Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
  • C12N15/1062—Isolating an individual clone by screening libraries mRNA-Display, e.g. polypeptide and encoding template are connected covalently
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P21/00—Preparation of peptides or proteins
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
  • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
  • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
  • C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads

Definitions

• the present disclosure relates to a method for producing a nucleic acid display library, a screening method, and a method for producing a polypeptide.
• Polypeptides and other medium-sized compounds have attracted attention as compounds that combine the low manufacturing costs and high stability of low-molecular-weight compounds with the binding ability to target proteins of high-molecular-weight compounds such as antibodies, and are beginning to be used in a wide range of bio-related industries, including therapeutic and diagnostic drugs.
• special polypeptides that incorporate unnatural amino acids that do not exist in nature, enabling them to achieve high target protein binding ability and stability.
• In vitro molecular evolution methods such as mRNA display, cDNA display, and ribosome display are known as methods for efficiently obtaining polypeptides with the desired activity, such as binding to a target protein.
• In vitro molecular evolution is a method in which a variety of polypeptides are bound to nucleic acids that code for the amino acid sequences of the polypeptides to produce nucleic acid-polypeptide conjugates, and then the nucleic acid-polypeptide conjugates that have the desired activity against the target substance are selected, and the base sequence of the nucleic acid portion is decoded to identify the polypeptide with the desired activity.
• the binding efficiency between the polypeptide and nucleic acid is low, so a mixture containing not only the nucleic acid-polypeptide conjugate but also unbound components such as unbound polypeptide and unbound nucleic acid is obtained.
• Patent Document 1 biotin and an enzyme cleavage site are introduced into a conjugate of mRNA and puromycin as a linker, which is then immobilized on avidin beads to perform reverse transcription of the nucleic acid, the enzyme cleavage site is cleaved, and His tag purification is performed to obtain an mRNA-polypeptide conjugate.
• the method of Patent Document 1 allows the production of a nucleic acid-polypeptide conjugate from which unbound components have been removed.
• Patent Document 1 allows the separation of nucleic acid-polypeptide conjugates from unbound components, but the separation requires multiple steps, making it complicated.
• the present disclosure relates to a simple method for producing a nucleic acid display library, as well as a screening method and a method for producing a polypeptide using the produced nucleic acid display library.
• Means for solving the above problems include the following aspects. ⁇ 1> expressing a polypeptide from a nucleic acid and linking the nucleic acid and the polypeptide to prepare a nucleic acid-polypeptide conjugate, the nucleic acid-polypeptide conjugate may or may not be provided with a modification molecule; Separating the nucleic acid-polypeptide conjugate from a mixture of a polypeptide not linked to a nucleic acid and the nucleic acid-polypeptide conjugate, independent of the base sequence of the nucleic acid and modified molecules; A method for producing a nucleic acid display library, comprising: ⁇ 2> Separating the nucleic acid-polypeptide conjugate includes: The method for preparing a nucleic acid display library according to ⁇ 1>, comprising: contacting the mixture with a solid phase carrier capable of binding to the nucleic acid of the nucleic acid-polypeptide conjugate; or adding to the mixture a solution capable of insolubilizing the nu
• ⁇ 3> The method for preparing a nucleic acid display library according to ⁇ 1> or ⁇ 2>, wherein separating the nucleic acid-polypeptide conjugates comprises contacting the mixture with a solid phase carrier capable of binding to the nucleic acid of the nucleic acid-polypeptide conjugate.
• ⁇ 4> The method for preparing a nucleic acid display library according to ⁇ 3>, further comprising eluting the nucleic acid-polypeptide conjugate bound to the solid phase carrier with water or an aqueous solution.
• ⁇ 5> The method for preparing a nucleic acid display library according to ⁇ 4>, wherein the total concentration of the dissolved substances in the aqueous solution is 0.2 M or less.
• ⁇ 6> The method for preparing a nucleic acid display library according to any one of ⁇ 2> to ⁇ 5>, wherein the surface material of the solid phase support is silica, glass, polysaccharides, a carboxy group-containing polymer, a hydroxy group-containing polymer, or hydroxyapatite.
• the solid phase carrier is a magnetic bead.
• ⁇ 8> The method for preparing a nucleic acid display library according to any one of ⁇ 2> to ⁇ 7>, wherein the solid phase carrier is a magnetic bead coated with silica or a magnetic bead coated with a carboxy group.
• ⁇ 10> The method for preparing a nucleic acid display library according to ⁇ 9>, further comprising reverse transcribing the mRNA to prepare a conjugate of the double strand of mRNA and cDNA and a polypeptide.
• ⁇ 11> A method for preparing a nucleic acid display library according to any one of ⁇ 1> to ⁇ 10>, selecting a nucleic acid-polypeptide conjugate having a desired activity from the nucleic acid display library, and identifying the base sequence of the nucleic acid of the selected nucleic acid-polypeptide conjugate;
• a screening method comprising: ⁇ 12> A method for producing a polypeptide, comprising obtaining a polypeptide having a desired activity based on the base sequence identified by the screening method according to ⁇ 11>.
• the present disclosure provides a simple method for producing a nucleic acid display library, as well as a screening method and a method for producing a polypeptide using the produced nucleic acid display library.
• a "step” or a word expressing a step includes not only a step that is independent of other steps, but also a step that cannot be clearly distinguished from other steps as long as the purpose of the step is achieved.
• a numerical range indicated using “to” indicates a range that includes the numerical values before and after "to" as the minimum and maximum values, respectively.
• the upper or lower limit value described in one numerical range may be replaced with the upper or lower limit value of another numerical range described in stages.
• the upper or lower limit value of the numerical range may be replaced with a value shown in the examples.
• each component may contain multiple types of corresponding substances.
• the total amount of the multiple substances present in the composition is meant unless otherwise specified.
• the three-letter and one-letter symbols defined by IUPAC-IUBMB JCBN (IUPAC-IUBMB Joint Commission on Biochemical Nomenclature) are used to represent amino acids.
• the amino acids referred to in this disclosure are L-amino acids unless otherwise specified.
• the unit "M" is a unit of molar concentration and is synonymous with mol/L.
• the method for preparing a nucleic acid display library includes: expressing a polypeptide from a nucleic acid and linking the nucleic acid and the polypeptide to prepare a nucleic acid-polypeptide conjugate, the nucleic acid-polypeptide conjugate may or may not be provided with a modification molecule (hereinafter, this step is also referred to as a "conjugate preparation step”); and separating the nucleic acid-polypeptide conjugate from a mixture of a polypeptide not linked to a nucleic acid and the nucleic acid-polypeptide conjugate, independent of the base sequence of the nucleic acid and modified molecules (hereinafter, this step is also referred to as the "separation step").
• nucleic acid-polypeptide conjugates in a nucleic acid display library are prepared by expressing corresponding polypeptides from multiple types of nucleic acids using a polypeptide synthesis system and linking the expressed polypeptides to nucleic acids.
• the product obtained using a polypeptide synthesis system is a mixture containing not only nucleic acid-polypeptide conjugates but also unbound components such as unbound polypeptides and unbound nucleic acids. If a method such as that described in Patent Document 1 is used, the nucleic acid-polypeptide conjugates can be separated from the unbound components and subjected to the next step.
• the inventors have proposed that a nucleic acid display library can be easily prepared while maintaining good performance of the nucleic acid display library according to the method of preparing a nucleic acid display library disclosed herein.
• the amount of unbound polypeptides is several to several hundred times that of the nucleic acid-polypeptide conjugate.
• the unbound polypeptides may occupy the action site on the target substance, and the nucleic acid-polypeptide conjugate may not be able to act on the target substance, making it possible that the target polypeptide cannot be identified.
• nucleic acids do not act on the target substance, so the performance of the resulting nucleic acid display library is not significantly impaired.
• unbound polypeptides can be removed by a method that is independent of the base sequence and modified molecules of the nucleic acid, the good performance of the nucleic acid display library can be maintained.
• unbound polypeptides can be removed simply (for example, only three steps, i.e., a solid-phase step, a washing step, and an elution step) and in a short time (for example, about 30 minutes) without requiring the multi-step (for example, eight steps consisting of a binding step to avidin beads, a washing step, a reverse transcription step, an enzyme cleavage step, a Ni-NTA bead binding step, a washing step, an elution step, and a size-exclusion purification step) and long-term (three hours or more) steps seen in the prior art, or a variety of materials (avidin beads, reverse transcriptase, a cleavage enzyme, Ni-NTA beads, a size-exclusion purification gel, etc.).
• nucleic acid display library to be prepared will be described below.
• a nucleic acid display library refers to a collection of multiple types of nucleic acid-polypeptide conjugates, each of which is a constituent unit of the nucleic acid-polypeptide conjugate. There is no limit to the number of clones or the number of copies of the nucleic acid-polypeptide conjugates constituting the nucleic acid display library.
• the polypeptide in each nucleic acid-polypeptide conjugate is the polypeptide expressed by the linked nucleic acid, i.e., the nucleic acid and the polypeptide in each nucleic acid-polypeptide conjugate correspond to each other, and the polypeptide can be identified by analysis of the nucleic acid sequence.
• the nucleic acid display library is, for example, an mRNA display library, a cDNA display library, or a ribosome display library.
• a nucleic acid-polypeptide conjugate is a structure in which a nucleic acid and a polypeptide are linked. It is preferable that the nucleic acid and the polypeptide are linked via a component such as a linker or ribosome.
• nucleic acid of the nucleic acid-polypeptide conjugate is not particularly limited.
• nucleic acid refers to a molecule that carries the information for synthesizing a polypeptide.
• Nucleic acid is a term that includes all nucleic acids (e.g., DNA, RNA, analogs thereof, natural products, and artificial products), as well as all nucleic acids to which low molecular weight compounds, groups, molecules other than nucleic acids, structures, etc. are linked.
• the nucleic acid may be a single-stranded nucleic acid or a double-stranded nucleic acid.
• the nucleic acid may comprise mRNA. In one embodiment, the nucleic acid-polypeptide conjugate may be an mRNA-polypeptide conjugate. In one embodiment, the nucleic acid may include cDNA. In one embodiment, the nucleic acid-polypeptide conjugate may be a conjugate of a double strand of mRNA and cDNA and a polypeptide (hereinafter, also referred to as "mRNA/cDNA-polypeptide conjugate"). In one embodiment, the nucleic acid-polypeptide conjugate may be a cDNA-polypeptide conjugate.
• the length of the nucleic acid of the nucleic acid-polypeptide conjugate is preferably 30 bases or more, more preferably 70 bases or more, and even more preferably 100 bases or more.
• the length of the nucleic acid of the nucleic acid-polypeptide conjugate is preferably 2000 bases or less, more preferably 1000 bases or less, and even more preferably 500 bases or less.
• the length of the nucleic acid of the nucleic acid-polypeptide conjugate is preferably 30 bases to 2000 bases, more preferably 70 bases to 1000 bases, and even more preferably 100 bases to 500 bases.
• the "length of the nucleic acid" refers to the length of the nucleic acid of one strand.
• the nucleic acid used to prepare the conjugate may be, for example, a transcription product of a population of double-stranded DNA fragments prepared by performing overlap extension PCR using a random primer set containing a random sequence.
• the random sequence is, for example, a triplet repeat sequence [NNK] m (where m is a positive integer, N is independently A, T, G or C, and K is independently T or G).
• the number of triplet [NNK] repeats can be set to any number to prepare a peptide having a random amino acid sequence of any length.
• the random sequence can be prepared by repeatedly linking an equal mixture of trimer oligonucleotides in which one type of codon is assigned to one type of amino acid. From the viewpoint of suppressing the appearance of a stop codon, the random sequence is preferably a trimer oligonucleotide rather than a triplet [NNK] repeat.
• the nucleic acid has a base sequence necessary for synthesizing a polypeptide by the cell-free peptide synthesis system.
• the base sequence necessary for polypeptide synthesis is, of course, the coding region, but also, for example, a ribosome binding sequence.
• the base sequence of the template nucleic acid may or may not contain a stop codon.
• a stop codon means a codon with which the paired tRNA is not present in the reaction solution of the cell-free peptide synthesis system. From the viewpoint of the efficiency of forming a nucleic acid-polypeptide conjugate, it is preferable that the base sequence of the template nucleic acid does not contain a stop codon.
• the 3' end of the template nucleic acid preferably contains a base sequence encoding a spacer in order to reduce steric hindrance to the action of the nucleic acid polypeptide.
• the spacer is, for example, 1 to 20 amino acid residues or peptide residues selected from glycine and serine.
• the polypeptide of a nucleic acid-polypeptide conjugate is a polypeptide expressed from a nucleic acid, and there are no limitations on the three-dimensional structure, amino acid sequence, number of amino acid residues, type of amino acid, or base sequence encoding the polypeptide.
• a polypeptide refers to a molecule in which amino acids are linked by peptide bonds.
• polypeptide encompasses proteins.
• Polypeptides include polypeptides in which amino acids have been post-translationally modified. Examples of post-translational modifications of amino acids include phosphorylation, methylation, acetylation, glycosylation, and lipid addition.
• amino acids include natural amino acids, unnatural amino acids, modified amino acids and derivatives thereof.
• natural amino acids refers to amino acids that generally constitute proteins, including alanine (Ala, A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D), cysteine (Cys, C), glutamine (Gln, Q), glutamic acid (Glu, E), glycine (Gly, G), histidine (His, H), isoleucine (Ile, I), leucine (Leu, L), lysine (Lys, K), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), serine (Ser, S), threonine (Thr, T), tryptophan (Trp, W), tyrosine (Tyr, Y), and valine (Val, V). Natural amino acids may be either natural or artificial.
• unnatural amino acids refer to amino acids other than the 20 types of amino acids listed above, and include both natural and artificial amino acids.
• Unnatural amino acids include amino acids with haloacetyl groups (e.g., chloroacetylated lysine, chloroacetyldiaminobutyric acid, and other chloroacetylated amino acids), N-methylamino acids (e.g., N-methylalanine, N-methylphenylalanine), and the like.
• Modified amino acids include labeled amino acids, which are amino acids bound to a labeling compound.
• a labeled compound is a substance that can be detected by a biochemical, chemical, immunochemical, or electromagnetic detection method.
• Labeling compounds include dye compounds, fluorescent substances, chemiluminescent substances, bioluminescent substances, enzyme substrates, coenzymes, antigenic substances, substances that bind to specific proteins, magnetic substances, etc.
• Labeled amino acids can be classified by function, including fluorescently labeled amino acids, photoresponsive amino acids, photoswitch amino acids, and fluorescent probe amino acids.
• the amino acid and the labeling compound in the labeled amino acid may be bonded directly or via a spacer.
• spacers include polyolefins such as polyethylene and polypropylene; polyethers such as polyoxyethylene, polyethylene glycol, and polyvinyl alcohol; polystyrene, polyvinyl chloride, polyester, polyamide, polyimide, polyurethane, and polycarbonate.
• Derivatives of natural amino acids, unnatural amino acids, or modified amino acids include, for example, hydroxy acids, mercapto acids, and carboxylic acids.
• the polypeptide may be a polypeptide that contains a non-natural amino acid.
• polypeptides that contain non-natural amino acids include the polypeptides that contain the non-natural amino acids listed above.
• the polypeptide may be a cyclic polypeptide containing an unnatural amino acid.
• cyclic polypeptides containing an unnatural amino acid include polypeptides that contain an amino acid having a thiol group (e.g., cysteine) and an amino acid having a chloroacetyl group (e.g., chloroacetyldiaminobutyric acid, chloroacetylated lysine) in one molecule.
• the thiol group and the chloroacetyl group react to cyclize, resulting in a cyclic polypeptide.
• the number of amino acid residues in the polypeptide of the nucleic acid-polypeptide conjugate is preferably 6 or more from the viewpoint of expression of the polypeptide's activity. Furthermore, the number of amino acid residues in the polypeptide of the nucleic acid-polypeptide conjugate is preferably 600 or less, more preferably 300 or less, and even more preferably 150 or less, from the viewpoint of the efficiency of formation of the nucleic acid-polypeptide conjugate. From this viewpoint, the number of amino acid residues in the polypeptide of the nucleic acid-polypeptide conjugate is preferably 6 to 600 residues, more preferably 6 to 300 residues, and even more preferably 6 to 150 residues.
• the nucleic acid and the polypeptide may be linked via a linker.
• a linker is a structure that functions as a linking portion that links a nucleic acid and a corresponding polypeptide.
• the linker is a compound comprising a puromycin-like compound and a single-stranded nucleic acid of 10 to 100 bases (hereinafter, this compound is also referred to as a "puromycin linker").
• the puromycin linker binds to the polypeptide via the puromycin-like compound.
• the single-stranded nucleic acid of the puromycin linker has a sequence (hereinafter, also referred to as a "complementary portion") complementary to a portion of the nucleic acid portion (e.g., the 3' end of mRNA) constituting the nucleic acid-polypeptide conjugate, and binds to the nucleic acid portion at the complementary portion. This forms a nucleic acid-polypeptide conjugate.
• a puromycin-like compound is a compound that has a chemical structure similar to the 3' end of aminoacyl-tRNA and has the ability to bind to the C-terminus of a synthesized polypeptide when protein synthesis is performed in a cell-free peptide synthesis system.
• Aminoacyl-tRNA is a tRNA in which an amino acid is covalently bound to the tRNA.
• puromycin-like compounds include 3'-N-aminoacyl puromycin aminonucleosides (PANS-amino acids; for example, PANS-Gly, PANS-Val, PANS-Ala, etc.); 3'-N-aminoacyladenosine aminonucleosides (AANS-amino acids; for example, AANS-Gly, AANS-Val, AANS-Ala, etc.) linked by an amide bond formed by dehydration condensation of the amino group of 3'-aminoadenosine and the carboxyl group of an amino acid; nucleosides or compounds in which a nucleoside and an amino acid are linked by an ester bond; ribocytidyl puromycin, deoxydyl puromycin, deoxyuridyl puromycin, etc.
• PANS-amino acids for example, PANS-Gly, PANS-Val, PANS-Ala, etc.
• AANS-amino acids for example
• the complementary portion refers to a portion of a single-stranded nucleic acid that binds to a nucleic acid by having a sequence complementary to a portion of the nucleic acid in the nucleic acid-polypeptide conjugate. From the viewpoint of the efficiency of forming a nucleic acid-polypeptide conjugate, it is preferable that the complementary portion binds to the 3' end side of the region of the nucleic acid that codes for the polypeptide. Also, from the viewpoint of suppressing dissociation between the nucleic acid and the puromycin linker, it is preferable to use a 2'-O-methylated complementary portion.
• the complementary portion and the nucleic acid portion form a covalent bond by introducing an ultraviolet crosslinking compound, for example.
• the number of bases in the complementary portion is preferably 15 to 40, more preferably 20 to 30.
• the puromycin linker may contain a spacer between the puromycin-like compound and the complementary portion.
• the spacer may be any structure capable of linking the puromycin-like compound to the complementary portion, and examples of the spacer include polynucleotides, polyalkylenes (e.g., polyethylene), polyalkylene glycols (e.g., polyethylene glycol), peptide nucleic acids, polystyrene, and combinations thereof.
• the nucleic acid-polypeptide conjugate may or may not have a modifying molecule.
• the modifying molecule in the nucleic acid-polypeptide conjugate refers to a molecule added to the nucleic acid-polypeptide conjugate other than the nucleic acid encoding the polypeptide and the polypeptide.
• the modifying molecule also includes the above-mentioned linker (puromycin linker, etc.) and the labeling compound in the above-mentioned modified amino acid.
• Other modifying molecules include molecules that impart binding specificity, such as biotin, azide, alkyne, affinity tag, His tag, FLAG tag, etc.
• a polypeptide is expressed from a nucleic acid, and the nucleic acid and the polypeptide are ligated to prepare a nucleic acid-polypeptide conjugate.
• the conjugate preparation step is carried out by a cell-free peptide synthesis system.
• the cell-free peptide synthesis system is a reaction system for polypeptide synthesis that does not use cells such as E. coli as they are, but utilizes components present in the cells of E. coli, etc., and includes a system that uses a cell extract and a system that uses a reaction solution reconstituted with purified components of the cell extract (reconstituted cell-free peptide synthesis system). Examples of those using cell extracts include those using Escherichia coli extracts, wheat germ extracts, rabbit red blood cell extracts, and insect cell extracts.
• the reconstituted cell-free cell-free peptide synthesis system can be constructed using purified ribosomal proteins, aminoacyl-tRNA synthetases (ARS), ribosomal RNA, amino acids, GTP, ATP, translation initiation factors (IFs), elongation factors (EFs), release factors (RFs), ribosome recycling factors, and other factors necessary for cell-free peptide synthesis.
• ARS aminoacyl-tRNA synthetases
• ribosomal RNA amino acids
• GTP GTP
• ATP translation initiation factors
• EFs elongation factors
• RFs release factors
• ribosome recycling factors and other factors necessary for cell-free peptide synthesis.
• any known cell-free peptide synthesis system can be used for the conjugate production process.
• Examples of commercially available cell-free peptide synthesis systems include PUREfrex (Gene Frontier), PUREx In Vitro Protein Synthesis Kit (New England BioLabs), S30 T7 High-Yield Protein Expression System (Promega), Human Cell-Free Protein Expression System (Takara Bio), Rapid Translation System (Roche), and Expressway Cell-Free Expression System (Invitrogen).
• the nucleic acid provided to the cell-free peptide synthesis system is a nucleic acid having a puromycin linker bound to the 3' end.
• the expressed polypeptide may be a polypeptide containing a non-natural amino acid. Details of the non-natural amino acid are as described above.
• the expressed polypeptide contains an amino acid having a first functional group and an amino acid having a second functional group covalently bonded to the first functional group, with 6 to 16 amino acids between the amino acid having the first functional group and the amino acid having the second functional group.
• the first functional group and the second functional group can react to cyclize, resulting in a cyclic polypeptide.
• the conjugate preparation step includes cyclizing the polypeptide of the nucleic acid-polypeptide conjugate by covalently bonding the first functional group and the second functional group.
• the cyclization may be formed in an mRNA-polypeptide conjugate, an mRNA/cDNA-polypeptide conjugate, or a cDNA-polypeptide conjugate.
• the first functional group and the second functional group may be the same type of functional group or different types of functional groups as long as they are covalently bonded.
• Examples of combinations of the first functional group and the second functional group include a thiol group and a chloroacetyl group, a thiol group and a thiol group, and a carboxyl group in a side chain and an amino group in a side chain.
• An example of an amino acid having a thiol group is cysteine.
• amino acids having a chloroacetyl group include chloroacetyldiaminobutyric acid and chloroacetylated lysine.
• Examples of amino acids having a carboxy group in the side chain include aspartic acid and glutamic acid.
• Examples of amino acids having an amino group in the side chain include lysine, asparagine, and glutamine.
• the method for producing a nucleic acid display library disclosed herein may further include reverse transcribing the mRNA-polypeptide conjugate to produce a conjugate of the double-stranded mRNA and cDNA and the polypeptide.
• the nucleic acid portion becomes a double-stranded nucleic acid, which is more preferable because it is possible to obtain a nucleic acid display library that is free of the effects of tertiary structure formation of mRNA.
• the nucleic acid-polypeptide conjugate is separated from a mixture of the polypeptide not linked to a nucleic acid and the nucleic acid-polypeptide conjugate, independent of the base sequence of the nucleic acid and the modified molecule.
• separating a nucleic acid-polypeptide conjugate from a mixture of a polypeptide not linked to a nucleic acid and a nucleic acid-polypeptide conjugate, independent of the base sequence of the nucleic acid and a modifying molecule means separating a polypeptide not linked to a nucleic acid and a nucleic acid-polypeptide conjugate, and does not necessarily mean isolating only the nucleic acid-polypeptide conjugate.
• the obtained nucleic acid-polypeptide conjugate may be mixed with other substances such as unbound nucleic acid.
• separation of the nucleic acid-polypeptide conjugate is preferably carried out by the following method.
• (1) The mixture obtained in the conjugate preparation step is contacted with a solid-phase carrier capable of binding to the nucleic acid of the nucleic acid-polypeptide conjugate.
• this method is also referred to as the "solid-phase adsorption method.”
• (2) A solution capable of insolubilizing nucleic acids is added to the mixture obtained in the conjugate preparation step.
• this method is also referred to as the "insolubilization method.”
• Methods (1) and (2) are particularly examples of simple separation methods. Among them, the solid-phase adsorption method is preferred from the viewpoints of purification yield, efficiency of removing impurities, and processing speed.
• the mixture is contacted with a solid-phase carrier capable of binding to the nucleic acid of the nucleic acid-polypeptide conjugate (hereinafter also referred to as the "adsorption step").
• the method for preparing a nucleic acid display library of the present disclosure may further include eluting the nucleic acid-polypeptide conjugate bound to the solid support with water or an aqueous solution (hereinafter also referred to as the "elution step").
• the surface material of the solid phase used in the solid-phase adsorption method may be any material to which nucleic acids can be adsorbed. Nucleic acids may be adsorbed to the carrier by any of the following means: covalent bond, chemical adsorption, physical adsorption, electrical interaction, hydrophobic interaction, van der Waals force, hydrogen bond, etc. From the viewpoint of reducing the inclusion of impurities in the elution solution, the surface material of the solid phase is preferably a material that allows the nucleic acid-polypeptide conjugate to be eluted with water.
• nucleic acid adsorption mechanism that enables the nucleic acid-polypeptide conjugate to be eluted with water
• examples of the nucleic acid adsorption mechanism that enables the nucleic acid-polypeptide conjugate to be eluted with water include materials that exhibit chaotropic interactions with nucleic acids.
• examples of surface materials that exhibit chaotropic interactions with nucleic acids include silica, glass, polysaccharides (cellulose, dextran, agarose, etc.), carboxy group-containing polymers, hydroxy group-containing polymers, and hydroxyapatite.
• the form of the solid phase used in the solid-phase adsorption method is not particularly limited, and may be, for example, a column, a resin, or magnetic beads. From the viewpoint of purification yield, resin and magnetic beads are preferred, and from the viewpoint of processing speed, magnetic beads are more preferred. In one embodiment, the magnetic beads are preferably silica-coated magnetic beads and carboxy-coated magnetic beads.
• the adsorption step may be carried out by contacting a mixture obtained by mixing the mixture obtained in the conjugate preparation step with a solution capable of insolubilizing nucleic acid with a solid phase carrier.
• the solution capable of insolubilizing nucleic acid includes a solution containing a component that removes hydration water of nucleic acid.
• the component that removes hydration water of nucleic acid includes chaotropic salts, water-soluble organic solvents, water-soluble polymers, etc.
• the component that removes hydration water of nucleic acid may be used alone or in combination of two or more kinds.
• chaotropic salts include sodium chloride, potassium chloride, ammonium chloride, sodium bromide, potassium bromide, calcium bromide, ammonium bromide, sodium iodide, potassium iodide, sodium perchlorate, guanidine hydrochloride, guanidine thiocyanate, guanidine sulfate, guanidine isothiocyanate, sodium isocyanate, urea, sodium thiocyanate, potassium thiocyanate, ammonium isothiocyanate, etc.
• One type of chaotropic salt may be used alone, or two or more types may be used in combination.
• water-soluble organic solvent examples include methanol, ethanol, isopropyl alcohol, n-propanol, n-butanol, 2-butanol, and dimethyl sulfoxide.
• the water-soluble organic solvent may be used alone or in combination of two or more kinds.
• water-soluble polymer examples include polyethylene glycol, polysaccharides, etc.
• the water-soluble polymer may be used alone or in combination of two or more kinds.
• concentration of the chaotropic salt in the mixture in the adsorption step may be appropriately determined within a range that allows the nucleic acid to be adsorbed onto the solid phase carrier.
• the elution step may be carried out by contacting the solid phase carrier to which the nucleic acid-polypeptide conjugate is adsorbed with water or an aqueous solution.
• the aqueous solution for elution include aqueous solutions that do not contain any of the above-mentioned components for removing the hydration water of nucleic acids, or have low concentrations of such components.
• the total concentration of the lysate in the aqueous solution for elution may be appropriately determined within a range in which the nucleic acid can be eluted, but a lower concentration is preferable because it has less effect on the next step.
• the total concentration of the lysate in the aqueous solution may be 0.2M or less, 0.1M or less, or 0.05M or less.
• the total concentration of the lysate in the aqueous solution may be 0.0001M or more, 0.001M or more, or 0.01M or more. Therefore, the total concentration of the lysate in the aqueous solution may be 0.0001M to 0.2M, 0.001M to 0.1M, or 0.01M to 0.05M.
• the lysate is any substance that dissolves in an aqueous solution, and examples of such substances include acids, alkalis, salts, and surfactants.
• the mixture may be contacted with the solid phase carrier at a first pH in the adsorption step, and then the nucleic acid-polypeptide conjugate may be eluted with an aqueous solution at a second pH in the elution step, the first pH and the second pH being different pHs.
• the first pH is preferably from 1.0 to 6.5, and more preferably from 3.0 to 6.5.
• the second pH is preferably from 7.5 to 10.0, and more preferably from 8.0 to 9.0.
• washing can be performed using a solution that can maintain the adsorption of the nucleic acid-polypeptide conjugate to the solid phase carrier.
• the above-mentioned solution can be used as a solution that can insolubilize nucleic acid. Washing can also be performed using an aqueous alcohol solution (70% ethanol, etc.).
• Insolubilization method a solution capable of insolubilizing nucleic acid is added to the mixture.
• the solution capable of insolubilizing nucleic acid is as described above.
• the composition of the solution for insolubilizing nucleic acid may be appropriately determined within a range in which nucleic acid can be precipitated.
• Insolubilization may be promoted by cooling after addition of the solution for insolubilizing nucleic acid.
• the cooling range is preferably 4°C or lower, more preferably -20°C or lower.
• the separation step may be performed on the mRNA-polypeptide conjugate before reverse transcription, or on the mRNA/cDNA-polypeptide conjugate after reverse transcription. It is preferable to perform the separation step on the mRNA/cDNA-polypeptide conjugate after reverse transcription, since this is expected to increase the total amount of nucleic acid and improve the recovery efficiency during purification.
• the method for preparing a nucleic acid display library may include steps other than the conjugate preparation step and the separation step.
• the method may include a step of preparing a cDNA-polypeptide conjugate by allowing an RNase to act on an mRNA/cDNA-polypeptide conjugate, a step of modifying or labeling the polypeptide in the nucleic acid-polypeptide conjugate, and a step of separating and/or purifying the nucleic acid-polypeptide conjugate depending on the base sequence of the nucleic acid, the amino acid sequence of the polypeptide, or a modifying molecule.
• the separation step may be performed on either the mRNA/cDNA-polypeptide conjugate or the cDNA-polypeptide conjugate.
• the screening method of the present disclosure includes preparing a nucleic acid display library by the above-described method for preparing a nucleic acid display library of the present disclosure, selecting a nucleic acid-polypeptide conjugate having a desired activity from the nucleic acid display library, and identifying the nucleic acid base sequence of the selected nucleic acid-polypeptide conjugate.
• Target activity is, for example, binding to a target substance.
• Target substance is a term that includes any chemical substance that exhibits physiological activity, including compounds, groups, molecules, proteins, nucleic acids, lipids, carbohydrates, and complexes thereof.
• Target substances are, for example, receptors, transcription factors, enzymes, coenzymes, regulatory factors, antibodies, antigens, DNA, RNA, exosomes, cells, tissues, fragments thereof, complexes thereof, and modifying groups thereof.
• the screening method of the present disclosure includes contacting and incubating the nucleic acid display library with the target substance.
• the nucleic acid display library and the target substance are contacted in a buffer solution, and incubated by adjusting the pH and temperature of the buffer solution and the contact time.
• the target substance may be immobilized on a solid phase carrier, and the nucleic acid display library may be contacted with the immobilized target substance.
• the solid phase carrier includes a microtiter plate, a substrate, beads, magnetic beads, a nitrocellulose membrane, a nylon membrane, and a PVDF membrane.
• the target substance is immobilized on the solid phase carrier by a known technique.
• the nucleic acid-polypeptide conjugates bound to the target substance are extracted, and the base sequence of the nucleic acid in the extracted nucleic acid-polypeptide conjugate is identified.
• the base sequence can be identified using a nucleic acid amplification system and a sequencer.
• a nucleic acid amplification system refers to a system that uses nucleic acid as a template to amplify nucleic acid.
• the nucleic acid amplification reaction of a nucleic acid amplification system may be any of the following: polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), etc.
• sequencer is a term including first-generation sequencers (capillary sequencers), second-generation sequencers (next-generation sequencers), third-generation sequencers, fourth-generation sequencers, and sequencers to be developed in the future.
• the sequencer may be a capillary sequencer, a next-generation sequencer, or another sequencer.
• a next-generation sequencer is preferable from the viewpoints of speed of analysis, the number of samples that can be processed at one time, etc.
• Next-generation sequencers refer to sequencers classified in contrast to capillary sequencers (called first-generation sequencers) that use the Sanger method.
• next-generation sequencers are sequencers that determine base sequences by capturing fluorescence or luminescence linked to complementary strand synthesis by DNA polymerase or complementary strand ligation by DNA ligase.
• Specific examples include MiSeq (Illumina, Inc., MiSeq is a registered trademark), HiSeq2000 (Illumina, Inc., HiSeq is a registered trademark), Roche454 (Roche), etc.
• the method for producing a polypeptide of the present disclosure includes obtaining a polypeptide having a desired activity based on a base sequence identified by the screening method of the present disclosure.
• the screening method and the method for identifying a base sequence are as described above.
• the polypeptide can be obtained based on the identified base sequence using a known polypeptide synthesis system.
• Examples of the polypeptide synthesis system include the above-mentioned cell-free peptide synthesis system, as well as a chemical synthesis system and a genetic engineering synthesis system. From the viewpoint of purity, a chemical synthesis system is preferred.
• the disclosed nucleic acid display library production method, screening method, and polypeptide production method can be widely used in the development of therapeutic drugs, diagnostic agents, research reagents, pharmaceutical production, biomaterials production, etc.
• Example 1 Establishment of Conditions for Separation Step After the conjugate preparation step and the separation step, removal of unbound polypeptide was confirmed by the following method.
• SEQ ID NO: 1 The sequence of SEQ ID NO: 1 was used as the nucleic acid sequence for evaluation.
• cell-free peptide synthesis begins from the initiation codon (ATG) at positions 86 to 88 from the 5' end
• the 89th to 106th bases are a sequence that increases the amount of cell-free peptide synthesis
• the 107th to 139th bases are a sequence that codes for a HiBiT tag (Promega)
• the 161st and subsequent base groups (NNNTGT(NNN) 12 TAGNNN (NNN is a trimer oligonucleotide described in Table 1, where N each independently represents A, T, G, or C)) are random sequences
• the base group located on the 3' end side of the random sequence is the binding site of the puromycin linker and the stop codon.
• the triplet TAG in this random sequence corresponds to the codon for chloroacetylated lysine, which is an unnatural amino acid. Therefore, in the polypeptide encoded by this random sequence, the thiol group of cysteine and the chloroacetyl group of chloroacetylated lysine spontaneously form a thioether bond, resulting in a cyclic polypeptide.
• the group of bases up to the 85th base from the 5' end is a sequence necessary for initiating transcription and cell-free peptide synthesis, such as a T7 promoter sequence and a Shine-Dalgarno sequence.
• the library of sequence number 1 was prepared by overlap extension PCR. Specifically, the three types of DNA, DNA of sequence number 2, DNA of sequence number 3, and DNA of sequence number 4, were mixed at 3 ⁇ mol/L, 1 ⁇ mol/L, and 1 ⁇ mol/L, respectively, and in the presence of Platinum SuperFi II DNA Polymerase (Thermo, 12361010), the three steps of 98°C/30 seconds, 98°C/10 seconds, 60°C/10 seconds, and 72°C/10 seconds were repeated for seven cycles, and finally, 72°C/5 minutes were treated, thereby linking the three DNAs and preparing the desired library.
• the prepared library was purified and diluted to 10 ng/ ⁇ L.
• the trimer oligonucleotide represented by NNN is an equal mixture of trimer oligonucleotides corresponding to the 18 types of codons shown in Table 1, with one type of codon assigned to one type of amino acid.
• SEQ ID NO: 2 GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTGTTTAACTTTAAGAAGGAGATATACATATGGTTAAGAAAACAAAAACAGTAAGTGGATGGCGATTATTCAAGAAGATTAGCGAAGAAGGAGATATACATATG SEQ ID NO: 3: ATACTCAAGCTTATTATTTATTTATTACCCCCCGCCCCCCGTCCTGCTACCGCCAGAACCACC SEQ ID NO: 4: AAGAAGGAGATATACATATGNNNTGT (NNN) 12 TAGNNNNGGCGGTTCTGGCGGTAGC
• the library (SEQ ID NO:1) was reacted in the presence of T7 RNA Polymerase (TaKaRa, 2540A) at 37°C for 30 minutes to produce library transcripts.
• T7 RNA Polymerase TaKaRa, 2540A
• the mRNA fragments were purified and diluted to 10 ⁇ M.
• the library transcript final concentration 5.0 ⁇ M
• the puromycin linker of sequence number 5 final concentration 10 ⁇ M
• TBS buffer 1.25 mM Tris, 25 mM NaCl, pH 7.5
• 10 J of UV 365 nm
• an example in which water was added instead of the puromycin linker was prepared and used to evaluate the separation efficiency of the polypeptide.
• the nucleic acid and the polypeptide are not linked in this comparative example, so the remaining amount of the polypeptide in this comparative example can be used as an index to measure the separation efficiency.
• SEQ ID NO:5 (PsoralenC6)-UACCCCCCGCCGCCCCCCCCGUCCU-(Sp18)-(Sp18)-(Sp18)-CC-(Puro) (See the diagram below for the structures of PsoralenC6, Sp18, and Puro.
• the nucleotides between (PsoralenC6) and (Sp18) are RNA modified with OMe at the 2' position, and the other nucleotides represent unmodified DNA.
• a tRNA with an anticodon of CUA that pairs with the UAG codon of mRNA was prepared by transcribing the DNA of SEQ ID NO: 34.
• This tRNA was aminoacylated with an N-chloroacetylated lysine pdCpA (5'-Phospho-2'-deoxyribocytidylylriboadenosine) ester.
• This aminoacyl-tRNA is called aminoacyl-tRNA(1).
• SEQ ID NO: 34 GTTGTAAAAACGACGGCCAGTGCCAAGCTTGGGCTAATACGACTCACTATAGGGAGAGTAGTTCAATGGTAGAACGTCGGTCTCTAAAAACCGAGCGTTGAGGGTTCGATTCCTTTCTCTCCAC
• the complex of the library transcript and puromycin linker was reacted in a cell-free peptide synthesis solution containing PUREfrex2.0 (Gene Frontier, PF201-0.25-5) and aminoacyl-tRNA (1) (complex 6 ⁇ L/reaction volume 20 ⁇ L, aminoacyl-tRNA (1) final concentration 0.5 ⁇ g/ ⁇ L) at 37°C for 60 minutes to perform cell-free peptide synthesis and produce a nucleic acid (mRNA)-polypeptide conjugate.
• PUREfrex2.0 Gene Frontier, PF201-0.25-5
• aminoacyl-tRNA (1) complex 6 ⁇ L/reaction volume 20 ⁇ L, aminoacyl-tRNA (1) final concentration 0.5 ⁇ g/ ⁇ L
• the unbound polypeptides from the cell-free peptide synthesis products were separated using a column or magnetic beads. For comparison, an example was also prepared in which this separation step was not performed.
• the separation step using the column was carried out using RNeasy MinElute Cleanup Kit (QIAGEN, 74204, silica gel membrane). First, 14 ⁇ L of the cell-free peptide synthesis product, 50 ⁇ L of Buffer RLT, and 70 ⁇ L of ethanol were mixed and passed through a spin column provided with the kit to bind the nucleic acid-polypeptide conjugate to the silica gel membrane in the spin column.
• the nucleic acid-polypeptide conjugate was eluted using 14 ⁇ L of water.
• the separation step using magnetic beads was carried out using RNAClean XP (Beckman Coulter, A63987, carboxyl group-containing polymer-coated magnetic beads).
• 14 ⁇ L of the cell-free peptide synthesis product was mixed with 25 ⁇ L of RNAClean XP beads, and the mixture was shaken for 5 minutes to bind the nucleic acid-polypeptide conjugate to the RNAClean XP beads.
• the mixture was then placed on a magnet rack and left to stand until the magnetic beads had precipitated, after which the supernatant was removed, the magnetic beads were washed five times with 200 ⁇ L of 70% ethanol, and 14 ⁇ L of water was added and left to stand for 5 minutes to elute the nucleic acid-polypeptide conjugate.
• the mixture was placed on a magnet rack and left to stand until the magnetic beads had precipitated, and the eluted supernatant was collected.
• the polypeptide and nucleic acid concentrations of the reverse transcription products or the products after removal of unbound polypeptide were quantified for each of the types and the presence or absence of a separation process for separating unbound polypeptide, and the presence or absence of a puromycin linker required for linking the polypeptide and nucleic acid.
• the removal rate of unbound polypeptide was calculated from the polypeptide concentration under conditions in which the puromycin linker was not added, and the yield of the nucleic acid-polypeptide conjugate was calculated from the nucleic acid concentration under conditions in which the puromycin linker was added.
• Polypeptide concentrations were quantified using HiBiT tags. Specifically, measurements were performed using the Nano Glo HiBiT Lytic Detection System (Promega, N3040) and a chemically synthesized polypeptide (SEQ ID NO: 7) with a known concentration for a calibration curve, according to the standard protocol for the Nano Glo HiBiT Lytic Detection System. The quantitative results are shown in Table 2.
• the nucleic acid concentration was quantified by qPCR using primers of sequence numbers 8 and 9 and a calibration curve DNA of known concentration (sequence number 10).
• SEQ ID NO: 8 GGAGATATACATATGGTTAAGAAAACAAAAAC
• SEQ ID NO: 9 CTGCTACCGCCAGAACCACC
• SEQ ID NO: 10 GCTACCGCCAGAACCACCTGCCTAACGATAGTTATCACCACGCGGTTCACATGCTGTTTTTGTTTTCTTAACCATATGTATATCTCCTTCTAAAGTTAAAACAAAATTATTTCTAGAGGGAAACCGTTGTGGTCTCCCC
• No. 4 to No. 6 are conditions in which no puromycin linker was added, and all of the polypeptides detected under these conditions are unbound polypeptides.
• the polypeptide concentration in No. 4 and No. 5 is 1/100th or less due to the separation step, demonstrating that the display library production method disclosed herein can remove 99% or more of the unbound polypeptides.
• No. 1 to No. 3 are conditions in which puromycin linker is added, and the detected polypeptide concentration is the combined value of unbound polypeptide and nucleic acid-polypeptide conjugate. Therefore, the polypeptide concentrations of No. 1 and No. 2 are higher than those of No. 4 and No. 5. The polypeptide concentrations of No. 1 and No. 2 are reduced to about 3% compared to No. 3. In contrast, the nucleic acid concentrations of No. 1 and No. 2 are about 73% and about 64% of No. 3, respectively, and the loss of nucleic acid-polypeptide conjugate in the separation process is low at about 27% and about 36%. This indicates that this separation method is highly practical.
• Example 2 Preparation of nucleic acid-polypeptide conjugates using various cell-free peptide synthesis systems
• Nucleic acid-polypeptide conjugates were prepared using PUREexpress In Vitro Protein Synthesis Kit (NEB, E6800) and S30 T7 High-Yield Protein Expression System (Promega, L1110) in addition to PUREfrex described in Example 1.
• the steps other than cell-free peptide synthesis were the same as in Example 1.
• the cell-free peptide synthesis process was carried out as follows.
• the complex of the library transcript and the puromycin linker was reacted in a cell-free peptide synthesis solution containing the PURExpress In Vitro Protein Synthesis Kit (complex 6 ⁇ L/reaction volume 20 ⁇ L, aminoacyl-tRNA (1) final concentration 0.5 ⁇ g/ ⁇ L) or in the S30 T7 High-Yield Protein Expression System (complex 4.8 ⁇ L/reaction volume 20 ⁇ L, aminoacyl-tRNA (1) final concentration 0.5 ⁇ g/ ⁇ L) for 60 minutes at 37° C. to perform cell-free peptide synthesis, thereby producing a nucleic acid (mRNA)-polypeptide conjugate.
• mRNA nucleic acid
• Example 3 Implementation of mRNA Display Method Using the method for producing a display library of the present disclosure, polypeptides that bind to FGFR1c protein were collected from a random library.
• sequences of SEQ ID NOs: 11 to 21 were used as libraries for the mRNA display method.
• cell-free peptide synthesis begins with the initiation codon (ATG) at positions 86 to 88 from the 5' end, the group of bases from the 107th position onwards (NNNTGT(NNN) 6 to 16 TAGNNN (NNN is a trimer oligonucleotide, where N each independently represents A, T, G or C)) is a random sequence, and the group of bases located on the 3' end side of the random sequence is the binding site of the puromycin linker and a stop codon.
• ATG initiation codon
• NNN trimer oligonucleotide, where N each independently represents A, T, G or C
• the group of bases before the 85th position from the 5' end is a sequence necessary for transcription and initiation of cell-free peptide synthesis, such as a T7 promoter sequence and a Shine-Dalgarno sequence.
• the triplet TAG in this random sequence corresponds to a codon for chloroacetylated lysine. Therefore, in the polypeptide encoded by this random sequence, the thiol group of cysteine and the chloroacetyl group of chloroacetylated lysine spontaneously form a thioether bond, resulting in a cyclic polypeptide.
• the trimer oligonucleotides represented by NNN are an equal mixture of trimer oligonucleotides corresponding to the 18 types of codons shown in Table 1, in which one type of codon is assigned to one type of amino acid.
• NNN For parts 6 to 16 , 11 types of libraries with different repeat numbers of 6 to 16 were individually prepared, mixed in equal amounts, and mRNA display was performed.
• NNN is a trimer oligonucleotide, where each N independently represents A, T, G, or C.
• the number of repeats of (NNN) is 6 in SEQ ID NO: 11, 7 in SEQ ID NO: 12, and 8 in SEQ ID NO: 13.
• the library of SEQ ID NOs: 11 to 21 was prepared by overlap extension PCR. Specifically, three types of DNA, DNA of SEQ ID NO: 22, DNA of SEQ ID NO: 3, and any of DNAs of SEQ ID NOs: 23 to 33, were mixed at 3 ⁇ mol/L, 1 ⁇ mol/L, and 1 ⁇ mol/L, respectively, and in the presence of Platinum SuperFi II DNA Polymerase (Thermo, 12361010), three steps of 98°C/30 seconds, 98°C/10 seconds, 60°C/10 seconds, and 72°C/10 seconds were repeated for seven cycles, and finally, 72°C/5 minutes were treated, thereby linking the three DNAs and preparing the desired library.
• the prepared library was purified and diluted to 10 ng/ ⁇ L.
• the trimer oligonucleotide represented by NNN is an equal mixture of trimer oligonucleotides corresponding to the 18 types of codons shown in Table 1, in which one type of codon is assigned to one type of amino acid.
• SEQ ID NO: 22 GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGTTAAAAAAACAAAAC
• SEQ ID NO: 23 AAGAAGGAGATATACATATGGTTAAAAAAACAAAACANNNTGT (NNN) 6 TAGNNNGGCGGTTCTGGCGGTAGC
• SEQ ID NO: 24 AAGAAGGAGATATACATATGGTTAAAAAAACAAAACANNNTGT (NNN) 7 TAGNNNGGCGGTTCTGGCGGTAGC SEQ ID NO: 25: AAGAAGGAGATATACATATGGTTAAAAAAACAAAACANNNTGT (NNN) 8 TAGNNNGGCGGTTCTGGCGGTAGC SEQ ID NO: 26: AAGAAGGAGATATACATATGGTTAAAAAAACAAAACANNNTGT (NNN) 9 TAGNNNGGCGGTTCTGGCGGTAGC SEQ ID NO: 27: AAGAAGGAGATATACATATGG
• FGFR protein was immobilized (FGFR protein concentration at immobilization: 1 ⁇ g/ ⁇ L) on magnetic beads (NHS Mag Sepharose, Cytiva, 28951380) according to the protocol specified by the manufacturer (Cytiva).
• the library (SEQ ID NOs: 11 to 21) was reacted in the presence of T7 RNA Polymerase (TaKaRa, 2540A) at 37°C for 30 minutes to produce library transcripts.
• T7 RNA Polymerase TaKaRa, 2540A
• the mRNA fragments were purified and diluted to 10 ⁇ M.
• the library transcripts (final concentration 5 ⁇ M) and puromycin linker of sequence number 5 (final concentration 10 ⁇ M) were mixed in TBS buffer (1.25 mM Tris, 25 mM NaCl, pH 7.5), heated at 95°C for 5 minutes, and then irradiated with 10 J of UV (365 nm) on ice to produce a complex of the library transcripts and puromycin linker.
• the complex of the library transcript and puromycin linker was subjected to a cell-free peptide synthesis reaction in a cell-free peptide synthesis solution containing PUREfrex (Gene Frontier) and aminoacyl-tRNA (complex 6 ⁇ L/reaction volume 20 ⁇ L, aminoacyl-tRNA (1) final concentration 0.5 ⁇ g/ ⁇ L) at 37°C for 60 minutes to produce a nucleic acid (mRNA)-polypeptide conjugate.
• PUREfrex Gene Frontier
• aminoacyl-tRNA complex 6 ⁇ L/reaction volume 20 ⁇ L, aminoacyl-tRNA (1) final concentration 0.5 ⁇ g/ ⁇ L
• RNAClean XP Beckman Coulter, A63987
• the mixture was placed on a magnetic rack and left to stand until the magnetic beads had settled, after which the supernatant was removed, the magnetic beads were washed five times with 200 ⁇ L of 70% ethanol, and 15 ⁇ L of water was added and left to stand for 5 minutes to elute the nucleic acid-polypeptide conjugate.
• the mixture was placed on a magnetic rack and left to stand until the magnetic beads had settled, after which the eluted supernatant was collected.
• the unbound polypeptide removal product or reverse transcription product was mixed with 10 ⁇ L of magnetic bead-immobilized FGFR in TBS buffer (20 mM Tris, 150 mM NaCl, 0.1% BSA, 0.05% Tween 20, pH 7.4) (reaction volume 100 ⁇ L), and after reacting at room temperature for 45 minutes, the magnetic beads were washed three times with 100 ⁇ L of TBS buffer to extract nucleic acid-polypeptide conjugates that bind to FGFR protein.
• TBS buffer 20 mM Tris, 150 mM NaCl, 0.1% BSA, 0.05% Tween 20, pH 7.4
• the amount of nucleic acid before and after the selection step was quantified by qPCR using primers of SEQ ID NO:8 and SEQ ID NO:9 and a calibration curve DNA (SEQ ID NO:10) of known concentration, and the recovery rate of the polypeptide in the selection step was calculated.
• the recovery rate was 0.00086% when the unbound polypeptide was not removed, and 0.047% when the unbound polypeptide was removed, confirming that removal of the unbound polypeptide made it possible to obtain polypeptides that bind to FGFR protein with approximately 50 times higher efficiency. This result indicates that removal of the unbound polypeptide makes it possible to obtain FGFR protein-binding polypeptides more comprehensively.
• the method for producing a nucleic acid display library disclosed herein makes it possible to easily produce a nucleic acid display library with good performance.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Plant Pathology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Bioinformatics & Computational Biology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Immunology (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (1)

Family

ID=92972067

Family Applications (1)

Country Status (4)

Citations (6)

• 2024
  • 2024-03-05 JP JP2025512449A patent/JPWO2024209857A1/ja active Pending
  • 2024-03-05 WO PCT/JP2024/008332 patent/WO2024209857A1/ja not_active Ceased
  • 2024-03-05 EP EP24784652.0A patent/EP4675020A1/en active Pending
  • 2024-03-19 TW TW113110031A patent/TW202440613A/zh unknown

Patent Citations (6)

Non-Patent Citations (3)

Also Published As

Similar Documents

Legal Events