WO2024138106A1 - Compositions et procédés d'identification de variants de p53 hypomorphes - Google Patents

Compositions et procédés d'identification de variants de p53 hypomorphes Download PDF

Info

Publication number
WO2024138106A1
WO2024138106A1 PCT/US2023/085631 US2023085631W WO2024138106A1 WO 2024138106 A1 WO2024138106 A1 WO 2024138106A1 US 2023085631 W US2023085631 W US 2023085631W WO 2024138106 A1 WO2024138106 A1 WO 2024138106A1
Authority
WO
WIPO (PCT)
Prior art keywords
genes
cancer
subject
sample
expression
Prior art date
Application number
PCT/US2023/085631
Other languages
English (en)
Inventor
Maureen E. Murphy
Original Assignee
The Wistar Institute Of Anatomy And Biology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Wistar Institute Of Anatomy And Biology filed Critical The Wistar Institute Of Anatomy And Biology
Publication of WO2024138106A1 publication Critical patent/WO2024138106A1/fr

Links

Definitions

  • the p53 tumor suppressor gene plays a central role in cancer, as best illustrated by the fact that TP53 is mutated in over 50% of human tumors. Germline mutations in TP53 are present in families with Li Fraumeni syndrome (LFS), who develop multiple cancers of the brain, breast, bone, and adrenal cortex as early as the first decade of life. p53 also is a central player in the response of cells to genotoxic stress, and mutations in TP53 are associated with cancer therapy resistance and poor prognosis. Consistent with the latter premise, numerous studies have shown that missense mutant forms of p53 protein can possess oncogenic functions: these are referred to as “gain of function”.
  • LFS Li Fraumeni syndrome
  • Prominent gain of function (GOF) activities by mutant p53 include the activation of SREBP1/2, growth factor receptor recycling, and activation of NF-KB signaling. It is important to note that despite widespread evidence for mutant p53 GOF, some tumor types do not show evidence for GOF. Typically, GOF activities of mutant p53 play roles in late-stage tumors, and GOF mutants are often associated with increased metastatic potential of tumors.
  • This ferroptotic defect is correlated with increased production of glutathione and coenzyme A in P47S cells.
  • the ferroptotic defect leads to iron accumulation in P47S mice; this led to our discovery that P47S is significantly associated with a disorder called Iron Overload in African Americans.
  • the increase in glutathione in P47S cells leads to increased activation of mTOR due to increased Rheb- mTOR association; this leads to improved fitness and muscle recovery in P47S mice, suggesting that this allele may have been selected for at one time.
  • a method of treating cancer in a subject in need thereof comprising: a) obtaining a tumor sample from the subject; b) detecting expression levels of at least two genes in the tumor sample, wherein the genes are selected from: CXCL10, FYN, ILDR2, PLD1, RAB38, C0L11A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cl lorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL
  • a method of treating cancer in a subject in need thereof comprising: having obtained information about expression levels of at least two genes in a sample obtained from the subject, wherein the genes are selected from: CXCL10, FYN, ILDR2, PLD1, RAB38, C0L11A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cl lorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL, TIMP1, F8, CYB5
  • a method of reducing, inhibiting, and/or preventing tumor metastasis in a subject in need thereof comprising: having obtained information about expression levels of two or more genes in a sample obtained from the subject, wherein the genes comprise CXCL10, FYN, ILDR2, PLD1, RAB38, COL11 A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cl lorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL
  • a method of assessing cancer risk in a subject comprising: a) obtaining a biological sample from the subject; b) detecting expression levels of two or more genes in the sample, wherein the genes comprise: CXCL10, FYN, ILDR2, PLD1, RAB38, C0L11A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cl lorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL, TIMP1,
  • composition comprising a collection of probes, primers, and/or antibodies suitable for detection of the expression and/or expression levels of a collection of genes, or their products, in a tumor sample, wherein the collection of genes comprises CXCL10, FYN, ILDR2, PLD1, RAB38, C0L11A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cl lorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL, TIMP
  • FIG. 1 A - FIG. II show p53 hypomorphs adopt a mutant conformation and express high levels of RRAD.
  • FIG. 1A IPA analysis showing significance and effect on regulators with their targets significantly enriched among the genes differentially expressed in p53 hypomorphs P47S and Y107H. The bars represent activation Z-score of the regulators predicted by IPA based on direction of target changes, color represents significance p value, the number after the bar represents the number of targets affected.
  • FIG. IB Log2 fold change plotted against -Logio(p-value) for genes that respond to Nutlin-3a treatment after 24 hr in wild type.
  • FIG. 1C- FIG. IE LCL cell lines expressing hypomorphic p53, either (FIG. 1C) P47S - homozygous and heterozygous, (FIG. ID) Y107H heterozygous, or (FIG. IE) R273H heterozygous compared to regionally/family matched WT p53 LCL cell lines were treated with lOpM Nutlin-3a for the indicated time points and harvested.
  • FIG. IF WT, P47S, and Y107H HCT116 cells were analyzed for mutant p53 (pAb240) conformation by immunofluorescence analysis. Scale bar, 25pm.
  • FIG. 2A - FIG. 2G show p53 hypomorphs exhibit elevated NF-KB signaling.
  • FIG. 2A - FIG. 2B LCL cell lines expressing WT or hypomorphic p53, either (FIG.2A) P47S or (FIG. 2B) Y107H were treated with 0.5 ng/mL TNF-a for the indicated periods.
  • FIG. 2C Representative immunohistochemical images of colon, spleen, thymus, and liver sections obtained from ten-week-old male mice of the indicated genotypes. Tissue sections were stained for phospho-p65 NF-KB (Ser276). Scale bar, 50pm.
  • FIG. 2D Hsc70 immunoprecipitation in colon tissue harvested from ten-week-old male mice of the indicated genotypes. Immunoprecipitation of Hsc70 or IgG negative control was followed by immunoblotting for p53.
  • FIG. 2E Whole cell lysates prepared from the colon and spleen of ten-week-old male mice of the indicated genotypes were analyzed by western blotting with the indicated antibodies.
  • FIG. 2F - FIG. 2G WT and Y107H LCLs were treated with 0.5 ng/mL TNF-a for 0, 1, or 24h and subjected to ChIP with (FIG. 2F) p65 NF-KB or (FIG. 2G) p53 antibodies, followed by Q-RT-PCR analysis with primers specific to the NF-KB site of the IL-6 and IL-8 promoters or a gene desert (negative control). Values are presented as percentage of input ⁇ SD. The data represent three technical replicates and are representative of 2 biological replicates. *p ⁇ 0.05; **p ⁇ 0.01; ***p ⁇ 0.001 as determined by two-tailed Student’ s t-test.
  • FIG. 3 A - FIG. 3F show altered biochemical properties of hypomorphic p53 proteins.
  • FIG. 3 A WT, P47S, and Y107H LCLs were treated with or without 1 mM BMH for 30 minutes followed by immunoblotting for p53.
  • FIG. 3B WT, P47S, and Y107H LCLs were treated with vehicle or 1 pg/mL ATO for 16 hr and then fixed with or without ImM BMH for 30 minutes followed by immunoblotting for p53.
  • FIG. 3 A WT, P47S, and Y107H LCLs were treated with vehicle or 1 pg/mL ATO for 16 hr and then fixed with or without ImM BMH for 30 minutes followed by immunoblotting for p53.
  • FIG. 4A - FIG. 4E show p53 hypomorphs share a predictive gene signature.
  • FIG. 4A Classification scores for training set samples obtained through leave one out cross- validation based on total 143 unique genes. Probability of 0.5 is used as the classification threshold to calculate accuracy.
  • FIG. 4B Classification scores for independent test set.
  • FIG. 4C IPA analysis showing enrichment and effect on regulators with targets significantly enriched among the 143 genes from the classifier.
  • FIG. 4D Western blot analysis of WT, R175C, and Y220H LCLs treated with lOpM Nutlin-3a for 24 hr.
  • FIG. 4E Western blot analysis of WT, P47S, G360A, El IQ, and R110H LCLS treated with lOpM Nutlin-3a for 24h.
  • FIG. 5A - FIG. 5H show expression of p53 target genes and p53 protein conformation in hypomorphic cell lines.
  • FIG. 5A Western blot analysis of WT or G334R LCLs treated with lOpM Nutlin-3a for the indicated time points.
  • FIG. 5B Western blot analysis of WT, P47S, and Y107H HCT116 cells treated with lOpM Nutlin-3a for 24 hr.
  • FIG. 5C Western blot analysis of WT, P47S, and Y107H primary MEFs treated with 5pM CDDP for 24 hr.
  • FIG. 5D WT, P47S, and Y107H HCT116 cells stained with the pan-p53 (1C12) antibody confirmed equivalent total p53 expression by immunofluorescence analysis. Scale bar, 25pm.
  • FIG. 5E Representative images of single antibody (Hsp70) conditions for WT, P47S, and Y107H primary MEFs, which served as a negative control for proximity ligation assay analysis. Scale bar, 20pm.
  • FIG. 5F Western blot analysis of WT, P47S (homozygous), or R273H LCLs treated with lOpM Nutlin-3a for the indicated time points, s.e., short exposure; l.e., long exposure.
  • FIG. 5G - FIG. 5H Western blot analysis of WT, (FIG. 5G) P47S, and (FIG. 5H) Y107H LCLs treated with lOpM Nutlin-3a for the indicated time points.
  • FIG. 6A - FIG. 6H show p53 hypomorph response to stimulation by EGF and TNF-a.
  • FIG. 6A - FIG. 6B WT,
  • FIG. 6A P47S, and
  • FIG. 6C Hsc70 IP in thymus tissue harvested from 10-week-old male mice of the indicated genotypes. Immunoprecipitation of Hsc70 or IgG negative control was followed by immunoblotting for p53 (left). Whole cell lysates were analyzed by western blotting with the indicated antibodies (right).
  • FIG. 7A - FIG. 7C show predictive p53 hypomorph gene signature and RRAD expression in benign and presumed hypomorphic p53 cell lines.
  • FIG. 7A ROC AUC for FIG. 7A.
  • FIG. 7B ROC AUC for FIG. 4B.
  • FIG. 7C Western blot analysis of WT, P47S, or R110H LCLs treated with lOpM Nutlin-3a for 24 hr.
  • FIG. 8A - FIG. 8H show P47S mice are sensitive to DSS-induced chronic inflammation.
  • FIG. 8A Schematic detailing the treatment schedule for inducing chronic inflammation in WT, P47S, and Y107H mice by administering three cycles of DSS.
  • FIG. 8B Mouse weights recorded throughout the study for both untreated mice and mice exposed to 2% DSS for each genotype.
  • FIG. 8C - FIG. 8D At the conclusion of the study, (FIG. 8C) spleen weight and (FIG. 8D) colon lengths were measured as proximal analyses of inflammation response to DSS treatment.
  • FIG. 8E - FIG. 8F Colonic inflammation was assessed by histopathological analysis; (FIG.
  • FIG. 8E total inflammation score and (FIG. 8F) hyperplasia atypia scores are reported.
  • hypomorphic p53 variants including P47S and Y107H, despite being located in different domains of p53, both have increased propensity to misfold compared to WT p53. Moreover, we determined that these variants adopt a protein conformation commonly associated with tumor-derived mutant forms of p53. Mutant p53 is known to enhance NF-KB activity, and we show that the P47S and Y107H hypomorphs are both associated with increased NF-KB activity in unstressed human cells and mouse tissues. We then used machine-learning approaches on RNA Sequencing data from unstressed lymphoblastoid cells to identify a gene signature that accurately distinguishes p53 hypomorphs from WT p53 and even a benign variant. The findings demonstrate, inter alia, that we are able to broadly screen individuals with genetic variants of p53, and better inform them of their cancer risk and select appropriate treatment regimes.
  • Upregulation refers to an elevation in the level of expression of a product of one or more genes in a cell or the cells of a tissue or organ.
  • Downregulate refers to a reduction in the level of expression of a product of one or more genes in a cell or the cells of a tissue or organ.
  • a “subject” is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon, or gorilla.
  • the term “patient” may be used interchangeably with the term subject.
  • the subject is a human.
  • the subject may be of any age, as determined by the health care provider.
  • the patient is a subject who has previously been diagnosed with cancer.
  • the subject may have been treated for cancer previously, or is currently being treated for cancer.
  • the subject is experiencing stress which has an impact on the beta-adrenergic signaling pathway.
  • sample as used herein means any biological fluid or tissue that contains blood cells, immune cells, and/or cancer cells.
  • the sample is whole blood or peripheral blood mononuclear cells (PBMC).
  • PBMC peripheral blood mononuclear cells
  • Other useful biological samples include, without limitation, plasma, saliva, synovial fluid, bone marrow, cerebrospinal fluid, vaginal mucus, cervical mucus, nasal secretions, sputum, semen, amniotic fluid, bronchoscopy sample, bronchoalveolar lavage fluid, and other cellular exudates from a patient having cancer.
  • Such samples may further be diluted with saline, buffer or a physiologically acceptable diluent. Alternatively, such samples are concentrated by conventional means.
  • the sample, or cells in the sample are not subject to any additional stresses, once removed from the subject.
  • cancer or “proliferative disease” as used herein means any disease, condition, trait, genotype, or phenotype characterized by unregulated cell growth or replication as is known in the art.
  • a “cancer cell” is cell that divides and reproduces abnormally with uncontrolled growth. This cell can break away from the site of its origin (e.g., a tumor) and travel to other parts of the body and set up another site (e.g., another tumor), in a process referred to as metastasis.
  • a “tumor” is an abnormal mass of tissue that results from excessive cell division that is uncontrolled and progressive and is also referred to as a neoplasm. Tumors can be either benign (not cancerous) or malignant.
  • the cancer can include, without limitation, breast cancer, lung cancer, prostate cancer, colorectal cancer, brain cancer, esophageal cancer, stomach cancer, bladder cancer, pancreatic cancer, cervical cancer, head and neck cancer, ovarian cancer, melanoma, acute and chronic lymphocytic and myelocytic leukemia, myeloma, Hodgkin’s and non-Hodgkin’s lymphoma, and multi-drug resistant cancers.
  • the cancer is lung cancer.
  • the cancer is ovarian cancer.
  • the cancer is prostate cancer. In another embodiment, the cancer is lung cancer. In another embodiment, the cancer is colorectal cancer. In another embodiment, the cancer is brain cancer. In certain embodiments, the cancer is pancreatic ductal adenocarcinoma (PDAC). In certain embodiments, the cancer is glioblastoma (GBM).
  • PDAC pancreatic ductal adenocarcinoma
  • GBM glioblastoma
  • Control refers to the source of the reference value for the biomarker gene levels as well as the particular panel of genes in a control obtained from cells or tissues that lack a p53 hypomorphic variant.
  • the control levels are obtained from cells or tissues that have at least one TP53 wildtype allele.
  • the control levels are obtained from cells or tissues that have a benign TP53 variant allele.
  • the control or reference level is from a population of individuals sharing a specific p53 variant.
  • the control or reference level is an assigned value which correlates with the level of a specific control individual or population, although not necessarily measured at the time of assaying the test subject's sample.
  • control or control level is obtained from healthy or normal tissue in a subject with disease. In certain embodiments, the control or control level is obtained from healthy or normal tissue in a subject without disease. In certain embodiments, the control or control level is obtained from a tumor-free margin.
  • hypomorph and “hypermorphic” as used herein refers to a p53 protein that is non-functional or lesser-functioning than wild type p53, or a variant TP53 coding sequence that encodes the non-functional or lesser-functioning p53 protein.
  • variation in the TP53 coding sequence results in expression a hypomorphic protein that is defective due to misfolding or truncation.
  • Cells and tissues containing these hypomorphic variants may also show increased NF-KB activity or increased levels of cell migration, invasion, and/or metastasis.
  • the methods and compositions provided herein are useful in distinguishing p53 hypomorphs that increase cancer risk from benign variants and/or wild type p53.
  • hypomorphic variants include P47S (Pro47Ser, rsl800371), Y107H (TyrlO7His, rs368771578), or G334R (Gly334Arg, rs78378222). Still others are described in the literature, See e.g., Kato et al. Proc Natl Acad Sci U S A. 2003 Jul 8;100(14):8424-9; Giacomelli et al. Nat Genet. 2018 October ; 50(10): 1381-1387; and Kotler et al. Mol Cell. 2018 Sep 6;71(5):873, which are incorporated herein by reference.
  • Missense mutations that inactivate p53 occur commonly in cancer, and germline mutations in TP53 cause Li Fraumeni syndrome, which is associated with early-onset cancer.
  • germline missense variants of p53 that remain uncharacterized. In some cases, these germline variants have been shown to encode a hypomorphic p53 protein, and these alleles are associated with increased cancer risk in humans and mouse models. However, the majority of p53 variants remain un- or misclassified in clinical genetics databases.
  • fragment is intended a molecule consisting of only a part of the intact full-length polypeptide sequence and structure.
  • the fragment can include a C terminal deletion, an N terminal deletion, and/or an internal deletion of the native polypeptide.
  • a fragment will generally include at least about 5-10 contiguous amino acid residues of the full length molecule, preferably at least about 15-25 contiguous amino acid residues of the full length molecule, and most preferably at least about 20-50 or more contiguous amino acid residues of the full length molecule, or any integer between 5 amino acids and the full length sequence, provided that the fragment in question retains the ability to elicit the desired biological response, although not necessarily at the same level.
  • antibody or “antibody molecule” is meant any immunoglobulin, including antibodies and fragments thereof, that binds to a specific antigen.
  • antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule.
  • the antibody may be a naturally occurring antibody or may be a synthetic or modified antibody (e.g., a recombinantly generated antibody; a chimeric antibody; a bispecific antibody; a humanized antibody; a camelid antibody; and the like).
  • the antibody may comprise at least one purification tag.
  • the framework antibody is an antibody fragment.
  • antibody fragment includes a portion of an antibody that is an antigen binding fragment or single chains thereof.
  • An antibody fragment can be a synthetically or genetically engineered polypeptide.
  • binding fragments encompassed within the term “antigen-binding portion” of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab’)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment, which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab’)2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • a Fd fragment consisting of the
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term “antigen-binding fragment” of an antibody.
  • Antibody fragments include, without limitation, immunoglobulin fragments including, without limitation: single domain (Dab; e.g., single variable light or heavy chain domain), Fab, Fab', F(ab')2, and F(v); and fusions (e.g., via a linker) of these immunoglobulin fragments including, without limitation: scFv, scFv2, scFv-Fc, minibody, diabody, triabody, and tetrabody.
  • the antibody may also be a protein (e.g., a fusion protein) comprising at least one antibody or antibody fragment.
  • derived from is used to identify the original source of a molecule (e.g., bovine or human) but is not meant to limit the method by which the molecule is made which can be, for example, by chemical synthesis or recombinant means.
  • change in expression is meant an upregulation of one or more selected genes in comparison to the reference or control; a downregulation of one or more selected genes in comparison to the reference or control; or a combination of certain upregulated genes and down regulated genes.
  • therapeutic reagent or “regimen” is meant any type of treatment employed in the treatment of cancers with or without solid tumors, including, without limitation, chemotherapeutic pharmaceuticals, biological response modifiers, radiation, diet, vitamin therapy, hormone therapies, gene therapy, surgical resection, etc.
  • target biomarker or “target biomarker signature” as used herein is meant those proteins/peptides or the genes/transcripts encoding same, the expression of which changes (either in an up-regulated or down-regulated manner) characteristically in the presence of a p53 hypomorph.
  • at least two target biomarkers form a suitable biomarker signature for use in the methods and compositions.
  • at least three target biomarkers form a suitable biomarker signature for use in the methods and compositions.
  • at least four target biomarkers form a suitable biomarker signature for use in the methods and compositions.
  • at least five biomarkers form a suitable biomarker signature for use in the methods and compositions.
  • At least six target biomarkers form a suitable biomarker signature for use in the methods and compositions. In certain embodiments, at least seven target biomarkers form a suitable biomarker signature for use in the methods and compositions. In certain embodiments, at least eight target biomarkers form a suitable biomarker signature for use in the methods and compositions. In certain embodiments, at least nine target biomarkers form a suitable biomarker signature for use in the methods and compositions. In certain embodiments, at least ten target biomarkers form a suitable biomarker signature for use in the methods and compositions. In certain embodiments, at least ten target biomarkers form a suitable biomarker signature for use in the methods and compositions.
  • biomarker signatures can include any combination of p53 hypomorph biomarkers employing at least two biomarkers identified in Table 1 or including all 143 biomarkers in Table 1.
  • One skilled in the art may readily reproduce the compositions and methods described herein by use of the sequences of the biomarkers, all of which are publicly available from conventional sources, such as GenBank. Table 1
  • upregulation of two or more target biomarkers forms a suitable biomarker signature for use in the methods and compositions.
  • the upregulated target biomarkers include two or more of CXCL10, FYN, ILDR2, PLD1, RAB38, COL11A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cllorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL, TIMP1, F8, CYB5R3, SOX4, FAM127
  • downregulation of two or more target biomarkers forms a suitable biomarker signature for use in the methods and compositions.
  • the downregulated target biomarkers include two or more of POLDIP3, LSG1, MAVS, FAM35A, PHKB, CLEC4A, GPATCH1, SPEN, N0L12, NAA50, TNFAIP8, SPAG5, ATP6V1E2, PTPLB, BRCA2, N0L6, FUS, NUP85, DEF6, CNTRL, SMAD3, MKI67, SLFN13, DLGAP5, ZMYND11, SFPQ, HEATR6, MBLAC1, PBX2, RAD51, RFC3, KNTC1, DNAJC25, PDCL3, SERPINB8, KCNH6, HCLS1, MEGF9, BIN2, FAM65B, SLC16A12, TAPBPL, and LGALS17A.
  • the downregulation of this collection of genes forms a suitable biomarker signature for use in the methods
  • microarray refers to an ordered arrangement of hybridizable array elements, e.g., primers, probes, ligands, on a substrate.
  • ligand refers to a molecule that binds to a protein or peptide, and includes antibodies and fragments thereof.
  • polynucleotide when used in singular or plural form, generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and doublestranded regions, single- and double-stranded RNA, and RNA including single- and doublestranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • polynucleotide specifically includes cDNAs.
  • the term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases.
  • polynucleotide embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.
  • oligonucleotide refers to a relatively short polynucleotide of less than 20 bases, including, without limitation, single-stranded deoxyribonucleotides, single- or doublestranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.
  • labels or “reporter molecules” are chemical or biochemical moieties useful for labeling a nucleic acid (including a single nucleotide), polynucleotide, oligonucleotide, or protein ligand, e.g., amino acid, peptide sequence, protein, or antibody.
  • Labelels and “reporter molecules” include fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionucleotides, enzymes, substrates, cofactors, inhibitors, radioactive isotopes, magnetic particles, and other moieties known in the art.
  • Labels or “reporter molecules” are capable of generating a measurable signal and may be covalently or noncovalently joined to an oligonucleotide or nucleotide (e.g., a non-natural nucleotide) or ligand.
  • a therapeutically effective amount refers an amount sufficient to achieve the intended purpose.
  • an effective amount of chemotherapeutic agent to kill p53 hypomorphic cancer cells is an effective amount sufficient to result in a reduction or complete removal of the symptoms of the disorder, disease, or medical condition.
  • the effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal to receive the therapeutic agent, and the purpose of the administration. The effective amount in each individual case may be determined by a skilled artisan according to established methods in the art.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations, and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed. (Mack Publishing Co., 1990). The formulation should suit the mode of administration.
  • Routes of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • the agent may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • disease As used herein, “disease”, “disorder”, and “condition” are used interchangeably, to indicate an abnormal state in a subject.
  • Target Biomarkers and Biomarker Signatures Useful in the Methods and Compositions Mutational inactivation of TP53 occurs commonly in cancer. In addition to mutation, there are over two hundred germline genetic variants in the TP53 coding region; some of these produce partially functional (hypomorphic) protein. Provided herein, is an optimized gene signature for identification of TP53 hypomorphs.
  • the “targets” of the compositions and methods of these inventions include, in one aspect, the genes, gene fragments, transcripts, and the expression products, including the proteins and fragments thereof, listed in Table 1, which comprise this gene signature. As described in the Examples below, the inventors identified a collection of genes that distinguish p53 hypomorphs from wildtype p53.
  • provided herein are superior tests for detection of p53 hypomorphs utilizing at least two of the biomarkers to provide more effective detection of cancer or cancer risk in a subject.
  • superior diagnostic tests utilizing at least two of the biomarkers for evaluating the prognosis of cancer treatment utilize are provided.
  • the methods utilize at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, or more of the specific target biomarkers identified herein.
  • the method employs all 143 of the biomarkers identified in Table 1.
  • diagnostic reagents for use in methods of identifying a p53 hypomorph in a sample include at least two target biomarkers identified in Table 1 herein, associated with a detectable label or portion of a detectable label system.
  • a diagnostic reagent includes at least two target biomarkers identified in Table 1 immobilized on a substrate.
  • combinations of such labeled or immobilized biomarkers are suitable reagents and components of a diagnostic kit.
  • immobilized or labeled biomarkers are those selected from the biomarkers: CXCL10, FYN, ILDR2, PLD1, RAB38, COL11A2, NCALD, FFAR2, ANK1, SNX33, ZP3, VCAN, NPL, PADI2, KCNK1, NIM1K, ATF5, JUP, DNASE1L3, HNMT, AFAP1L2, ARMCX2, GDF15, Cl lorf74, CALD1, SRGN, CABP1, CSF1, PRR18, VN1R2, PPFIBP1, DUSP7, ZNF438, FKBP9, CD109, CPOX, GAS7, CSRNP1, TMEM144, CYB5A, TNFSF9, B4GALT5, RHOG, TNFRSF10B, SORD, FTL, TIMP1, F8, CYB5R3, SOX4, FAM127A, STAT5A, C7orf60, LYST, ARL5B, BANP, E
  • suitable embodiments of such labeled or immobilized reagents detect at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, or 60 of the biomarkers in Table 1.
  • suitable embodiments of such labeled or immobilized reagents detect all 143 of the biomarkers in Table 1. Any combination of labeled or immobilized biomarkers can be assembled in a kit for the purposes of identifying a p53 hypomorph in cells or tissues.
  • a kit includes labeled or immobilized reagents for detection of the 143 biomarkers in Table 1.
  • the labels may be selected from among many known diagnostic labels, including those described above.
  • the substrates for immobilization may be any of the common substrates, glass, plastic, a microarray, a microfluidics card, a chip or a chamber.
  • the diagnostic reagent includes ligands that bind to biomarkers, or a fragment thereof, as listed in Table 1.
  • a ligand desirably binds to a protein biomarker or a fragment thereof, and can be an antibody which specifically binds a single biomarker from Table 1.
  • Various forms of antibody e.g., polyclonal, monoclonal, recombinant, chimeric, as well as fragments and components (e.g., CDRs, single chain variable regions, etc.) may be used in place of antibodies.
  • the ligand itself may be labeled or immobilized.
  • suitable embodiments of such labeled or immobilized reagents detect at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, or 60 of the ligands.
  • Each ligand binds to a single biomarker listed in Table 1.
  • such labeled or immobilized reagents include ligands that bind all 143 biomarkers listed in Table 1.
  • kits for the purposes of identifying a p53 hypomorph in cells or tissues.
  • a kit includes labeled or immobilized reagents that bind to biomarkers listed in Table 1.
  • the diagnostic reagent includes polynucleotide or oligonucleotide sequences that hybridize to genes, gene fragments, gene transcripts or nucleotide sequences encoding the biomarkers listed in Table 1.
  • a polynucleotide/oligonucleotide can be a probe or primer, and may itself be labeled or immobilized.
  • suitable embodiments of such labeled or immobilized reagents include least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, or 60 polynucleotides/oligonucleotides.
  • Each polynucleotide/oligonucleotide hybridizes to a gene, gene fragment, gene transcript or expression product encoding a single biomarker listed in Table 1.
  • Any combination of labeled or immobilized biomarker-hybridizable sequences can be assembled in a kit for the purposes of identifying a gene signature indicative of a p53 hypomorph.
  • certain embodiments of a kit include labeled or immobilized reagents that hybridize to all 143 biomarkers listed in Table 1.
  • Still other components of the many biomarker signatures that may be formed by various combinations of polynucleotide/oligonucleotide sequences that hybridize to the biomarkers listed in Table 1 associated with detectable labels or immobilized on substrates provide additional diagnostic kits. Still other components include similar reagents that hybridize to biomarkers or fragments thereof as listed in Table 1. In certain embodiments, these polynucleotide or oligonucleotide reagent(s) are part of a primer-probe set, and the kit comprises both primers and probes. Each said primer-probe set amplifies a different gene, gene fragment or gene expression product that encodes a different biomarker of any combination of the biomarkers listened in Table 1.
  • primer and probe sequences are within the skill of the art once the particular gene target is selected.
  • the particular methods selected for the primer and probe design and the particular primer and probe sequences are not limiting features of these compositions.
  • a ready explanation of primer and probe design techniques available to those of skill in the art is summarized in US Patent No. 7,081,340, with reference to publicly available tools such as DNA BLAST software, the Repeat Masker program (Baylor College of Medicine), Primer Express (Applied Biosystems); MGB assay -by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the web for general users and for biologist programmers and other publications).
  • a composition for identifying a p53 hypomorph in cells or tissues in a mammalian subject as described herein can be a kit containing multiple reagents or one or more individual reagents.
  • a composition includes a substrate upon which the biomarkers, polynucleotides or oligonucleotides, or ligands are immobilized.
  • the composition is a kit also contains optional detectable labels, immobilization substrates, optional substrates for enzymatic labels, as well as other laboratory items.
  • compositions based on the biomarkers selected from Table 1 described herein, optionally associated with detectable labels can be presented in the format of a microfluidics card, a chip or chamber, or a kit adapted for use with the assays described in the Examples.
  • a method for identifying a p53 hypomorph in cells or tissues from a subject includes measuring in a biological fluid sample of the subject the expression level of a protein or fragment thereof selected from at least one biomarker of Table 1. Alternatively, the method includes measuring a combination of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, or 140 biomarkers in Table 1. In certain embodiments, the method includes measuring a combination of all 143 biomarkers of Table 1. The method involves comparing the expression level of the selected biomarker or biomarker fragment with the level of the same protein or peptide in the biological fluid of a reference or control mammalian subject.
  • Differences in expression of the subject’s selected biomarker protein or peptide fragment from those of the reference or control correlates with the presence of a p53 hypomorph. In certain embodiments, differences in expression of the subject’s selected biomarker protein or peptide fragment from those of the reference or control correlates with shortened patient survival. In certain embodiments, differences in expression of the subject’s selected biomarker protein or peptide fragment from those of the reference or control correlates with cancer treatment failure.
  • a difference in expression level of one or more of the selected biomarker proteins in comparison to the control reference may be an increase or decrease in the expression levels of the individual biomarkers.
  • This method may employ any of the suitable diagnostic reagents or kits or compositions described above.
  • the measurement of the biomarkers in the biological sample may employ any suitable ligand, e.g., antibody (or antibody to any second biomarker) to detect the biomarker protein.
  • suitable ligand e.g., antibody (or antibody to any second biomarker) to detect the biomarker protein.
  • Such antibodies may be presently extant in the art or presently used commercially, such as those available as part of commercial antibody ELISA assay kits or that may be developed by techniques now common in the field.
  • the antibodies may be tagged or labeled with reagents capable of providing a detectable signal, depending upon the assay format employed.
  • Such labels are capable, alone or in concert with other compositions or compounds, of providing a detectable signal.
  • the labels are desirably interactive to produce a detectable signal.
  • the label is detectable visually, e.g. colorimetrically.
  • a variety of enzyme systems operate to reveal a colorimetric signal in an assay, e.g., glucose oxidase (which uses glucose as a substrate) releases peroxide as a product that in the presence of peroxidase and a hydrogen donor such as tetramethyl benzidine (TMB) produces an oxidized TMB that is seen as a blue color.
  • a hydrogen donor such as tetramethyl benzidine (TMB) produces an oxidized TMB that is seen as a blue color.
  • Other examples include horseradish peroxidase (HRP) or alkaline phosphatase (AP), and hexokinase in conjunction with glucose-6-phosphate dehydrogenase that reacts with ATP, glucose, and NAD+ to yield, among other products, NADH that is detected as increased absorbance at 340 nm wavelength.
  • HRP horseradish peroxidase
  • AP alkaline phosphatase
  • hexokinase in conjunction
  • label systems that may be utilized in the methods of this invention are detectable by other means, e.g., colored latex microparticles (Bangs Laboratories, Indiana) in which a dye is embedded may be used in place of enzymes to provide a visual signal indicative of the presence of the resulting selected biomarker-antibody complex in applicable assays.
  • Still other labels include fluorescent compounds, radioactive compounds or elements.
  • an anti-biomarker antibody is associated with, or conjugated to a fluorescent detectable fluorochromes, e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), coriphosphine-0 (CPO) or tandem dyes, PE-cyanin-5 (PC5), and PE-Texas Red (ECD).
  • FITC fluorescein isothiocyanate
  • PE phycoerythrin
  • API allophycocyanin
  • CPO coriphosphine-0
  • tandem dyes PE-cyanin-5 (PC5)
  • PC5 PE-cyanin-5
  • ECD PE-Texas Red
  • fluorochromes include fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), and also include the tandem dyes, PE- cyanin-5 (PC5), PE-cyanin-7 (PC7), PE-cyanin-5.5, PE-Texas Red (ECD), rhodamine, PerCP, fluorescein isothiocyanate (FITC) and Alexa dyes. Combinations of such labels, such as Texas Red and rhodamine, FITC +PE, FITC + PECy5 and PE + PECy7, among others may be used depending upon assay method.
  • Detectable labels for attachment to antibodies useful in diagnostic assays of this invention may be easily selected from among numerous compositions known and readily available to one skilled in the art of diagnostic assays.
  • the biomarker-antibodies or fragments useful in this invention are not limited by the particular detectable label or label system employed. Thus, selection and/or generation of suitable biomarker-antibodies with optional labels for use in this invention is within the skill of the art, provided with this specification, the documents incorporated herein, and the conventional teachings of immunology.
  • the particular assay format used to measure the selected biomarker in a biological sample may be selected from among a wide range of immunoassays, such as enzyme-linked immunoassays, such as those described in the examples below, sandwich immunoassays, homogeneous assays, immunohistochemistry formats, or other conventional assay formats.
  • immunoassays such as enzyme-linked immunoassays, such as those described in the examples below, sandwich immunoassays, homogeneous assays, immunohistochemistry formats, or other conventional assay formats.
  • sandwich immunoassays such as those described in the examples below
  • homogeneous assays such as those described in the examples below
  • immunohistochemistry formats such as those described in the examples below
  • One of skill in the art may readily select from any number of conventional immunoassay formats to perform this invention.
  • reagents for the detection of protein in biological samples such as peptide mimetics, synthetic chemical compounds capable of detecting the selected EP biomarker may be used in other assay formats for the quantitative detection of biomarker protein in biological samples, such as high-pressure liquid chromatography (HPLC), immunohistochemistry, etc.
  • HPLC high-pressure liquid chromatography
  • Still other methods useful in performing the diagnostic steps described herein are known in the art. Such methods include methods based on hybridization analysis of polynucleotides, methods based on sequencing of polynucleotides, proteomics-based methods or immunochemistry techniques.
  • the most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization; RNAse protection assays; and PCR-based methods, such as real-time polymerase chain reaction (RT-PCR), qPCR, and quantitative RT-PCR (Q-RT-PCR) (e.g., using the QuantStudio 5 Real-Time PCR System (Applied Biosystems)).
  • RT-PCR real-time polymerase chain reaction
  • Q-RT-PCR quantitative RT-PCR
  • antibodies may be employed that can recognize specific DNA-protein duplexes.
  • RNA Stat-60 Tel-Test
  • MassARRAY-based method Sequenom, Inc., San Diego, CA
  • differential display amplified fragment length polymorphism
  • BeadArrayTM technology Illumina, San Diego, CA
  • a method for treating cancer includes obtaining a tumor sample from the subject detecting expression levels of at least two genes in the tumor sample, wherein the genes are selected from the biomarkers listed in Table 1.
  • a method of reducing, inhibiting, and/or preventing tumor metastasis in a subject in need thereof includes detecting the expression levels of biomarkers listed in Table 1.
  • a method for assessing cancer risk in a subject in a subject includes obtaining a biological sample from the subject and detecting the expression levels of biomarkers listed in Table 1.
  • the biological sample includes primary peripheral blood mononuclear cells.
  • an increase in expression level of one or more of the selected biomarker genes, gene fragments, gene transcripts or expression products in comparison to a control reference is detected. In certain embodiments, an increase in expression level of all of the selected biomarker genes, gene fragments, gene transcripts or expression products in comparison to a control reference is detected. In certain embodiments, an increase in expression level of one or more of the selected biomarker genes, gene fragments, gene transcripts or expression products in comparison to a control reference is greater than or equal to 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.75 fold, 2.0 fold, 4.0 fold, 5.0 fold, 6.0 fold, 8.0 fold, or 10 fold.
  • a decrease in expression level of one or more of the selected biomarker genes, gene fragments, gene transcripts or expression products in comparison to a control reference is greater than or equal to 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.75 fold, 2.0 fold, 4.0 fold, 5.0 fold, 6.0 fold, 8.0 fold, or 10 fold.
  • the methods and compositions described herein may be used in conjunction with clinical risk factors to help physicians make more accurate decisions about how to manage patients with cancers with p53 hypomorphic variants. Another advantage of these methods and compositions is that diagnosis may occur earlier and treatment may commence earlier.
  • the treatment includes administering a chemotherapy, radiation therapy, immunotherapy, hormone therapy, stem cell or bone marrow transplant, and/or surgical resection.
  • Chemotherapeutic agents are well known in the art and include, but are not limited to, anthracenediones (anthraquinones) such as anthracyclines (e.g., daunorubicin (daunomycin; rubidomycin), doxorubicin, epirubicin, idarubicin, and valrubicin), mitoxantrone, and pixantrone; platinum-based agents (e.g., cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin); tamoxifen and metabolites thereof such as 4-hydroxytamoxifen (afimoxifene) and N-desmethyl-4- hydroxytamoxifen (endoxifen); taxanes such as paclitaxel (taxol) and docetaxel; alkylating agents (e.g., paclitaxel (taxol
  • LCL Human EBV-immortalized lymphoblastoid
  • RPMI 1640 supplemented with 15% fetal bovine serum, 1% penicillin/streptomycin, and 2 mM L- glutamine.
  • Primary and transformed mouse embryonic fibroblasts (MEFs) were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Cells were grown in a 5% CO2 humidified incubator at 37°C. All cell lines were confirmed to be free of mycoplasma prior to each experiment.
  • WT, P47S, and Y107H primary mouse embryonic fibroblasts were isolated from 13.5-day-old Hupki embryos and cultured at 37°C in DMEM with 1% penicillin/streptomycin and 10% FBS.
  • the P47S and Y107H point mutations were introduced respectively by nucleofection of HCT116 cells with a synthetic gRNA/Cas9 ribonucleoprotein complex along with a ssODN.
  • the gRNA recognition site for P47S is 5’- ACCATTGTTCAATATCGTCCNGG (SEQ ID NO: 1), and the ssODN has the following sequence with two phosphorothioate bonds at each end: 5’cttttcacccatctacagtcccccttgccgtcccaagcaatggatgatttgatgctgtccAGTgacgatattgaacaatggttcactg aagacccaggtccagatgaagctcccagaatg (SEQ ID NO: 2).
  • the gRNA recognition site for Y107H is 5’- aaaacctaccagggcagctaCGG (SEQ ID NO: 3), with the PAM site in upper case, and the ssODN has the following sequence with two phosphorothioate bonds at each end: 5’- tgaccgtgcaagtcacagacttggctgtcccagaatgcaagaagcccagacggaaaccgtGGGAgccctggtaggttttctggga agggacagaagatgacaggggccaggagggggctggtgc (SEQ ID NO: 4).
  • Both synthetic gRNAs and ssODNs in ul tram er format were purchased from IDT.
  • the transfected pools of HCT116 cells were analyzed by using Next Generation Sequencing for knock-in rate, and single-cell clones were obtained by sorting on a Sony sorter and screened by using Next Gen Sequencing. Positive clones were expanded, genotype confirmed prior to cryopreservation. All clones are negative for mycoplasma contamination and authenticated as HCT116 cells by STR profiling.
  • P47S clones B5 (cl 1) and G12 (cl2) and Y107H clones Al 1 (cl 1) and C2 (cl2) were confirmed and the TP53 cDNA was sequenced in its entirety.
  • GAPDH 14C10; Cell Signaling Technology
  • anti-Histone H3 acetyl K27; Abeam
  • anti- Histone H3 acetyl K27; Abeam
  • anti-Hsc70 Proteintech
  • anti-Ki67 D3B5; Cell Signaling Technology
  • anti-LCN15 Invitrogen
  • anti-Mdm2 Cell Signaling Technology
  • anti-Mdm2 Ab-1; Sigma-Aldrich
  • anti-Mdm2 Ab-2; Sigma-Aldrich
  • Mouse monoclonal IgGl isotype control G3A1; Cell Signaling Technology), anti-NF-KB p65 (D14E12; Cell Signaling Technology), anti-NF-KB p65 (phospho-Ser276; GeneTex)
  • anti-p21 (12D1; Cell Signaling Technology
  • anti-p53 (1C12; Cell Signaling Technology
  • anti-p53 7F5; Cell Signaling Technology
  • anti-p53 CM5; Cell Signaling Technology
  • Tissues were homogenized using the Wheaton Overhead Stirrer in Lysis Buffer (50 mM Tris-HCl, pH 8; 150 mM NaCl, 5 mM EDTA, 0.5% IGEPAL CA- 630) with freshly supplemented protease inhibitors at 4°C. Total cellular homogenates were rotated at 4°C for 30 min, and spun at 11,000 x g for 30 min at 4°C. Protein extracts (3 mg per reaction) were incubated with the anti-Hsc70 antibody (Proteintech) or control IgG overnight at 4°C.
  • Lysis Buffer 50 mM Tris-HCl, pH 8; 150 mM NaCl, 5 mM EDTA, 0.5% IGEPAL CA- 630
  • Total cellular homogenates were rotated at 4°C for 30 min, and spun at 11,000 x g for 30 min at 4°C. Protein extracts (3 mg per reaction) were incubated with the anti-Hsc70 antibody (Pro
  • the Hsc70-immunocomplexes were captured using the Recombinant Protein G Agarose (Thermo Fisher Scientific) at 4°C for 2 h.
  • the resins were washed three times using the Lysis Buffer.
  • the Hsc70-associated proteins were size fractionated on Novex 4-20% Tris-Glycine Mini Protein Gels (Thermo Fisher Scientific) at room temperature and subsequently transferred overnight onto Immuno-Blot PVDF membranes (BioRad) at 4°C.
  • the membranes were blocked with 3% Blotting-Grade Blocker (BioRad) in IX PBST for 30 min at room temperature and incubated with the anti-p53 antibody (Cell Signaling Technology) overnight at 4°C. After washing the blots in IX PBST, the membranes were incubated with Peroxidase AffiniPure F(ab')2 Fragment Donkey Anti-Mouse IgG (H+L) (Jackson ImmunoResearch) at 1 : 10,000 dilution for 2 h at room temperature.
  • Membrane- immobilized protein detection used ECL Western Blotting Detection Reagents (Cytiva RPN2106; Millipore Sigma).
  • Tissues were harvested and fixed in formalin overnight at 4°C, followed by a wash with IX PBS and then placed in 70% ethanol prior to paraffin embedding.
  • the Wistar Institute Histotechnology Facility performed the tissue embedding and sectioning. Paraffin embedded tissue sections were deparaffinized in xylene and rehydrated in ethanol (100%-95%-85%-75%) followed by distilled water. Samples underwent antigen retrieval by steaming slides in lOmM Citrate Buffer (pH 6). Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and slides were incubated in blocking buffer for 1 hr. The slides were incubated with primary antibody overnight at 4°C.
  • Immunofluorescence and proximity ligation assay Cells were grown on eight-well chamber slides (Lab-Tek), and were treated with 5pM CDDP for 24 hr. Cells were fixed in 4% paraformaldehyde (Electron Microscopy Sciences) for 10 min, followed by 3 washes in IX PBS and permeabilization with 0.25% Triton X-100 (Millipore Sigma) for 5 min. For immunofluorescence staining, cells were washed 3x with IX PBS prior to blocking for 1 hr at room temperature in a blocking buffer consisting of 4% normal goat serum (Jackson Immunoresearch) and 1% bovine serum albumin in PBS.
  • Cells were incubated overnight at 4°C with primary antibodies diluted in blocking buffer. Cells were washed 3x with IX PBS and incubated with the following secondary antibodies at room temperature for 1 hr: Alexa Fluor 488 AffiniPure Goat anti-Mouse IgG (Jackson ImmunoResearch) and Alexa Fluor 594 AffiniPure Goat anti-Rabbit IgG (Jackson ImmunoResearch). Cells were mounted with media containing DAPI and images were captured using a Nikon TiE automated inverted microscope. Protein-protein interactions were assessed using the PLA Duolink in situ starter kit (Sigma-Aldrich) following the manufacturer’s protocol. Images were captured using a Leica TSC SP5 confocal microscope.
  • Matrigel invasion assays for MEFs and HCT116 cells were carried out with 24-well BioCoat Matrigel Invasion Chambers with 8.0 pm PET membrane (Corning). In brief, chambers were rehydrated with serum free media and incubated for 2 h at 37 °C and then inserted into a 24-well filled with 750pL media supplemented with 10% FBS. Approximately 20,000-50,000 cells were seeded in the upper chamber in 500pL media supplemented with 1% FBS. Cells were allowed to adhere to the Matrigel prior to treating with 20 ng/mL TNF-a, and were then incubated at 37 °C.
  • RNA isolation and quantitative RT-PCR Cells were lysed using QIAshredder columns (Qiagen). Total RNA was extracted using the RNeasy Mini kit (Qiagen) and on- column DNase digestions, according to the manufacturer’s protocol. Equal amounts of total RNA were then used to generate cDNA using the High-Capacity Reverse Transcription kit (Applied Biosystems) according to the manufacturer’s protocol. The resulting cDNA was used with PowerUp SYBR Green Master Mix and the indicated primer sets (see Table S2). Quantitative RT-PCR (Q-RT-PCR) was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems). Ct values for the genes of interest were normalized to the invariant control genes. Gene expression data are expressed as relative quantity and normalized to untreated- or vehicle-treated WT controls. All experiments were replicated in at least three independent experiments with three technical replicates in each experiment unless otherwise stated.
  • Each nuclear pellet was resuspended and homogenized in mRIPA (lOOmM Tris pH 8.0, 2% NP-40, 0.5% sodium deoxycholate), incubated on ice for 3 min, and then centrifuged at 6500 x g for 3 min at 4°C to isolate the chromatin pellet. The supernatant (soluble nuclear fraction) was transferred to a clean tube before proceeding with sequential salt extraction of the chromatin pellet.
  • Each chromatin pellet was resuspended and homogenized in mRIPA with sequentially increasing concentrations of NaCl (lOOmM - 500mM), incubated on ice for 3 min, and centrifuged at 6500 x g for 3 min at 4°C to extract chromatin bound proteins.
  • NuPAGE Sample Buffer supplied with 5% 0- mercaptoethanol was added to each fraction. Samples were loaded into an SDS-PAGE gel for western blot analysis.
  • LCLs (2.0 x 10 7 ) were treated with vehicle control or 0.5 ng/mL TNF-a for the indicated timepoints and then crosslinked with 1% formaldehyde for 10 minutes at room temperature and quenched with 2.5 M glycine for 5 minutes.
  • Crosslinked cells were washed twice in PBS, collected by centrifugation, lysed in 10 ml swelling buffer (10 mM Tris, pH 7.5, 2 mM MgC12, 3 mM CaC12), and placed on ice for 10 minutes.
  • Chromatin fragmentation was performed with a Bioruptor sonication bath (Diagenode) at 4 °C with the following settings: 25 cycles of high amplitude for 30 seconds, with a 30 second pause in between each sonication. Chromatin was then cleared with centrifugation at maximum speed for 30 minutes at 4 °C, 5% saved for input, and immunoprecipitated with the appropriate antibodies overnight at 4 °C using magnetic Dynabeads Protein G beads (ThermoFisher).
  • Beads were subsequently subjected to the following washes: 2x5 min in ChIP -buffer (50 mM HEPES, pH 7.5, 155 mM NaCl, 1.1% Triton X-100, 0.11% NaDeoxycholate, 1 mM EDTA), 5 min in ChIP -buffer with an additional 500 nM NaCl, 5 min in TE buffer (lOmM Tris-HCl pH 8.0, ImM EDTA).
  • ChIP -buffer 50 mM HEPES, pH 7.5, 155 mM NaCl, 1.1% Triton X-100, 0.11% NaDeoxycholate, 1 mM EDTA
  • the crosslink was reversed overnight at 65 °C with elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS) before treatment with 0.33 mg/ml RNase A (ThermoFisher) and 0.5 mg/ml Proteinase K (Thermo) at 37°C for 2 h. DNA was isolated with phenol/chloroform followed by overnight ethanol precipitation at -20 °C. Q-RT-PCR was used to determine the enrichment of immunoprecipitated DNA relative to the input DNA using gene-specific primer sets to the specified regions. Primers directed to a gene-desert were used as a negative control. ChlP-Q-RT-PCR experiments were performed in two independent biological replicates.
  • RNA-Seq experiment For the RNA-Seq experiment to identify a p53 hypomorph gene signature, the samples in triplicates or duplicates were assayed among three runs with the same two samples (one hypomorph and one wild-type) repeated among the runs. Alignment was done using bowtie2 (Langmead B et al. Nat Methods. 2012 Mar 4;9(4):357-9) against hgl9 version of human genome and Ensemble transcriptome information followed by RSEM to estimate read counts on gene level. Normalization was carried out using DESeq2 (Love MI et al. Genome Biol. 2014;15(12):550) and batch correction was performed using the two samples that were repeated in each of the 3 runs.
  • mice All mice were of the C57B1/6J strain. WT and P47S mice were generated previously in the humanized p53 knock-in backbone (Hupki) (Jennis M et al. Genes Dev. 2016 Apr 15;30(8):918-30). Y107H Hupki mice were generated by microinjection of Cas9/gRNA ribonucleoprotein complex along with single-stranded oligo deoxyribonucleotide donor (ssODN) into single-cell embryos of WT-Hupki mice in the Transgenic Facility at the Fox Chase Cancer Center.
  • ssODN single-stranded oligo deoxyribonucleotide donor
  • the gRNA recognition site is aaaacctaccagggcagctaCGG (SEQ ID NO: 21), with the PAM site in upper case.
  • the ssODN has the following sequence: tgaccgtgcaagtcacagacttggctgtcccagaatgcaagaagcccagacggaaaccgtGGGAgccctggtaggttttctggga agggacagaagatgacaggggccaggagggggctggtgc (SEQ ID NO: 22).
  • the single-piece synthetic gRNA and ssODN containing two phosphorothioate bonds at each end were ordered from Integrated DNA Technologies and validated in human K562 cells prior to microinjection for efficient introduction of the Y107H mutation.
  • Two independent founders with heterozygous T to C mutations were bred to homozygosity and crossed to C57B1/6 background for five generations.
  • the entire p53 coding region was amplified and sequenced by the Genomics Facility at the Wistar Institute.
  • mice were housed in plastic cages with ad libitum diet and maintained with a 12 hr dark/12 hr light cycle at 22°C.
  • IACUC Institutional Animal Care and Use Committee
  • Mice were housed in plastic cages with ad libitum diet and maintained with a 12 hr dark/12 hr light cycle at 22°C.
  • DSS dextran sulfate sodium
  • Mice were monitored three times per week for overall weight, stool consistency, and gross bleeding. Inflammatory score assessment was conducted in blinded manner by a pathologist (D. Garlick, StageBio).
  • RNA Seq RNA Sequencing
  • hypomorphic variants are located in distinct functional domains of p53 (P47S in transactivation domain 2, and Y107H in the DNA binding domain of p53) we were surprised to find three things in common between them.
  • RRAD p53 target
  • hypomorphs are defective in the transactivation of only a small subset of p53 target genes, and thus can be classified as hypomorphic. They also suggest that there might be a correlation between RRAD level and the presence of inactive or hypomorphic p53. p53 hypomorphs adopt a mis-folded, mutant conformation
  • RRAD is regulated by both p53 and NF-KB (24). Mutant forms of p53, including the R273H mutant, bind and enhance NF-KB activity (9). This led us to predict that the P47S and Y107H variants might both misfold into the common, denatured conformation that is characteristic of mutant p53 and specifically recognized by the monoclonal antibody pAb240 (25, 26). We further reasoned that P47S and Y107H LCLs might show increased NF-KB activity. To test the first hypothesis, we used CRISPR-Cas9 knock-in technology to generate two clones each of the P47S and Y107H hypomorphs, in the background of HCT116 cells (FIG. 5B and FIG. 5C).
  • PLA of the Hsc70-p53 interaction in early passage primary MEFs revealed significantly increased association of Hsc70 with P47S and Y107H compared to WT p53 (FIG. 1H, FIG. 51; see FIG. 5E for the negative control). These data indicate that the P47S and Y107H hypomorphs both have increased propensity to misfold into a mutant conformation. This is similar to what we showed previously for the G334R hypomorph of p53 (23).
  • Tumor-derived mutant forms of p53 can bind and stabilize the p65 subunit of NF-KB on chromatin, leading to increased steady state level of NF-KB target genes in tumors with mutant p53 (9, 29, 30).
  • mutant p53 9, 29, 30.
  • LCLs heterozygous for P47S and Y107H with TNF-a and analyzed the induction of IL-6 and IL-8, two well-known NF-KB target genes by quantitative real time polymerase chain reaction (q-RT-PCR). In both cases we compared this induction to matched WT LCL lines.
  • Altered biochemical properties of the Y107H hypomorph can be reversed by the p53 refolding agent arsenic trioxide (ATO)
  • RNA Seq data from RNA isolated from eighteen samples This included eight different LCL lines with WT p53 (of varied ethnicity, sex, and age) along with ten different hypomorph cell lines: Y107H; P47S (5 independent lines); R175C; Y220H; G334R and R273H (Li Fraumeni mutant). With the exception of one P47S line, all LCLs were heterozygous. All lines were analyzed in unstressed conditions in biological triplicates.
  • IP A Ingenuity pathways analysis

Abstract

L'invention concerne des compositions et des utilisations associées pour l'identification de variants de p53 hypomorphes. L'invention concerne également des méthodes de traitement du cancer et d'identification de patients présentant un risque accru de cancer.
PCT/US2023/085631 2022-12-23 2023-12-22 Compositions et procédés d'identification de variants de p53 hypomorphes WO2024138106A1 (fr)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US63/477,024 2022-12-23

Publications (1)

Publication Number Publication Date
WO2024138106A1 true WO2024138106A1 (fr) 2024-06-27

Family

ID=

Similar Documents

Publication Publication Date Title
US20130040852A1 (en) Biomarkers based on a multi-cancer invasion-associated mechanism
US10745761B2 (en) Method and systems for lung cancer diagnosis
US20210395834A1 (en) Abca1 downregulation in prostate cancer
TW201300777A (zh) 預測大腸直腸癌轉移復發之生物標記
US11360093B2 (en) Colorectal cancer diagnostic composition, and method for detecting diagnostic marker
CN110229899B (zh) 用于结直肠癌早期诊断或预后预测的血浆标记物组合
KR101475032B1 (ko) Her2 저해제 내성 암을 진단하기 위한 마커, 이를 포함하는 진단키트 및 her2 저해제 내성 암을 진단하는 방법
CN112626207B (zh) 一种用于区分非侵袭性和侵袭性无功能垂体腺瘤的基因组合
US20130345077A1 (en) Diagnosis of lymph node involvement in rectal cancer
KR101657051B1 (ko) 만성폐쇄성폐질환 진단용 마커 조성물
CN109504773B (zh) 一种与口腔鳞癌分化等级相关的生物标志物
US10081842B2 (en) Prostate cancer gene expression profiles
WO2019134994A1 (fr) Biomarqueurs pronostiques pour cancers positifs du papillomavirus humain
US20090123932A1 (en) Quantitative test to detect disease progression markers of epithelial ovarian cancer patients
KR101289454B1 (ko) 소세포폐암 및 비소세포폐암 진단 마커로서의 보체 ｃ９
WO2024138106A1 (fr) Compositions et procédés d'identification de variants de p53 hypomorphes
CN112522405B (zh) Magi3在预测结直肠癌患者预后或化疗敏感性中的应用
WO2017214189A1 (fr) Méthodes et compositions pour la détection et le diagnostic du cancer de la vessie
US10890579B2 (en) Methods and kits for detecting a fusion messenger RNA transcript or a polypeptide encoded by the fusion messenger RNA transcript
US10066270B2 (en) Methods and kits used in classifying adrenocortical carcinoma
KR101871847B1 (ko) Igbp1을 포함하는 루프스 신염 진단용 바이오 마커 조성물
CN116411080B (zh) 一种区分冷、热肿瘤的标志物
US20120156681A1 (en) Composition for diagnosis of liver metastasis of colorectal cancer and the use thereof
KR102259708B1 (ko) 대장암에 대한 항암제 감수성 예측을 위한 신규 바이오마커
KR102326119B1 (ko) 암의 면역 치료 후 예후 예측용 바이오 마커