WO2024106545A1 - 髄腔内投与のためのヘテロ核酸 - Google Patents

髄腔内投与のためのヘテロ核酸 Download PDF

Info

Publication number
WO2024106545A1
WO2024106545A1 PCT/JP2023/041677 JP2023041677W WO2024106545A1 WO 2024106545 A1 WO2024106545 A1 WO 2024106545A1 JP 2023041677 W JP2023041677 W JP 2023041677W WO 2024106545 A1 WO2024106545 A1 WO 2024106545A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid strand
composition
nucleoside
nucleosides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2023/041677
Other languages
English (en)
French (fr)
Japanese (ja)
Inventor
隆徳 横田
哲也 永田
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tokyo Medical and Dental University NUC
Original Assignee
Tokyo Medical and Dental University NUC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tokyo Medical and Dental University NUC filed Critical Tokyo Medical and Dental University NUC
Priority to JP2024558963A priority Critical patent/JPWO2024106545A1/ja
Publication of WO2024106545A1 publication Critical patent/WO2024106545A1/ja
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the present invention relates to double-stranded nucleic acid complexes and compositions for intrathecal administration.
  • oligonucleotides have attracted attention in the ongoing development of pharmaceuticals known as nucleic acid drugs, and in particular, the development of nucleic acid drugs using the antisense method is being actively pursued, given their high selectivity for target genes and low toxicity.
  • the antisense method involves selectively modifying or inhibiting the expression of proteins encoded by target genes or the activity of miRNA by introducing complementary oligonucleotides (antisense oligonucleotides: often referred to as "ASOs (Antisense Oligonucleotides)" in this specification) into cells, using a partial sequence of mRNA or miRNA transcribed from a target gene as the target sense strand.
  • ASOs Antisense Oligonucleotides
  • the present inventors have developed a double-stranded nucleic acid complex (heteroduplex oligonucleotide, HDO) in which an antisense oligonucleotide is annealed to its complementary strand (Patent Document 1, Non-Patent Documents 1 and 2).
  • the double-stranded nucleic acid complex is a technological technology with a strong antisense effect.
  • the present inventors have developed a double-stranded nucleic acid complex in which a lipid ligand such as cholesterol is bound to the end of the complementary strand in order to control drug delivery of the double-stranded nucleic acid complex (Patent Document 3).
  • This double-stranded nucleic acid complex exhibits excellent properties for passing through the blood-brain barrier and is efficiently delivered to the central nervous system by intravenous administration. Therefore, it is possible to provide an excellent antisense effect in the central nervous system.
  • the objective of the present invention is to provide a new double-stranded nucleic acid complex that can produce an excellent antisense effect in the central nervous system by intrathecal administration.
  • the present inventors bound a new target-binding molecule to the complementary strand of a double-stranded nucleic acid complex and administered it intracerebroventricularly to mice.
  • the antisense effect was enhanced in the central nervous system, including various brain regions ( Figure 3C).
  • the enhancement of the antisense effect based on the target-binding molecule is considered to be an effect unique to double-stranded nucleic acid complexes.
  • a composition for intrathecal administration comprising a double-stranded nucleic acid complex comprising a first nucleic acid strand and a second nucleic acid strand
  • the first nucleic acid strand is capable of hybridizing to at least a portion of a gene of interest or a transcription product thereof and capable of inducing steric blocking, exon skipping, and/or exon inclusion in the central nervous system for the gene of interest or the transcription product thereof
  • the second nucleic acid strand comprises a base sequence complementary to the first nucleic acid strand and is bound to at least one target binding molecule capable of binding to a target molecule expressed on the surface of a cell in the central nervous system
  • the composition wherein the target binding molecule is a ligand molecule, an antibody or fragment thereof, or a nucleic acid aptamer.
  • the peptide is (a) neurotensin or its D-retro-inverso peptide, (b) a transferrin receptor-binding peptide or a D-form retro-inverso peptide thereof; (c) a rabies virus glycoprotein or a fragment thereof; or (d) a cyclic peptide having an amino acid sequence shown in any one of SEQ ID NOs: 31 to 34.
  • the composition described in (3), wherein the neurotensin consists of the amino acid sequence shown in SEQ ID NO: 5, 22, or 23.
  • composition described in (3), wherein the transferrin receptor-binding peptide consists of the amino acid sequence shown in SEQ ID NO: 14, 16, or 27.
  • the first nucleic acid strand (i) a central region comprising at least two consecutive deoxyribonucleosides; (ii) a 5' wing region comprising an unnatural nucleoside disposed on the 5' end of the central region; and (iii) a 3' wing region comprising an unnatural nucleoside disposed on the 3' end of the central region.
  • the second nucleic acid strand comprises at least one selected from the group consisting of deoxyribonucleosides, 2'-modified nucleosides, 5'-modified nucleosides, and bridged nucleosides.
  • composition described in (12), wherein the 2'-modified nucleoside is selected from the group consisting of 2'-O-methyl modified nucleosides, 2'-O-methoxyethyl modified nucleosides, and 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleosides.
  • the 5'-modified nucleoside is a 5'-cp modified nucleoside, a 5'-methyl modified nucleoside, or a 5'-dimethyl modified nucleoside.
  • composition according to (12) wherein the bridged nucleoside is selected from the group consisting of LNA nucleosides, 2',4'-BNA NC nucleosides, cEt BNA nucleosides, ENA nucleosides, AmNA nucleosides, GuNA nucleosides, scpBNA nucleosides, scpBNA2 nucleosides, and BANA3 nucleosides.
  • the second nucleic acid strand contains non-complementary bases and/or one or more insertions and/or deletions relative to the first nucleic acid strand.
  • composition according to (16), wherein the second nucleic acid strand comprises 1 to 3 non-complementary bases.
  • the insertion sequence consists of 1 to 8 bases.
  • the deletion consists of 1 to 4 consecutive bases.
  • the composition according to any one of (1) to (19), wherein the second nucleic acid strand comprises at least one overhang region located on the 5'-end and/or 3'-end side of a region consisting of a base sequence complementary to the first nucleic acid strand.
  • the composition described in (20), wherein the overhang region is 1 to 20 bases in length.
  • the nucleic acid consists of one or 2 to 10 nucleosides and/or non-natural nucleosides linked by internucleoside bonds.
  • the polyether group is a polyethylene glycol group or a triethylene glycol group.
  • the alkylamino group is a hexylamino group.
  • the central nervous system is selected from the group consisting of the cerebral cortex, the basal ganglia, the cerebral white matter, the diencephalon, the brainstem, the cerebellum, and the spinal cord.
  • the present invention provides a new double-stranded nucleic acid complex that can produce an excellent antisense effect in the central nervous system when administered intrathecally.
  • FIG. 1 shows the structures of various natural and non-natural nucleotides.
  • FIG. 2 shows the structures of various bridged nucleic acids.
  • 3 shows the antisense effect in the central nervous system when various double-stranded nucleic acid complexes are administered intravenously or intrathecally.
  • FIG. 3A shows the antisense effect in the central nervous system when lipid-bound and non-lipid-bound double-stranded nucleic acid complexes are administered intravenously.
  • FIG. 3B shows the antisense effect in the central nervous system when lipid-bound and non-lipid-bound double-stranded nucleic acid complexes are administered intrathecally.
  • FIG. 3A shows the antisense effect in the central nervous system when lipid-bound and non-lipid-bound double-stranded nucleic acid complexes are administered intrathecally.
  • FIG. 3A shows the antisense effect in the central nervous system when lipid-bound and non-lipid-bound double-stranded nucleic acid complexe
  • FIG. 3C shows the antisense effect in the central nervous system when a peptide-bound double-stranded nucleic acid complex is administered intrathecally in one embodiment of the present invention.
  • Figure 4 shows the linker between the cRNA and the peptide in the second nucleic acid strand (eNT-cRNA or LT7-cRNA) of eNT-HDO (mMalat1) or LT7-HDO (mMalat1).
  • the linker between the cRNA and the peptide includes an alkylene group (six carbon atoms), polyethylene glycol (PEG), and a cyclooctyne derivative.
  • Figure 5 shows the structures of various nucleic acids used in the examples.
  • Figure 5A shows the structure of an ASO (mMalat1) targeting the Malat1 gene.
  • Figure 5B shows the structures of eNT-ASO (mMalat1) and LT7-ASO (mMalat1).
  • Figure 5C shows the structures of eNT-HDO (mMalat1), KNT-HDO (mMalat1), LT7-HDO (mMalat1), and LT12-HDO (mMalat1).
  • Figure 6 shows the expression levels of Malat1 in the left and right frontal cortex, parietal cortex, occipital cortex, striatum, hippocampus, cerebellum, brain stem, and cervical spine in mice that were intracerebroventricularly administered 5 ⁇ g of various nucleic acid agents one week after administration.
  • Figure 7 shows the expression levels of Malat1 in the left and right frontal cortex, parietal cortex, occipital cortex, striatum, hippocampus, cerebellum, brain stem, and cervical spine in mice that were intracerebroventricularly administered 25 ⁇ g of various nucleic acid agents one week after administration. Error bars indicate standard error.
  • Figure 8 shows Malat1 expression levels one week after intracerebroventricular administration of various nucleic acid agents at different doses (5 ⁇ g, 10 ⁇ g, 25 ⁇ g, or 50 ⁇ g) in mice.
  • Figure 8A shows Malat1 expression levels in the frontal cortex.
  • Figure 8B shows Malat1 expression levels in the parietal cortex.
  • Figure 8C shows Malat1 expression levels in the occipital cortex. Error bars indicate standard error.
  • Figure 9 shows Malat1 expression levels one week after intracerebroventricular administration of various nucleic acid agents at different doses (5 ⁇ g, 10 ⁇ g, 25 ⁇ g, or 50 ⁇ g) in mice.
  • Figure 9A shows Malat1 expression levels in the striatum.
  • Figure 9B shows Malat1 expression levels in the hippocampus.
  • Figure 9C shows Malat1 expression levels in the brain stem. Error bars indicate standard error.
  • Figure 10 shows the expression levels of Malat1 in the left and right frontal cortex, parietal cortex, occipital cortex, striatum, hippocampus, cerebellum, brain stem, cervical spine, and lumbar spine in mice that were intracerebroventricularly administered 9 ⁇ g of various nucleic acid agents one week after administration. Error bars indicate standard error.
  • Figure 11 shows the expression levels of Malat1 in the left and right frontal cortex, parietal cortex, occipital cortex, striatum, hippocampus, and cerebellum one week after intracerebroventricular administration of 25 ⁇ g of various nucleic acid agents. Error bars indicate standard error.
  • Figure 12 shows the expression levels of Malat1 in the left and right parietal cortex and occipital cortex one week after intracerebroventricular administration of 25 ⁇ g of various nucleic acid agents. Error bars indicate standard error. 13 shows Malat1 expression levels in the left and right brain regions one week after intracerebroventricular administration of various nucleic acid agents in mice. Error bars indicate standard error. 14 shows the Malat1 expression levels in the left and right brain regions one week after intracerebroventricular administration of various nucleic acid agents in mice. Error bars indicate standard error. 15 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error.
  • 16 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error. 17 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error. 18 shows the Malat1 expression level in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error. 19 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error.
  • 20 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error.
  • 21 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error.
  • 22 shows the expression level of Malat1 in each brain region one week after administration of various nucleic acid agents into the cerebroventricular cavity of mice. Error bars indicate standard error.
  • Double-stranded nucleic acid complex 1-1 The first aspect of the present invention is a double-stranded nucleic acid complex for intrathecal administration.
  • the double-stranded nucleic acid complex of the present invention comprises a first nucleic acid strand and a second nucleic acid strand, and the second nucleic acid strand is bound to at least one target-binding molecule.
  • the double-stranded nucleic acid complex of the present invention has an excellent antisense effect in the central nervous system when administered intrathecally.
  • the "transcription product" of a target gene refers to any RNA that is a direct target of the double-stranded nucleic acid complex of the present invention and is synthesized by RNA polymerase. Specifically, it may include mRNA (including mature mRNA, mRNA precursor, and mRNA without base modification) transcribed from a target gene, non-coding RNA (ncRNA) such as miRNA, long non-coding RNA (lncRNA), and natural antisense RNA.
  • ncRNA non-coding RNA
  • miRNA miRNA
  • lncRNA long non-coding RNA
  • lncRNA long non-coding RNA
  • a target gene refers to a gene whose transcription or translation product expression level can be suppressed or enhanced, whose transcription or translation product function can be inhibited, or whose steric blocking, splicing switch, RNA editing, exon skipping, or exon inclusion can be induced by the antisense effect of the double-stranded nucleic acid complex of the present invention.
  • the target gene may be referred to as a "gene of interest" in some cases.
  • the type of target gene is not particularly limited as long as it is expressed in a living body such as the central nervous system, but examples of the target gene include genes derived from an organism into which the double-stranded nucleic acid complex of the present invention is introduced, such as genes whose expression is increased in various diseases (e.g., central nervous system diseases).
  • target genes include the scavenger receptor B1 (often referred to herein as “SR-B1”) gene, the metastasis associated lung adenocarcinoma transcript 1 (often referred to herein as “Malat1”) gene, the microtubule-associated protein tau (often referred to herein as “Mapt”) gene, the beta-secretase 1 (often referred to herein as “BACE1”) gene, the dystrophia myotonic-protein kinase (DMPK) gene, and the dystrophin gene.
  • the target gene is preferably a gene expressed in the central nervous system.
  • target transcript refers to any RNA that is a direct target of the nucleic acid complex of the present invention and is synthesized by RNA polymerase. In general, this refers to a "transcription product of a target gene.” Specifically, this may include mRNA (including mature mRNA, mRNA precursor, and mRNA without base modification) transcribed from a target gene, non-coding RNA (ncRNA) such as miRNA, long non-coding RNA (lncRNA), and natural antisense RNA.
  • ncRNA non-coding RNA
  • miRNA miRNA
  • lncRNA long non-coding RNA
  • transcription products of a target gene examples include SR-B1 mRNA, which is a transcription product of the SR-B1 gene, Mapt mRNA, which is a transcription product of the Mapt gene, BACE1 mRNA, which is a transcription product of the BACE1 gene, Malat1 non-coding RNA, which is a transcription product of the Malat1 gene, DMPK mRNA, which is a transcription product of the DMPK gene, and dystrophin mRNA, which is a transcription product of the dystrophin gene, or its precursor (pre-mRNA).
  • Mapt mRNA which is a transcription product of the Mapt gene
  • BACE1 mRNA which is a transcription product of the BACE1 gene
  • Malat1 non-coding RNA which is a transcription product of the Malat1 gene
  • DMPK mRNA which is a transcription product of the DMPK gene
  • dystrophin mRNA which is a transcription product of the dystrophin gene, or its precursor (pre-mRNA).
  • a specific example of a target transcript is the exon 23/intron 23 boundary region of Dystrophin pre-mRNA (GenBank accession number: NC_000086.7), for example positions 83803482 to 83803566, for example positions 83803512 to 83803536.
  • the nucleotide sequence of mouse DMPK mRNA is shown in SEQ ID NO: 18, and the nucleotide sequence of human DMPK mRNA is shown in SEQ ID NO: 19. Note that in both SEQ ID NOs: 18 and 19, the nucleotide sequence of mRNA has been replaced with the nucleotide sequence of DNA.
  • the nucleotide sequence information of these genes and transcripts can be obtained from publicly known databases, for example the NCBI (National Center for Biotechnology Information) database.
  • antisense oligonucleotide (ASO) or “antisense nucleic acid” refers to a single-stranded oligonucleotide that contains a base sequence capable of hybridizing (i.e., complementary) to at least a portion of a target transcript (mainly a transcript of a target gene) and can exert an antisense effect on the target transcript.
  • the first nucleic acid strand functions as an ASO
  • the target region may include the 3'UTR, 5'UTR, exon, intron, coding region, translation initiation region, translation termination region, or any other nucleic acid region.
  • the target region of the target transcript can be at least 8 bases long, for example, 10-35 bases long, 12-25 bases long, 13-20 bases long, 14-19 bases long, or 15-18 bases long, or 13-22 bases long, 16-22 bases long, or 16-20 bases long.
  • Antisense effect refers to the effect of regulating the expression or editing of a target transcript by hybridizing an ASO to the target transcript (e.g., RNA sense strand).
  • Regulatory expression or editing of a target transcript refers to suppression or reduction of the expression of a target gene or the expression level of a target transcript (herein, "expression level of a target transcript” is often referred to as “level of a target transcript”), inhibition of translation, RNA editing, base editing, splicing control or splicing function modification effects (e.g., splicing switch, exon inclusion, exon skipping, etc.), steric blocking, or degradation of a transcript.
  • RNA oligonucleotide when introduced into a cell as an ASO, the ASO forms a partial duplex by annealing with the mRNA, which is the transcript of the target gene.
  • This partial duplex acts as a cover to prevent translation by ribosomes, thereby inhibiting the expression of the target protein encoded by the target gene at the translation level (steric blocking).
  • an oligonucleotide containing DNA is introduced into a cell as an ASO, a partial DNA-RNA heteroduplex is formed.
  • This heteroduplex structure is recognized by RNase H, resulting in degradation of the mRNA of the target gene and inhibition of expression of the protein encoded by the target gene at the expression level. Additionally, an antisense effect can also be achieved by targeting an intron in a pre-mRNA. Additionally, an antisense effect can also be achieved by targeting an miRNA, in which case inhibition of the function of the miRNA can increase expression of the gene whose expression is normally controlled by the miRNA. In one embodiment, modulation of expression of the target transcript can be a reduction in the amount of the target transcript.
  • the antisense effect can be measured, for example, by administering a test nucleic acid compound to a subject (e.g., a mouse) and measuring, for example, several days later (e.g., 2 to 7 days later), the expression level of a target gene whose expression is regulated by the antisense effect provided by the test nucleic acid compound or the level (amount) of a target transcript (e.g., amount of mRNA or amount of RNA such as microRNA, amount of cDNA, amount of protein, etc.).
  • a decrease in the measured expression level of the target gene or the level of the target transcript by at least 10%, at least 20%, at least 25%, at least 30%, or at least 40% compared to a negative control (e.g., vehicle administration) indicates that the test nucleic acid compound can produce an antisense effect (e.g., a reduction in the amount of the target transcript).
  • the number, type and position of non-natural nucleotides in the nucleic acid strand may affect the antisense effect provided by the nucleic acid complex.
  • the choice of modification may vary depending on the sequence of the target gene, etc., but a person skilled in the art can determine a suitable embodiment by referring to the descriptions in the literature related to antisense methods (e.g., WO 2007/143315, WO 2008/043753, and WO 2008/049085).
  • the relevant modification can be evaluated if the measured value thus obtained is not significantly lower than that of the nucleic acid complex before modification (e.g., if the measured value obtained after modification is 70% or more, 80% or more, or 90% or more of the measured value of the nucleic acid complex before modification).
  • translation product of a target gene refers to any polypeptide or protein synthesized by translation of the target transcript or the transcription product of a target gene that is the direct target of the nucleic acid complex of the present invention.
  • aptamer refers to a nucleic acid molecule that specifically binds to a specific target molecule inside a cell, on a cell membrane, or outside a cell, for example, on a cell membrane or outside a cell. Aptamers can be produced by methods known in the art, for example, in vitro selection methods using the SELEX (systematic evolution of ligands by exponential enrichment) method.
  • decoy refers to a nucleic acid that has a sequence of the binding site of a transcription factor (e.g., NF-kB) or a similar sequence, and is introduced into a cell as a “decoy” to suppress the action of the transcription factor (if it is a transcription activator, it suppresses transcription, and if it is a transcription repressor, it promotes transcription).
  • a transcription factor e.g., NF-kB
  • Decoy nucleic acids can be easily designed based on information on the binding sequence of the target transcription factor.
  • bait refers to a nucleic acid molecule that specifically binds to a specific target molecule within a cell and modifies the function of the target molecule.
  • a target that interacts with a bait is also called a "prey.”
  • nucleic acid or “nucleic acid molecule” as used herein may refer to a monomeric nucleotide or nucleoside, or may mean an oligonucleotide consisting of multiple monomers, or a polynucleotide if it is a polymer.
  • Natural nucleic acid refers to a nucleic acid that exists in nature. Natural nucleic acids include the natural nucleosides and natural nucleotides described below.
  • Non-natural nucleic acid or “artificial nucleic acid” refers to any nucleic acid other than natural nucleic acid. Non-natural nucleic acid or artificial nucleic acid includes the non-natural nucleosides and non-natural nucleotides described below.
  • nucleic acid strand refers to two or more nucleosides linked by internucleoside bonds, and may be, for example, an oligonucleotide or a polynucleotide.
  • a nucleic acid strand may be made full length or partial by chemical synthesis, for example, using an automated synthesizer, or by enzymatic processes using polymerases, ligases, or restriction reactions.
  • a nucleic acid strand may contain natural and/or non-natural nucleotides.
  • Nucleoside generally refers to a molecule that is composed of a combination of a base and a sugar.
  • the sugar portion of a nucleoside is typically, but not limited to, a pentofuranosyl sugar, examples of which include ribose and deoxyribose.
  • the base portion of a nucleoside is typically a heterocyclic base moiety, including, but not limited to, adenine, cytosine, guanine, thymine, or uracil, as well as other modified nucleobases (modified bases).
  • Nucleotide refers to a molecule in which a phosphate group is covalently linked to the sugar portion of the nucleoside.
  • the phosphate group is usually linked to the hydroxyl group at the 2', 3', or 5' position of the sugar.
  • Oligonucleotide refers to a linear oligomer formed by covalently linking several to several dozen hydroxyl groups and phosphate groups in the sugar moieties between adjacent nucleotides.
  • Polynucleotide refers to a linear polymer formed by linking several dozen or more, preferably several hundred or more, nucleotides that are more numerous than an oligonucleotide, by the covalent bonds.
  • the phosphate groups are generally considered to form internucleoside bonds.
  • naturally nucleosides refer to nucleosides that exist in nature. Examples include ribonucleosides consisting of ribose and bases such as adenine, cytosine, guanine, or uracil, and deoxyribonucleosides consisting of deoxyribose and bases such as adenine, cytosine, guanine, or thymine.
  • ribonucleosides found in RNA and deoxyribonucleosides found in DNA are often referred to as "DNA nucleosides" and "RNA nucleosides,” respectively.
  • natural nucleotide refers to a nucleotide that exists in nature and is a molecule in which a phosphate group is covalently bonded to the sugar portion of the natural nucleoside.
  • examples include ribonucleotides, which are known as the building blocks of RNA and in which a phosphate group is bonded to a ribonucleoside, and deoxyribonucleotides, which are known as the building blocks of DNA and in which a phosphate group is bonded to a deoxyribonucleoside.
  • non-natural nucleotide refers to any nucleotide other than a natural nucleotide, and includes modified nucleotides and nucleotide mimetics.
  • modified nucleotide refers to a nucleotide having one or more of a modified sugar moiety, a modified internucleoside linkage, and a modified nucleobase.
  • nucleotide mimetics includes structures used to replace nucleosides and linkages at one or more positions of an oligomeric compound.
  • Peptide nucleic acids PNA are nucleotide mimetics with a backbone in which N-(2-aminoethyl)glycine is linked by amide bonds in place of sugars.
  • nucleic acid strands including non-natural oligonucleotides often have desirable properties, such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity. Thus, they are preferred over natural nucleotides.
  • unnatural nucleoside refers to any nucleoside other than a natural nucleoside. For example, it includes modified nucleosides and nucleoside mimetics.
  • modified nucleoside refers to a nucleoside having a modified sugar moiety and/or a modified nucleobase.
  • mimetic refers to functional groups that replace the sugar, nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of a sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • nucleoside mimic includes structures that are used to replace the sugar, or the sugar and base, at one or more positions of an oligomeric compound, or to replace the linkage between the monomeric subunits that make up the oligomeric compound, etc.
  • oligomeric compound is meant a polymer of linked monomeric subunits that is at least capable of hybridizing to a region of a nucleic acid molecule.
  • Nucleoside mimetics include, for example, morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimetics, e.g., nucleoside mimetics having non-furanose sugar units.
  • Modified sugar refers to a sugar having a substitution and/or any change from a natural sugar moiety (i.e., a sugar moiety found in DNA (2'-H) or RNA (2'-OH)), and "sugar modification” refers to a substitution and/or any change from a natural sugar moiety.
  • a nucleic acid strand may optionally include one or more modified nucleosides, including modified sugars.
  • “Sugar-modified nucleoside” refers to a nucleoside having a modified sugar moiety. Such sugar-modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to a nucleic acid strand.
  • the nucleoside includes a chemically modified ribofuranose ring moiety.
  • chemically modified ribofuranose rings include, but are not limited to, the addition of substituents (including 5' and 2' substituents), bridging of non-geminal ring atoms to form bicyclic nucleic acids (bridged nucleic acids, BNAs), replacement of ribosyl ring oxygen atoms with S, N(R), or C(R1)(R2) (wherein R, R1, and R2 each independently represent H, C1 - C12 alkyl, or a protecting group), and combinations thereof.
  • sugar-modified nucleosides include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 5'-allyl (R or S), 4'-S, 2'-F (2'-fluoro group), 2' -OCH3 (2'-O-Me group or 2'-O-methyl group), 2'-O-[2-(N-methylcarbamoyl)ethyl] (2'-O-MCE group), and 2'-O-methoxyethyl (2'-O-MOE or 2 -O( CH2 ) 2OCH3 ) substituents.
  • nucleosides containing 5'-vinyl, 5'-methyl (R or S), 5'-allyl (R or S), 4'-S, 2'-F (2'-fluoro group), 2' -OCH3 (2'-O-Me group or 2'-O-methyl group), 2'-O-[2-(N-methylcarbamo
  • “2'-modified sugar” refers to a furanosyl sugar modified at the 2'-position. Nucleosides containing a 2'-modified sugar may also be referred to as "2'-modified nucleosides" or "2'-sugar modified nucleosides.”
  • BNA nucleoside refers to a modified nucleoside that contains a bicyclic sugar moiety. Nucleics that contain a bicyclic sugar moiety are commonly referred to as bridged nucleic acids (BNAs). Nucleosides that contain a bicyclic sugar moiety are also sometimes referred to as “bridged nucleosides,” “bridged non-natural nucleosides,” or “BNA nucleosides.” Some examples of bridged nucleic acids are shown in Figure 2.
  • a bicyclic sugar may be a sugar in which the 2' and 4' carbon atoms are bridged by two or more atoms.
  • bicyclic sugars are known to those of skill in the art.
  • One subgroup of bicyclic sugar-containing nucleic acids (BNAs) or BNA nucleosides can be described as having the 2' and 4 ' carbon atoms bridged by 4'-( CH2 ) p -O-2', 4'-( CH2 ) p - CH2-2 ', 4'-( CH2 ) p -S-2', 4'-( CH2 ) p -OCO-2', 4'-(CH2) n -N( R3 )-O-( CH2 ) m -2', where p, m and n represent integers from 1 to 4, 0 to 2 and 1 to 3, respectively; and R3 represents a hydrogen atom, an alkyl group, an alkenyl group, a cycloalkyl group, an
  • R 1 and R 2 are typically hydrogen atoms, but may be the same as or different from each other, and may also be a protecting group for a hydroxyl group for nucleic acid synthesis, an alkyl group, an alkenyl group, a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group, a silyl group, a phosphate group, a phosphate group protected by a protecting group for nucleic acid synthesis, or P(R 4 )R 5 (wherein R 4 and R 5 may be the same as or different from each other and respectively represent a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto
  • amine BNAs also known as 2'-Amino-LNAs
  • 2'-Amino-LNAs e.g., 3-(Bis(3-aminopropyl)amino)propanoyl substitutions
  • 2'-O,4'-C-spirocyclopropylene bridged nucleic acids also known as scpBNAs
  • BNA nucleosides include methyleneoxy (4'-CH 2 -O-2') BNA nucleosides (also known as LNA nucleosides, 2',4'-BNA nucleosides) (e.g., ⁇ -L-methyleneoxy (4'-CH 2 -O-2') BNA nucleosides, ⁇ -D-methyleneoxy (4'-CH 2 -O-2') BNA nucleosides), ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA nucleosides (also known as ENA nucleosides), ⁇ -D-thio (4'-CH 2 -S-2') BNA nucleosides, aminooxy (4'-CH 2 -ON(R 3 )-2') BNA nucleosides, oxyamino (4'-CH 2 -N(R 3 )-O-2') BNA nucleosides (2',4'-BNA Also known as NC nucle
  • a "cationic nucleoside” is a modified nucleoside that exists in a cationic form relative to a neutral form (such as the neutral form of a ribonucleoside) at a certain pH (e.g., human physiological pH (about 7.4), the pH of a delivery site (e.g., an organelle, cell, tissue, organ, organism, etc.) etc.).
  • a cationic nucleoside may contain one or more cationic modifying groups at any position of the nucleoside.
  • Bicyclic nucleosides with a methyleneoxy (4'- CH2 -O-2') bridge are sometimes referred to as LNA nucleosides.
  • modified internucleoside linkage refers to an internucleoside linkage having a substitution or any change from a naturally occurring internucleoside linkage (i.e., a phosphodiester linkage).
  • Modified internucleoside linkages include internucleoside linkages that contain a phosphorus atom and internucleoside linkages that do not contain a phosphorus atom.
  • Representative phosphorus-containing internucleoside bonds include phosphodiester bonds, phosphorothioate bonds, phosphorodithioate bonds, phosphotriester bonds (e.g., methyl phosphotriester bonds and ethyl phosphotriester bonds as described in U.S. Patent Registration No.
  • alkyl phosphonate bonds e.g., methyl phosphonate bonds as described in U.S. Patent Registration Nos. 5,264,423 and 5,286,717, and methoxypropyl phosphonate bonds as described in WO 2015/168172
  • alkylthiophosphonate bonds e.g., methylthiophosphonate bonds
  • boranophosphate bonds e.g., a cyclic guanidine moiety
  • internucleoside bonds containing a cyclic guanidine moiety e.g., a partial structure represented by the following formula (II):
  • an internucleoside linkage containing a guanidine moiety e.g., a tetramethylguanidine (TMG) moiety
  • TMG tetramethylguanidine
  • III a partial structure represented by the following formula (III):
  • Phosphorothioate linkages refer to internucleoside linkages in which the non-bridging oxygen atom of the phosphodiester bond is replaced with a sulfur atom. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.
  • the modified internucleoside linkage is preferably one that is more resistant to nucleases than naturally occurring internucleoside linkages.
  • the internucleoside linkage When an internucleoside linkage has a chiral center, the internucleoside linkage may be chiral controlled.
  • chiral controlled it is intended to exist in a single diastereomer with respect to the chiral center, e.g., the chiral linkage phosphorus.
  • a chiral controlled internucleoside linkage may be completely chirally pure or may have a high chiral purity, e.g., 90% de, 95% de, 98% de, 99% de, 99.5% de, 99.8% de, 99.9% de, or higher.
  • chiral purity refers to the proportion of one diastereomer in a mixture of diastereomers, expressed as diastereomeric excess (% de), and defined as (target diastereomer - other diastereomers)/(total diastereomers) x 100 (%).
  • the internucleoside linkages may be phosphorothioate linkages chiral controlled in the Rp or Sp configuration, internucleoside linkages comprising guanidine moieties substituted with one to four C1-6 alkyl groups (e.g., tetramethylguanidine (TMG) moieties; see, e.g., Alexander A. Lomzov et al., Biochem Biophys Res Commun., 2019, 513(4), 807-811), and/or internucleoside linkages comprising cyclic guanidine moieties.
  • TMG tetramethylguanidine
  • phosphorothioate bonds chirally controlled in the Rp or Sp configuration can be synthesized according to the methods described in Naoki Iwamoto et al., Angew. Chem. Int. Ed. Engl. 2009, 48(3), 496-9; Natsuhisa Oka et al., J. Am. Chem. Soc. 2003, 125, 8307-8317; Natsuhisa Oka et al., J. Am. Chem. Soc. 2008, 130, 16031-16037; Yohei Nukaga et al., J. Org. Chem. 2016, 81, 2753-2762; Yohei Nukaga et al., J. Org. Chem.
  • phosphorothioate bonds in the Rp or Sp configuration are also known and are known to have the effects described in, for example, Naoki Iwamoto et al., Nat. Biotechnol., 2017, 35(9), 845-851 and Anastasia Khvorova et al., Nat. Biotechnol., 2017, 35(3), 238-248.
  • phosphorothioate bonds in the Sp configuration are chiral and more stable than those in the Rp configuration, and/or ASOs in the Sp configuration are chiral and more stable, promoting target RNA cleavage by RNase H1 and resulting in a more sustained response in vivo.
  • nucleobase refers to the base component (heterocyclic moiety) that constitutes a nucleic acid, and the main known bases are adenine, guanine, cytosine, thymine, and uracil.
  • nucleobase or “base” includes both modified and unmodified nucleic acid bases (bases), unless otherwise specified.
  • a purine base may be either a modified or unmodified purine base.
  • a pyrimidine base may be either a modified or unmodified pyrimidine base.
  • Modified nucleobase or “modified base” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil.
  • Unmodified nucleobase or “unmodified base” (natural nucleobase) means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • modified nucleobases include, but are not limited to, hypoxanthine, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, or N4-methylcytosine; N6-methyladenine or 8-bromoadenine; 2-thio-thymine; and N2-methylguanine or 8-bromoguanine.
  • the modified nucleobase is preferably 5-methylcytosine.
  • standard amino acids refers to the 20 types of L-amino acids that normally constitute proteins. Specific examples include histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, valine, arginine, cysteine, glutamine, glycine, proline, tyrosine, alanine, aspartic acid, asparagine, glutamic acid, and serine.
  • nonstandard amino acid refers to any amino acid other than the standard amino acids.
  • nonstandard amino acids include selenocysteine, O-phosphoserine, N-formylmethionine, pyrrolysine, pyroglutamic acid, pyrroleucin, selenomethionine, hydroxyproline, and gamma-carboxyglutamic acid.
  • Further examples of nonstandard amino acids include D-amino acids.
  • antibody refers to a protein that exhibits immune responsiveness to an antigen. Unless otherwise specified, in this specification, it refers to a monoclonal antibody. There are no particular limitations on the species from which the antibody is derived. Antibodies are preferably derived from birds and mammals. Examples include chicken, ostrich, mouse, rat, guinea pig, rabbit, goat, donkey, sheep, camel, horse, and human.
  • the term "monoclonal antibody” refers to a single type of immunoglobulin that contains a framework region (hereinafter referred to as "FR") and a complementarity determining region (hereinafter referred to as "CDR") and is capable of specifically binding to and recognizing an antigen, or a recombinant antibody or synthetic antibody that contains at least one pair of a light chain variable region ( VL region) and a heavy chain variable region ( VH region) contained in an immunoglobulin.
  • FR framework region
  • CDR complementarity determining region
  • the immunoglobulin can be of any class (e.g., IgG, IgE, IgM, IgA, IgD, and IgY) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2).
  • class e.g., IgG, IgE, IgM, IgA, IgD, and IgY
  • subclass e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2
  • Recombinant antibody refers to a chimeric antibody or a humanized antibody.
  • a “chimeric antibody” is an antibody created by combining the amino acid sequences of antibodies derived from different animals, in which the constant region (C region) of one antibody is replaced with the C region of another antibody.
  • C region constant region
  • an antibody in which the C region of a rat monoclonal antibody is replaced with the C region of a human antibody corresponds to this.
  • a specific example is an antibody in which the heavy chain variable region of a human antibody against an arbitrary antigen is replaced with the heavy chain variable region of an antibody against a target antigen, and the light chain variable region of a human antibody is replaced with the light chain variable region of an antibody against a target antigen. This can reduce the immune response against the antibody in the human body.
  • a “humanized antibody” is a mosaic antibody in which the CDR of a human antibody is replaced with the CDR of an antibody derived from a mammal other than human.
  • the variable region (V region) of an immunoglobulin molecule is composed of four FRs (FR1, FR2, FR3, and FR4) and three CDRs (CDR1, CDR2, and CDR3) linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 from the N-terminus.
  • the FRs are relatively conserved regions that form the framework of the variable region, and the CDRs directly contribute to the antigen-binding specificity of the antibody.
  • a humanized antibody can be constructed as a human antibody that inherits the antigen-binding specificity of an antibody against an antigen of interest, for example, by replacing a set of CDR1, CDR2, and CDR3 in the light chain or heavy chain of an antibody against an antigen of interest with a set of CDR1, CDR2, and CDR3 in the light chain or heavy chain of a human antibody against any antigen.
  • Such a humanized antibody is derived from a human antibody except for the CDRs, and therefore can reduce the immune response to the antibody in the human body more than a chimeric antibody.
  • synthetic antibody refers to an antibody synthesized chemically or by using recombinant DNA techniques.
  • an antibody newly synthesized by recombinant DNA techniques can be mentioned.
  • an scFv single chain fragment of variable region
  • an immunoglobulin molecule a pair of variable regions (light chain variable region VL and heavy chain variable region VH ) that form a functional antigen-binding site are located on separate polypeptide chains called light chain and heavy chain.
  • An scFv is a synthetic antibody with a molecular weight of about 35 kDa or less that has a structure in which VL and VH are linked by a flexible linker of sufficient length in an immunoglobulin molecule and are included in one polypeptide chain.
  • a pair of variable regions can self-assemble with each other to form one functional antigen-binding site.
  • An scFv can be obtained by incorporating a recombinant DNA encoding it into a vector using a known technique and expressing it.
  • Antibodies can also be modified.
  • Modification here includes functional modifications, such as glycosylation, that are necessary for antigen-specific binding activity, and labeling modifications that are necessary for antibody detection.
  • Glycosylation modifications on antibodies are carried out to adjust the affinity of the antibody for the target antigen. Specifically, for example, modifications can be made to remove the glycosylation site by introducing substitutions into the amino acid residues that make up the glycosylation in the FR of the antibody, thereby eliminating the glycosylation at that site.
  • the dissociation constant of the antibody with the antigen is preferably 10 ⁇ 7 M or less, and preferably has a high affinity of, for example, 10 ⁇ 8 M or less, more preferably 10 ⁇ 9 M or less, and particularly preferably 10 ⁇ 10 M or less.
  • the dissociation constant can be measured using a technique known in the art. For example, it may be measured using a Biacore system (GE Healthcare) with a kinetic evaluation kit software.
  • fragment of an antibody refers to an antibody fragment that is composed of a part of an antibody and exhibits immune responsiveness to an antigen like an antibody, and is an antigen-binding fragment.
  • fragments include Fab, Fab', F(ab') 2 , Fv fragment, Fv fragment stabilized by a disulfide bond (dsFv), (dsFv) 2 , bispecific dsFv (dsFv-dsFv'), diabody stabilized by a disulfide bond (dsdiabody), single-chain antibody molecule (scFv), dimeric scFv (bivalent diabody), multispecific antibody, heavy chain antibody such as camelized single domain antibody (camelized antibody; VHH antibody), nanobody, domain antibody, and bivalent domain antibody.
  • Fab is an antibody fragment generated by cleavage of an IgG molecule at the N-terminal side of the disulfide bond in the hinge region with papain, and is composed of the C H 1 and V H adjacent to the V H of the three domains (C H 1, C H 2, C H 3) that constitute the H chain constant region (heavy chain constant region: hereinafter referred to as C H ) , and a full-length L chain.
  • C H H chain constant region
  • Fab' can be obtained by reducing the Fab' dimer (F(ab') 2 ) generated by cleavage of an IgG molecule at the C-terminal side of the disulfide bond in the hinge region with pepsin under mild conditions to cleave the disulfide bond in the hinge region. All of these antibody fragments contain an antigen-binding site and therefore have the ability to specifically bind to an antigen epitope.
  • sugar includes monosaccharides, sugar molecules containing two or more sugars, and glycans.
  • glycan means linear or branched oligosaccharides or polysaccharides.
  • monosaccharides include acidic sugars (e.g., sialic acid, uronic acid), amino sugars (e.g., N-acetylglucosamine, N-acetylgalactosamine (GalNAc)), and neutral sugars (e.g., glucose, mannose, galactose, fucose).
  • Glycosylation is broadly classified into N-glycoside-linked glycan that is linked to asparagine residues and O-glycoside-linked glycan that is linked to serine/threonine, etc., depending on the binding mode with proteins.
  • monosaccharides contained in glycans include the monosaccharides mentioned above.
  • the term "complementary" as used herein means a relationship in which nucleic acid bases can form so-called Watson-Crick base pairs (natural base pairs) or non-Watson-Crick base pairs (Hoogsteen base pairs, etc.) through hydrogen bonds.
  • the antisense oligonucleotide region in the first nucleic acid strand does not necessarily need to be completely complementary to at least a portion of the target transcript (e.g., the transcript of the target gene), and it is acceptable if the base sequence has at least 70%, preferably at least 80%, and even more preferably at least 90% (e.g., 95%, 96%, 97%, 98%, or 99% or more) complementarity.
  • the antisense oligonucleotide region in the first nucleic acid strand can hybridize to the target transcript when the base sequence is complementary (typically, when the base sequence is complementary to at least a portion of the base sequence of the target transcript).
  • the complementary region in the second nucleic acid strand does not necessarily have to be completely complementary to at least a portion of the first nucleic acid strand, but is acceptable as long as the base sequence has at least 70%, preferably at least 80%, and even more preferably at least 90% (e.g., 95%, 96%, 97%, 98%, or 99% or more) complementarity.
  • the complementary region in the second nucleic acid strand can anneal when the base sequence is complementary to at least a portion of the first nucleic acid strand.
  • the complementarity of the base sequence can be determined by using a BLAST program or the like. Those skilled in the art can easily determine the conditions (temperature, salt concentration, etc.) under which the two strands can anneal or hybridize, taking into account the degree of complementarity between the strands. Furthermore, those skilled in the art can easily design an antisense nucleic acid complementary to a target transcription product, for example, based on information on the base sequence of the target gene.
  • Hybridization conditions may be various stringent conditions, such as low stringency conditions and high stringency conditions.
  • Low stringency conditions may be conditions of relatively low temperature and high salt concentration, for example, 30°C, 2xSSC, 0.1% SDS.
  • High stringency conditions may be conditions of relatively high temperature and low salt concentration, for example, 65°C, 0.1xSSC, 0.1% SDS.
  • Hybridization stringency can be adjusted by changing conditions such as temperature and salt concentration.
  • 1xSSC contains 150 mM sodium chloride and 15 mM sodium citrate.
  • subject refers to an object to which the double-stranded nucleic acid complex or composition of the present invention is applied.
  • Subjects include individuals, as well as organs, tissues, and cells. When the subject is an individual, it may be any animal, including humans. Examples of subjects other than humans include various livestock, poultry, pets, and laboratory animals. Although not limited thereto, the subject may be an individual in which the expression level of a target transcript needs to be reduced, or an individual in which treatment or prevention of a disease such as a central nervous system disease is required.
  • multiple refers to an integer of 2 or more, for example, an integer of 2 to 10, 2 to 7, 2 to 5, 2 to 4, or 2 to 3.
  • mutant peptide refers to any protein that is derived from the amino acid sequence of a wild-type peptide and has an amino acid sequence that is different from the amino acid sequence of the wild-type peptide.
  • mutant peptides include splicing variants, mutants based on SNPs, etc., and active fragments of peptides.
  • Mutant peptides may also include artificial peptides that are created based on the amino acid sequence of a wild-type peptide and have an amino acid sequence that is different from the amino acid sequence of the wild-type peptide.
  • active fragment refers to a peptide or polypeptide fragment that contains a partial region of a protein such as a peptide, and that retains 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or an equivalent or greater, of the activity of the full-length peptide or full-length protein.
  • amino acid length of the active fragment there are no particular limitations on the amino acid length of the active fragment, so long as it retains the activity of the peptide or protein.
  • amino acid identity refers to the percentage of matching amino acid residues out of the total number of amino acid residues in the amino acid sequences of two peptides or polypeptides being compared, when the sequences are aligned by inserting appropriate gaps into one or both sequences as necessary to maximize the number of matching amino acid residues.
  • amino acid substitution refers to substitution within a conservative amino acid group that has similar properties such as charge, side chain, polarity, and aromaticity among the 20 types of amino acids that make up natural peptides or proteins. Examples include substitutions within the uncharged polar amino acid group with low polarity side chains (Gly, Asn, Gln, Ser, Thr, Cys, Tyr), branched chain amino acids (Leu, Val, Ile), neutral amino acids (Gly, Ile, Val, Leu, Ala, Met, Pro), neutral amino acids with hydrophilic side chains (Asn, Gln, Thr, Ser, Tyr, Cys), acidic amino acids (Asp, Glu), basic amino acids (Arg, Lys, His), and aromatic amino acids (Phe, Tyr, Trp). Amino acid substitutions within these groups are preferred because they are known to be less likely to cause changes in the properties of the polypeptide.
  • the double-stranded nucleic acid complex of the present invention contains a first nucleic acid strand and a second nucleic acid strand, and can be administered intrathecally.
  • the specific structure of each nucleic acid strand is shown below.
  • the first nucleic acid strand can hybridize to at least a portion of a gene of interest or its transcription product, and can induce steric blocking, exon skipping, and/or exon inclusion of the gene of interest or its transcription product in the central nervous system.
  • the second nucleic acid strand contains a base sequence complementary to the first nucleic acid strand, and is bound to at least one target binding molecule.
  • target-binding molecule refers to any molecule capable of binding to a target molecule expressed on the cell surface in the central nervous system.
  • the target-binding molecule is a ligand molecule, an antibody or a fragment thereof, or a nucleic acid aptamer.
  • a "target molecule expressed on the cell surface in the central nervous system” refers to a molecule that is expressed on the cell membrane of any cell in the central nervous system and to which a target-binding molecule can bind.
  • the target molecule is, for example, a protein, lipid molecule, or sugar chain on the cell membrane.
  • the protein on the cell membrane is not particularly limited and may be an integral membrane protein, a superficial membrane protein, or a lipid-anchored protein, and specific examples include receptor proteins and transport proteins (transporters).
  • the term "ligand molecule” is not limited as long as it is a molecule that can bind to a target molecule. Examples include peptides, sugars such as monosaccharides and sugar chains, nucleic acids, and small molecules. Furthermore, the ligand molecule may be either a ligand that exists naturally in the body and binds to a target molecule (natural ligand), or another ligand (non-natural ligand or artificial ligand).
  • peptide refers to an amino acid polymer having one or more peptide bonds.
  • the term “peptide” is not limited by the number of amino acid residues contained in the peptide.
  • “peptide” includes everything from oligopeptides, such as dipeptides and tripeptides, that contain a few amino acid residues, to polypeptides (proteins) that contain a large number of amino acid residues.
  • Peptides may be linear, branched, or cyclic.
  • a peptide bound to a second nucleic acid strand may be specifically referred to as a "peptide ligand.”
  • the peptide bound to the second nucleic acid strand may be either a natural peptide or a non-natural peptide.
  • natural peptide refers to a peptide that can naturally exist in nature. Examples of natural peptides include natural peptides consisting of standard amino acids, as well as natural peptides containing non-standard amino acids such as selenocysteine and D-amino acids.
  • non-natural peptide refers to any peptide other than natural peptides. Non-natural peptides can also be called artificial peptides.
  • non-natural peptides include peptides consisting of standard amino acids, as well as peptides containing non-standard amino acids such as selenocysteine and D-amino acids.
  • the peptide may be any of a linear peptide, a branched peptide, and a cyclic peptide.
  • membrane proteins that can serve as peptide binding targets include neuropeptide receptors (e.g., sortilin 1), macrophage scavenger receptor 1 (MSR1 or SR-A1; class A scavenger receptor), sialic acid-binding immunoglobulin-type lectins (Siglecs) such as CD22 (Siglec-2), stabilin (class H scavenger receptors) such as stabilin-1/2, asialoglycoprotein receptor (ASGPR; class E scavenger receptor), epidermal growth factor receptor (EGFR), and mammary gland receptor (MARR).
  • neuropeptide receptors e.g., sortilin 1
  • MSR1 or SR-A1 macrophage scavenger receptor 1
  • Siglecs sialic acid-binding immunoglobulin-type lectins
  • Siglecs such as CD22 (Siglec-2)
  • stabilin class H scavenger receptors
  • stabilin-1/2 asialogly
  • Examples of peptides that can bind to target molecules include neuropeptides and their active fragments, glycosylated peptides, viral proteins, and artificial peptides.
  • Examples of neuropeptides include neurotensin.
  • Examples of viral proteins include rabies virus glycoproteins or fragments thereof.
  • Examples of artificial peptides include transferrin receptor-binding peptides such as T7 peptide and T12 peptide, and D-retroinversopeptides of any of the above peptides.
  • artificial peptides include a cyclic peptide consisting of the amino acid sequence shown in SEQ ID NO: 31 (CAGALCY) or the amino acid sequence shown in SEQ ID NO: 30 (LGDPNSCAGALCY), which were identified by phage display as BBB-passing ligands in a previous publication (Fan X., et al., Pharm Res., 2007, 24(5): 868-79.), and a cyclic peptide consisting of the amino acid sequence shown in SEQ ID NO: 32 (CLNSNKTNC) and a cyclic peptide consisting of the amino acid sequence shown in SEQ ID NO: 33 (CWRENKAKC), which were identified as BBB-passing ligands in another publication (Pleiko K., et al., Nucleic Acids Research, 2021, 49(7): e38.). Note that these cyclic peptides are preferably cyclized by forming a disulfide bond between two Cys residues in the a
  • neurotensin As used herein, “neurotensin” (often abbreviated as “NT”) is a neuropeptide consisting of about 10 or more amino acids that is expressed in the brain. Neurotensin is a neuropeptide that is widely expressed in the central nervous system and can function as a neurotransmitter or hormone. Specific functions of neurotensin are known to be analgesia, improvement of motor ability, and regulation of the dopamine pathway. Sortilin 1 is also known as a receptor for neurotensin. It is known that antisense oligonucleotides bound to neurotensin improve uptake into cells (Nikan M. et al., J Med Chem., 2020, 63(15):8471-8484.).
  • Neurotensin may be derived from any organism, for example, human, cow, rat, or mouse.
  • wild-type neurotensin derived from human, cow, rat, and mouse include the amino acid sequence (LYENKPRRPYIL) shown in SEQ ID NO:5.
  • Further examples of neurotensin include the amino acid sequence shown in SEQ ID NO: 22 (pyroGlu-LYENKPRRPYIL) in which pyroglutamic acid (pyroGlu) has been added to the N-terminus of the amino acid sequence shown in SEQ ID NO: 5, and the amino acid sequence shown in SEQ ID NO: 23 (pyroLeu-LYENKPRRPYIL) in which pyrroleucine (pyroLeu) has been added.
  • neurotensin examples include mutant neurotensins having an amino acid sequence in which one or more amino acids have been deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 5, 22, or 23 and having activity equivalent to or greater than that of human wild-type neurotensin; or mutant neurotensins having an amino acid sequence having 80% or more, 85% or more, preferably 90% or more, 95% or more, more preferably 96% or more, 97% or more, 98% or more, or 99% or more identity to the amino acid sequence shown in SEQ ID NO: 5, 22, or 23 and having activity equivalent to or greater than that of human wild-type neurotensin.
  • genes encoding neurotensin include the human neurotensin gene consisting of the base sequence shown in SEQ ID NO:24, the mouse neurotensin gene consisting of the base sequence shown in SEQ ID NO:25, and the bovine neurotensin gene consisting of the base sequence shown in SEQ ID NO:26.
  • the "rabies virus glycoprotein” (often referred to herein as "RVG”) is a membrane glycoprotein found on the viral surface of rabies virus. RVG is known to be necessary for rabies virus infection of mammalian cells and can bind to acetylcholine receptors expressed by neuronal cells.
  • a "fragment thereof" of the rabies virus glycoprotein refers to an active fragment consisting of a portion of RVG, and there is no restriction on its amino acid length.
  • a specific example of a "fragment thereof" of RVG is the amino acid sequence shown in SEQ ID NO: 30 (YTIWMPENPRPGTPCDIFTNSRGKRASNG), or a peptide fragment containing the amino acid sequence shown in SEQ ID NO: 30.
  • a "transferrin receptor-binding peptide” refers to a peptide that binds to the transferrin receptor (TfR), and may be either a natural or non-natural peptide made of standard amino acids, or a natural or non-natural peptide containing non-standard amino acids.
  • transferrin receptor-binding peptides include transferrin, T7 peptide, and T12 peptide.
  • Transferrin is a glycoprotein that transports iron ions and is known to be found mainly in plasma. There are no particular limitations on the biological species from which transferrin is derived. Specific examples of transferrin include human transferrin consisting of the amino acid sequence shown in SEQ ID NO:27, a peptide having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more amino acid identity to SEQ ID NO:27, and a peptide having an amino acid sequence in which one or more amino acids are deleted, substituted, or added in SEQ ID NO:27.
  • T7 peptide refers to a peptide consisting of seven amino acids obtained by phage display against the human transferrin receptor (hTfR) and related peptides. It is known that T7 peptide and transferrin have different binding sites for the transferrin receptor and do not compete with each other (Lee, J.H., et al, Eur J Biochem., 2001, 268(7):2004-12.).
  • T7 peptides include peptides consisting of the amino acid sequence shown in SEQ ID NO: 20 (HAIYPRH) and the amino acid sequence shown in SEQ ID NO: 14 (CHAIYPRH); peptides having an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 20 or 14 and having activity equal to or greater than that of the T7 peptide; or peptides having an amino acid sequence with 80% or more, 85% or more, preferably 90% or more, 95% or more, more preferably 96% or more, 97% or more, 98% or more, or 99% or more identity to the amino acid sequence shown in SEQ ID NO: 20 or 14 and having activity equal to or greater than that of the T7 peptide.
  • the T7 peptide consisting of L-amino acid residues is particularly referred to as "LT7"
  • the T7 peptide refers to LT7 consisting of L-a
  • T12 peptide refers to a peptide consisting of 12 amino acids obtained by phage display against the human transferrin receptor (hTfR) and related peptides. It is known that the binding sites of the T12 peptide and transferrin are different and do not compete with each other for the transferrin receptor (Lee, J.H., et al, Eur J Biochem., 2001, 268(7):2004-12.).
  • the T12 peptide include a peptide consisting of the amino acid sequence shown in SEQ ID NO: 16 (THRPPMWSPVWP); a peptide having an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 16 and having activity equal to or greater than that of the T12 peptide; or a peptide having an amino acid sequence having 80% or more, 85% or more, preferably 90% or more, 95% or more, more preferably 96% or more, 97% or more, 98% or more, or 99% or more identity with the amino acid sequence shown in SEQ ID NO: 16 and having activity equal to or greater than that of the T12 peptide.
  • the T12 peptide composed of L-amino acid residues is specifically referred to as "LT12", and unless otherwise specified, the T12 peptide refers to LT12 composed of L-amino acid residues.
  • D-retro-inverso-peptide refers to a peptide in which all of the amino acid residues constituting the peptide are replaced with D-amino acid residues, as opposed to a normal peptide composed of L-amino acid residues, and which is composed of an amino acid sequence rearranged in the reverse direction.
  • D-retro-inverso peptides the original spatial arrangement and chirality of the side chains are not substantially changed, and it is believed that the binding to the target can be maintained or increased.
  • it since it is composed of D-amino acid residues, it is known to have protease resistance.
  • D-retro-inverso peptides include the D-retro-inverso peptide of neurotensin (e.g., the DT7 peptide, which consists of the amino acid sequence hrpyiahc shown in SEQ ID NO: 28 and is composed of D-amino acid residues) and the D-retro-inverso peptide of transferrin receptor binding peptide (e.g., the DT12 peptide, which consists of the amino acid sequence pwvpswmpprht shown in SEQ ID NO: 29 and is composed of D-amino acid residues).
  • neurotensin e.g., the DT7 peptide, which consists of the amino acid sequence hrpyiahc shown in SEQ ID NO: 28 and is composed of D-amino acid residues
  • transferrin receptor binding peptide e.g., the DT12 peptide, which consists of the amino acid sequence pwvps
  • amino acid residues written in lower case letters in the amino acid sequences described herein indicate D-amino acid residues and are to be distinguished from L-amino acid residues written in upper case letters.
  • amino acid sequences described herein are written in the direction from the N-terminus to the C-terminus.
  • the antibody is not limited as long as it can bind to a target molecule expressed on the cell surface in the central nervous system.
  • examples include anti-Sortilin 1 antibody, anti-MSR1 antibody, and anti-Siglec antibody (e.g., anti-CD22 antibody or anti-Siglec-2 antibody, anti-CD33 antibody or anti-Siglec-3 antibody, anti-MAG antibody or anti-Siglec-4 antibody, or anti-Siglec-11 antibody), anti-Stabilin antibody, anti-ASGPR antibody, anti-Lymphocyte antigen 27 antibody, anti-Integrin CD11b/CD1 antibody, anti-RAGE antibody, anti-MNAB antibody, anti-GLP1 receptor antibody, anti-TfR antibody (anti-TfR Fab), anti-folate receptor antibody, etc.
  • Further examples of antibodies include antibodies that bind to neurotransmitter receptors such as acetylcholine receptors, glutamate receptors, and GABA receptors (e.g., anti-acetylcholine
  • the sugar that can be bound to the second nucleic acid strand as a target-binding molecule may be either a monosaccharide or a sugar chain.
  • monosaccharides include GalNAc and mannose.
  • GalNAc N-acetylgalactosamine
  • mannose is known as a ligand for mannose receptors such as MRC1.
  • folic acid An example of a small molecule that can bind to the second nucleic acid strand as a target-binding molecule is folic acid. Folic acid is known to bind to folate receptors expressed in cancer cells, etc.
  • the number of target binding molecules bound to the second nucleic acid strand is at least one, and may be, for example, one, two, three, four, five, six or more.
  • the target binding molecule may be attached to the 5' end, the 3' end, or both ends of the second nucleic acid strand.
  • the target binding molecule may also be attached to an internal nucleotide or nucleoside of the second nucleic acid strand.
  • the target binding molecule may be attached to a base moiety or a sugar moiety (e.g., the 2' position).
  • the bond between the second nucleic acid strand and the target binding molecule may be a direct bond or an indirect bond mediated by another substance.
  • the second nucleic acid strand and the target binding molecule When the second nucleic acid strand and the target binding molecule are directly bound to each other, they may be bound to the second nucleic acid strand via, for example, a covalent bond, an ionic bond, a hydrogen bond, or the like. In view of the fact that a more stable bond can be obtained, a covalent bond is preferred.
  • the second nucleic acid strand and the target binding molecule When the second nucleic acid strand and the target binding molecule are indirectly bound, they may be bound via a linking group (often referred to as a "linker” in this specification. Note that a linker capable of binding the second nucleic acid strand and the target binding molecule may be referred to as a "first linker” to distinguish it from a linker capable of binding the first nucleic acid strand and the second nucleic acid strand described below).
  • the linker may be either a cleavable linker or an uncleavable linker.
  • “Cleavable linker” means a linker that can be cleaved under physiological conditions, e.g., within a cell or an animal body (e.g., within the human body). Cleavable linkers are selectively cleaved by endogenous enzymes, such as nucleases. Cleavable linkers include, but are not limited to, amides, esters, one or both phosphodiesters, phosphate esters, carbamates, and disulfide bonds, as well as natural DNA linkers (e.g., 1-50 bases in length, 2-10 bases in length, or 3-5 bases in length). As an example, the target binding molecules may be linked via disulfide bonds.
  • Non-cleavable linker means a linker that is not cleaved under physiological conditions, for example, within a cell or an animal body (for example, within the human body).
  • Non-cleavable linkers include, but are not limited to, linkers consisting of phosphorothioate bonds, and modified or unmodified deoxyribonucleosides or modified or unmodified ribonucleosides linked by phosphorothioate bonds.
  • the linker is a nucleic acid such as DNA or an oligonucleotide
  • the chain length is not particularly limited, but may be usually 2 to 20 bases, 3 to 10 bases, or 4 to 6 bases.
  • linker is not limited, and may include, for example, an alkyl group, an amino group, an oxo group, an amide group, and/or an ether group.
  • linkers include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid, 4-(N-maleimidomethyl)cyclohexane-1-carboxylate succinimidyl (SMCC), and 6-aminohexanoic acid (AHEX or AHA).
  • Other examples of linkers include optionally substituted C 1 -C 10 alkyl, optionally substituted C 2 -C 10 alkenyl, or optionally substituted C 2 -C 10 alkynyl.
  • the substituent may be a hydroxyl group, an amino group, an alkoxy group, a carboxy group, a benzyl group, a phenyl group, a nitro group, a thiol group, a thioalkoxy group, a halogen group, an alkyl group, an aryl group, an alkenyl group, and/or an alkynyl group.
  • linker a linker containing a group represented by the following formula (IV):
  • L2 represents a substituted or unsubstituted C1 - C12 alkylene group (e.g., propylene, hexylene, dodecylene), a substituted or unsubstituted C3 - C8 cycloalkylene group (e.g., cyclohexylene), -(CH2)2-O-( CH2 ) 2 -O-(CH2) 2 -O-( CH2 )3-, -( CH2 ) 2 -O-( CH2 ) 2-O-(CH2)2-O-(CH2)2 - O- ( CH2 ) 3- , or CH( CH2- OH) -CH2 -O-( CH2 ) 2 - O-( CH2 ) 2 -O-( CH2 ) 2 -O-( CH2 ) 2 -O-( CH2 ) 3- ; L3 represents -NH- or a bond; L 4 represents a substituted or unsubstituted C 1
  • L 2 is an unsubstituted C 3 to C 6 alkylene group (e.g., propylene, hexylene), -(CH 2 ) 2 -O-(CH 2 ) 2 -O-(CH 2 ) 2 -O-(CH 2 ) 3 -, or -(CH 2 ) 2 -O-(CH 2 ) 2 -O-(CH 2 ) 2 -O-(CH 2 ) 3 -, L 3 is -NH-, and L 4 and L 5 are bonds.
  • C 3 to C 6 alkylene group e.g., propylene, hexylene
  • L 3 is -NH-
  • L 4 and L 5 are bonds.
  • the linker includes a nucleic acid, a polyether group, and/or an alkylamino group.
  • the nucleic acid may be, for example, one or two to ten nucleosides and/or non-natural nucleosides linked by internucleoside bonds.
  • Examples of polyether groups include polyethylene glycol groups or triethylene glycol groups.
  • Examples of alkylamino groups include hexylamino groups.
  • linkers include linkers containing a group represented by the following formula (V) or formula (VI):
  • n 0 or 1.
  • linkers include substituted or unsubstituted C 1 -C 12 alkylene groups (e.g., ethylene, pentylene, heptylene, undecylene), polyethers such as polyethylene glycol, and cyclooctyne derivatives.
  • linkers containing cyclooctyne derivatives include linkers containing dibenzocyclooctyne (DBCO) derivatives (referred to herein as “DBCO linkers”) and linkers containing bicyclononyne (BCN) derivatives (referred to herein as "BCN linkers").
  • DBCO linkers and BCN linkers can be used in a linking reaction by click reaction, and various types of linkers are known in the art.
  • a specific example of a DBCO linker can be a linker represented by the following formula (XVIII) (e.g., a linker represented by the following formula (VII)), and a specific example of a BCN linker can be a linker represented by the following formula (XIX) (e.g., a linker represented by the following formula (XVII)).
  • n 1 to 10, and may be, for example, 4.
  • n 1 to 10, and may be, for example, 5.
  • linker represented by formula (VII) above may be a linker represented by formula (VIII) below.
  • n 1 to 10, and may be, for example, 4.
  • linkers include linkers containing a group represented by the following formula (IX):
  • linkers can be appropriately selected from known linkers that can be used in the art to link target binding molecules such as nucleic acids and peptides.
  • linkers described in Nikan M. et al., J Med Chem., 2020, 63(15):8471-8484. can be used.
  • methods for synthesizing linkers and methods for linking target binding molecules such as nucleic acids and peptides via linkers are also known in the art, and the above-mentioned literature can be referenced.
  • the link between the target binding molecule and the linker may be a direct link, or an indirect link via a spacer. Indirect link via a spacer may be preferable because it can suppress intramolecular interactions between the nucleic acid and the peptide.
  • the spacer may be one amino acid residue or two or more amino acid residues (in this case, it is called a spacer peptide).
  • An example of a spacer peptide is a peptide consisting of the amino acid sequence (KPPPAGSSPG) shown in SEQ ID NO: 4.
  • the first nucleic acid strand may be a gapmer.
  • the term “gapmer” refers, in principle, to a single-stranded nucleic acid consisting of a central region (DNA gap region) and wing regions (referred to as the 5' wing region and the 3' wing region, respectively) located directly at the 5' end and the 3' end of the central region.
  • the length of the DNA gap region may be 13 to 22 bases, 16 to 22 bases, or 16 to 20 bases, or 2 to 20 bases, 4 to 20 bases, 5 to 18 bases, 6 to 16 bases, 7 to 14 bases, or 8 to 12 bases.
  • the central region in the gapmer contains at least two, for example at least four consecutive deoxyribonucleosides, and the wing regions contain at least one non-natural nucleoside.
  • the non-natural nucleosides contained in the wing region usually have a stronger binding strength with RNA than natural nucleosides and have a higher resistance to nucleases (nucleases, etc.).
  • the non-natural nucleosides constituting the wing region include or consist of bridged nucleosides
  • the gapmer is specifically referred to as a "BNA/DNA gapmer".
  • the number of bridged nucleosides contained in the 5' wing region and the 3' wing region is at least one, and may be, for example, two or three.
  • the bridged nucleosides contained in the 5' wing region and the 3' wing region may be present contiguously or non-contiguously in the 5' wing region and the 3' wing region.
  • the bridged nucleoside may further include a modified nucleobase (e.g., 5-methylcytosine).
  • a modified nucleobase e.g., 5-methylcytosine
  • the gapmer is specifically referred to as an "LNA/DNA gapmer".
  • the gapmer is specifically referred to as a "peptide nucleic acid gapmer.”
  • the gapmer is specifically referred to as a "morpholino nucleic acid gapmer.”
  • the base length of the 5' wing region and the 3' wing region may be independently at least 2 bases long, for example, 2 to 10 bases long, 2 to 7 bases long, or 3 to 5 bases long.
  • the 5' wing region and/or the 3' wing region may comprise at least one non-natural nucleoside, and may further comprise a natural nucleoside.
  • the 5' and 3' wing regions may be, for example, unnatural nucleosides linked by modified internucleoside linkages such as phosphorothioate linkages, bridged nucleosides such as LNA nucleosides, or 2'-modified nucleosides such as 2'-O-methyl modified nucleosides.
  • the first nucleic acid strand constituting the gapmer may be composed of, in order from the 5' end, a bridged nucleoside that is 2 to 7 bases long or 3 to 5 bases long (e.g., 2 or 3 bases long), a ribonucleoside or deoxyribonucleoside that is 4 to 15 bases long or 8 to 12 bases long (e.g., 8 or 10 bases long), and a bridged nucleoside that is 2 to 7 bases long or 3 to 5 bases long (e.g., 2 or 3 bases long).
  • a bridged nucleoside that is 2 to 7 bases long or 3 to 5 bases long (e.g., 2 or 3 bases long)
  • hemigapmer a nucleic acid strand having a wing region only at either the 5' or 3' end
  • hemigapmers are also included in the term "gapmer.”
  • the first nucleic acid strand may be a mixmer.
  • a "mixmer” refers to a nucleic acid strand that contains alternating natural and non-natural nucleosides of periodic or random segment lengths, and does not contain four or more consecutive deoxyribonucleosides and ribonucleosides.
  • a mixmer in which the non-natural nucleoside is a bridged nucleoside and the natural nucleoside is a deoxyribonucleoside is particularly referred to as a "BNA/DNA mixmer.”
  • the bridged nucleoside may be an scpBNA nucleoside represented by the following formula (X) or an AmNA nucleoside represented by the following formula (XI).
  • R represents a hydrogen atom or a methyl group.
  • the bridged non-natural nucleoside represented by the above formula (X) is a 2'-O,4'-C-spirocyclopropylene bridged nucleic acid, and is mainly referred to as "scpBNA” in this specification.
  • R may be either a hydrogen atom or a methyl group.
  • R may be either a hydrogen atom or a methyl group, but when distinguishing between the two, it can also be represented as AmNA[N-H] when R is a hydrogen atom, and AmNA[N-Me] when R is a methyl group.
  • a mixmer in which the non-natural nucleoside is a peptide nucleic acid and the natural nucleoside is a deoxyribonucleoside is specifically referred to as a "peptide nucleic acid/DNA mixmer.”
  • a mixmer in which the non-natural nucleoside is a morpholino nucleic acid and the natural nucleoside is a deoxyribonucleoside is specifically referred to as a "morpholino nucleic acid/DNA mixmer.”
  • a mixmer is not limited to containing only two types of nucleosides.
  • a mixmer can contain any number of types of nucleosides, whether natural or modified nucleosides or nucleoside mimics. For example, it may have one or two consecutive deoxyribonucleosides separated by a bridged nucleoside (e.g., an LNA nucleoside or a bridged non-natural nucleoside represented by formula (X) or formula (XI) above).
  • the bridged nucleoside may further include a modified nucleobase (e.g., 5-methylcytosine).
  • the first nucleic acid strand in the double-stranded nucleic acid complex of the present invention comprises one or more of morpholino nucleic acid, 2'-O-methyl modified nucleoside, 2'-O-methoxyethyl modified nucleoside, tricycloDNA, peptide nucleic acid, or 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleoside.
  • the nucleic acid in the first nucleic acid strand may consist of morpholino nucleic acid.
  • the second nucleic acid strand may contain at least two (e.g., at least three or four) consecutive ribonucleosides that are complementary to the at least two (e.g., at least three or four) consecutive nucleosides (e.g., deoxyribonucleosides) in the central region of the first nucleic acid strand, such that the second nucleic acid strand forms a partial DNA-RNA heteroduplex with the first nucleic acid strand and is recognized and cleaved by RNase H.
  • the at least two (e.g., at least three or four) consecutive ribonucleosides in the second nucleic acid strand are preferably linked by naturally occurring internucleoside bonds, i.e., phosphodiester bonds.
  • the second nucleic acid strand may further include at least two consecutive deoxyribonucleosides in addition to the at least two (e.g., at least three or four) consecutive ribonucleosides.
  • the at least two consecutive deoxyribonucleosides may be complementary to the first nucleic acid strand and may be included in a region complementary to a central region of the first nucleic acid strand.
  • the at least two consecutive deoxyribonucleosides may be located on either the 5' or 3' side of the at least four (e.g., at least three or four) consecutive ribonucleosides, or may be located on both the 5' and 3' sides.
  • the at least two consecutive deoxyribonucleosides may be 2, 3, 4, 5, 6 or more consecutive deoxyribonucleosides.
  • At least one, at least two (e.g., two), at least three, or at least four nucleosides from the termini (5' termini, 3' termini, or both termini) of the second nucleic acid strand may be modified nucleosides.
  • the modified nucleosides may include a modified sugar and/or a modified nucleobase.
  • the modified sugar may be a 2'-modified sugar (e.g., a sugar including a 2'-O-methyl group).
  • the modified nucleobase may be a 5-methylcytosine.
  • the second nucleic acid strand may be composed of, in order from the 5' end, a 2-7 base or 3-5 base (e.g., 2- or 3-base) long modified nucleoside (e.g., a modified nucleoside containing a 2'-modified sugar), a 4-15 base or 8-12 base (e.g., 8- or 10-base) long ribonucleoside or deoxyribonucleoside (optionally linked by a modified internucleoside bond), and a 2-7 base or 3-5 base (e.g., 2- or 3-base) long modified nucleoside (e.g., a modified nucleoside containing a 2'-modified sugar).
  • the first nucleic acid strand may be a gapmer.
  • the first nucleic acid strand and/or the second nucleic acid strand may comprise, in whole or in part, a nucleoside mimic or a nucleotide mimic.
  • the nucleotide mimic may be a peptide nucleic acid and/or a morpholino nucleic acid.
  • the second nucleic acid strand includes any one or more selected from the group consisting of deoxyribonucleosides, 2'-modified nucleosides, 5'-modified nucleosides, and bridged nucleosides.
  • the 2'-modified nucleosides may be, for example, 2'-O-methyl modified nucleosides, 2'-O-methoxyethyl modified nucleosides, or 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleosides.
  • the 5'-modified nucleosides may be, for example, 5'-cp modified nucleosides, 5'-methyl modified nucleosides, or 5'-dimethyl modified nucleosides.
  • the bridged nucleoside may be, for example, an LNA nucleoside, a 2',4'-BNA NC nucleoside, a cEt BNA nucleoside, an ENA nucleoside, an AmNA nucleoside, a GuNA nucleoside, an scpBNA nucleoside, an scpBNA2 nucleoside, or a BANA3 nucleoside.
  • the number of deoxyribonucleosides, 2'-modified nucleosides, 5'-modified nucleosides, or bridged nucleosides contained in the second nucleic acid strand may be at least one, or may be equal to or less than the number of all nucleosides constituting the second nucleic acid strand (i.e., the base length of the second nucleic acid strand).
  • the specific number of deoxyribonucleosides, 2'-modified nucleosides, 5'-modified nucleosides, and/or bridged nucleosides contained in the second nucleic acid strand may be, for example, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more, and may be 30 or less, 25 or less, 20 or less, 15 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less.
  • the number of deoxyribonucleosides, 2'-modified nucleosides, 5'-modified nucleosides, and/or bridged nucleosides can be 1 to 30, 1 to 25, 1 to 24, 1 to 23, 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6.
  • it can be 1, 2, 3, 4, 5, or 6.
  • the second nucleic acid strand includes one or multiple consecutive 2'-modified nucleosides located at the 5' end.
  • “including multiple consecutive 2'-modified nucleosides” means including multiple 2'-modified nucleosides linked by any internucleoside bond.
  • the second nucleic acid strand may include one or 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, or 2 to 3, e.g., 2, 3, or 4, 2'-modified nucleosides located at the 5' end.
  • the second nucleic acid strand comprises one or multiple consecutive 2'-modified nucleosides located at the 3' end.
  • the second nucleic acid strand may comprise one or 2-12, 2-10, 2-8, 2-6, 2-5, 2-4, or 2-3, e.g., 2, 3, or 4, consecutive 2'-modified nucleosides located at the 3' end.
  • the second nucleic acid strand comprises one or more contiguous 2'-modified nucleosides located at the 5' end and one or more contiguous 2'-modified nucleosides located at the 3' end.
  • the second nucleic acid strand includes 2'-modified nucleosides at positions other than the 5' and 3' ends.
  • the second nucleic acid strand “includes 2'-modified nucleosides at positions other than the 5' and 3' ends” means that the second nucleic acid strand includes 2'-modified nucleosides at positions other than the one or multiple consecutive 2'-modified nucleosides at the 5' end and the one or multiple consecutive 2'-modified nucleosides at the 3' end.
  • the second nucleic acid strand includes 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 12, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, or 1 to 3, for example 1 or 2, 2'-modified nucleosides at positions other than the 5' and 3' ends.
  • the 2'-modified nucleoside is a 2'-O-methoxyethyl modified nucleoside and/or a 2'-O-methyl modified nucleoside.
  • the 2'-O-methoxyethyl modified nucleoside has the following formula (XII):
  • the 2'-O-methyl modified nucleoside is represented by the following formula (XIII): As shown in the figure.
  • all of the nucleosides in the first nucleic acid strand may be non-natural nucleosides or modified nucleosides. In a further embodiment, all of the nucleosides in the first nucleic acid strand may be 2'-modified nucleosides. In yet a further embodiment, all of the nucleosides in the first nucleic acid strand may be 2'-O-methoxyethyl modified nucleosides.
  • the first nucleic acid strand may contain at least 2, at least 3, at least 4, at least 5, at least 6, or at least 7 consecutive nucleosides that are recognized by RNase H when hybridized to the target transcript.
  • the region may contain 2-20, 4-20, 5-16, or 6-12 consecutive nucleosides.
  • the nucleosides recognized by RNase H may be, for example, natural deoxyribonucleosides. Suitable nucleosides containing modified deoxyribonucleosides and other bases are well known in the art. It is also known that nucleosides having a hydroxy group at the 2' position, such as ribonucleosides, are unsuitable as the nucleoside.
  • the suitability of nucleosides for use in this region containing "at least 2 consecutive nucleosides" may be readily determined.
  • the first nucleic acid strand can include at least two consecutive deoxyribonucleosides.
  • the first nucleic acid strand can include at least four consecutive deoxyribonucleosides.
  • the nucleosides of the first nucleic acid strand comprise or consist of deoxyribonucleosides, e.g., 70% or more, 80% or more, 90% or more, or 95% or more of the nucleosides of the first nucleic acid strand are deoxyribonucleosides.
  • the second nucleic acid strand includes 2'-modified nucleosides in a region of the second nucleic acid strand that is complementary to the 5' wing region and/or the 3' wing region of the first nucleic acid strand. In a further embodiment, all nucleosides in the second nucleic acid strand that is complementary to the 5' wing region and/or the 3' wing region of the first nucleic acid strand may be 2'-modified nucleosides.
  • At least one guanosine nucleoside in the first nucleic acid strand (i) at least one guanosine nucleoside in the first nucleic acid strand, (ii) the nucleoside adjacent to the 5' end of the guanosine nucleoside, (iii) the nucleoside adjacent to the 3' end of the guanosine nucleoside, or (iv) the nucleoside in the second nucleic acid strand that is complementary to any combination of (i) to (iii) above may be a 2'-modified nucleoside.
  • nucleoside in the first nucleic acid strand may be a 2'-modified nucleoside.
  • At least one guanosine nucleoside in the 3' wing region and/or 5' wing region of the first nucleic acid strand may be a 2'-modified nucleoside.
  • all guanosine nucleosides in the 3' wing region and/or 5' wing region of the first nucleic acid strand may be a 2'-modified nucleoside.
  • nucleosides in the region consisting of a base sequence complementary to the central region of the first nucleic acid strand are (a) deoxyribonucleosides, (b) deoxyribonucleosides and ribonucleosides, (c) deoxyribonucleosides and 2'-modified nucleosides, or (d) ribonucleosides and 2'-modified nucleosides, or (e) deoxyribonucleosides, ribonucleosides, and 2'-modified nucleosides.
  • all nucleosides in the region consisting of base sequences complementary to the 5' wing region and the 3' wing region of the first nucleic acid strand may be 2'-modified nucleosides, and all nucleosides in the region consisting of base sequences complementary to the central region of the first nucleic acid strand may be deoxyribonucleosides.
  • At least one of the nucleosides containing a pyrimidine base in the second nucleic acid strand may be a 2'-modified nucleoside and/or a deoxyribonucleoside.
  • the second nucleic acid strand does not contain natural ribonucleosides containing a pyrimidine base, for example, all of the nucleosides containing a pyrimidine base in the second nucleic acid strand may be 2'-modified nucleosides and/or deoxyribonucleosides.
  • the second nucleic acid strand may include modified nucleosides other than 2'-modified nucleosides in addition to 2'-modified nucleosides.
  • the second nucleic acid strand may include non-complementary bases and/or an insertion sequence and/or deletion of one or more bases relative to the first nucleic acid strand.
  • the number of non-complementary bases in the second nucleic acid strand is not limited, but may be, for example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 or 2.
  • the sequence consisting of non-complementary bases may form a bulge structure as described below.
  • the number of bases of the insertion sequence in the second nucleic acid strand is not limited, but may be, for example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 or 2.
  • the insertion sequence may be a sequence that forms a bulge structure as described below.
  • the length of the consecutive bases deleted in the second nucleic acid strand is not limited, but may be, for example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 or 2.
  • the second nucleic acid strand may include a bulge structure, as described below, at the deletion position.
  • the base length of the first nucleic acid strand and the second nucleic acid strand is not particularly limited, but may be at least 8 bases, at least 9 bases, at least 10 bases, at least 11 bases, at least 12 bases, at least 13 bases, at least 14 bases, or at least 15 bases.
  • the base length of the first nucleic acid strand and the second nucleic acid strand may be 35 bases or less, 30 bases or less, 25 bases or less, 24 bases or less, 23 bases or less, 22 bases or less, 21 bases or less, 20 bases or less, 19 bases or less, 18 bases or less, 17 bases or less, or 16 bases or less.
  • the first nucleic acid strand and the second nucleic acid strand may be the same length or different lengths (for example, one of them may be 1 to 3 bases shorter or longer).
  • the length of the second nucleic acid strand is shorter than the first nucleic acid strand.
  • the position at which the second nucleic acid strand can bind to the first nucleic acid strand does not matter. For example, it may be capable of binding to the 5' region, the central region, or the 3' region of the first nucleic acid strand.
  • the second nucleic acid strand may be at least 8 bases long.
  • the double-stranded structure formed by the first and second nucleic acid strands may include a bulge.
  • the length may be selected by balancing the strength of the antisense effect and the specificity of the nucleic acid strand for the target, among other factors such as cost, synthesis yield, etc.
  • the second nucleic acid strand may include at least one overhang region located at one or both of its 5'-end and 3'-end.
  • An "overhang region” refers to a region in the second nucleic acid strand adjacent to a region complementary to the first nucleic acid strand, in which, when the first and second nucleic acid strands anneal to form a double-stranded structure, the 5'-end of the second nucleic acid strand extends beyond the 3'-end of the first nucleic acid strand and/or the 3'-end of the second nucleic acid strand extends beyond the 5'-end of the first nucleic acid strand, i.e., a nucleotide region in the second nucleic acid strand protruding from the double-stranded structure.
  • the overhang region in the second nucleic acid strand may be located at the 5'-end or 3'-end of the complementary region.
  • the overhang region in the second nucleic acid strand may be located at the 5'-end and 3'-end of the complementary region.
  • the length of the overhang region is not limited, but may be 1 to 20 bases long, for example, 2 to 15 bases long, 2 to 12 bases long, 2 to 10 bases long, 2 to 8 bases long, 2 to 6 bases long, 2 to 5 bases long, 2 to 4 bases long, or 2 to 3 bases long.
  • the type of nucleoside constituting the overhang region is not limited. For example, it may be composed of natural nucleosides (e.g., deoxyribonucleosides) or non-natural nucleosides (e.g., bridged nucleosides such as LNA nucleosides). All or a part of the internucleoside bonds in the overhang region may be modified internucleoside bonds.
  • the modified internucleoside bonds may be, for example, phosphorothioate bonds.
  • the overhang region is preferably protein-binding, lipid-soluble, and/or nuclease-resistant, and may be composed of, for example, deoxyribonucleosides or LNA nucleosides linked by phosphorothioate bonds.
  • the base sequence of the overhang region may be unrelated to the base sequence of the target gene.
  • At least one, at least two (e.g., two), at least three, or at least four nucleosides from the termini (5' termini, 3' termini, or both termini) of the second nucleic acid strand may be non-natural nucleosides (modified nucleosides).
  • the modified nucleosides may include a modified sugar and/or a modified nucleobase.
  • the modified sugar may be a 2'-modified sugar (e.g., a sugar including a 2'-O-methyl group).
  • the modified nucleobase may also be a 5-methylcytosine.
  • the second nucleic acid strand may have 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 (e.g., 1 to 2 or 1) non-complementary bases, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 (e.g., 1 to 2 or 1) deleted bases, and/or 1 to 20 (e.g., 1 to 15, 1 to 12, 1 to 10, 1 to 8, 1 to 6, 1 to 4, 1 to 3, or 1) inserted bases relative to the first nucleic acid strand, so long as the second nucleic acid strand can form a double strand with the first nucleic acid strand.
  • the sequence region consisting of the inserted bases may form a bulge structure.
  • the second nucleic acid strand contains at least one bulge structure consisting of a base sequence that is non-complementary to the first nucleic acid strand.
  • the term "bulge structure" refers to a portion of a double-stranded nucleic acid in which a part of the nucleic acid of either of the nucleic acid strands that constitute the double strand protrudes from the double-stranded structure without base pairing.
  • the base length of the bulge structure is not limited. For example, it is 1 to 50 bases long, 1 to 40 bases long, 1 to 30 bases long, 1 to 20 bases long, 1 to 15 bases long, and preferably 1 to 10 bases long.
  • the internucleoside bonds in the first and second nucleic acid strands may be naturally occurring internucleoside bonds and/or modified internucleoside bonds. Although not limited thereto, it is preferable that at least one, at least two, or at least three internucleoside bonds from the end (5' end, 3' end, or both ends) of the first and/or second nucleic acid strand are modified internucleoside bonds.
  • two internucleoside bonds from the end of the nucleic acid strand refer to the internucleoside bond closest to the end of the nucleic acid strand and the internucleoside bond adjacent thereto and located on the opposite side to the end.
  • Modified internucleoside bonds in the terminal region of the nucleic acid strand are preferable because they can suppress or inhibit undesired degradation of the nucleic acid strand.
  • all or some of the internucleoside linkages of the first nucleic acid strand and/or the second nucleic acid strand may be modified internucleoside linkages.
  • the first nucleic acid strand and/or the second nucleic acid strand may each include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more modified internucleoside linkages.
  • the first nucleic acid strand and/or the second nucleic acid strand may each contain at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 93%, at least 95%, at least 98%, or 100% modified internucleoside linkages.
  • the modified internucleoside linkages may be phosphorothioate linkages or boranophosphate linkages.
  • nucleic acid in the first nucleic acid strand when the nucleic acid in the first nucleic acid strand is composed of morpholino nucleic acid, all or a portion of the internucleoside linkages in the first nucleic acid strand may be phosphorothioate linkages.
  • the first nucleic acid strand and/or the second nucleic acid strand may each contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more chiral controlled internucleoside linkages.
  • the first nucleic acid strand and/or the second nucleic acid strand may each contain at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more chiral controlled internucleoside linkages.
  • the first nucleic acid strand and/or the second nucleic acid strand may each contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more non-negatively charged internucleoside linkages (preferably neutral internucleoside linkages).
  • the first nucleic acid strand and/or the second nucleic acid strand may each contain at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more non-negatively charged internucleoside linkages.
  • At least one, at least two, or at least three internucleoside linkages from the 5'-end of the second nucleic acid strand may be modified internucleoside linkages.
  • At least one, at least two, or at least three internucleoside linkages from the 3'-end of the second nucleic acid strand may be modified internucleoside linkages, such as phosphorothioate linkages, internucleoside linkages containing guanidine moieties substituted with 1-4 C1-6 alkyl groups (e.g., TMG moieties) and/or internucleoside linkages containing cyclic guanidine moieties.
  • the modified internucleoside linkages may be chiral controlled in the Rp or Sp configuration.
  • At least one (e.g., three) internucleoside bond from the 3' end of the second nucleic acid strand may be a modified internucleoside bond such as a phosphorothioate bond that is highly RNase resistant.
  • a modified internucleoside bond such as a phosphorothioate bond
  • this is preferred because it improves the gene suppression activity of the double-stranded nucleic acid complex.
  • the modified internucleoside linkages of the first and/or second nucleic acid strand comprise a non-negatively charged (neutral or cationic, respectively) internucleoside linkage that exists in a neutral or cationic form at a certain pH (e.g., human physiological pH (about 7.4), the pH of the delivery site (e.g., organelle, cell, tissue, organ, organism, etc.)) compared to the anionic form (e.g., -OP(O)(O - )-O- (anionic form of a natural phosphate linkage), -OP(O)(S - )-O- (anionic form of a phosphorothioate linkage), etc.).
  • a certain pH e.g., human physiological pH (about 7.4)
  • the pH of the delivery site e.g., organelle, cell, tissue, organ, organism, etc.
  • anionic form e.g., -OP(O)(O - )-O- (
  • the modified internucleoside linkages of the first and/or second nucleic acid strand comprise a neutral internucleoside linkage. In one embodiment, the modified internucleoside linkages of the first and/or second nucleic acid strand comprise a cationic internucleoside linkage. In one embodiment, the non-negatively charged internucleoside linkage (e.g., neutral internucleoside linkage) does not have a moiety with a pKa less than 8, 9, 10, 11, 12, 13, or 14 when in its neutral form. In one embodiment, the non-negatively charged internucleoside linkage is, for example, a methyl phosphonate linkage as described in U.S. Patent Registration Nos.
  • the non-negatively charged internucleoside linkage comprises a triazole moiety or an alkyne moiety.
  • the non-negatively charged internucleoside linkage comprises a cyclic guanidine moiety and/or a guanidine moiety substituted with one to four C 1-6 alkyl groups (preferably a TMG moiety).
  • the modified internucleoside linkage comprising a cyclic guanidine moiety has a moiety represented by formula (II).
  • the guanidine moiety substituted with one to four C 1-6 alkyl groups has a moiety represented by formula (III).
  • the neutral internucleoside linkage comprising a cyclic guanidine moiety and/or a guanidine moiety substituted with one to four C 1-6 alkyl groups is chiral controlled.
  • the present disclosure relates to a composition
  • a composition comprising an oligonucleotide comprising at least one neutral internucleoside linkage and at least one phosphorothioate internucleoside linkage.
  • neutral internucleotide linkages can provide improved properties and/or activity compared to comparable nucleic acids that do not include neutral internucleotide linkages, such as improved delivery, improved resistance to exonucleases and endonucleases, improved cellular uptake, improved endosomal escape, and/or improved nuclear uptake.
  • the second nucleic acid strand may be bound to a further molecule other than the target binding molecule in addition to the target binding molecule.
  • the further molecule may be a small molecule, a medium molecule, or a large molecule, for example a lipid molecule.
  • lipid molecules include, but are not limited to, tocopherol, cholesterol, fatty acids, phospholipids and their analogs; folic acid, vitamin C, vitamin B1, vitamin B2; estradiol, androstane and their analogs; steroids and their analogs; ligands for LDLR, SRBI or LRP1/2; FK-506, and cyclosporine; lipids described in WO2019/182109, WO2019/177061 and WO2021054370.
  • the lipid molecule may also be tocopherol or an analog thereof and/or cholesterol or an analog thereof, a substituted or unsubstituted C 1-30 alkyl group, a substituted or unsubstituted C 2-30 alkenyl group, or a substituted or unsubstituted C 1-30 alkoxy group .
  • tocopherol is a methylated derivative of tocorol, a fat-soluble vitamin (vitamin E) with a ring structure called chroman.
  • Tocorol has a strong antioxidant effect, and therefore, as an antioxidant in the body, it has the function of eliminating free radicals generated by metabolism and protecting cells from damage.
  • Tocopherol is known in several different forms, consisting of ⁇ -tocopherol, ⁇ -tocopherol, ⁇ -tocopherol, and ⁇ -tocopherol, based on the position of the methyl group bound to the chroman.
  • tocopherol may be any tocopherol.
  • examples of tocopherol analogs include various unsaturated analogs of tocopherol, such as ⁇ -tocotrienol, ⁇ -tocotrienol, ⁇ -tocotrienol, and ⁇ -tocotrienol.
  • the tocopherol is ⁇ -tocopherol.
  • cholesterol refers to a type of sterol, also known as a steroid alcohol, and is found in large amounts in animals. Cholesterol plays an important role in metabolic processes in the body, and in animal cells, it is also a major component of the cell membrane system along with phospholipids. Furthermore, cholesterol analogs refer to various cholesterol metabolites and analogs, which are alcohols with a sterol skeleton, and include, but are not limited to, cholestanol, lanosterol, cerebrosterol, dehydrocholesterol, and coprostanol.
  • analog refers to a compound that has a similar structure and properties with the same or a similar basic skeleton.
  • Analogs include, for example, biosynthetic intermediates, metabolic products, compounds with substituents, etc. Whether or not a compound is an analog of another compound can be determined by a person skilled in the art based on common technical knowledge.
  • Cholesterol analogs refer to various cholesterol metabolites and analogs, which are alcohols with a sterol skeleton, and include, but are not limited to, cholestanol, lanosterol, cerebrosterol, dehydrocholesterol, and coprostanol.
  • the second nucleic acid strand bound to cholesterol or an analogue thereof may have a group represented by the following general formula (XIV):
  • R c represents an alkylene group having 4 to 18 carbon atoms, preferably 5 to 16 carbon atoms, which may have a substituent (wherein the substituent is a halogen atom or an alkyl group having 1 to 3 carbon atoms which may be substituted with a hydroxy group, such as a hydroxymethyl group, and non-adjacent carbon atoms of the alkylene group may be substituted with an oxygen atom).
  • the substituent is a halogen atom or an alkyl group having 1 to 3 carbon atoms which may be substituted with a hydroxy group, such as a hydroxymethyl group, and non-adjacent carbon atoms of the alkylene group may be substituted with an oxygen atom.
  • R c may be, but is not limited to, -( CH2 ) 3 -O-( CH2 ) 2 -O-( CH2 ) 2 -O-( CH2 ) 2 -O-( CH2 )2-O-(CH2) 2- , -( CH2 ) 3 -O-( CH2 ) 2 -O-( CH2 ) 2 -O-( CH2 ) 2 -O-(CH2) 2 -O-CH2 - CH(CH2OH)-, or -( CH2 ) 6- .
  • the group represented by the above general formula (XIV) can be bound to the 5'-end or 3'-end of the second nucleic acid strand via a phosphate ester bond.
  • the additional molecule such as cholesterol or an analog thereof, may be attached to either the 5' end or the 3' end of the second nucleic acid strand.
  • the additional molecule such as cholesterol or an analog thereof, may also be attached to an internal nucleotide of the second nucleic acid strand.
  • the second nucleic acid strand contains multiple cholesterol or analogues thereof, they may be the same or different. With respect to the binding positions, the cholesterol or analogues thereof may be bound to multiple positions on the second nucleic acid strand and/or may be bound as a group to one position.
  • the bond between the second nucleic acid strand and the further molecule may be a direct bond or an indirect bond mediated by another substance.
  • the specific bonding mode shall conform to the example of the linker (first linker) described above for bonding to the target binding molecule.
  • the second nucleic acid strand is not bound to any additional molecule other than the target binding molecule, such as a peptide.
  • "not bound to any additional molecule other than the target binding molecule” refers to no additional molecule, such as tocopherol or cholesterol, being bound.
  • the double-stranded nucleic acid complex of the present invention is not bound to any additional molecule other than the target binding molecule, such as a peptide, i.e., neither the first nor the second nucleic acid strand is bound to any such additional molecule.
  • the first nucleic acid strand and/or the second nucleic acid strand may further include at least one functional moiety bound to the polynucleotide constituting the nucleic acid strand.
  • the term "functional moiety" refers to a moiety that imparts a desired function to the double-stranded nucleic acid complex and/or the nucleic acid strand to which the functional moiety is bound.
  • the desired function may be, for example, a labeling function or a purification function.
  • moieties that impart a labeling function include compounds such as fluorescent proteins and luciferase.
  • moieties that impart a purification function include compounds such as biotin, avidin, His tag peptide, GST tag peptide, and FLAG tag peptide.
  • the first nucleic acid strand and/or the second nucleic acid strand (preferably the second nucleic acid strand) is bound to a functional moiety.
  • the bond between the second nucleic acid strand and the functional moiety may be a direct bond or an indirect bond via another substance. In one embodiment, however, it is preferable that the second nucleic acid strand and the functional moiety are directly bonded via a covalent bond, ionic bond, hydrogen bond, or the like, and a covalent bond is more preferable from the viewpoint of obtaining a more stable bond.
  • the first and second nucleic acid strands may be linked via a linker.
  • the first and second nucleic acid strands may be linked via a linker to form a single strand.
  • the linker capable of linking the first and second nucleic acid strands may be referred to as a "second linker" in this specification.
  • the double-stranded nucleic acid complex may be called a hinge nucleic acid, single-stranded HDO, ssHDO, or the like.
  • the functional region has the same configuration as the double-stranded nucleic acid complex, so in this specification, such a single-stranded nucleic acid is also included as one embodiment of the double-stranded nucleic acid complex of the present invention.
  • the second linker connects the 5' end of the first nucleic acid strand to the 3' end of the second nucleic acid strand. In another embodiment, the second linker connects the 3' end of the first nucleic acid strand to the 5' end of the second nucleic acid strand. In a further embodiment, the second linker connects the 5' end of the first nucleic acid strand to the 3' end of the second nucleic acid strand, and connects the 3' end of the first nucleic acid strand to the 5' end of the second nucleic acid strand. In this case, the double-stranded nucleic acid complex has a circular structure.
  • the second linker may be any polymer.
  • a linker that links the second nucleic acid strand to the target binding molecule as described above i.e., the linker described above as the first linker
  • it may be composed of natural nucleotides and nucleosides such as DNA and RNA, or non-natural nucleotides and nucleosides such as peptide nucleic acid and morpholino nucleic acid. It may also be composed of polyethers such as polyethylene glycol.
  • the chain length of the linker may be at least 1 base, for example, 2 to 50 bases, 2 to 40 bases, 2 to 30 bases, 2 to 20 bases, 2 to 15 bases, 2 to 12 bases, 3 to 10 bases, or 4 to 6 bases.
  • the chain length is preferably 4 bases.
  • the second linker can be located on either the 5' or 3' side of the first nucleic acid strand, but for example, in a configuration in which a target binding molecule is bound to the 5' side of the second nucleic acid strand, the 5' end of the first nucleic acid strand and the 3' end of the second nucleic acid strand are linked via the second linker.
  • the second linker may be either cleavable or uncleavable.
  • first nucleic acid strand and the second nucleic acid strand are linked via a linker, and the second nucleic acid strand can include at least one bulge structure consisting of a base sequence that is non-complementary to the first nucleic acid strand.
  • the antisense effect of the first nucleic acid strand on the target transcript can be measured by a method known in the art.
  • the double-stranded nucleic acid complex can be introduced into cells, etc., and then measured using known techniques such as Northern blotting, quantitative PCR, or Western blotting.
  • the expression level of the target gene or the level of the target transcript e.g., the amount of mRNA or the amount of RNA such as microRNA, the amount of cDNA, the amount of protein, etc.
  • the effect can be determined by comparing the product produced by exon skipping with the product produced in the absence of exon skipping.
  • double-stranded nucleic acid complex of the present invention As described above, exemplary embodiments of the double-stranded nucleic acid complex of the present invention have been described, but the double-stranded nucleic acid complex of the present invention is not limited to the above exemplary embodiments.
  • the double-stranded nucleic acid complex of the present invention can be produced by a person skilled in the art by appropriately selecting a known method. Although not limited thereto, the method usually starts with designing and producing each of the first and second nucleic acid strands constituting the double-stranded nucleic acid complex.
  • the first nucleic acid strand is designed based on the base sequence information of the target transcription product (e.g., the base sequence of the target gene), and the second nucleic acid strand is designed as its complementary strand.
  • each nucleic acid strand may be synthesized using a commercially available automated nucleic acid synthesizer, for example, from GE Healthcare, Thermo Fisher Scientific, Beckman Coulter, etc. Thereafter, the obtained oligonucleotide may be purified using a reverse phase column or the like.
  • the second nucleic acid strand to which a target-binding molecule such as a peptide or a functional moiety is bound can be produced by carrying out the above synthesis and purification using a nucleic acid species to which a target-binding molecule or a functional moiety is already bound, without limitation.
  • the second nucleic acid strand may be produced by carrying out the above synthesis and purification using a nucleic acid species to which a target-binding molecule is already bound.
  • the target-binding molecule may be bound to the second nucleic acid strand produced by carrying out the above synthesis and purification using a known method.
  • the linker contains a cyclooctyne derivative
  • the target-binding molecule such as a peptide can be bound to the cyclooctyne derivative by a click reaction with azide.
  • annealing can be performed on the first and second nucleic acid strands to produce a double-stranded nucleic acid complex in which the desired functional moiety is bound.
  • the nucleic acids are mixed in an appropriate buffer solution and denatured at about 90°C to 98°C for several minutes (e.g., 5 minutes), and then the nucleic acids are annealed at about 30°C to 70°C for about 1 to 8 hours to produce one of the double-stranded nucleic acid complexes of the present invention.
  • Nucleic acid strands can also be ordered and obtained from various manufacturers (e.g., Gene Design Co., Ltd.) by specifying the base sequence and the modification site and type.
  • the double-stranded nucleic acid complex of the present invention is administered intrathecally, and as a result, can exert one or more of the following actions in the central nervous system:
  • the double-stranded nucleic acid complex of the present invention may be used for at least one of the following purposes: suppressing or enhancing the expression level of a transcription product or translation product of a target gene, inhibiting the function of a transcription product or translation product of a target gene, regulating RNA splicing, and inhibiting the binding of a target gene to a protein, for example, for exon skipping.
  • the double-stranded nucleic acid complex of the present invention may be used for at least one of the following purposes: exon skipping, exon inclusion, steric blocking, and enhancing RNA expression.
  • the present invention also provides a method for treating and/or preventing diseases, such as central nervous system diseases, which comprises administering any of the above double-stranded nucleic acid complexes to a subject, such as a human.
  • diseases such as central nervous system diseases
  • the present invention also provides any of the above double-stranded nucleic acid complexes for use in treating and/or preventing central nervous system disorders, etc., in subjects, such as humans.
  • the present invention also provides the use of any of the above double-stranded nucleic acid complexes in the manufacture of a medicine for treating and/or preventing a disease.
  • composition 2-1 Overview
  • the second aspect of the present invention is a composition for intrathecal administration.
  • the composition of the present invention is specifically a pharmaceutical composition, and contains the double-stranded nucleic acid complex of the first aspect as an active ingredient.
  • the composition of the present invention can exhibit excellent antisense effects in the central nervous system when administered intrathecally.
  • Each component that may be contained in the composition of the present invention will be specifically described below.
  • composition 2-2-1 Active ingredient
  • the composition of the present invention contains, as an active ingredient, at least the double-stranded nucleic acid complex described in the first aspect.
  • the composition of the present invention may contain one or more double-stranded nucleic acid complexes.
  • the amount (content) of the double-stranded nucleic acid complex contained in the composition of the present invention varies depending on the type of double-stranded nucleic acid complex, the delivery site, the formulation of the composition, the dosage of the composition, and the type of carrier described below. Therefore, it may be appropriately determined taking into account each condition. Usually, the amount is adjusted so that an effective amount of the double-stranded nucleic acid complex is contained in a single dose of the composition.
  • the "effective amount” refers to the amount necessary for the double-stranded nucleic acid complex to function as an active ingredient, and to an amount that gives little or no harmful side effects to the living body to which it is applied.
  • Subject information refers to various individual information of the living body to which the composition is applied. For example, if the subject is a human, it includes age, weight, sex, diet, health condition, progression and severity of the disease, drug sensitivity, and the presence or absence of concomitant drugs.
  • composition of the present invention may contain a pharma- ceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to an additive commonly used in the field of formulation technology. Examples include solvents, vegetable oils, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, excipients, vehicles, preservatives, binders, diluents, isotonicity agents, sedatives, bulking agents, disintegrants, buffers, coating agents, lubricants, thickeners, dissolution aids, and other additives.
  • the solvent may be, for example, water or any other pharma- ceutically acceptable aqueous solution, or a pharma-ceutically acceptable organic solvent.
  • aqueous solutions include physiological saline, isotonic solutions containing glucose or other adjuvants, phosphate buffer, and sodium acetate buffer.
  • adjuvants include D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other low-concentration nonionic surfactants, polyoxyethylene sorbitan fatty acid esters, etc.
  • the above-mentioned carriers are used to avoid or inhibit the decomposition of the active ingredient, the double-stranded nucleic acid complex, by enzymes and other factors in the body, as well as to facilitate formulation and administration methods and maintain the dosage form and efficacy, and may be used appropriately as needed.
  • the dosage form of the composition of the present invention is not particularly limited as long as it is a form that can deliver the double-stranded nucleic acid complex described in the first embodiment, which is an active ingredient, to a target site without inactivating it by degradation or the like, and can exert the pharmacological effect of the active ingredient in the body (antisense effect on the expression of a target gene).
  • composition of the present invention is administered intrathecally
  • the specific dosage form may be one suitable for intrathecal administration.
  • the preferred dosage form is a liquid that can be administered intrathecally.
  • An example of a liquid is an injection.
  • An injection can be formulated by appropriately combining the above-mentioned excipients, elixirs, emulsifiers, suspending agents, surfactants, stabilizers, pH regulators, etc., and mixing them in a unit dose form required for generally accepted pharmaceutical practice.
  • composition of the present invention may be formulated according to the usual methods in the art.
  • the double-stranded nucleic acid complex of the present invention has excellent properties as a pharmaceutical, such as excellent solubility in water, Japanese Pharmacopoeia Dissolution Test Fluid 2, or Japanese Pharmacopoeia Disintegration Test Fluid 2, excellent pharmacokinetics (e.g., drug half-life in blood, brain transferability, metabolic stability, CYP inhibition), low toxicity (e.g., superior as a pharmaceutical in terms of acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, drug interactions, carcinogenicity, phototoxicity, etc.), and few side effects (e.g., suppression of sedation, avoidance of lamellar necrosis).
  • excellent pharmacokinetics e.g., drug half-life in blood, brain transferability, metabolic stability, CYP inhibition
  • low toxicity e.g., superior as a pharmaceutical in terms of acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, drug interactions, carcinogenicity, phototoxicity, etc.
  • Intrathecal administration can be, for example, intraventricular administration, posterior fossa puncture, or lumbar puncture. Intrathecal administration can also be administered using a shunt, an indwelling catheter, or a subcutaneous port.
  • the double-stranded nucleic acid complex may be administered in an amount of 0.01 mg or more, 0.1 mg or more, or 1 mg or more, for example, 2 mg or more, 3 mg or more, 4 mg or more, 5 mg or more, 10 mg or more, 20 mg or more, 30 mg or more, 40 mg or more, 50 mg or more, 75 mg or more, 100 mg or more, 200 mg or more, 300 mg or more, 400 mg or more, or 500 mg or more, or 0.01 mg to 1000 mg, 0.1 mg to 200 mg, or 1 mg to 20 mg, and in the case of mice, 1 ⁇ g or more may be administered.
  • the dosage of the composition may be, for example, such that the amount of the double-stranded nucleic acid complex contained therein is 0.00001 mg/kg/day to 10,000 mg/kg/day, or 0.001 mg/kg/day to 100 mg/kg/day.
  • the composition may be administered in a single dose or multiple doses. In the case of multiple doses, the composition may be administered daily or at appropriate time intervals (e.g., at intervals of 1 day, 2 days, 3 days, 1 week, 2 weeks, or 1 month), for example, 2 to 20 times.
  • the amount of the double-stranded nucleic acid complex administered at one time can be, for example, 0.001 mg/kg or more, 0.005 mg/kg or more, 0.01 mg/kg or more, 0.25 mg/kg or more, 0.5 mg/kg or more, 1.0 mg/kg or more, 2.0 mg/kg or more, 3.0 mg/kg or more, 4.0 mg/kg or more, 5 mg/kg or more, 10 mg/kg or more, 20 mg/kg or more, 30 mg/kg or more, 40 mg/kg or more, 50 mg/kg or more, 75 mg/kg or more, 100 mg/kg It can be 150 mg/kg or more, 200 mg/kg or more, 300 mg/kg or more, 400 mg/kg or more, or 500 mg/kg or more, and can be selected appropriately from any amount within the range of, for example, 0.001 mg/kg to 500 mg/kg (for example, 0.001 mg/kg, 0.01 mg/kg, 0.1 mg/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg,
  • the double-stranded nucleic acid complex of the present invention may be administered at a dose of 0.01 to 10 mg/kg (e.g., about 6.25 mg/kg) twice a week for four doses.
  • the double-stranded nucleic acid complex may also be administered at a dose of 0.05 to 30 mg/kg (e.g., about 25 mg/kg) once or twice a week for two to four doses, e.g., twice a week for two doses.
  • toxicity e.g., avoiding a decrease in platelets
  • the burden on the subject can be reduced compared to a single administration of a higher dose.
  • the pharmaceutical composition exerts an additive inhibitory effect within cells even when administered repeatedly. Furthermore, when administering repeatedly, the effectiveness can be improved by leaving a certain interval between administrations (for example, half a day or more).
  • the target diseases for the pharmaceutical composition include, for example, central nervous system diseases.
  • the target diseases may involve genes whose expression levels of transcription products or translation products may be suppressed or enhanced, whose functions of transcription products or translation products may be inhibited, or whose steric blocking, splicing switch, RNA editing, exon skipping, or exon inclusion may be induced by the antisense effect of the double-stranded nucleic acid complex of the present invention.
  • the composition may be used in animals, including humans, as subjects. However, there is no specific limitation on animals other than humans, and various livestock, poultry, pets, laboratory animals, etc. may be subjects in some embodiments.
  • the subject may be one in which it is necessary to reduce the expression level of a target transcript in the central nervous system.
  • the subject may also be one in which it is necessary to treat a central nervous system disorder.
  • the disease to be treated may be a central nervous system disease associated with increased or decreased gene expression, particularly a disease (such as a tumor) associated with increased expression of a target transcript or target gene.
  • central nervous system diseases include, but are not limited to, brain tumors, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, Huntington's disease, etc.
  • the nervous system is divided into the central nervous system and the peripheral nervous system.
  • the central nervous system consists of the brain and spinal cord.
  • the brain includes the cerebrum (cerebral cortex, cerebral white matter, basal ganglia), diencephalon (thalamus, subthalamic nucleus), cerebellum (cerebellar cortex, cerebellar nuclei) and brainstem (midbrain, substantia nigra, pons, medulla oblongata).
  • the spinal cord includes the cervical, thoracic, lumbar, sacral and coccygeal spinal cord.
  • the central nervous system in this specification may be any of these regions, but in particular may be the cerebral cortex (frontal lobe, temporal lobe, parietal lobe, occipital lobe), diencephalon, cerebellum, striatum, globus pallidus, claustrum, hippocampus, parahippocampal gyrus, brainstem, cervical spinal cord, thoracic spinal cord or lumbar spinal cord.
  • the peripheral nerves consist of the cranial nerves and spinal nerves.
  • FTD frontotemporal dementia
  • SD semantic dementia
  • PNFA progressive non-fluent aphasia
  • Pick's disease drug delivery to the frontal lobe, temporal lobe and/or substantia nigra may be effective.
  • Parkinson's disease dementia drug delivery to the occipital lobe, substantia nigra and/or striatum may be effective.
  • drug delivery to the substantia nigra and/or striatum may be effective.
  • corticobasal degeneration In the treatment of corticobasal degeneration (CBD), drug delivery to the frontal lobe, parietal lobe, basal ganglia and/or substantia nigra may be effective. In the treatment of progressive supranuclear palsy (PSP), drug delivery to the frontal lobe, basal ganglia and/or substantia nigra may be effective. In the treatment of amyotrophic lateral sclerosis, drug delivery to the frontal lobe, parietal lobe, basal ganglia, and/or substantia nigra may be effective.
  • CBD corticobasal degeneration
  • PPSP progressive supranuclear palsy
  • amyotrophic lateral sclerosis drug delivery to the frontal lobe, parietal lobe, basal ganglia, and/or substantia nigra may be effective.
  • SCD spinocerebellar degeneration
  • DPLA dentatorubral-pallidoluysian degeneration
  • SBMA spinal-bulbar atrophy
  • FA Friedreich's ataxia
  • striatum In the treatment of Huntington's disease, drug delivery to the striatum, frontal lobe, parietal lobe, and/or basal ganglia may be effective.
  • prion diseases mad cow disease, GSS
  • drug delivery to the cerebral cortex, cerebral white matter, basal ganglia and/or substantia nigra In the treatment of cerebral leukoencephalopathy, drug delivery to the cerebral white matter may be effective.
  • encephalitis viral, bacterial, fungal, tuberculous
  • meningitis viral, bacterial, fungal, tuberculous
  • drug delivery to the entire brain may be effective.
  • drug delivery to the cerebral white matter may be effective.
  • cerebral infarction cerebral hemorrhage, subarachnoid hemorrhage, moyamoya disease, and anoxic encephalopathy
  • drug delivery to the entire brain may be effective.
  • drug delivery to the cerebral white matter may be effective.
  • drug delivery to the cerebral white matter may be effective.
  • drug delivery to the cerebral white matter may be effective.
  • drug delivery to the cerebral white matter may be effective.
  • drug delivery to the cerebral white matter may be effective.
  • head trauma drug delivery to the entire brain may be effective.
  • MM ⁇ sclerosis multiple sclerosis
  • NMO neuromyelitis optica
  • drug delivery to the cerebral white matter, cerebral cortex, optic nerve, and/or spinal cord may be effective.
  • myotonic dystrophy DM1, DM2
  • drug delivery to skeletal muscle, cardiac muscle, cerebral cortex, and/or cerebral white matter may be effective.
  • HSP familial spastic paraplegia
  • drug delivery to the parietal lobe and/or spinal cord may be effective.
  • Fukuyama muscular dystrophy drug delivery to skeletal muscle, cerebral cortex, and/or cerebral white matter may be effective.
  • ⁇ nigra In the treatment of dementia with Lewy bodies (DLB), drug delivery to the substantia nigra, striatum, occipital lobe, frontal lobe, and/or parietal lobe may be effective.
  • MSA multiple system atrophy
  • drug delivery to the striatum, basal ganglia, cerebellum, substantia nigra, frontal lobe, and/or temporal lobe In the treatment of Alexander disease, drug delivery to the cerebral white matter may be effective. In the treatment of CADASIL and CARASIL, drug delivery to the cerebral white matter may be effective.
  • composition of the present invention can achieve preventive or therapeutic effects on central nervous system diseases by intrathecal administration.
  • the present invention also provides a method for treating and/or preventing diseases, such as central nervous system diseases, which comprises administering the above-mentioned composition to a subject, such as a human.
  • diseases such as central nervous system diseases
  • Example 1 eNT-binding heterogeneous nucleic acid (the purpose)
  • a heteroduplex oligonucleotide (hereinafter referred to as "HDO") comprising a first nucleic acid strand consisting of a 16mer single-stranded LNA/DNA gapmer antisense nucleic acid (hereinafter referred to as "ASO (mMalat1)”) targeting mouse Malat1 (mMalat1) non-coding RNA, and a second nucleic acid strand having a base sequence complementary to the first nucleic acid strand, a peptide is linked to the 5'-end of the second nucleic acid strand via a linker.
  • ASO 16mer single-stranded LNA/DNA gapmer antisense nucleic acid
  • the peptide linked to the 5' end of the second nucleic acid strand is the eNT peptide (hereinafter simply referred to as "eNT"), which is composed of the amino acid sequence shown in SEQ ID NO: 6 (KPPPAGSSPGLYENKPRRPYIL) formed by linking a spacer peptide composed of the amino acid sequence shown in SEQ ID NO: 4 (KPPPAGSSPG) and neurotensin composed of the amino acid sequence shown in SEQ ID NO: 5 (LYENKPRRPYIL), which is common to humans and mice.
  • the spacer peptide is included in eNT for the purpose of suppressing the intramolecular interaction between the ASO (mMalat1) and the ligand.
  • the ASO (mMalat1) used in this example is an LNA/DNA gapmer-type antisense nucleic acid that targets mouse metastasis associated lung adenocarcinoma transcript 1 (Malat1 ncRNA) non-coding RNA, and has a base sequence complementary to a portion of Malat1 ncRNA, with three LNA nucleosides at the 5' end, three LNA nucleosides at the 3' end, and 10 DNA nucleosides between them linked by phosphorothioate bonds (Figure 5A).
  • eNT-ASO has three DNA nucleosides linked by phosphodiester bonds to the 5' end of the ASO (mMalat1) described above, and furthermore, an eNT peptide consisting of the amino acid sequence shown in SEQ ID NO:6, which includes human neurotensin consisting of the amino acid sequence shown in SEQ ID NO:5, is linked to the 5' end via a linker moiety (Figure 5B).
  • the linker moiety is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (carbon number 6) ( Figure 4 and the above formula (XV)).
  • the eNT-HDO (mMalat1) used in this example contains the above ASO (mMalat1) as the first nucleic acid strand, and the second nucleic acid strand (eNT-cRNA) has a sequence complementary to the first nucleic acid strand.
  • the second nucleic acid strand (eNT-cRNA) contains three 2'-O-Me-RNA nucleosides at the 5' end, three 2'-O-Me-RNA nucleosides at the 3' end, and 10 RNA nucleosides between them, with three internucleoside bonds at each of the 5' and 3' ends being phosphorothioate bonds, and the central nine internucleoside bonds being phosphodiester bonds.
  • the eNT peptide which contains human neurotensin consisting of the amino acid sequence shown in SEQ ID NO: 5, is linked to the 5' end of the eNT-cRNA via a linker portion (Figure 5C).
  • the linker portion is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (carbon number 6) ( Figure 4 and formula (XV) above).
  • the eNT-ASO (mMalat1) and eNT-cRNA listed in Table 1 were synthesized by the following method.
  • An azidoacetyl group was added to the N-terminus of the eNT peptide consisting of the amino acid sequence shown in SEQ ID NO:6 (KPPPAGSSPGLYENKPRRPYIL).
  • This azidoacetyl group was linked by a click reaction to an ASO (DBCO-ASO) or cRNA (DBCO-cRNA) that has a dibenzyl octyl (DBCO) group via an alkylene group and PEG on the phosphate group at the 5' end.
  • DBCO-ASO ASO
  • DBCO-cRNA cRNA
  • the powdered second nucleic acid strand (eNT-cRNA) was added to and dissolved in phosphate-buffered saline (PBS), and then mixed with an equimolar amount of a solution of the first nucleic acid strand heated to 95°C.
  • PBS phosphate-buffered saline
  • the resulting mixture was kept at 95°C for 5 minutes, then cooled to 37°C and kept for 1 hour, thereby annealing the nucleic acid strands to prepare a double-stranded nucleic acid complex.
  • the annealed nucleic acid was stored at 4°C or on ice. All oligonucleotides were contract-synthesized by Gene Design Inc. (Osaka, Japan).
  • mice Female weight 20-25g
  • mice Female weight 20-25g
  • mice Female weight 20-25g
  • mice Male a 1mm diameter drill 1mm left and 0.2mm behind the bregma
  • Various nucleic acid agents or PBS as a negative control were filled in a Hamilton syringe.
  • the needle was inserted about 3mm into the hole, and 10 ⁇ L of the solution per mouse was administered into the left lateral ventricle at a rate of 2-3 ⁇ l/min, and the skin was sutured with nylon thread.
  • mice were dissected and the brain and spine were removed.
  • the cerebrum frontal cortex, parietal cortex, occipital cortex), cerebellum, striatum, hippocampus, brain stem, and cervical spine were collected separately.
  • RNA was extracted from each of the removed sites using a high-throughput fully automated nucleic acid extraction device MagNA Pure 96 (Roche Life Sciences) according to the protocol.
  • cDNA was synthesized using PrimeScript RT Master Mix (Takara Bio) according to the protocol.
  • Quantitative RT-PCR was performed using the obtained cDNA as a template to measure the expression levels of Malat1 ncRNA and Actb mRNA (internal control gene). Quantitative RT-PCR was performed using a LightCycler 480 Probe Master (Roche Life Sciences).
  • the primers and probe used in quantitative RT-PCR targeting Malat1 were Mm_Malat1_Foward primer (TGGGTTAGAGAAGGCGTGTACTG, sequence number 7), Mm_Malat1_Reverse primer (TCAGCGGCAACTGGGAAA, sequence number 8), and Malat1 probe (FAM-TGTTGGCACGACACCTTCAGGGACT-MGB, sequence number 9).
  • the primers and probe used in quantitative RT-PCR targeting Actb were Mm_Actb_Foward primer (CGCGAGCACAGCTTCTTTG, sequence number 10), Mm_Actb_Reverse primer (CATGCCGGAGCCGTTGTC, sequence number 11), and Actin probe (FAM-CACACCCGCCACCAGTTCGCCATG-MBG, sequence number 12).
  • the amplification conditions were as follows: 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 second (1 cycle), repeated for 40 cycles.
  • the ratio of Malat1 ncRNA expression to Actb mRNA (internal control gene) expression was calculated, and the value normalized to the value in the PBS-treated group was used as the relative Malat1 expression level.
  • eNT-HDO mMalat1
  • eNT-ASO mMalat1
  • eNT-ASO did not show a stronger gene suppression effect compared to ASO (mMalat1), and instead showed a weakened effect.
  • neurotensin-binding ASO did not exhibit a stronger gene-suppressing effect than non-peptide-binding ASO, whereas intracerebroventricular administration of HDO with neurotensin bound to the second nucleic acid strand improved the gene-suppressing effect.
  • Example 2 KNT-binding heterogeneous nucleic acid (the purpose) We will verify the gene expression suppression effect of HDO, in which neurotensin is linked to the 5' end of the second nucleic acid strand, when administered intracerebroventricularly once in an in vivo experiment.
  • the peptide linked to the 5' end of the second nucleic acid strand does not contain a spacer peptide, and uses the KNT peptide (hereinafter simply referred to as "KNT") consisting of the amino acid sequence shown in SEQ ID NO: 13 (KLYENKPRRPYIL) in which a lysine (K) residue has been added to the N-terminus of human neurotensin consisting of the amino acid sequence shown in SEQ ID NO: 5 (LYENKPRRPYIL).
  • KNT KNT peptide
  • the ASO (mMalat1) used in this example was the same as in Example 1.
  • the KNT-HDO (mMalat1) used in this example contains ASO (mMalat1) as the first nucleic acid strand, and the second nucleic acid strand (KNT-cRNA) has a sequence complementary to the first nucleic acid strand.
  • the second nucleic acid strand contains three 2'-O-Me-RNA nucleosides at the 5' end, three 2'-O-Me-RNA nucleosides at the 3' end, and 10 RNA nucleosides between them, with three internucleoside bonds at each of the 5' end and 3' end being phosphorothioate bonds, and the central nine internucleoside bonds being phosphodiester bonds.
  • the 5' end of the KNT-cRNA is linked to the KNT peptide consisting of the amino acid sequence shown in SEQ ID NO: 13, which contains human neurotensin consisting of the amino acid sequence shown in SEQ ID NO: 5, via a linker portion (FIG. 5C).
  • the linker portion is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (having six carbon atoms) (FIG. 4 and formula (XV) above).
  • ASO (mMalat1) and KNT-HDO (mMalat1) were prepared in the same manner as in Example 1.
  • KNT-HDO mMalat1
  • ASO mMalat1
  • Example 3 LT7-binding heterogeneous nucleic acid (the purpose) The gene expression suppression effect of a single intracerebroventricular administration of peptide-linked HDO will be verified through in vivo experiments.
  • LT7 transferrin receptor binding peptide
  • CHO transferrin receptor binding peptide
  • LT7-HDO (mMalat1) used in this example contains ASO (mMalat1) as the first nucleic acid strand, and the second nucleic acid strand (LT7-cRNA) has a sequence complementary to the first nucleic acid strand.
  • the second nucleic acid strand (LT7-cRNA) of LT7-HDO contains three 2'-O-Me-RNA nucleosides at the 5' end, three 2'-O-Me-RNA nucleosides at the 3' end, and 10 RNA nucleosides between them, with three internucleoside bonds at the 5' end and 3' end being phosphorothioate bonds, and the central nine internucleoside bonds being phosphodiester bonds.
  • a transferrin receptor-binding peptide (LT7) consisting of the amino acid sequence shown in SEQ ID NO: 14 is bound to the 5' end of LT7-cRNA via a linker portion (FIG. 5C).
  • the linker portion is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (having six carbon atoms) ( Figure 4 and formula (XV)).
  • LT7-cRNA was synthesized by adding an azidoacetyl group to the N-terminus of the amino acid sequence (CHAIYPRH) shown in SEQ ID NO:14, and carrying out a ligation reaction with cRNA in the same manner as in Example 1.
  • LT7-HDO (mMalat1) showed enhanced gene silencing effects in the parietal cortex and occipital cortex, etc., compared with ASO (mMalat1). Therefore, it was demonstrated that the gene silencing effects of HDO with a transferrin receptor-binding peptide bound to the second nucleic acid strand were improved by intracerebroventricular administration.
  • Example 4 LT12-binding heterogeneous nucleic acid (the purpose) The gene expression suppression effect of a single intracerebroventricular administration of peptide-linked HDO will be verified through in vivo experiments.
  • LT12 transferrin receptor binding peptide
  • THRPPMWSPVWP transferrin receptor binding peptide
  • LT12-HDO (mMalat1) used in this example contains ASO (mMalat1) as the first nucleic acid strand, and the second nucleic acid strand (LT12-cRNA) has a sequence complementary to the first nucleic acid strand.
  • the second nucleic acid strand (LT12-cRNA) of LT12-HDO contains three 2'-O-Me-RNA nucleosides at the 5' end, three 2'-O-Me-RNA nucleosides at the 3' end, and 10 RNA nucleosides between them, with three internucleoside bonds at the 5' end and 3' end being phosphorothioate bonds, and the central nine internucleoside bonds being phosphodiester bonds.
  • a transferrin receptor-binding peptide (LT12) consisting of the amino acid sequence shown in SEQ ID NO: 16 is bound to the 5' end of LT12-cRNA via a linker portion (FIG. 5C).
  • the linker portion is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (having six carbon atoms) (FIG. 4 and formula (XV) above).
  • LT12-cRNA was synthesized by adding an azidoacetyl group to the N-terminus of the amino acid sequence (THRPPMWSPVWP) shown in SEQ ID NO:16, and ligating it with cRNA in the same manner as in Example 1.
  • Example 5 DT7-binding heterogeneous nucleic acid (the purpose) The gene expression suppression effect of a single intracerebroventricular administration of HDO bound to the D-retroinversopeptide of LT7 (hereinafter referred to as "DT7") (hereinafter referred to as “DT7-HDO (mMalat1)”) will be verified through in vivo experiments.
  • DT7 D-retroinversopeptide of LT7
  • DT7-HDO mMalat1
  • D-retro-inverso-peptide refers to a peptide in which all of the amino acid residues constituting the peptide have been replaced with D-amino acid residues, as opposed to a normal peptide composed of L-amino acid residues, and the amino acid sequence is rearranged in reverse.
  • D-retro-inverso peptides the original spatial arrangement and chirality of the side chains do not change, and it is believed that binding to the target is maintained or may be enhanced.
  • it is composed of D-amino acid residues, it is known to be resistant to proteases.
  • DT7 a D-form retro-inverso peptide of LT7
  • LT7 is a peptide in which all of the amino acid residues constituting the above-mentioned LT7 are replaced with D-form amino acid residues
  • amino acid residues written in lower case letters indicate D-form amino acid residues and are distinguished from L-form amino acid residues written in upper case letters.
  • DT7-cRNA was synthesized by adding an azidoacetyl group to the C-terminus of the amino acid sequence (hrpyiahc) shown in SEQ ID NO: 28 and performing a ligation reaction with cRNA in the same manner as in Example 1.
  • the ASO (mMalat1) and LT7-HDO (mMalat1) used in this Example were the same as those in Example 3 above.
  • Example 6 DT12-binding heterogeneous nucleic acid (the purpose) We will verify the gene expression suppression effect of a single intracerebroventricular administration of HDO bound to the D-retroinversopeptide of LT12 (hereinafter referred to as "DT12”) (hereinafter referred to as "DT12-HDO (mMalat1)”) through in vivo experiments.
  • DT12 D-retroinversopeptide of LT12
  • DT12-HDO mMalat1
  • DT12 is a peptide in which all of the amino acid residues constituting the above-mentioned LT12 have been replaced with D-amino acid residues, and is a peptide consisting of an amino acid sequence in which the amino acid sequence of LT12 has been rearranged in the reverse direction, and is composed of the amino acid sequence shown in SEQ ID NO:29 (pwvpswmpprht; amino acid residues written in lowercase indicate D-amino acid residues).
  • DT12-cRNA was synthesized by adding an azidoacetyl group to the C-terminus of the amino acid sequence (pwvpswmpprht) shown in SEQ ID NO: 29 and performing a ligation reaction with cRNA in the same manner as in Example 1.
  • the ASO (mMalat1) and LT12-HDO (mMalat1) used in this Example were the same as those in Example 4 above.
  • Example 7 RVG-binding heterogeneous nucleic acid (the purpose) In vivo experiments were performed to verify the gene expression suppression effect of a single intracerebroventricular administration of HDO bound to a peptide derived from rabies virus glycoprotein (hereinafter referred to as "RVG") (hereinafter referred to as "RVG-HDO (mMalat1)”).
  • RVG rabies virus glycoprotein
  • This peptide consists of an amino acid sequence of 29 amino acid residues (YTIWMPENPRPGTPCDIFTNSRGKRASNG, SEQ ID NO: 30) and is known to bind to acetylcholine receptors on neurons (Ren, M., et al., Int J Mol Sci., 2023, 24(6):5851).
  • the ASO (mMalat1) used in this example was the same as in Example 1.
  • the RVG-HDO (mMalat1) used in this example contains ASO (mMalat1) as the first nucleic acid strand, and the second nucleic acid strand (RVG-cRNA) has a sequence complementary to the first nucleic acid strand.
  • a peptide derived from RVG consisting of the amino acid sequence shown in SEQ ID NO: 30 is bound to the 5' end of the RVG-cRNA via a linker moiety (Figure 5C).
  • the linker moiety is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (6 carbon atoms) ( Figure 4 and formula (XV)).
  • RVG-cRNA was synthesized by adding an azidoacetyl group to the C-terminus of the amino acid sequence shown in SEQ ID NO:30 (YTIWMPENPRPGTPCDIFTNSRGKRASNG) and carrying out a ligation reaction with cRNA in the same manner as in Example 1.
  • RVG-HDO showed a strong gene suppression effect in the occipital lobe, hippocampus, brainstem, cervical spinal cord, etc. Therefore, it was revealed that the gene suppression effect of HDO in which a peptide derived from RVG was bound to the second nucleic acid strand was improved by intracerebroventricular administration.
  • Example 8 Cyclic peptide-linked heterogeneous nucleic acid (the purpose)
  • BB1-HDO single intracerebroventricular administration of HDO
  • BB3-HDO mMalat1
  • BB1 consists of the amino acid sequence (LGDPNSCAGALCY) shown in SEQ ID NO: 31 based on the sequence identified in the literature (Fan X., et al., Pharm Res., 2007, 24(5): 868-79.).
  • the amino acid sequence (CAGALCY) shown in SEQ ID NO: 32 has a cyclized structure formed by disulfide bonds between two Cys residues.
  • BB2 and BB3 consist of the amino acid sequence (CLNSNKTNC) shown in SEQ ID NO: 33 and the amino acid sequence (CWRENKAKC) shown in SEQ ID NO: 34, respectively, based on the sequence identified in the literature (Pleiko K., et al., Nucleic Acids Research, 2021, 49(7): e38.). BB2 and BB3 also have a cyclized structure formed by disulfide bonds between two Cys residues.
  • the ASO (mMalat1) used in this example was the same as in Example 1.
  • BB1-HDO (mMalat1) to BB3-HDO (mMalat1) used in this example contain ASO (mMalat1) as the first nucleic acid strand, and the second nucleic acid strand (BB1-cRNA, BB2-cRNA, or BB3-cRNA) has a sequence complementary to the first nucleic acid strand.
  • each of the peptides BB1 to BB3 consisting of the amino acid sequences shown in SEQ ID NOs: 31, 33, and 34 is bound via a linker portion (FIG. 5C).
  • the linker portion is composed of a cyclooctyne derivative, polyethylene glycol (PEG), and an alkylene group (6 carbon atoms) (FIG. 4 and formula (XV)).
  • BB1-cRNA to BB3-cRNA were synthesized by adding an azidoacetyl group via an aminohexyl group to the amino group of the amino acid residue located at the N-terminus of the amino acid sequences shown in SEQ ID NOs: 31, 33, and 34, and then carrying out a ligation reaction with cRNA in the same manner as in Example 1.
  • BB1-HDO mMalat1
  • BB1-HDO mMalat1
  • BB1-HDO showed a significant gene suppression effect, particularly in the cortex (parietal lobe and occipital lobe).
  • Example 9 Comparison of DBCO and BCN linkers (the purpose)
  • DBCO linker dibenzocyclooctyne
  • BCN linker bicyclononyne
  • eNT-DBCO-HDO used in this example is the same as that of eNT-HDO (mMalat1) in Example 1, and the linker connecting the nucleic acid portion and the peptide in the second nucleic acid strand (eNT-DBCO-cRNA) has the structure shown in formula (XV) above.
  • eNT-BCN-HDO the linker that connects the nucleic acid portion and the peptide in the second nucleic acid strand (eNT-BCN-cRNA) has the structure shown in formula (XVI) below.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurosurgery (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Neurology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/JP2023/041677 2022-11-18 2023-11-20 髄腔内投与のためのヘテロ核酸 Ceased WO2024106545A1 (ja)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2024558963A JPWO2024106545A1 (https=) 2022-11-18 2023-11-20

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2022184714 2022-11-18
JP2022-184714 2022-11-18

Publications (1)

Publication Number Publication Date
WO2024106545A1 true WO2024106545A1 (ja) 2024-05-23

Family

ID=91084602

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2023/041677 Ceased WO2024106545A1 (ja) 2022-11-18 2023-11-20 髄腔内投与のためのヘテロ核酸

Country Status (2)

Country Link
JP (1) JPWO2024106545A1 (https=)
WO (1) WO2024106545A1 (https=)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021187392A1 (ja) * 2020-03-16 2021-09-23 国立大学法人東京医科歯科大学 モルホリノ核酸を含むヘテロ核酸

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021187392A1 (ja) * 2020-03-16 2021-09-23 国立大学法人東京医科歯科大学 モルホリノ核酸を含むヘテロ核酸

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
NAGATA, T.: " BBB-penetrating heteroduplex oligonucleotide. ", CLINICAL NEUROLOGY, vol. 60, no. suppl., 1 January 2020 (2020-01-01), pages S255, XP009554763 *
NIKAN MEHRAN, TANOWITZ MICHAEL; DWYER CHRISSA A.; JACKSON MICHAELA; GAUS HANS J.; SWAYZE ERIC E.; RIGO FRANK; SETH PUNIT P.; PRAKA: "Targeted Delivery of Antisense Oligonucleotides Using Neurotensin Peptides", JOURNAL OF MEDICINAL CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 63, no. 15, 13 August 2020 (2020-08-13), US , pages 8471 - 8484, XP093172211, ISSN: 0022-2623, DOI: 10.1021/acs.jmedchem.0c00840 *
YOKOTA TAKANORI , KAZUTAKA NISHINA, HIROYA KUWAHARA: "Gene therapy with therapeutic oligonucleotides", NEUROLOGICAL THERAPEUTICS, vol. 33, no. 3, 1 January 2016 (2016-01-01), pages 303 - 306, XP093172214, DOI: 10.15082/jsnt.33.3_303 *
YOKOTA, TAKANORI.: "Potential of heterogeneous nucleic acids as nucleic acid medicines for the treatment of immune-mediated neurological disorders", EXPERIMENTAL MEDICINE, YODOSHA CO., LTD., JP, vol. 39, no. 15, 1 January 2021 (2021-01-01), JP , pages 179 - 185, XP009554799, ISSN: 0288-5514 *

Also Published As

Publication number Publication date
JPWO2024106545A1 (https=) 2024-05-23

Similar Documents

Publication Publication Date Title
JP7554488B2 (ja) 血液脳関門通過型ヘテロ2本鎖核酸
US11260134B2 (en) Double-stranded nucleic acid complex having overhang
EP4389891A1 (en) Modified heteronucleic acid containing morpholino nucleic acid
JP7394392B2 (ja) 核酸複合体
JP7669602B2 (ja) ヘテロ核酸のbbb通過脂質リガンド
JP7333079B2 (ja) 毒性が軽減した核酸
CN120129749A (zh) 靶向微管相关蛋白TAU核酸的siRNA组合物和方法
JP7737667B2 (ja) 核酸複合体
WO2021187392A1 (ja) モルホリノ核酸を含むヘテロ核酸
WO2024106545A1 (ja) 髄腔内投与のためのヘテロ核酸
WO2021157730A1 (ja) 核酸医薬とその使用
WO2024071099A1 (ja) 5'-シクロプロピレン修飾を含む核酸分子
KR20200127008A (ko) 담관 부족-연관된 상태의 치료를 위한 방법 및 조성물
CN120035669A (zh) 用于治疗神经系统病症的组合物和方法
US20250297249A1 (en) Antisense oligonucleotide complex
WO2024071362A1 (ja) 神経系送達促進剤
WO2023042876A1 (ja) 2'-修飾ヌクレオシドを含むヘテロ核酸
WO2024005156A1 (ja) 核酸医薬の毒性軽減剤
WO2022250050A1 (ja) scpBNA又はAmNAを含むヘテロ核酸
CN120693403A (zh) 多价结合性核酸剂
WO2024005158A1 (ja) オリゴヌクレオチド
WO2026048822A1 (ja) Mapt rna配列に基づく新規二本鎖rna及びその利用
CN120112644A (zh) 用于治疗神经炎性疾病的组合物和方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23891690

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2024558963

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23891690

Country of ref document: EP

Kind code of ref document: A1