이루어지고 있고, 향후에는 더 나아가 다양한 희귀 유전질환 및 난치질환의 치료제 개발을 위해서도 활용범위가 넓을 것으로 예상된다.
질병 원인 유전자를 mRNA 형태로 세포 및 생체에 전달해서 단백질의 양이나 활성을 보충함으로써 치료적 효과를 내는 방식으로, 질병과의 상관성이 명확하게 검증된 유전자의 양이나 활성의 감소에 의해서 발병하는 유전질환 그 중에서도 단일 유전자의 결함이 원인인 단일 유전자 질환(monogenic disease)에 가장 적합한 방식이다.
상기와 같은 mRNA를 수단으로 하는 백신이나 치료제 개발은 질병의 원인 유전자를 직접적으로 공급하는 방식이기 때문에 표적 특이성이 높은 방식이고, RNA를 활용하기 때문에 유전체에 삽입되지 않고 일시적인 발현을 하는 방식이어서 안전성이 높으며, mRNA 구조체 및 전달체 모듈이 확립되면 다양한 질병 유전자를 쉽게 적용할 수 있다. 더불어 생산 및 공정이 효율적이고 전체 개발기간이 짧아 전반적으로 경제적인 의약개발이 가능하고 저가 약물 개발에 유리하며, 향후 환자 맞춤형 치료제 개발에 매우 적합한 방식일 수 있는 장점이 있다.
최근 AAV(adeno-associated virus)를 이용한 생체 전달방식의 유전자 치료제가 다수 신약 승인된 바 있다. 척수성 근위축증 치료제인 졸겐스마(zolgensma), 빈혈치료제 진테글로(zynteglo), 혈우병 치료제인 헴제닉스(hemgenix) 등이 대표적인 예로, 약가가 25-45억/1회로 천문학적인 수준이다. 1회 투여로 다년간의 치료효과를 낸다는 장점에도 불구하고, AAV 벡터의 패키징 수용능력의 한계로 유전자의 크기에 제약이 있고, 여전히 비현실적으로 높은 약가, 작지 않은 면역반응, AAV 바이러스에 노출된 환자의 경우 중화항체가 형성되어 약효를 내지 못하는 점 등이 한계점으로 인식되고 있다.
이에 반해, mRNA 기반 치료제는 적용 유전자의 크기에 이론적으로 제약이 없고, 안전성이 높고, 경제적 의약생산으로 비교적 낮은 약가가 가능하고, 환자군에 제약이 없어 AAV 기반의 치료제의 약점을 보완할 수 있는 강점을 가지고 있다. 이러한 mRNA 기반 치료제의 장점에도 불구하고, mRNA가 치료제로서 성공적이기 위해서는 질병 유전자를 고발현으로 장기간 지속적으로 발현하는 것이 필수적인데, 이는 백신이 1회 투여로도 충분한 항원을 발현하여 생체내 면역작용에 의해서 면역기억을 형성하는 것과는 달리 치료제의 경우 질병 단백질을 지속적으로 높게 발현하는 것이 치료적 효과를 내는데 중요하기 때문이다.
따라서 단백질을 높은 효율로 발현시킬 수 있는 mRNA 구조체 플랫폼의 개발은 SARS-CoV-2를 비롯해 다양한 고위험 바이러스들(Zika, influenza, SFTS, Dengue 등) 및 향후 출현할 신변종 바이러스 전염병을 극복할 수 있는 mRNA 백신의 효과적이고 신속한 개발에 적용될 수 있을 뿐만 아니라, 나아가 mRNA 기반의 유전자 치료제 개발을 가능하게 하는 필수적인 과정이라 하지 않을 수 없다.
본 발명의 일 목적은 목적 단백질을 고효율로 발현할 수 있는 플랫폼으로 적용될 수 있는 신규 mRNA 구조체를 제공하는 것이다.
본 발명의 다른 목적은 상기 신규 mRNA 구조체를 포함하는 약학적 조성물을 제공하는 것이다.
상기의 목적을 달성하기 위하여, 본 발명의 일 측면은 목적 단백질을 암호화하는 염기서열; 상기 목적 단백질을 암호화하는 염기서열의 하류에 배치되는 ζ-글로빈의 3’-UTR의 염기서열; 및 상기 ζ-글로빈의 3’-UTR의 염기서열의 하류에 배치되는 (A60G)n의 반복단위를 포함하는 염기서열(여기서, n은 1 내지 3의 정수);을 포함하는 mRNA 구조체를 제공한다.
상기 mRNA 구조체는 상기 목적 단백질을 암호화하는 염기서열의 상류에 배치되는 BBV(black beetle virus) 또는 PPRV(peste des petits ruminants virus) 유래 염기서열을 더 포함할 수 있다.
상기 mRNA 구조체는 상기 목적 단백질을 암호화하는 염기서열의 하류와 상기 ζ-글로빈의 3’-UTR의 염기서열의 상류의 사이에, EMCV(encephalomyocaditis virus)의 IRES(internal ribosome entry site)의 염기서열을 더 포함할 수 있다.
또한, 상기 목적을 달성하기 위하여, 본 발명의 다른 측면은 상기 mRNA 구조체를 포함하는 약학적 조성물을 제공한다.
상기 약학적 조성물은 백신 또는 유전자 치료제일 수 있다.
본 발명에서 새롭게 고안 및 도출된 mRNA 구조체는 종래 상용화된 모더나社나 화이자-바이오엔텍社의 mRNA 구조체에 비해, 그 세포 내에서의 발현 효율이 훨씬 우수하므로, mRNA 기반의 백신이나 치료제의 개발에 폭넓게 활용될 수 있는 플랫폼 기술로서 유용하게 적용될 수 있는 장점이 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 최적의 3'-UTR을 도출하기 위하여, 3'-UTR에 다양한 세포 유전자의 염기서열을 적용하여 mRNA 구조체들을 설계하고(A), 이들 mRNA 구조체들을 293T 세포에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과(B)와 상기 나노루시퍼라아제의 활성을 12시간 결과로 보정하여 상대적인 활성의 변화를 분석한 결과(C)를 나타낸 것이다.
도 2는 역시 최적의 3'-UTR을 도출하기 위하여, 3'-UTR에 다양한 바이러스 유래의 염기서열을 적용하여 mRNA 구조체들을 설계하고(A), 이들 mRNA 구조체들을 293T 세포에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과(B)와 상기 나노루시퍼라아제의 활성을 12시간 결과로 보정하여 상대적인 활성의 변화를 분석한 결과(C)를 나타낸 것이다.
도 3은 역시 최적의 폴리(A)테일을 도출하기 위하여, 폴리(A)테일에 구아닌을 다양한 숫자와 간격으로 삽입한 염기서열을 적용하여 mRNA 구조체들을 설계하고(A), 이들 mRNA 구조체들을 293T 세포에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과(B)와 상기 나노루시퍼라아제의 활성을 12시간 결과로 보정하여 상대적인 활성의 변화를 분석한 결과(C)를 나타낸 것이다.
도 4는 3'-UTR에 ζ-글로빈의 3'-UTR의 염기서열 또는 EMCV의 IRES의 염기서열을 단독 또는 조합하여 적용하고, 폴리(A)테일로 A60G2를 적용하여 mRNA 구조체들을 설계하고(A), 이들 mRNA 구조체들을 293T 세포에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과(B)와 상기 나노루시퍼라아제의 활성을 12시간 결과로 보정하여 상대적인 활성의 변화를 분석한 결과(C)를 나타낸 것이다.
도 5는 최적의 5'-UTR을 도출하기 위하여, 3'-UTR에 ζ-글로빈의 3'-UTR의 염기서열 또는 EMCV의 IRES의 염기서열과 ζ-글로빈의 3'-UTR의 염기서열의 조합을 적용하고, 폴리(A)테일로 A60G2를 적용하는 한편, 5'-UTR에 다양한 염기서열을 적용하여 mRNA 구조체들을 설계하고(A), 이들 mRNA 구조체들을 293T 세포에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과(B)와 상기 나노루시퍼라아제의 활성을 12시간 결과로 보정하여 상대적인 활성의 변화를 분석한 결과(C)를 나타낸 것이다.
도 6은 도 5에서 최고의 발현효율을 나타내는 3종의 mRNA 구조체(CJ-1, BBV+ζG+A60G2; , CJ-2, PPRV+ζG+A60G2; CJ-3, BBV+EMCV+ζG+A60G2)를 선별하고, 모더나社 및 화이자-바이오엔텍社에서 코로나 mRNA 백신 개발에 사용한 mRNA 구조체를 추가적으로 제작하여(A), 이들 mRNA 구조체들을 단핵구 계열 면역세포인 THP-1 세포(B), 덴드리틱 세포 계열인 마우스 DC2.4 세포(C), 그리고 상기 DC2.4 세포를 LPS로 활성화시킨 세포(Activated DC2.4 Cell)(D)에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과를 나타낸 것이다.
도 7은 3종의 mRNA 구조체(CJ-1, CJ-2, CJ-3)를 대표적인 마우스 근육세포인 C2C12 세포(A), 대표적인 간세포인 Huh-7 세포(B), 대표적인 폐세포인 A549(C) 및 대표적인 망막세포인 AREP-19(D), 대표적인 신경세포인 SH-SY5Y 세포(ATCC) 및 Neuro-2a 세포(ATCC), 및 293T 세포에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과를 나타낸 것이다.
도 8은 3종의 mRNA 구조체(CJ-1, CJ-2, CJ-3)를 293T 세포(A), 또 다른 대표적인 간세포인 HepG2 세포(B), 대표적인 신경세포인 SH-SY5Y 세포(C) 및 Neuro-2a 세포(D)에 형질주입한 후 시간별로 나노루시퍼라아제의 활성을 측정한 결과(C)를 나타낸 것이다.
이하, 본 발명을 상세히 설명한다.
1. 신규 mRNA 구조체
본 발명의 일 측면은 신규 mRNA 구조체를 제공한다.
상기 본 발명의 mRNA 구조체는 목적 단백질을 암호화하는 염기서열; ζ-글로빈의 3’-UTR(3'-untranslated region)의 염기서열; 및 (A60G)n의 반복단위를 포함하는 염기서열;을 포함한다.
상기 목적 단백질은 본 발명의 mRNA 구조체를 통해 발현시키고자 하는 목적이 되는 단백질을 의미한다. 구체적으로, 상기 목적 단백질은 본 발명의 mRNA 구조체가 세포에 도입된 후에 상기 세포의 자체 번역(translation) 체계에 의해 상기 mRNA 구조체로부터 직접 번역되어 발현되는 단백질을 의미할 수 있다. 따라서 상기 본 발명의 mRNA 구조체에 포함되는 '목적 단백질을 암호화하는 염기서열'은 인트론이 제거되고 엑손만으로 구성되어 곧바로 번역되어 목적 단백질로 생성될 수 있는 CDS(coding sequence)를 의미하는 것일 수 있다.
상기 ζ-글로빈은 인간 HBZ 유전자로, 인간 α-글로빈 유전자 클러스터에 속하는 5종의 유전자들 중 하나이다. 상기 ζ-글로빈의 3’-UTR의 염기서열은 상기 인간 HBZ 유전자가 발현되는 과정에서 생성되는 mRNA에 포함된 3’-UTR의 염기서열을 의미한다. 특히, 상기 ζ-글로빈의 3’-UTR의 염기서열은 서열번호 6의 염기서열 또는 이의 변이체를 포함할 수 있고, 구체적으로 상기 ζ-글로빈의 3’-UTR의 염기서열은 서열번호 6의 염기서열 또는 이의 변이체로 구성되는 것일 수 있다. 상기 서열번호 6의 염기서열의 변이체는 서열번호 6의 염기서열과 80％ 이상, 90％ 이상, 95％ 이상, 96% 이상, 97% 이상, 98% 이상 또는 99% 이상의 서열 상동성을 갖는 것들을 의미하나, 이에 한정되는 것은 아니며, 상기 서열번호 6의 염기서열과 같이 mRNA의 안정성과 발현 효율을 향상시킬 수 있는 기능을 하는 염기서열을 모두 의미한다.
상기 ζ-글로빈의 3’-UTR의 염기서열은 상기 목적 단백질을 암호화하는 염기서열의 하류(downstream)에 배치될 수 있고, 특히 상기 목적 단백질을 암호화하는 염기서열과 작동가능하게 연결될 수 있다.
상기 (A60G)n의 반복단위를 포함하는 염기서열은 폴리(A)테일의 변이체로서, 상기 (A60G)n의 반복단위를 포함하는 염기서열은 115nt 내지 125nt의 길이를 가질 수 있고, 예컨대 117nt 내지 123nt의 길이를 가질 수 있고, 특히 상기 (A60G)n의 반복단위를 포함하는 염기서열은 121nt의 길이를 가질 수 있다. 이에, 상기 n은 1 내지 3의 정수일 수 있고, 예컨대 1 내지 2의 정수일 수 있고, 특히 상기 n은 1일 수 있다. 구체적으로, 상기 (A60G)n의 반복단위를 포함하는 염기서열은 서열번호 21의 염기서열(A57GA60GAA)일 수 있다.
상기 (A60G)n의 반복단위를 포함하는 염기서열은 상기 ζ-글로빈의 3’-UTR의 염기서열의 하류에 배치될 수 있고, 특히 상기 목적 단백질을 암호화하는 염기서열 및 상기 ζ-글로빈의 3’-UTR의 염기서열과 작동가능하게 연결될 수 있다.
한편, 상기 본 발명의 mRNA 구조체는 BBV(black beetle virus)의 5’-UTR의 염기서열 또는 PPRV(peste des petits ruminants virus)의 5’-UTR의 염기서열을 더 포함할 수 있다. 상기 BBV의 5'-UTR의 염기서열은 검은딱정벌레에 감염되는 바이러스에서 유래한 서열로 암호화 서열(coding sequence)의 상류에 존재함으로써 단백질의 번역 효율을 향상시킨다. 특히, 상기 BBV의 5'-UTR의 염기서열은 Cap-독립적 번역(Cap-independent translation) 기전으로 알려져 있는 IRES 염기서열에 비해 훨씬 짧으면서도 높은 단백질 번역 효율을 나타낸다. 또한, 상기 PPRV는 파라믹소바이러스과(Paramyxoviridae) 하위 모르빌리바이러스(Morbillivirus) 속에 속하고, 주로 염소와 양에 감염하는 가성우역바이러스이다. 상기 PPRV의 5'-UTR의 염기서열은 PPRV의 F 유전자의 상류에 존재하면서 18S rRNA와 상보적으로 결합함으로써 단백질 번역 효율을 향상시킬 것으로 추정된다.
상기 BBV(black beetle virus)의 5’-UTR의 염기서열은 서열번호 24의 염기서열 또는 이의 변이체를 포함할 수 있고, 구체적으로 상기 BBV의 5’-UTR의 염기서열은 서열번호 24의 염기서열 또는 이의 변이체로 구성되는 것일 수 있다. 또한, 상기 PPRV의 5’-UTR의 염기서열은 서열번호 25의 염기서열이나 서열번호 26의 염기서열 또는 이들의 변이체를 포함할 수 있고, 구체적으로 상기 PPRV의 5’-UTR의 염기서열은 서열번호 25의 염기서열이나 서열번호 26의 염기서열 또는 이들의 변이체로 구성되는 것일 수 있다. 상기 서열번호 24, 25 또는 26의 염기서열의 변이체는 상기 서열번호 24, 25 또는 26의 염기서열과 80％ 이상, 90％ 이상, 95％ 이상, 96% 이상, 97% 이상, 98% 이상 또는 99% 이상의 서열 상동성을 갖는 것들을 의미하나, 이에 한정되는 것은 아니며, 상기 서열번호 24, 25 또는 26의 염기서열과 같이 mRNA의 안정성과 발현 효율을 향상시킬 수 있는 기능을 하는 염기서열을 모두 의미한다.
상기 BBV의 5’-UTR의 염기서열 또는 PPRV의 5’-UTR의 염기서열은 상기 목적 단백질을 암호화하는 염기서열의 상류(upstream)에 배치될 수 있고, 특히 상기 목적 단백질을 암호화하는 염기서열과 작동가능하게 연결될 수 있다.
또한, 상기 본 발명의 mRNA 구조체는 EMCV(encephalomyocaditis virus)의 IRES(internal ribosome entry site)의 염기서열을 더 포함할 수 있다. 상기 EMCV의 IRES의 염기서열은 서열번호 13의 염기서열 또는 이의 변이체로 구성되는 것일 수 있다. 상기 서열번호 13의 염기서열의 변이체는 서열번호 13의 염기서열과 80％ 이상, 90％ 이상, 95％ 이상, 96% 이상, 97% 이상, 98% 이상 또는 99% 이상의 서열 상동성을 갖는 것들을 의미하나, 이에 한정되는 것은 아니며, 상기 서열번호 13의 염기서열과 같이 mRNA의 안정성과 발현 효율을 향상시킬 수 있는 기능을 하는 염기서열을 모두 의미한다.
상기 EMCV의 IRES의 염기서열은 상기 목적 단백질을 암호화하는 염기서열의 하류와 상기 ζ-글로빈의 3’-UTR의 염기서열의 상류의 사이에 배치될 수 있고, 특히 상기 목적 단백질을 암호화하는 염기서열 및 상기 ζ-글로빈의 3’-UTR의 염기서열과 작동가능하게 연결될 수 있다.
상기와 같이 구성되는 본 발명의 mRNA 구조체는 세포 내에서의 안정성이나 발현 효율이 매우 우수하여, 형질주입된 후에도 세포 내에서 높은 발현 상태를 장시간 동안 유지할 수 있는 효과가 있다. 특히, 본 발명의 구체적인 실시예에 따르면, 기존의 모더나社나 화이자-바이오엔텍社의 mRNA 구조체에 비하여 더욱 높은 발현 효율을 나타내는 것으로 확인되었을 뿐만 아니라, 근육세포, 간세포, 폐세포, 안세포, 신경세포 등 다양한 세포의 종류에 상관없이 일관성 있게 높은 발현 효율을 나타내는 것으로 확인되었다(도 6 내지 8 참고).
2. 신규 mRNA 구조체의 활용
상술한 바와 같이, 상기 본 발명의 신규 mRNA 구조체는 세포 내에서 높은 발현 효율을 나타내므로 목적 단백질의 발현을 위해 세포에 형질주입되기 위한 것일 수 있다.
또한, 상기와 같이 세포에 형질주입될 수 있는 본 발명의 신규 mRNA 구조체는 목적 단백질에 따라 약학적 조성물의 유효성분으로 이용될 수 있다.
예컨대, 상기 목적 단백질이 바이러스나 세균에서 유래한 단백질인 경우 상기 본 발명의 mRNA 구조체를 포함하는 약학적 조성물은 백신일 수 있다. 이러한 경우, 본 발명의 약학적 조성물이 주입된 개체 내에서 상기 신규 mRNA 구조체에 의해 목적 단백질인 바이러스나 세균 유래의 단백질이 높은 효율로 발현되게 되고, 이렇게 발현된 바이러스나 세균 유래의 단백질은 개체 내에서 항원으로 인식되어 면역 반응을 유발함으로써 백신으로 작용할 수 있다.
또한, 상기 목적 단백질이 암이나 유전질환 등과 같은 특정 질환에서 결핍된 원인 단백질인 경우 상기 본 발명의 mRNA 구조체를 포함하는 약학적 조성물은 유전자 치료제일 수 있다. 이러한 경우, 본 발명의 약학적 조성물이 주입된 개체 내에서 상기 신규 mRNA 구조체에 의해 목적 단백질인 상기 특정 질환에서 결핍된 원인 단백질이 높은 효율로 발현되게 되고, 상기 원인 단백질의 고효율 발현에 의해 상기 원인 단백질의 결핍이 보완됨으로써 상기 특정 질환이 치료될 수 있다. 따라서 결핍된 유전자의 보완에 의해 치료될 수 있는 질환이라면 특별한 제한없이, 본 발명의 약학적 조성물에 의해 치료될 수 있다.
특히, 상기와 같은 유전자 치료제로 적용하기에 가장 적합한 질환으로는 단일 유전자 결함으로 발병하는 단일 유전 질환(monogenic genetic diseases)이 있는데, 예컨대 희귀 신경근육질환인 척수성 근위축증(Spinal muscular atrophy, SMA)이 대표적이고, 그 외에도 낭포성 섬유증(Cystic Fibrosis, CF), 듀켄씨 근이영양증(Duchenne Muscular Dystrophy, DMD), 프리드리히 실조(Friedreich's Ataxia, FA), 혈우병(hemophilia), 레트 증후군(Rett Syndrome), 파브리병(Fabry Disease), 겸상적혈구병(Sickle Cell Disease) 등에도 적용해 볼 수 있다.
더욱이, 본 발명의 mRNA 구조체는 근육세포, 간세포, 폐세포, 안세포, 신경세포 등 다양한 세포의 종류에 상관없이 일관성 있게 높은 발현 효율을 나타내므로 각종 질환이 유발될 수 있는 다양한 세포에 적용될 수 있다. 따라서, 본 발명의 mRNA 구조체는 상기와 같은 유전자 치료제의 유효성분으로 이용될 때, 기존의 모더나社나 화이자-바이오엔텍社의 mRNA 구조체를 이용하는 경우에 비해, 훨씬 우수한 치료 효과를 담보할 수 있는 장점이 있다.
한편, 상기와 같이 본 발명의 mRNA 구조체가 약학적 조성물의 유효성분으로 이용되는 경우, 상기 약학적 조성물은 본 발명의 mRNA 구조체를 전달하기 위한 전달 수단을 더 포함할 수 있다.
상기 전달 수단의 대표적인 예로 리포좀이나 LNP(lipid nanoparticle) 등과 같은 나노입자를 들 수 있고, 상기 리포좀 또는 LNP는 양이온성 지질, 비양이온성 지질 또는 중성 지질 등을 포함하며, 추가적으로 PEG(polyethylene glycol) 또는 콜레스테롤 등의 다른 지질을 포함할 수 있다. 또한, 상기와 같은 전달 수단으로서의 역할을 하는 나노입자로는 엑소좀도 이용될 수 있고, 또 다른 전달 수단으로 본 발명의 mRNA 구조체와 정전기적으로 상호작용하여 향상된 안정성을 제공할 수 있는 양이온성 생체적합성 폴리머나 양이온성 펩티드(예, 프로타민, 세포 투과성 펩타이드(cell penetrating peptide, CPP) 등이 이용될 수도 있으나, 이에 한정되지 않고 본 발명이 속하는 기술분야에서 mRNA 구조체를 전달할 수 있는 것으로 알려진 임의의 모든 수단이 이용될 수 있다.
또한, 상기 약학적 조성물은 추가로 약제학적으로 허용 가능한 담체를 1종 이상 포함할 수 있다. 약제학적으로 허용 가능한 담체는 본 발명의 유효성분과 양 립 가능하여야 하며, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 한 성분 또는 둘 이상의 성분을 혼합하여 사용할 수 있고, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형으로 제제화 할 수 있다. 특히, 동결건조 (lyophilized)된 형태의 제형으로 제제화하여 제공하는 것이 바람직하다. 동결건조 제형 제조를 위해서 본 발명이 속하는 기술분야에서 통상적으로 알려져 있는 방법이 사용될 수 있으며, 동결건조를 위한 안정화제가 추가될 수도 있다. 더 나아가 당 분야의 적정한 방법으로 또는 레밍톤 약학 과학(Remington's pharmaceutical Science, Mack Publishing company, Easton PA)에 개시되어 있는 방법을 이용하여 각 질병에 따라 또는 성분에 따라 바람직하게 제제화 할 수 있다.
상기 약학적 조성물에 포함되는 유효성분 등의 함량 및 투여방법은 통상의 환자의 증후와 질병의 심각도에 기초하여 본 기술분야의 통상의 전문가가 결정할 수 있다. 또한 산제, 정제, 캡슐제, 액제, 주사제, 연고제, 시럽제 등의 다양한 형태로 제제화 할 수 있으며 단위-투여량 또는 다-투여량 용기, 예를 들면 밀봉된 앰플 및 병 등으로 제공될 수도 있다.
또한 상기 약학적 조성물은 경구 또는 비경구 투여가 가능하다. 본 발명에 따른 조성물의 투여경로는 이들로 한정되는 것은 아니지만, 예를 들면, 기관지, 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 장관, 설하 또는 국소 투여가 가능하다. 본 발명에 따른 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 방법, 배설율 또는 질병의 중증도 등에 따라 그 범위가 다양하며, 본 기술분 야의 통상의 전문가가 용이하게 결정할 수 있다. 또한, 임상 투여를 위해 공지의 기술을 이용하여 상기 약학적 조 성물을 적합한 제형으로 제제화할 수 있다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.
[실시예 1]
신규 mRNA 구조체의 구조
선형의 형태로 세포 내에서 높은 안정성 및 번역 효율을 갖는 신규의 mRNA 구조체를 도출하기 위하여, 먼저 리포터 단백질들 중 가장 발광도가 높고 단백질의 크기가 작은 나노루시퍼라아제와 상기 나노루시퍼라아제의 C-말단에 PEST 아미노산이 융합된 나노루시퍼라아제-PEST 융합 단백질을 발현 대상의 목적 단백질로 정하였다. 그리고, 상기 나노루시퍼라아제-PEST 융합 단백질을 암호화하는 서열번호 1의 염기서열을 기준으로, 그 상류에 5'-UTR의 염기서열이 배치되고 상기 5'-UTR의 염기서열의 5'-말단에 Cap1의 형태를 지닌 CleanCap(TriLink社)이 배치되는 한편, 그 하류에 3'-UTR의 염기서열과 폴리(A)테일의 염기서열을 순차적으로 배치되는 형태로 신규 mRNA 구조체의 구조를 특정하였다.
[실시예 2]
신규 mRNA 구조체의 최적의 구성요소들의 선별
[2-1] 최적의 3'-UTR의 선정
먼저, 최적의 3'-UTR을 도출하기 위하여, 상기 실시예 1에서 특정한 mRNA 구조체에서, 5'-UTR의 염기서열을 인간 α-글로빈(α-globin)의 5'-UTR의 염기서열(서열번호 2의 염기서열)로, 폴리(A)테일의 염기서열을 117nt의 폴리(A) 서열로 각각 고정하는 한편, 3'-UTR의 염기서열로 아래 표 1에 개시된 여러 종류의 3'-UTR의 염기서열들을 적용하여, 도 1의 A에 도시된 바와 같은 제조예 1-1 내지 제조예 1-6의 mRNA 구조체 6종을 설계하였다.
적용 제조예 # 명칭 염기서열(5'->3') 서열번호
1-1 α-globin GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA (111bp) 3
1-2 β-globin GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA (134bp) 4
1-3 γ1-globin GCTCACTGCCCATGATTCAGAGCTTTCAAGGATAGGCTTTATTCTGCAAGCAATACAAATAATAAATCTATTCTGCTGAGAGATCACACA (90bp) 5
1-4 ζ-globin GCGCCGCCTCCGGGACCCCCAGGACAGGCTGCGGCCCCTCCCCCGTCCTGGAGGTTCCCCAGCCCCACTTACCGCGTAATGCGCCAATAAACCAATGAACGAA (103bp) 6
1-5 Tyrosine hydroxylase GTGCACGGCGTCCCTGAGGGCCCTTCCCAACCTCCCCTGGTCCTGCACTGTCCCGGAGCTCAGGCCCTGGTGAGGGGCTGGGTCCCGGGTGCCCCCCATGCCCTCCCTGCTGCCAGGCTCCCACTGCCCCTGCACCTGCTTCTCAGCGCAACAGCTGTGTGTGCCCGTGGTGAGGTTGTGCTGCCTGTGGTGAGGTCCTGTCCTGGCTCCCAGGGTCCTGGGGGCTGCTGCACTGCCCTCCGCCCTTCCCTGACACTGTCTGCTGCCCCAATCACCGTCACAATAAAAGAAACTGTGGTCTCTA (304bp) 7
1-6 Insulin ACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC (73bp) 8
상기와 같이 설계된 제조예 1-1 내지 제조예 1-6의 mRNA 구조체를, DNA 벡터(pcDNA3.1 hygro Vector)의 T7 프로모터 하류에 연결하는 한편, 상기 mRNA 구조체의 폴리(A)테일 바로 뒤에 타입 II 제한효소 인식 서열이 배치되도록 삽입하였다. 따라서 상기와 같은 DNA 벡터로부터 발현되는 mRNA 구조체는 5'-말단이 CleanCap으로 캡핑되어 있고, 3'-말단은 순수하게 117nt 길이의 아데닌 서열이 된다.상기와 같이 제조된 DNA 벡터 5ug에 타입 IIS 제한효소 BspQI(NEB사)를 처리하고 밤새 반응시킴으로써 DNA 벡터를 선형화하였고, 아가로오스 젤을 이용한 전기영동을 통해 DNA 벡터의 절단이 완벽하게 이루어졌는지 여부를 확인한 다음, 상기 선형화 과정에서 이용된 효소와 완충용액들을 glassfiber membrane(ExpinTM CleanUP SV, GeneAll사)을 이용하여 제거하고 선형화된 DNA만을 분리 및 정제하였다. 상기와 같이 분리 및 정제된 선형 DNA 500ng을 이용하여 섭씨 37도에서 4시간 동안 인 비트로 전사(in vitro transcription)을 진행한 다음, DNase를 처리하고 섭씨 37도에서 30분 동안 반응시켜 반응에 사용된 DNA를 제거하였다. 그리고 실리카 컬럼(HiYield RNA UltraPurification Kit, RealBiotechCorporation(RBC)사)을 이용하여 인 비트로 전사 결과 생성된 mRNA만을 분리 및 정제하였다. 상기와 같이 분리 및 정제된 mRNA를 섭씨 70도에서 10분간 변성(denaturation)한 다음 아가로오스 젤을 이용한 전기영동을 수행하여 해당 mRNA 들이 예상되는 크기로 균일하게 생성된 것을 확인하였고, 추가적으로 nanodrop 장비(spectrophotometer, ND-2000, ThermoScientific사)를 이용하여 생성된 mRNA의 순도와 농도를 측정하였다.그런 다음, 리포펙타민 2000(Lipofectamine2000TM Transfection Reagent, ThermoFisher)을 이용하여 역-트랜스펙션(reverse-transfection)법으로, 96웰 플레이트에 1x104세포/웰의 농도로 분주되어 있는 293T 세포(ATCC)에, 상기와 같이 분리 및 정제된 mRNA를 형질주입하였고, Nano-Glo 시약(Nano-Glo(R) Luciferase Assay System, Promega사)을 이용하여 형질주입 후 6, 12, 24, 48, 72, 96 시간 경과 후의 나노루시퍼라아제 활성을 측정하였다.
그 결과, 도 1의 B, C에 도시된 바와 같이, 인간 ζ-글로빈의 3'-UTR을 적용한 제조예 1-4의 mRNA 구조체에서 나노루시퍼라아제의 발현이 가장 높고 가장 오랫동안 지속된 것으로 확인되었다.
한편, 상기 실시예 1에서 특정한 mRNA 구조체에서, 3'-UTR의 염기서열로 아래 표 2에 개시된 카포시싸코마 허피스바이러스 (KSHV)의 RNA 안정화 서열인 ENE 및 여러 RNA 바이러스의 IRES(internal ribosome entry site)의 염기서열들을 적용하여, 도 2의 A에 도시된 바와 같은 제조예 1-7 내지 제조예 1-13의 mRNA 구조체 7종을 설계하였다.
적용 제조예 # 명칭 염기서열(5'->3') 서열번호
1-7 1X ENE TGTTTTGGCTGGGTTCTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTCTTATCCCAGTGTATATTGGAAAAACATGTTATACTTTTGACAATTTAACGTGCCTAGAGCTCAAATTAAACTAATACCATAACGTAATGCAACTTACAACATAAATAAAGGTCAATGTTTAATCCATA (190bp) 9
1-8 2X ENE TGTTTTGGCTGGGTTCTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTCTTATCCCAGTGTATATTTGTTTTGGCTGGGTTCTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTCTTATCCCAGTGTATATTGGAAAAACATGTTATACTTTTGACAATTTAACGTGCCTAGAGCTCAAATTAAACTAATACCATAACGTAATGCAACTTACAACATAAATAAAGGTCAATGTTTAATCCATA (269bp) 10
1-9 3X ENE TGTTTTGGCTGGGTTCTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTCTTATCCCAGTGTATATTTGTTTTGGCTGGGTTCTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTCTTATCCCAGTGTATATTTGTTTTGGCTGGGTTCTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTCTTATCCCAGTGTATATTGGAAAAACATGTTATACTTTTGACAATTTAACGTGCCTAGAGCTCAAATTAAACTAATACCATAACGTAATGCAACTTACAACATAAATAAAGGTCAATGTTTAATCCATA (348bp) 11
1-10 CVB3 TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATTGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA (742bp) 12
1-11 EMCV CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC (586bp) 13
1-12 HCV GGCGACACTCCACCATAGATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATTAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCATCATGAGCACAAATCCTAAACCTCAAAGAAAAACC (357bp) 14
1-13 CrPV AAAGCAAAAATGTGATCTTGCTTGTAAATACAATTTTGAGAGGTTAATAAATTACAAGTAGTGCTATTTTTGTATTTAGGTTAGCTATTTAGCTTTACGTTCCAGGATGCCTAGTGGCAGCCCCACAATATCCAGGAAGCCCTCTCTGCGGTTTTTCAGATTAGGTAGTCGAAAAACCTAAGAAATTTA (189bp) 15
상기와 같이 설계된 제조예 1-7 내지 제조예 1-13의 mRNA 구조체를, 상기 제조예 1-1 내지 제조예 1-6의 mRNA 구조체와 동일한 방식으로 DNA 벡터에 삽입한 다음, 인 비트로 전사시키고 생성된 mRNA를 293T 세포에 형질주입하여 나노루시퍼라아제 활성을 측정하였다.그 결과, 도 2의 B, C에 도시된 바와 같이, EMCV의 IRES를 적용한 제조예 1-11의 mRNA 구조체에서 나노루시퍼라아제의 발현이 가장 높고 가장 오랫동안 지속된 것으로 확인되었다.[2-2] 최적의 폴리(A)테일의 선정
폴리(A)테일이 아데노신(A)만으로 구성된 경우에 비해 구아노신(G)이 혼합된 형태의 경우에 mRNA 안정성이 더욱 향상될 수 있다는 최근 보고에 따라, 상기 실시예 1에서 특정한 mRNA 구조체에서, 3'-UTR의 염기서열은 제외하고, 폴리(A)테일의 염기서열로 아래 표 3에 개시된 여러 종류의 염기서열들을 적용하여, 도 3의 A에 도시된 바와 같은 제조예 2-1 내지 제조예 2-6의 mRNA 구조체 6종을 설계하였다.
적용 제조예 # 명칭 염기서열(5'->3') 서열번호
2-1 A10-G11 A9GA10GA10GA10GA10GA10GA10GA10GA10GA10GA10GAA 16
2-2 A20-G6 A13GA20GA20GA20GA20GA20GAA 17
2-3 A30-G4 A25GA30GA30GA30GAA 18
2-4 A40-G3 A36GA40GA40GAA 19
2-5 A50-G3 A16GA50GA50GAA 20
2-6 A60-G2 A57GA60GAA 21
상기와 같이 설계된 제조예 2-1 내지 제조예 2-6의 mRNA 구조체를, 상기 실시예 [2-1]에서와 동일한 방식으로 DNA 벡터에 삽입한 다음, 인 비트로 전사시키고 생성된 mRNA를 293T 세포에 형질주입하여 나노루시퍼라아제 활성을 측정하였다.그 결과, 도 3의 B, C에 도시된 바와 같이, 다양한 서열들 중에서, 60nt의 간격으로 2개의 구아노신(G)이 삽입된 형태의 변형 폴리(A)테일(A60-G2)을 적용한 제조예 2-6의 mRNA 구조체에서 나노루시퍼라아제의 발현이 가장 높고 가장 오랫동안 지속된 것으로 확인되었다.
[2-3] 목적 단백질을 암호화하는 염기서열의 하류의 최적 조합 선정
또한, 목적 단백질을 암호화하는 염기서열의 하류의 최적 조합을 선정하기 위하여, 상기 실시예 1에서 특정한 mRNA 구조체에서, 폴리(A)테일의 염기서열로 상기 실시예 2-2에서 선정된 변형 폴리(A)테일(A60-G2)을 적용하는 한편, 3'-UTR의 염기서열로 상기 실시예 2-1에서 선정된 ζ-글로빈의 3’-UTR의 염기서열(서열번호 6의 염기서열)과 EMCV의 IRES의 염기서열(서열번호 13의 염기서열)을 도 4의 A에서와 같이 조합하여 적용하여, 도 4의 A에 도시된 바와 같은 제조예 3-1 내지 제조예 3-6의 mRNA 구조체 6종을 설계하였다.
상기와 같이 설계된 제조예 3-1 내지 제조예 3-6의 mRNA 구조체를, 상기 실시예 [2-1]에서와 동일한 방식으로 DNA 벡터에 삽입한 다음, 인 비트로 전사시키고 생성된 mRNA를 293T 세포에 형질주입하여 나노루시퍼라아제 활성을 측정하였다.
그 결과, 도 4의 B, C에 도시된 바와 같이, ζ-글로빈의 3’-UTR이 단독으로 적용된 제조예 3-4의 mRNA 구조체에서 나노루시퍼라아제의 발현이 가장 높고 가장 오랫동안 지속된 것으로 확인되었다. 그리고, EMCV의 IRES와 조합된 경우에는, EMCV의 IRES가 ζ-글로빈의 3’-UTR의 상류에 배치된 제조예 3-5의 mRNA 구조체에서 우수한 나노루시퍼라아제의 지속 발현을 달성할 수 있는 것으로 확인되었다.
[2-4] 최적의 5'-UTR의 선정
한편, 최적의 5'-UTR을 도출하기 위하여, 상기 실시예 1에서 특정한 mRNA 구조체에서, 3'-UTR을 ζ-글로빈의 3'-UTR의 염기서열(제조예 4-1 내지 제조예 4-5의 mRNA 구조체)이나 EMCV의 IRES의 염기서열과 ζ-글로빈의 3'-UTR의 조합(제조예 4-6 내지 제조예 4-10의 mRNA 구조체)으로, 그리고 폴리(A)테일을 A60-G2의 변형 폴리(A)테일로 각각 고정하는 한편, 5'-UTR의 염기서열로 아래 표 4에 개시된 여러 종류의 5'-UTR의 염기서열들을 적용하여, 도 5의 A에 도시된 바와 같은 제조예 4-1 내지 제조예 4-10의 mRNA 구조체 10종을 설계하였다.
적용 제조예 # 명칭 염기서열(5'->3') 서열번호
4-1, 4-6 1-23b CAGCGGAAACGAGCGAAAAAAAAACAGCGGAAACGAGCGAAAAAAAAACAGCGGAAACGAGCGAAAAAAAAACAGCGGAAACGAGCGAAAAAAAAACAGCGGAAACGAGCGAGAGAGAACCCCTTAAGACC (131bp) 22
4-2, 4-7 17.2 TCCGGTCGTAAAAAAAAATCCGGTCGTAAAAAAAAATCCGGTCGTAAAAAAAAATCCGGTCGTAAAAAAAAATCCGGTCGTAGAGAGAACCCCTTAAGACC (101bp) 23
4-3, 4-8 BBV GTTTTCGAAACAAATAAAACAGAAAAGCGAACCTAAACA (39bp) 24
4-4, 4-9 PPRV AGGGGCCAAGTCCATACGACAGGCCCCAGCCCGCCAGACGGAGGGCCGCAGAAAGGAAGGAGACACGACCGCCCCAGAAGGAGGA (85bp) 25
4-5, 4-10 ΔPPRV GCCCGCCAGACGGAGGGCCGCAGAAAGGAAGGAGACACGACCGCCCCAGAAGGAGGA (57bp) 26
상기와 같이 설계된 제조예 4-1 내지 제조예 4-10의 mRNA 구조체를, 상기 실시예 [2-1]에서와 동일한 방식으로 DNA 벡터에 삽입한 다음, 인 비트로 전사시키고 생성된 mRNA를 293T 세포에 형질주입하여 나노루시퍼라아제 활성을 측정하였다.그 결과, 도 5의 B, C에 도시된 바와 같이, 3'-UTR로 ζ-글로빈의 3'-UTR의 염기서열을 이용한 경우나, 3'-UTR로 EMCV의 IRES의 염기서열과 ζ-글로빈의 3'-UTR의 조합을 이용한 경우 모두, BBV의 5’-UTR의 염기서열을 적용한 제조예 4-3, 4-8의 mRNA 구조체와 PPRV의 5’-UTR의 염기서열을 적용한 제조예 4-4, 4-5, 4-9 및 4-10의 mRNA 구조체에서 나노루시퍼라아제의 발현이 가장 높고 가장 오랫동안 지속된 것으로 확인되었다.
[실시예 3]
최적의 mRNA 구조체의 도출 및 평가
상기 [실시예 2]에서 선별된 최적의 요소들을 조합하여, 상기 실시예 1에서 특정한 mRNA 구조체에서, i) 5'-UTR로 BBV의 5’-UTR의 염기서열(서열번호 24)이나 PPRV의 5’-UTR의 염기서열(서열번호 25)을, ii) 3'-UTR로 ζ-글로빈의 3'-UTR의 염기서열(서열번호 6)이나 EMCV의 IRES의 염기서열과 ζ-글로빈의 3'-UTR의 염기서열의 조합(서열번호 13+서열번호 6)을, 그리고 iii) 폴리(A)테일로 A60-G2의 변형 폴리(A)테일(서열번호 21)을 적용하여, 도 6의 A에 도시된 바와 같은 3종의 mRNA 구조체(BBV+ζG+A60G2; CJ-1, PPRV+ζG+A60G2; CJ-2, BBV+EMCV+ζG+A60G2; CJ-3)를 제작하였다. 그리고, 상기와 같은 3종의 mRNA 구조체를, 기존에 상용화된 모더나社 및 화이자-바이오엔텍社의 mRNA 구조체와 비교하여 평가하였다.
먼저, mRNA 구조체가 백신 개발에 적용되는 경우를 고려하여, 상기 실시예 [2-1]에서와 동일한 방식으로 생성한 3종의 mRNA, 그리고 실시예 [2-1]과 유사하지만 타입 IIS 제한효소로 BsmBI(NEB社)를 사용하여 DNA를 선형화한 후 인 비트로 전사를 통해 생성된 모더나社 및 화이자-바이오엔텍社의 mRNA를, 대표적인 항원제시 세포이면서 단핵구 유래 세포인 THP-1 세포(ATCC) 또는 항원제시 면역세포이면서 근육조직에서 중요하게 작용하는 덴드리틱(dendritic) 세포 계열인 마우스 DC2.4 세포(Merck), 또는 상기 DC2.4 세포에 LPS를 처리하여 활성화시킨 세포(Activated DC2.4 Cell)에 형질주입하여 시간별로 나노루시퍼라아제의 활성을 비교하였다. 그 결과, 도 6의 B, C, D에 도시된 바와 같이, 본 발명의 3종의 mRNA 구조체가 전반적으로 모더나社 및 화이자-바이오엔텍社의 mRNA 구조체와 유사하거나 더 우수한 발현 효율을 나타내는 것으로 확인되었고, DC2.4 세포에서 본 발명의 mRNA 구조체의 높은 효율이 한층 더 두드러지게 나타나는 것으로 확인되었으며, 특히 CJ-1의 mRNA 구조체가 가장 높은 효율을 나타내는 것으로 확인되었다.
나아가, 향후 mRNA 구조체가 근육질환, 간질환, 폐질환, 안질환, 신경질환 등의 유전자 치료에 적용되는 경우를 고려하여, 상기 실시예 [2-1]에서와 동일한 방식으로 생성한 mRNA를 대표적인 근육세포인 C2C12 세포(ATCC), 대표적인 간세포인 Huh-7 세포(ATCC) 및 HepG2 세포(ATCC), 대표적인 폐세포인 A549(ATCC), 대표적인 망막세포인 AREP-19(ATCC), 대표적인 신경세포인 SH-SY5Y 세포(ATCC) 및 Neuro-2a 세포(ATCC), 및 293T 세포에 형질주입하여 시간별로 나노루시퍼라아제의 활성을 비교하였다. 그 결과, 도 7 및 도 8에 도시된 바와 같이, 모든 세포에서 본 발명의 mRNA 구조체가 높은 발현 효율을 나타내는 것으로 확인되었다. 특히, 모더나社 및 화이자-바이오엔텍社의 mRNA 구조체는 사용하는 세포에 따라 그 발현 양상이 다르게 나타났으나 본 발명의 3종의 mRNA 구조체는 세포의 종류에 상관없이 일관되게 높은 발현 효율을 나타내는 것으로 확인되었다.
상기에서는 본 발명의 바람직한 실시예를 예시적으로 설명하였으나, 본 발명의 범위는 상기와 같은 특정 실시예에만 한정되지 아니하며, 해당 분야에서 통상의 지식을 가진 자라면 본 발명의 청구범위에 기재된 범주 내에서 적절하게 변경이 가능할 것이다.

Claims (13)

  1. 목적 단백질을 암호화하는 염기서열;
    상기 목적 단백질을 암호화하는 염기서열의 하류에 배치되는 ζ-글로빈의 3’-UTR의 염기서열; 및
    상기 ζ-글로빈의 3’-UTR의 염기서열의 하류에 배치되는 (A60G)n의 반복단위를 포함하는 염기서열(여기서, n은 1 내지 3의 정수);
    을 포함하는 mRNA 구조체.
  2. 청구항 1에 있어서,
    상기 ζ-글로빈 3’-UTR의 염기서열은 서열번호 6의 염기서열을 포함하는 것인, mRNA 구조체.
  3. 청구항 1에 있어서,
    상기 (A60G)n의 반복단위를 포함하는 염기서열은 서열번호 21의 염기서열을 포함하는 것인, mRNA 구조체.
  4. 청구항 1에 있어서,
    상기 목적 단백질을 암호화하는 염기서열의 하류와 상기 ζ-글로빈의 3’-UTR의 염기서열의 상류의 사이에, EMCV(encephalomyocaditis virus)의 IRES(internal ribosome entry site)의 염기서열을 더 포함하는 것인, mRNA 구조체.
  5. 청구항 4에 있어서,
    상기 EMCV의 IRES의 염기서열은 서열번호 13의 염기서열을 더 포함하는 것인, mRNA 구조체.
  6. 청구항 1 내지 청구항 5 중 어느 한 항에 있어서,
    상기 목적 단백질을 암호화하는 염기서열의 상류에, BBV(black beetle virus)의 5’-UTR의 염기서열 또는 PPRV(peste des petits ruminants virus)의 5’-UTR의 염기서열을 더 포함하는 것인, mRNA 구조체.
  7. 청구항 6에 있어서,
    상기 BBV의 5’-UTR의 염기서열은 서열번호 24의 염기서열을 포함하는 것이고,
    상기 PPRV의 5’-UTR의 염기서열은 서열번호 25의 염기서열 또는 서열번호 26의 염기서열을 포함하는 것인, mRNA 구조체.
  8. 청구항 6에 있어서,
    상기 목적 단백질을 암호화하는 염기서열의 상류에, BBV의 5’-UTR의 염기서열을 포함하는 것인, mRNA 구조체.
  9. 청구항 6에 있어서,
    상기 mRNA 구조체는 세포에 형질주입되기 위한 것인, mRNA 구조체.
  10. 청구항 1의 mRNA 구조체를 포함하는 미생물 감염 질환의 예방 또는 치료용 약학적 조성물.
  11. 청구항 10에 있어서,
    상기 약학적 조성물은 백신인 것인 약학적 조성물.
  12. 청구항 1의 mRNA 구조체를 포함하는 암 또는 유전질환의 예방 또는 치료용 약학적 조성물.
  13. 청구항 12에 있어서,
    상기 약학적 조성물은 유전자 치료제인 것인 약학적 조성물.
PCT/KR2024/006580 2023-05-26 2024-05-14 단백질 고효율 발현용 mRNA 구조체 플랫폼 Ceased WO2024248367A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP24815745.5A EP4722367A1 (en) 2023-05-26 2024-05-14 Mrna structure platform for protein expression with high efficiency

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20230068278 2023-05-26
KR10-2023-0068278 2023-05-26

Publications (1)

Publication Number Publication Date
WO2024248367A1 true WO2024248367A1 (ko) 2024-12-05

Family

ID=93657840

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/006580 Ceased WO2024248367A1 (ko) 2023-05-26 2024-05-14 단백질 고효율 발현용 mRNA 구조체 플랫폼

Country Status (3)

Country Link
EP (1) EP4722367A1 (ko)
KR (1) KR20240170759A (ko)
WO (1) WO2024248367A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210065065A (ko) * 2019-11-26 2021-06-03 한국생명공학연구원 단백질 발현용 mRNA 구조체 및 이의 용도
KR20220159909A (ko) * 2021-05-25 2022-12-05 한국생명공학연구원 단백질 발현용 mRNA 제조방법 및 이에 의해 제조된 mRNA의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210065065A (ko) * 2019-11-26 2021-06-03 한국생명공학연구원 단백질 발현용 mRNA 구조체 및 이의 용도
KR20220159909A (ko) * 2021-05-25 2022-12-05 한국생명공학연구원 단백질 발현용 mRNA 제조방법 및 이에 의해 제조된 mRNA의 용도

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Science", MACK PUBLISHING COMPANY
DASMAHAPATRA BIMALENDU, ROZHON EDWARD J, SCHWARTZ JEROME: "Nucleic Acids Research pBD7, a novel cell-free expression vector with efficient translation initiation signal", NUCLEIC ACIDS RESEARCH, vol. 15, no. 9, 11 May 1987 (1987-05-11), pages 3933 - 3933, XP093245439, DOI: 10.1093/nar/15.9.3933 *
RUSSELL J ERIC, MORALES JULIA, MAKEYEV ALEKSANDR V, LIEBHABER STEPHEN A : "Sequence Divergence in the 3Ј Untranslated Regions of Human and ␣-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient ␣-to-Gene Developmental Switching", MOLECULAR AND CELLULAR BIOLOGY, AMERICAN SOCIETY FOR PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, US, vol. 18, no. 4, 1 April 1998 (1998-04-01), US , pages 2173 - 2183, XP093245437, ISSN: 0270-7306 *
ZHAO TAOLAN, HUAN QING, SUN JING, LIU CHUNYAN, HOU XIULI, YU XIANG, SILVERMAN IAN M., ZHANG YI, GREGORY BRIAN D., LIU CHUN-MING, Q: "Impact of poly(A)-tail G-content on Arabidopsis PAB binding and their role in enhancing translational efficiency", GENOME BIOLOGY, vol. 20, no. 1, 1 December 2019 (2019-12-01), XP093042803, DOI: 10.1186/s13059-019-1799-8 *
ZHENNING HE;DECHENG SONG;SEBASTIAAN VAN ZALEN;J ERIC RUSSELL: "Structural determinants of human ?-globin mRNA stability", JOURNAL OF HEMATOLOGY & ONCOLOGY, BIOMED CENTRAL LTD, LONDON UK, vol. 7, no. 1, 21 April 2014 (2014-04-21), London UK , pages 35, XP021182406, ISSN: 1756-8722, DOI: 10.1186/1756-8722-7-35 *

Also Published As

Publication number Publication date
EP4722367A1 (en) 2026-04-08
KR20240170759A (ko) 2024-12-04

Similar Documents

Publication Publication Date Title
JP2021504445A (ja) エプスタイン−バーウイルスワクチン
EP3307894B1 (en) Non-integrating viral delivery system and methods of use thereof
RU2007101039A (ru) Иммуностимулирующие олигонуклеотидные мультимеры
US7504098B2 (en) Method for introducing a biological molecule using a viral envelope and heparin and system therefore
CN103079597A (zh) 包含反义寡核苷酸的药物组合物及其使用方法
WO2024091037A1 (ko) 폐를 표적장기로 하는 생분해성 지질나노입자 약물 전달 제형 및 이의 활용
US10105385B1 (en) Adjuvant composition
WO2024248367A1 (ko) 단백질 고효율 발현용 mRNA 구조체 플랫폼
JP2011521648A5 (ko)
JP2004505113A (ja) 単純疱疹ウイルス糖蛋白質ｄを用いた組成物及びそれを用いて免疫応答を抑制する方法
WO2020238427A1 (zh) 特异杀伤肿瘤细胞的溶瘤病毒系统及其应用
WO2023224388A1 (ko) 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체
WO2024144272A1 (ko) 노로바이러스 gii mrna를 포함하는 백신 조성물
WO2012133997A1 (ko) 폴리소르비톨계 삼투압적 활성 전달체 및 이를 이용한 유전자 치료
CN118215486A (zh) 难治性病毒感染症的治疗剂
WO2025110722A1 (ko) 단백질 번역 효율 향상용 mRNA 구조체 및 이의 용도
WO2022173199A1 (ko) 양이온성 분자 수송체 및 sars-cov-2 mrna의 이온 복합체를 포함하는 코로나바이러스감염증-19 예방 백신 조성물
CN117947057B (zh) 一种用于预防猪瘟的mRNA纳米脂质体颗粒及其制备、检测方法
CN118662522B (zh) Mir2911在制备抗黄热病毒yfv的药物中的应用
US11898145B2 (en) Enhanced oligonucleotides for inhibiting RTEL1 expression
WO2025228275A1 (en) Circular rna-based therapeutics for methylmalonic acidemia
JP2006515172A (ja) パラポックスウイルス・オヴィスの組換えタンパク質およびそれ由来の医薬組成物
WO2024258229A1 (ko) 아포지질단백질 또는 이의 단편을 포함하는 융합 단백질 및 이의 용도
CN118634243A (zh) Mir2911在制备抗登革病毒denv的药物中的应用
WO2024085723A1 (ko) SARS-CoV-2 S1 유래 단백질 및 항체 Fc 영역 단백질을 표면에 동시에 디스플레이하는 페리틴 단백질 구조체 및 이의 코로나바이러스 SARS-CoV-2에 대한 백신 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24815745

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2024815745

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2024815745

Country of ref document: EP

Effective date: 20260102

ENP Entry into the national phase

Ref document number: 2024815745

Country of ref document: EP

Effective date: 20260102

ENP Entry into the national phase

Ref document number: 2024815745

Country of ref document: EP

Effective date: 20260102

ENP Entry into the national phase

Ref document number: 2024815745

Country of ref document: EP

Effective date: 20260102

ENP Entry into the national phase

Ref document number: 2024815745

Country of ref document: EP

Effective date: 20260102

ENP Entry into the national phase

Ref document number: 2024815745

Country of ref document: EP

Effective date: 20260102

WWP Wipo information: published in national office

Ref document number: 2024815745

Country of ref document: EP